Crustacea: Ostracoda: Polycopidae), the First Report of a Living Species of the Genus from the Indo- Pacific Region

Zoological Studies 59:13 (2020) doi:10.6620/ZS.2020.59-13

Open Access

Pontopolycope orientalis sp. nov. (Crustacea: Ostracoda: Polycopidae), the First Report of a Living Species of the Genus from the Indo- Pacific Region

Hayato Tanaka1,*, Yusuke Kondo2, and Susumu Ohtsuka2

1Tokyo Sea Life Park, 6-2-3 Rinkai-cho, Edogawa-ku, Tokyo 134-8587, Japan. *Correspondence: E-mail: [email protected] (Tanaka) 2Takehara Station, Setouchi Field Science Center, Graduate School of Integrated Sciences for Life, Hiroshima University, 5-8-1 Minato-machi, Takehara, Hiroshima 725-0024, Japan. E-mail: [email protected] (Kondo); [email protected] (Ohtsuka)

Received 16 December 2019 / Accepted 9 March 2020 / Published 20 April 2020 Communicated by Ryuji Machida

The present study describes Pontopolycope orientalis sp. nov. (Polycopidae), which was collected from the shallow sandy bottom off of Nagannu Island, Okinawa Prefecture, southwestern Japan.This new species is the first living representative of Pontopolycope from the Indo-Pacific region. We also provided a key to identifying five living congeners throughout the world’s oceans. Since Pontopolycope is defined by the morphological characteristics of the carapace, the following five fossil and subfossil (empty valve) species of Polycope (Polycopidae) are moved to Pontopolycope: Pontopolycope luxuriosa (Herrig, 1964) comb. nov., P. sanctacatherinae (Whatley and Downing, 1983) comb. nov., P. krauseae (Herrig, 1994) comb. nov., P. proboscidea (Herrig, 1994) comb. nov., and P. isolata (Whatley, Jones and Wouters, 2000) comb. nov. Finally, the nucleotide sequence data of three genes (18S rRNA, 28S rRNA, and mitochondrial cytochrome c oxidase subunit 1) of the new species are provided for future systematic and phylogenetic studies. Key words: Pontopolycope, Myodocopa, New species, New combination, Southwestern Japan, Indo- Pacific, Molecular data.

BACKGROUND rostrum on the anterior margin of the carapace. This is a special characteristic of the family Polycopidae. To date, Ostracods are small bivalved crustaceans that live all four living congeners have been described from the in various aquatic environments including freshwater Atlantic: Pontopolycope rostrata (Müller, 1894), type (e.g., Meisch 2000; Karanovic 2012; Külköylüoğlu et species; P. dentata (Brady, 1868); P. mylax Kornicker al. 2017; Díaz and Martens 2018) and marine habitats and Iliffe, 1992; and P. storthynx Kornicker, Iliffe and ranging from the supralittoral zone (Hiruta et al. 2007) Harrison-Nelson, 2007. to the hadal zone (Brandão et al. 2019; Yoo et al. 2019). Here, we describe the first living representative of A number of ostracods are also known to be symbiotic the Pontopolycope species from the Indo-Pacific region with invertebrates (Mestre et al. 2014; Tanaka and Arai and provide a key to identifying five living species in 2017) and vertebrates (Tanaka and Hayashi 2019). the genus. In addition, the present study examines all The polycopid ostracod genus Pontopolycope fossil species of Polycope in the available literature Chavtur, 1981 is characterized by a fully developed and suggests that some Mesozoic and Cenozoic rostrum and concavity immediately ventral to the fossil Polycopidae should be recategorized into

Citation: Tanaka H, Kondo Y, Ohtsuka S. 2020. Pontopolycope orientalis sp. nov. (Crustacea: Ostracoda: Polycopidae), the first report of a living species of the genus from the Indo-Pacific region. Zool Stud 59:13. doi:10.6620/ZS.2020.59-13.

