BASIC RESEARCH www.jasn.org
Prolyl Hydroxylase Domain Inhibitor Protects against Metabolic Disorders and Associated Kidney Disease in Obese Type 2 Diabetic Mice
Mai Sugahara,1 Shinji Tanaka ,1 Tetsuhiro Tanaka,1 Hisako Saito,1 Yu Ishimoto,1 Takeshi Wakashima,2 Masatoshi Ueda,2 Kenji Fukui,2 Akira Shimizu,3 Reiko Inagi,4 Toshimasa Yamauchi,5 Takashi Kadowaki,5 and Masaomi Nangaku1
Due to the number of contributing authors, the affiliations are listed at the end of this article.
ABSTRACT Background Prolyl hydroxylase domain (PHD) inhibitors, which stimulate erythropoietin production through the activation of hypoxia-inducible factor (HIF), are novel therapeutic agents used for treating renal anemia. Several PHD inhibitors, including enarodustat, are currently undergoing phase 2 or phase 3 clinical trials. Because HIF regulates a broad spectrum of genes, PHD inhibitors are expected to have other effects in addition to erythropoiesis, such as protection against metabolic disorders. However, whether such beneficial effects would extend to metabolic disorder–related kidney disease is largely unknown. Methods We administered enarodustat or vehicle without enarodustat in feed to diabetic black and tan brachyury (BTBR) ob/ob mice from 4 to 22 weeks of age. To elucidate molecular changes induced by enarodustat, we performed transcriptome analysis of isolated glomeruli and in vitro experiments using murine mesangial cells. Results Compared with BTBR ob/ob mice that received only vehicle, BTBR ob/ob mice treated with enarodustat displayed lower body weight, reduced blood glucose levels with improved insulin sensitivity, lower total cholesterol levels, higher adiponectin levels, and less adipose tissue, as well as a tendency for lower macrophage infiltration. Enarodustat-treated mice also exhibited reduced albuminuria and amelio- ration of glomerular epithelial and endothelial damage. Transcriptome analysis of isolated glomeruli revealed reduced expression of C-C motif chemokine ligand 2/monocyte chemoattractant protein-1 (CCL2/MCP-1) in enarodustat-treated mice compared with the vehicle-only group, accompanied by re- duced glomerular macrophage infiltration. In vitro experiments demonstrated that both local HIF-1 acti- vation and restoration of adiponectin by enarodustat contributed to CCL2/MCP-1 reduction in mesangial cells. Conclusions These results indicate that the PHD inhibitor enarodustat has potential renoprotective effects in addition to its potential to protect against metabolic disorders.
JASN 31: ccc–ccc, 2020. doi: https://doi.org/10.1681/ASN.2019060582
Prolyl hydroxylase domain (PHD) inhibitors are Received June 9, 2019. Accepted December 12, 2019. novel therapeutic agents for the treatment of renal M.S. and S.T. contributed equally to this work. anemia, among which at least five compounds are 1,2 Published online ahead of print. Publication date available at being evaluated in phase 2 and 3 clinical trials. www.jasn.org. They stimulate erythropoietin production by acti- Correspondence: Dr. Tetsuhiro Tanaka, Division of Nephrology vating hypoxia-inducible factor (HIF), a transcrip- and Endocrinology, The University of Tokyo Graduate School tion factor responsible for the induction of genes of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan. that facilitate cellular adaptation to hypoxic condi- Email: [email protected] tions. HIF is a heterodimer consisting of a Copyright © 2020 by the American Society of Nephrology
JASN 31: ccc–ccc,2020 ISSN : 1046-6673/3103-ccc 1 BASIC RESEARCH www.jasn.org constitutively expressed b subunit and an oxygen-regulated a Significance Statement subunit. Under normoxic conditions, PHDs hydroxylate spe- cific proline residues of HIF-a. Proline-hydroxylated HIF-a is Prolyl hydroxylase domain (PHD) inhibitors, primarily developed to then recognized by the von Hippel-Lindau (VHL)-E3 ubiqui- treat renal anemia, stimulate erythropoietin production through tin ligase complex, resulting in HIF-a ubiquitination and sub- activation of hypoxia-inducible factor (HIF). Because HIF affects a broad spectrum of genes, PHD inhibitors are thought likely to have sequent proteasomal