Pontopolycope. Finally, the nucleotide sequence data of chloral medium (Shiga Konchu Fukyusha Co., Ltd.), three genes (18S rRNA, 28S rRNA, and mitochondrial on glass slides under the binocular stereomicroscope. cytochrome c oxidase subunit 1) of the currently These specimens were then observed and illustrated undescribed species are provided for future systematic using a transmitted-light binocular microscope (BX53, and phylogenetic studies. OLYMPUS Co., Ltd.) with a differential interference contrast system and a camera lucida. The valves were washed with distilled water and gold-coated using an MATERIALS AND METHODS ion sputtering device (JFC-1100, JEOL Co., Ltd.). The materials were then observed using scanning electron Sediment samples were obtained from the microscopy (SEM) (JSM-6510LV, JEOL Co., Ltd.). sandy bottom at 52 m depth off the Nagannu Island, The type series was deposited in the collection of Okinawa Prefecture, southwestern Japan (26°14.339'N, the National Museum of Nature and Science, Tokyo 127°32.280'E) on May 21, 2016 (Fig. 1) by using a (NSMT) under the prefix ‘NSMT-Cr’. dredge (mouth 50 cm wide × 15 cm high; mesh size DNA extraction, polymerase chain reaction (PCR) 5 mm) towed along the bottom twice by the TRV amplification, and sequencing were performed. Total Toyoshio-maru (Hiroshima University). Sediments were DNA was extracted the paratype (NSMT-Cr 27378) stirred in seawater, and the supernatant was filtered with following the method described by Tanaka and Ohtsuka a small plankton net (mesh size 0.1 mm). All living (2016). Morphological voucher specimens were ostracod specimens were extracted from the remaining deposited into the NSMT. Nearly complete sequences deposits under a binocular stereomicroscope (SZ60, of nuclear 18S rRNA (18S) and 28S rRNA (28S) and OLYMPUS Co., Ltd.). The collected specimens were mitochondrial cytochrome c oxidase subunit 1 (CO1) fixed and preserved in 80% ethanol at room temperature genes were PCR-amplified. Primer sets for the PCR and for observation of morphological characteristics or cycle sequencing reactions used in this study are shown 99.5% ethanol at -20°C for DNA extraction. The in table 1. The PCR reactions were performed using a valves and soft parts were dissected with fine needles. T100 Thermal Cycler (Bio-Rad). The reaction solutions The valves were preserved on a cardboard cell slide consisted of a 25 μl solution containing 0.5 μl KOD FX and the soft parts mounted in Neo-Shigaral, a gum- Neo (Toyobo), 12.5 μl of 2X PCR buffer for KOD FX

Fig. 1. Map showing the sampling site. A, Japan; B, type locality of Pontopolycope orientalis sp. nov. (open circle).

Neo, 5 μl of dNTP mix, 1 μl of each primer (5 pmol), on one slide and valves on SEM stab, NSMT-Cr 27374, template DNA (2 μl for 18S and 1 μl for 28S and CO1), 27375), 3 adult males (dissected on one slide and valves and 3 or 4 μl of sterilized distilled water. The PCR preserved in one cardboard cell slide, NSMT-Cr 27376 conditions consisted of an initial denaturation step at to 27378), 1 adult female (dissected on one slide and 95°C for 2 min, followed by 40 cycles of denaturation at valves on SEM stab, NSMT-Cr 27379), and 3 adult 98°C for 10 s, annealing at 52°C (18S and 28S) or 45°C females (dissected on one slide and valves preserved in (CO1) for 30 s, extension at 68°C for 1 min 30 s (18S), one cardboard cell slide, NSMT-Cr 27380 to 27382); 2 min (28S), or 1 min (CO1), and a final extension same collecting data with holotype. at 68°C for 5 min. The products were purified for Type locality: The holotype specimen was sequencing using a FastGene Gel/PCR Extraction Kit collected from a sea bottom consisting of coarse coral (Nippon Gene, Japan) according to the manufacture’s sand grains off of Nagannu Island, Okinawa Prefecture, protocol. Sequencing was performed by the Macrogen southwestern Japan (26°14.339'N, 127°32.280'E) at a Japan Corp. (Tokyo) with the primer sets shown in table depth of 52 m on May 21, 2016. 1. Diagnosis: Carapace circular in lateral view, with developed rostrum and concavity immediately ventral to rostrum of the anterior margin. Carapace surface RESULTS covered with shallow pits. Carapace margin with serrations, along the anterior to posterior margin in left valve and anterior to ventral margin in right valve. Pore TAXONOMY system consisting of shallow depression and a small dome with pore canal. Male copulatory organ consisting Subclass Myodocopa Sars, 1866 of a long pillar-shaped tube. Order Halocyprida Dana, 1853 Description: (Measurements: Table 2). Adult male. Suborder Cladocopina Sars, 1866 (Figs. 2A–D, G, H; 3; 4E, F, H; 5A–E; 6A, B). Family Polycopidae Sars, 1866 Carapace (Figs. 2A–D, G, H; 3): Circular in Genus Pontopolycope Chavtur, 1981 lateral view, with developed rostrum and concavity immediately ventral to the rostrum of anterior margin. Pontopolycope orientalis sp. nov. Tanaka, Posterior end situated slightly near the ventral side. Kondo and Ohtsuka Surface covered with shallow pits (Fig. 2A, B). (Figs. 2–6) Along anterior to posterior margin in left valve and urn:lsid:zoobank.org:act:A73D0D0D-1BB3-4786-962A- anterior to ventral margin in right valve with serrations 2BCBEB009724 (Figs. 2C, D; 3). Pore system consisting of a shallow depression and a small dome with pore canal (Fig. Type series: Holotype: adult male (NSMT-Cr 2G). Adductor muscle scar consisting of three closely 27373), right valve length 0.42 mm, height 0.34 mm, spaced scars (Figs. 2C, D, H; 3). Marginal infold with left valve length 0.44 mm, height 0.34 mm, soft parts groove around internal marginal zone of postero-dorsal, mounted on one glass slide and valves preserved in one anterior and ventral margins in right valve (Fig. 2C) cardboard cell slide. Paratypes: 2 adult males (dissected and corresponding ridge in left valve (Fig. 2D). Hinge