degradation. Under hypoxic conditions, other effects, including protection against metabolic disorders. The hydroxylation of HIF-a is inhibited, allowing translocation to authors show that in obese type 2 diabetic mice, administration of the nucleus where dimerization with HIF-b and binding to the the PHD inhibitor enarodustat not only improves glucose and lipid hypoxia response element occurs, inducing transcription of metabolism, but also reduces albuminuria and ameliorates glo- target genes. Mammals have three principal isoforms of merular epithelial and endothelial damage. Enarodustat-treated a a a a a a mice also exhibit reduced glomerular expression and urinary HIF- :HIF-1 ,HIF-2 ,andHIF-3 .HIF-1 and HIF-2 excretion of C-C motif chemokine ligand 2/monocyte chemo- share similar domain architecture and undergo analogous attractant protein-1 (CCL2/MCP-1). The authors further demon- proteolytic regulation, but have different distribution pat- strate that enarodustat directly suppresses CCL2/MCP-1 production terns and partly overlapping, but largely nonredundant, via HIF-1 activation in mesangial cells. These results indicate that functions.TheroleofHIF-3a is not yet fully understood. enarodustat has renoprotective effects in addition to its potential to protect against metabolic disorders. There are also three isoforms of PHD enzymes, PHD1, PHD2, and PHD3, among which PHD2 is the major regu- lator of HIF activity.3,4 fibrosis, we administered enarodustat to black and tan bra- Because the PHD-HIF oxygen-sensing pathway is a ubiq- chyury (BTBR) ob/ob mice. Because of the lack of appetite uitous system regulating a broad spectrum of genes, PHD in- inhibitory hormone leptin, BTBR ob/ob mice develop obe- hibitors are anticipated to have other effects in addition to sity, hyperglycemia, hypercholesterolemia, and massive pro- erythropoiesis.5 One of the anticipated benefits is their poten- teinuria.20 Here, we report that 18-week administration of tial ability to protect against metabolic disorders. A preclinical enarodustat not only improved glucose and lipid metabolism, study demonstrated that administration of a PHD inhibitor, but also reduced albuminuria, and ameliorated glomerular FG-4497, ameliorated diet-induced glucose intolerance and epithelial and endothelial damage, without worsening tubu- decreased visceral adiposity in mice.6 Enarodustat (JTZ- lointerstitial fibrosis. Transcriptome analysis of isolated glo- 951), another PHD inhibitor currently undergoing clinical meruli and in vitro experiments suggested that suppression of trials,7 also protects mice from high-fat diet–induced obesity C-C motif chemokine ligand 2/monocyte chemoattractant and dyslipidemia, effects partly attributed to reduced inflam- protein-1 (CCL2/MCP-1) production in mesangial cells con- mation in adipose tissue.8 In line with these animal studies, tributed to enarodustat’s protective role against glomerular clinical trials of roxadustat revealed reduced total cholesterol injury. These results indicated additional benefits of PHD levels in the drug-treated group.9,10 inhibitors, especially in patients with diabetes- and obesity- The aim of treating metabolic disorders is to prevent the related kidney disease. development of complications, including cardiovascular dysfunction and CKD. Although PHD inhibition has been demonstrated to protect against stroke11 and myocardial infarc- METHODS tion,12 and to inhibit atherosclerosis in LDL receptor-deficient mice,13 PHD inhibitors’ effects on metabolic disorder–related Animal Studies kidney disease have not been fully elucidated to date. Several Four-week-old male BTBR ob/ob mice (Jackson Laboratory, preclinical studies have revealed that systemic PHD inhibition Bar Harbor, ME) were randomly assigned to vehicle-only and ameliorates AKI induced by ischemia-reperfusion and cis- enarodustat-treated groups. Enarodustat was mixed in feed platin therapy.14–16 However, stabilization of HIF-1 in kidney with three different concentrations; low, 0.015 mg/g; interme- proximal tubules by genetic deletion of Vhl promoted tubu- diate, 0.05 mg/g; high, 0.15 mg/g (vehicle only, n56; low, n58; lointerstitial