Table 1. List of PCR and cycle sequencing (CS) primers used in this study

Target gene Primer name Reaction Sequence (5' to 3') Direction Reference

18S rRNA Euk18SF PCR & CS ACCTGGTTGATCCTGCCAG Forward Moon-van der Staay et al. (2000) Euk18SR PCR & CS TGATCCTTCYGCAGGTTCAC Reverse Moon-van der Staay et al. (2000) 18SF2 CS CCTGAGAAACGGCTRCCACAT Forward Yamaguchi and Endo (2003) 28S rRNA 28S-01 PCR & CS GACTACCCCCTGAATTTAAGCAT Forward Kim et al. (2000) 11RC PCR & CS GCTTGGCBGCCACAAGCCAGTTA Reverse Machida and Knowlton (2012) 28S-18F CS GAAAGATGGTGAACTATGCCTG Forward This study 28S-24F CS GTGGAGAAGGGTTCCATGT Forward This study 28S-18R CS CAGGCATAGTTCACCATCTTTC Reverse Ohtsuka et al. (2018) 28S-32R CS AGAGCACTGGGCAGAATTC Reverse Ohtsuka et al. (2018) CO1 LCO1490 PCR & CS GGTCAACAAATCATAAAGATATTGG Forward Folmer et al. (1994) HCO2198 PCR & CS TAAACTTCAGGGTGACCAAAAAATCA Reverse Folmer et al. (1994)

structure consisted of simple groove in right valve (Fig. two annulated plumose setae at distal end. 2C), and of corresponding bar in left valve (Fig. 2D). Maxillula (Fig. 5A–D): Precoxa (Fig. 5A, B) with Bellonci organ (Fig. 4A): Two setulous seta. eight annulated plumose setae. Coxa (Fig. 5A, C) with Upper lip (Fig. 4B): Semicircular in lateral view, eight plumose setae on ventral side. Basis (Fig. 5A) with fine setae on surface. rectangular with dorso-proximally hump in lateral view, Antennula (Fig. 4C): Uniramous, four podomeres. with one plumose and one plumose annulated setae First podomere with setulae on dorsal margin and lateral on ventral margin. First podomere of endopodite bare. surface. Second podomere about four-fifths the length Second podomere with one plumose seta on ventral of first podomere, with one setulous annulated seta near margin. Third podomere with two setulous and one dorso-proximal end, one simple seta on ventro-distal annulated setae at ventral margin, and two setulous setae end, and setulae on dorsal and ventral middle margins at dorso-distal end. Fourth podomere with one setulous and at dorso-distal end. Third podomere about one- annulated seta, three annulated stout seta with spines on fourth the length of first podomere, with one setulous middle part and setulae on distal part. Exopodite (Fig. seta at dorsal end and three setae consisting of one 5D) with setulae along dorsal margin, and 10 annulated setulous annulated seta and two setae with curved tip on setulous setae at distal end. ventro-distal margin. Fourth podomere small, with four Fifth limb (Fig. 5E): Coxa bearing branchial long setulous annulated setae. plate (epipodite) with 13 long plumose setae, and Antenna (Fig. 4E, F): Biramous, with exopodite two setulous short setae on dorso-lateral area and two and endopodite consisting of nine and three podomeres, setulous short setae at dorso-distal end. Basis with three respectively. Basis triangular and tapering distally. setulous and two plumose setae on dorsal and ventral Exopodite (Fig. 4F): first podomere about half lengths margin, respectively. Endopodite consisting of two of basis; Second podomere about one-fifth the length podomeres. First podomere with one setulous stout seta. of first podomere; podomere lengths decreasing in size Second podomere cylindrical tapering proximally, with from second to eighth, each podomere with one setulous one setulous stout seta. Exopodite with four setulous annulated long seta, respectively; ninth podomere very setae. small, with one long annulated, one medium annulated Uropod (Fig. 6A, B): Each lamella with eight and one short simple setae at distal end. Endopodite (Fig. claws. Anterior-most claw small, with a row of fine 4E): first podomere same length as first podomere of setae on posterior margin. Anterior second to eighth exopodite; second podomere about one-third the length claws with a row of setae on anterior and posterior of first podomere, with three simple setae along dorsal margins, respectively. margin, one clavate process at proximal middle end, Male copulatory organ and posterior body (Fig. and five setulous annulated setae at distal end. Third 6A): Male copulatory organ arising from outer surface podomere one-fifth the length of first podomere, with of body on left side of terminal trunk segment as a long one dorsal outgrowth, and four setulous annulated setae pillar-shaped tube. A row of stout small setae on ventral at distal end. margin. One spinous process (telson) at terminal end. Mandibula (Fig. 4H): Coxal endite with six Adult female (Figs. 2E, F; 4D, G; 6C): Bellonci teeth. Basis with four plumose annulated setae on organ, mandibula, maxillula, fifth limbs, and upper lip ventral margin and one plumose seta at dorsal margin. similar to those of adult male. Exopodite pear-shaped, with one thin broad setulous seta Carapace (Fig. 2E, F): Carapace length and height with blunt tip. Endopodite consisting of two podomeres. slightly larger than adult male (Table 2). First podomere with three annulated plumose setae on Antennula (Fig. 4D): Only third and fourth ventral margin and two annulated setulous long setae at podomeres different from those of adult male. Third dorso-distal end. Second podomere very small, bearing podomere about one-fourth the length of first podomere,

Table 2. Dimension of valves of Pontopolycope orientalis sp. nov. from the type locality

Length (mm) Height (mm)

Mean Observed range N Mean Observed range N

Male Right valve 0.41 0.39–0.43 5 0.33 0.31–0.34 5 Left valve 0.42 0.39–0.44 5 0.32 0.30–0.34 5 Female Right valve 0.46 0.44–0.49 3 0.35 0.34–0.37 4 Left valve 0.46 0.45–0.47 4 0.36 0.34–0.37 4

Fig. 2. Pontopolycope orientalis sp. nov., SEM images. A, B, G, paratype male (NSMT-Cr 27374); C, D, H, paratype male (NSMT-Cr 27375); E, F, paratype female (NSMT-Cr 27379). A, E, external lateral view of right valve; B, F, external lateral view of left valve; C, internal lateral view of right valve; D, internal lateral view of left valve; G, external surface of left valve; H, adductor muscle scar, internal view of right valve. Scale bars: A–F =100 μm; G = 15 μm; H = 30 μm.