fibrosis in a 5/6 renal ablation model,17 which intermediate, n57; high, n58). Mice were killed at 22 weeks raised the concern that long-term supraphysiological HIF ac- of age, after a 6-hour starvation period. Only mice treated with tivation might promote CKD. The prospect of HIF activation the intermediate dose of enarodustat exhibited adequate he- in diabetic kidney disease is also controversial: whereas ad- matocrit increase without apparent toxicity. Therefore, fur- ministration of cobalt chloride, which inhibits PHD activity, ther metabolic and renal investigations were conducted using reduced proteinuria and ameliorated tubulointerstitial injury BTBR ob/ob mice treated with vehicle only and 0.05 mg/g of in streptozotocin-induced diabetic rats,18 administration of a enarodustat (approximately 8–10 mg/kg body wt per day). HIF inhibitor also reduced albuminuria and attenuated glo- BTBR wild-type mice (n55) fed with vehicle-only food were merular expansion in type 1 diabetic OVE26 mice.19 also used to highlight the characteristic changes induced by To determine whether long-term administration of PHD obesity and type 2 diabetes. All animal experiments were ap- inhibitors improves metabolic disorder–related kidney disease proved by the ethics committee of the Graduate School of without adverse effects such as worsened tubulointerstitial Medicine, The University of Tokyo, and performed in
2 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH accordance with the guidelines established by the Committee Warrington, PA). Methyl Carnoy–fixed kidney sections on the Ethical Animal Care and Use at the University of Tokyo. were stained with a goat anti-type 4 collagen (1340–01; SouthernBiotech, Birmingham, AL) and a biotinylated sec- Biochemical Measurement ondary antibody (Dako Code E0466; Agilent Technologies), For hematocrit measurement, blood was collected in glass followed by incubation with VECTASTAIN ABC kit (Vector capillary tubes and centrifuged. The volume of red blood cells Laboratories) and ImmPACT DAB. Quantitative analysis was determined using a hematocrit chart. Plasma erythropoi- was performed with ImageJ software. etin concentration was measured with Immunoelit EPO (Toyobo, Osaka, Japan). Fasting blood glucose was measured Transmission Electron Microscopy with a self-monitoring blood glucose device (Nipro Stat Strip Kidney tissue was fixedin2.5%glutaraldehydesolutioninphos- XP2; Nipro, Osaka, Japan) after a 6-hour starvation period. phate buffer (pH 7.4), postfixed with 1% osmium tetroxide, de- Hemoglobin A1c was determined by an enzymatic method hydrated, and embedded in Epok 812. Ultrathin sections were (MetaboLead HbA1c; Kyowa Medex, Tokyo, Japan). Plasma stained with uranyl acetate and lead citrate, and examined with insulin was measured with Ultra Sensitive Mouse Insulin an electron microscope (model H7650; Hitachi, Tokyo, Japan). ELISA Kit (Morinaga Institute of Biologic Science, Yokohama, Japan). Plasma total cholesterol was determined by Determiner Quantitative Real-Time PCR LTCII (Kyowa Medex). Plasma adiponectin was measured with Mechanically homogenized tissue and mesangial cells were used Mouse/Rat adiponectin ELISA Kit (Otsuka Pharmaceutical, in RNA quantification. Total RNA was isolated with RNAiso Tokyo, Japan). The urinary albumin-to-creatinine ratio was (Takara Bio, Shiga, Japan), and reverse transcribed with RT Mas- determined using Mouse Albumin ELISA Kit (AKRAL-121; ter Mix (Takara Bio). Complementary DNA was subjected to Shibayagi, Gunma, Japan) and aqua-auto KINOS CRE-III quantitative real-time PCR using THUNDERBIRD qPCR Mix plus (KAINOS Laboratories, Tokyo, Japan). Urinary CCL2/ (Toyobo) and a CFX96 Real Time System (Bio-Rad) according MCP-1 was measured with Mouse CCL2/JE/MCP-1 Quanti- to the manufacturer’sprotocols.Theresultswereanalyzedby kine ELISA Kit (R&D Systems, Minneapolis, MN). the DDCt method with Actb (b-actin) as a normalization con- trol. Primer sequences are listed in Supplemental Table 1. GFR The GFR was determined as previously reported.21 In brief, Transcriptome Analysis 0.1 mg/g body wt of FITC-labeled sinistrin (diluted in 0.85% Glomeruli