with one setulous seta at dorsal end. Fourth podomere new species has no posterior projections, while the small, with five long setulous annulated setae. latter two species have four posterior projections. The Antenna (Fig. 4G): Only second and third ornamentation of carapace surface of the new species podomeres of endopodite are different from those of differs from that of P. mylax: shallow punctations in adult male. Second podomere with one annulated seta the former versus reticulations, and surface within on dorsal margin and six annulated setae at distal end. reticulate with pebbly texture in the latter. The carapace Third podomere one-sixth the length of first podomere and appendage morphologies of the new species with four annulated setae at distal end. resemble those of P. dentata. Pontopolycope dentata Uropod (Fig. 6C). Each lamella with eight claws. was originally described by carapace morphology alone DNA sequences: Three nucleotide sequences were (Brady 1868), until Müller (1894) described appendages obtained from the paratype (NSMT-Cr 27378): 28S of this species based on the materials collected from (Accession no. LC528590, 3217 bp), 18S (Accession sand between the roots of sea grasses in the Gulf of no. LC528589, 1794 bp), and CO1 (Accession no. Naples. Pontopolycope orientalis sp. nov. and P. LC528833, 660 bp). dentata can be distinguished based on the following Etymology: The specific name orientalis (Latin, features: (1) the rostral tip of the carapace is obtuse meaning in the east) refers to the first record of the rather than sharp; (2) the mandibular exopodite possess living species of the genus Pontopolycope in the Indo- one thin broad setulous seta versus one pillar-shaped Pacific region. seta and one simple seta; (3) setae on the ventral margin of male copulatory organ is stout rather than fine. In general, the carapace of Polycopidae is DISCUSSION heavily calcified and well preserved as fossils up to the Carboniferous (Moore 1961). However, due to the The present study is the first to report a living presence of a relatively simple valve, fossil polycopid species of the genus Pontopolycope in the Indo-Pacific ostracods tend to be classified as the genus Polycope region. All previous congeners were found in the (type genus of the family Polycopidae). From the North Atlantic and Mediterranean Sea (Fig. 7), namely literature survey carried out in the present study, we Pontopolycope rostrata from between lime (calcareous) established that 114 species have been described as algae in the Gulf of Naples (Fig. 7B); P. strothyx, from Polycope among the 121 known fossil species of Ocean Blue Holes of the Bahamas (Fig. 7C); P. mylax Polycopidae. Genus-level classification of polycopids is from the anchialine caves of Jamaica (Fig. 7D); and P. very difficult without knowing the anatomy of soft parts. dentata, from off the coast of Shetland (Fig. 7E). This is due to the fact that the carapaces of some genera Pontopolycope orientalis sp. nov. can be easily closely resemble one another, even though their soft distinguished from Pontopolycope rostrata and P. parts are clearly different (e.g., Polycopetta Chavtur, strothyx by the structure of the carapace surface: the 1981 and Polycopissa Chavtur, 1981). In contrast,

Fig. 3. Pontopolycope orientalis sp. nov., holotype male (NSMT-Cr 27373). A, external lateral view of the right valve; B, external lateral view of the left valve. Scale bar = 100 μm.

Fig. 4. Pontopolycope orientalis sp. nov. A–C, E, F, H, holotype male (NSMT-Cr 27373); D, G, paratype female (NSMT-Cr 27379). A, Bellonci organ; B, upper lip; C, antennula; D, distal part of antennula; E, antenna except exopodite; F, exopodite of antenna; G, endopodite of antenna; H, mandibula. Scale bar = 50 μm. Abbreviations: cp, clavate process; do, dorsal outgrowth.

Pontopolycope is special in the family with respect to described, the following five Polycope species can most their developed rostrum and concavity just ventral to likely be reclassified as Pontopolycope: Pontopolycope the rostrum along the anterior margin of the carapace. luxuriosa (Herrig, 1964) comb. nov. from Rügen Considering this morphological uniqueness, some fossil Island (Late Cretaceous, Late Maastrichtian, Fig. and subfossil (empty valve) polycopid species could 7F); Pontopolycope sanctacatherinae (Whatley and be classified as Pontopolycope due to their similarities Downing, 1983) comb. nov. from south-east Australia with respect to these features. Although no appendage is (Middle Miocene, Langhian, Fig. 7G); Pontopolycope

Fig. 5. Pontopolycope orientalis sp. nov., holotype male (NSMT-Cr 27373). A, maxillula; B, precoxa of maxillula; C, coxa of maxillula; D, exopodite of maxillula; E, fifth limb. Scale bar = 50 μm. Abbreviations: ba, basis; cx, coxa; en, endopodite; ex, exopodite; pc, precoxa.

krauseae (Herrig, 1994) comb. nov. from Rügen Easter Island (Holocene, Fig. 7J). In addition, some Island (Late Cretaceous, Late Maastrichtian, Fig. 7H); Polycope species in open nomenclature could be Pontopolycope proboscidea (Herrig, 1994) comb. assigned to Pontopolycope. There are: Polycope sp. nov. from Bornholm Island (Late Cretaceous, Late B sensu Cronin (1983) from the bathyal seafloor of Maastrichtian, Fig. 7I); and Pontopolycope isolata Florida-Hatteras Slope; Polycope sp. 2 sensu Bergue (Whatley, Jones and Wouters, 2000) comb. nov. from et al. (2006) from the bathyal seafloor of Santos Basin,

Fig. 6. Pontopolycope orientalis sp. nov. A, B, holotype male (NSMT-Cr 27373); C, paratype female (NSMT-Cr 27379). A, left lateral view except right uropodal lamella; B, right uropodal lamella; C, left uropodal lamella. Scale bar = 50 μm.

Brazil; Polycope sp. A and Polycope sp. B sensu Key to living species of Pontopolycope Titterton and Whatley (2006) from the shallow seafloor Chavtur, 1981 of Honiara Bay, the Solomon Islands. Polycope? moenia Joy and Clark, 1977 described as having empty 1 Posterior projections present on carapace surface ...... 2 carapace collected from the deep sea floor of the Arctic - Posterior projections absent on carapace surface ...... 3 2 Reticulations on carapace surface fine; a long seta absent on Ocean was classified as Pontopolycope by Chavtur dorsal side of basis of mandibula ...... (1983). However, the present study excludes Polycope? ...... Pontopolycope rostrata (Müller, 1894) moenia from the Pontopolycope group because this - Reticulations on carapace surface coarse; a long seta present on species lacks concavity along the anterior margin of the dorsal side of basis of mandible ...... carapace and has more elliptic shaped carapace in the Pontopolycope storthynx Kornicker, Iliffe and Harrison-Nelson, 2007 3 Carapace surface reticulated ...... lateral view...... Pontopolycope mylax Kornicker and Iliffe, 1992 The distribution of living and fossil species of - Carapace surface punctuated ...... 4 Pontopolycope seems to imply a Tethyan origin. From 4 Tip of rostrum of carapace is sharp; the mandibular exopodite the type locality of Pontopolycope orientalis sp. nov. possess one pillar-shaped seta and one simple seta; setae on the (off Nagannu Island), some copepod species have been ventral margin of male copulatory organ is fine ...... Pontopolycope dentata (Brady, 1868) reported as Tethyan relicts (Ohtsuka and Boxshall 1994; - Tip of rostrum of carapace is obtuse; the mandibular exopodite Ohtsuka et al. 1998). More extensive studies on living possess one thin broad setulous seta; setae on the ventral margin and fossil species of Pontopolycope in the world’s of male copulatory organ is stout ...... oceans will enable us to reveal the natural history of this ...... Pontopolycope orientalis sp. nov. genus.

Fig. 7. Global distribution and fossil occurrences of the genus Pontopolycope. A, Pontopolycope orientalis sp. nov.; B, P. rostrata (Müller, 1894); C, P. storthynx Kornicker, Iliffe and Harrison-Nelson, 2007; D, P. mylax Kornicker and Iliffe, 1992; E, P. dentata (Brady, 1868); F, P. luxuriosa (Herrig, 1964) comb. nov., fossil; G, P. sanctacatherinae (Whatley and Downing, 1983) comb. nov., fossil; H, P. krauseae (Herrig, 1994) comb. nov., fossil; I, P. proboscidea (Herrig, 1994) comb. nov., fossil; J, P. isolata (Whatley, Jones and Wouters, 2000) comb. nov., empty carapace. Solid circle is living species; open triangular is Late Cretaceous; open square is Middle Miocene; open circle is Holocene.