were isolated using the Dynabeads methods, as pre- NaCl; Fresenius Kabi, Linz, Austria) was injected into the ret- viously described (three mice per group).22,23 In brief, kidneys roorbital plexus. Plasma was collected at 3, 5, 7, 10, 15, 35, 56, were perfused with 4.5-mmdiameterDynabeads(Thermo and 75 minutes after injection, and sample fluorescence inten- Fisher Scientific, Waltham, MA) through a catheter placed sities were measured using a plate reader (EnSpire; PerkinElmer, in the aorta. After removal, kidneys were minced into small Waltham, MA). Two-phase decay curve fitting was performed pieces, digested by collagenase and DNase, filtered through a using JMP Pro 14 software (SAS Institute, Cary, NC). 100-mm cell strainer, and collected using a magnet. Total RNA was extracted using miRNeasy Mini Kit (Qiagen, Hilden, Immunohistochemistry Germany). Cy3-labeled complementary RNA was generated Three-micrometer formalin-fixed, paraffin-embedded sec- using Low Input Quick Amp Labeling Kits (Agilent Tech- tions were stained with the following primary antibodies; rab- nologies), and 0.6 mg was hybridized onto Agilent SurePrint bit anti–HIF-1a (10006421; Cayman Chemical, Ann Arbor, G3 Mouse GE Microarray 8x60Kversion 2.0 and scanned at MI), rat anti-F4/80 (MCA497; Bio-Rad, Hercules, CA), and 3 mm resolution using SureScan Microarray Scanner (Agi- rabbit anti-pAMPKa (Thr172) (40H9) (2535; Cell Signaling lent Technologies). The intensity data were extracted, and Technology, Danvers, MA). CSA II, Biotin-Free Catalyzed the quality was assessed with the Feature Extraction Software Amplification System with CSA II Rabbit Link (Dako Code version 11.5.1.1 (Agilent Technologies). Raw data were pro- K1497; Agilent Technologies, Santa Clara, CA), Histofine Sim- cessed with the R package limma in Bioconductor to per- ple Stain MAX PO (Nichirei Biosciences, Tokyo, Japan), and form background correction and data normalization using SignalStain Boost (Cell Signaling Technology) were used for the quantile normalization method. The data have been de- signal amplification in HIF-1a, F4/80, and phosphorylated posited in the Gene Expression Omnibus under accession AMP-activated protein kinase (pAMPK) staining, respec- number GSE131266. tively. Color signals were developed with ImmPACT DAB (Vector Laboratories, Burlingame, CA). Periodate-lysine- Cell Culture paraformaldehyde–fixed frozen sections were stained with Murine mesangial cells, SV40 MES 13, were obtained from the a rat anti-CD68 antibody (MCA1957; Bio-Rad), followed by American Type Culture Collection (Manassas, VA). They were Histofine Simple Stain MAX PO and ImmPACT DAB. cultured in a 3:1 mixture of DMEM/F-12 (Sigma-Aldrich, Formalin-fixed kidney sections were stained with Picrosirius St. Louis, MO) with 14 mM HEPES and 5% FBS. Cells were red, following the manufacturer’s protocol (Polysciences, stimulated by palmitate and treated with either enarodustat or
JASN 31: ccc–ccc,2020 PHD Inhibitors in Obesity-Related Kidney Disease 3 BASIC RESEARCH www.jasn.org
AdipoRon (Cayman Chemical) for 12 hours. MISSION small 22 weeks of age increased hematocrit levels, whereas the low interfering RNA (siRNA) Universal Negative Control (Sigma- dose did not induce erythropoiesis (Figure 1A). The high dose Aldrich) and Hif-1a siRNA (Mm_HIF1A_0473; Sigma-Aldrich) was considered toxic because it caused severe polycythemia, were used for siRNA experiments. SV40 MES 13 cells were trans- diminished food intake, and less physical activity (Figure 1A, fected with 25 pmol siRNA using lipofectamine RNAiMax Supplemental Table 2). Eighteen-week treatment of enarodustat (Thermo Fisher Scientific) according to the manufacturer’s at a concentration of 0.05 mg/g increased plasma erythropoietin instructions. After 24 hours, the siRNA-treated cells were level (Figure 1B), indicating adequate HIF-2 activation in renal stimulated by palmitate and treated with enarodustat. So- erythropoietin-producing cells.25,26 Immunohistochemical dium palmitate (Sigma-Aldrich) was conjugated to fatty staining of kidney revealed HIF-1a accumulation in the nuclei acid–free BSA (Wako, Osaka, Japan), as previously