Acknowledgments: This work and new species Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. 1994. DNA name have been registered with ZooBank under primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol urn:lsid:zoobank.org:pub:1F460398-080D-47D0- Biotechnol 3:294–299. BD0D-19D4EA205BD9. We thank the captain and Herrig E. 1964. Vier neue Ostracoden-Arten aus der Rügener crew of the TRV Toyoshio-maru, Hiroshima University, Schreibkreide (Unter-Maastricht). Geologie 13(8):1004–1012. for their cooperation at sea. We also thank the plankton Herrig E. 1994. Polycopidae (Crustacea, Ostracoda) from the boreal laboratory members at Takehara Station, Setouchi Field Upper Cretaceous of the middle and southern Baltic Sea. Pälaont Z 68:351–359. doi:10.1007/BF02991348. Science Center, Graduate School of Integrated Sciences Hiruta SF, Hiruta SI, Mawatari SF. 2007. A new, interstitial species of for Life, Hiroshima University for their assistance in Terrestricythere (Crustacea: Ostracoda) and its microdistribution collecting specimens. This study was funded by the at Orito Beach, northeastern Sea of Japan. Hydrobiologia JSPS KAKENHI Grant Numbers JP263700 (HT). 585:43–56. doi:10.1007/s10750-007-0627-4. Karanovic I. 2012. Recent freshwater Ostracoda of the world. Springer-Verlag, Berlin. doi:10.1007/978-3-642-21810-1. Authors’ contributions: HT collected and processed Kim C-G, Zhou H-Z, Imura Y, Tominaga O, Su Z-H, Osawa S. 2000. the samples, conceived the study, and drafted the Pattern of morphological diversification in the Leptocarabus manuscript. YK and SO assisted with sample collection. ground beetles (Coleoptera: Carabidae) as deduced from All authors read and approved the final manuscript. mitochondrial ND5 gene and nuclear 28S rDNA sequences. Mol Biol Evol 17:137–145. doi:10.1093/oxfordjournals.molbev. a026226. Competing interests: The authors declare that they Kornicker LS, Iliffe TM. 1992. Ostracoda (Halocypridina, have no conflict of interest. Cladocopina) from anchialine caves in Jamaica, West Indies. Smith Contrib Zool 530:1–22. doi:10.5479/si.00810282.530. Availability of data and materials: Sequences Kornicker LS, Iliffe TM, Harrison-Nelson E. 2007. Ostracoda generated in the study have been deposited into the (Myodocopa) from Anchialine Caves and Ocean Blue Holes. Zootaxa 1565:1–151. doi:10.11646/zootaxa.1565.1.1. DNA Data Bank of Japan (DDBJ) database (accession Külköylüoğlu O, Akdemir D, Yavuzatmaca M, Schwartz BF, Hutchins numbers in manuscript). BT. 2017. Cypria lacrima sp. nov. a new Ostracoda (Candonidae, Crustacea) species from Texas, U.S.A. Zool Stud 56:15. Consent for publication: Not applicable. doi:10.6620/ZS.2017.56-15. Machida RJ, Knowlton N. 2012. PCR primers for metazoan nuclear 18S and 28S ribosomal DNA sequences. PLoS ONE Ethics approval consent to participate: Not 7(9):e46180. doi:10.1371/journal.pone.0046180. applicable. Meisch C. 2000. Freshwater Ostracoda of western and central Europe. In: Schwoerbel J, Zwick P, (eds) Süßwasserfauna von Mitteleuropa 8/3. Spektrum Akademischer Verlag, Berlin, p. REFERENCES 387. Mestre A, Monrós JS, Mesquita-Joanes F. 2014. A review of the Entocytheridae (Ostracoda) of the world: updated Bergue CT, Costa KB, Dwyer G, Moura CAV. 2006. Bathyal bibliographic and species checklists and global georeferenced ostracode diversity in the Santos Basin, Brazilian Southeast database, with insights into host specificity and latitudinal margin: response to Late Quaternary climate changes. Rev Bras patterns of species richness. Crustaceana 87:923–951. Paleontol 9(2):201–210. doi:10.4072/rbp.2006.2.04. doi:10.1163/9789004287600_004. Brady GS. 1868. Ostracoda. In: De Folin L, Perier L. (eds) Les Fonds Moon-van der Staay SY, van der Staay GWM, Guillou L, Vaulot de la Mer, 1. Savy, Paris. D, Claustre H, Medlin LK. 2000. Abundance and diversity Brandão SN, Hoppema M, Kamenev GM, Karanovic I, Tiehl T, of prymnesiophytes in the picoplankton community from the Tanaka H, Vital H, Yoo H, Brandt A. 2019. Review of Ostracoda equatorial Pacific Ocean inferred from 18S rDNA sequences. (Crustacea) living below the Carbonate Compensation Depth Limnol Oceanogr 45:98–109. doi:10.4319/lo.2000.45.1.0098. and the deepest record of a calcified ostracod. Prog Oceanogr Moore RC. 1961. Summary of classification and stratigraphic 178:102144. doi:10.1016/j.pocean.2019.102144. distribution. In: Moore RC (ed) Treatise on invertebrate Chavtur VG. 1981. On the systematic position of the modern Paleontology, PartQ, Arthropoda 3, Crustacea. Ostracoda. Ostracoda in the family Polycopidae (Ostracoda, Cladocopina). Geological Society of America and University of Kansas Press, Trudy Instituta Okeanologii Akademii Nauk SSSR 115:53–61. Lawrence, p. 422. Chavtur VG. 1983. Ostracodes (Myodocopina, Cladocopina) of Müller GW. 1894. Die Ostracoden des Golfes von Neapel und der Temperate and Cold Waters of the Northern Hemisphere. angrenzenden Meeres-Abschnitte. Fauna Flora Golf Neapel Academy of Sciences of the USSR, Far-Eastern Science Center, 21:1–404. Institute of Marine Biology, Vladivostok, Russia (in Russian) Ohtsuka S, Boxshall GA. 1994. Platycopia orientalis, new species Cronin TM. 1983. Bathyal ostracodes from the Florida—Hatteras (Copepoda: Platycopioida), from the North Pacific, with slope, the Straits of Florida, and the Blake Plateau. Mar descriptions of copepodid stages. J Crust Biol 14:151–167. Micropaleontol 8:89–119. doi:10.1016/0377-8398(83)90007-5. doi:10.1163/193724094X00542. Díaz A, Martens K. 2018. On Argentodromas bellanella gen. nov., Ohtsuka S, Soh HY, Ueda H. 1998. Platycopia compacta n. sp., sp. nov. (Crustacea, Ostracoda) from a stream in northeastern the second species of Platycopioida (Crustacea: Copepoda) Argentina (South America). Zool Stud 57:10. doi:10.6620/ in the Indo-Pacific region, with remarks on development, ZS.2018.57-10.

feeding, swimming, and zoogeography. Zool Sci 15:415–424. Zootaxa 4624(4):507–522. doi:10.11646/zootaxa.4624.4.4. doi:10.2108/zsj.15.415. Titterton R, Whatley RC. 2006. Recent marine Ostracoda from Ohtsuka S, Tanaka H, Hirano K, Kondo Y, Jaume D, Boxshall GA. the Solomon Islands: part 1 – Cypridoidea, Platycopina and 2018. Some observations of morphology and behavior of a Cladocopina. J Micropalaeontol 25:73–94. doi:10.1144/ hyperbenthic misophrioid copepod. Bull Southern California jm.25.1.73. Acad Sci 117(2):127–137. doi:10.3160/3615.1. Whatley RC, Downing SE. 1983. Middle Miocene Ostracoda from Tanaka H, Ohtsuka S. 2016. Historical biogeography of the genus Victoria, Australia. Rev Esp Micropaleontol 15:347–407. Polycopissa (Ostracoda: Myodocopa: Cladocopina), with the Whatley RC, Jones RL, Wouters K. 2000. The Ostracoda of Easter description and DNA barcode of the second Indo-Pacific species Island. Rev Esp Micropaleontol 32(1):79–106. from the Seto Inland Sea. Mar Biodiv 46:625–640. doi:10.1007/ Yamaguchi S, Endo K. 2003. Molecular phylogeny of Ostracoda s12526-015-0412-y. (Crustacea) inferred from 18S ribosomal DNA sequences: Tanaka H, Arai M. 2017. A new commensal ostracod Asterositus implication for its origin and diversification. Mar Biol 143:23– ohtsukai n. g., n. sp. (Paradoxostomatidae) on the sea star 38. doi:10.1163/20021975-99990322. Sclerasterias euplecta (Fisher) (Asteriidae) and its feeding Yoo H, Tanaka H, Lee W, Brandão SN, Karanovic I. 2019. Six new habits. Syst Parasitol 94:263–274. doi:10.1007/s11230-016- Krithe from the Kuril-Kamchatka Trench, with the first insight 9690-4. into phylogeography of deep-sea ostracods. Progr Oceanogr Tanaka H, Hayashi R. 2019. Chelonocytherois omutai gen. et sp. nov. 176:102128. doi:10.1016/j.pocean.2019.102128. (Crustacea: Ostracoda) from the back of loggerhead sea turtles.