de- in mice treated with the intermediate and high doses, whereas scribed.24 The cells were incubated with either palmitate- very few HIF-1a–positive cells were observed in the kidney of BSA or BSA-only solution for 12 hours. The concentration the vehicle-only and low-dose groups (Figure 1C). To obtain of CCL2/MCP-1 in the culture supernatants was determined similar biologic effects as those in human clinical trials without using Mouse CCL2/JE/MCP-1 DuoSet ELISA (R&D Systems). causing adverse effects, the drug-admixed concentration of 0.05 mg/g food was used in the remainder of the experiments. Western blotting Cell pellets of mouse mesangial cells were resuspended in RIPA Enarodustat Suppressed Body Weight Increase and buffer (50 mM Tris-HCl [pH 8.0], 150 mM sodium chloride, Maintained Insulin Sensitivity in BTBR ob/ob Mice 0.5% sodium deoxycholate, 0.1% SDS, 1.0% Triton X-100) with The body weights of 12-week old BTBR ob/ob mice in the a protease and phosphatase inhibitor cocktail (Thermo Fisher enarodustat-treated group were lower compared with the Scientific), and denatured with incubation in sample buffer (2% vehicle-only group, and this difference persisted throughout SDS, 10% glycerol, 60 mM Tris [pH 6.8], 10 mM dithiothreitol, the study period (Figure 2A). No difference was observed in and 0.01% bromophenol blue) for 5 minutes at 97°C. Proteins the amount of food intake between the groups (Figure 2B). were separated by 10% SDS-PAGE and transferred onto a poly- The fasting blood glucose levels of 8- and 12-week-old BTBR vinylidene fluoride membrane. Nonspecific protein binding was ob/ob mice in the enarodustat-treated group were lower com- blocked with 5% skim milk or 5% BSA in Tris-buffered saline pared with the vehicle-only group. Although the difference be- (pH 7.4) containing 0.05% Tween 20. Membranes were incu- came less obvious, the tendency to lower blood glucose levels in bated with primary antibodies (rabbit polyclonal anti–HIF-1a the enarodustat-treated group persisted throughout the study (NB100–449; Novus Biologicals, Centennial, CO), rabbit anti- period (Figure 2C), and hemoglobin A1c levels at 22 weeks of pAMPKa (Thr172) (40H9) (2535; Cell Signaling Technology), age were lower in BTBR ob/ob mice treated with enarodustat rabbit anti-AMPKa (2532; Cell Signaling Technology), or rabbit (Figure 2D). Plasma insulin concentration at the end of the study anti-actin antibody (A2066; Sigma-Aldrich)) at 4°C overnight period was significantly decreased in BTBR ob/ob mice treated and then incubated at room temperature for 45 minutes with with enarodustat (Figure 2E), which indicated improved insulin HRP-conjugated goat anti-rabbit IgG antibody (170–6515; sensitivity in the drug-treated group (Figure 2F). Bio-Rad). Bands were observed with an enhanced chemilu- minescence system (ECL Plus and Image Quant LAS 4000; GE Enarodustat Improved Lipid Metabolism in BTBR ob/ Healthcare, Tokyo, Japan). ob Mice In accordance with several clinical trials that showed Statistical Analyses cholesterol-lowering effects of PHD inhibitors,9,10 the levels All values are expressed as means6SEM. Unpaired two-tailed of plasma total cholesterol were lower in BTBR ob/ob mice t test was used to analyze the data for the two groups. Differences treated with enarodustat (Figure 3A). The mass of epididymal among more than two groups were analyzed using a one-way white adipose tissue (WAT) was significantly lower in the ANOVA with post-hoc Tukey–Kramer test. The Cochra- enarodustat-treated group (Figure 3B). Histologic examina- n–Armitage trend test was performed to examine the change tion revealed a shift in adipocyte size distribution toward in frequency distribution of adipocyte area. Differences with P smaller cells in BTBR ob/ob mice treated with enarodustat com- values ,0.05 were considered significant. All analyses were pared with the mice treated only with vehicle (Figure 3C). The performed with JMP Pro 14 software (SAS Institute). amelioration of adipocyte hypertrophy was accompanied by restoration of plasma adiponectin (Figure 3D), an adipokine considered to have protective roles against metabolic syn- RESULTS drome,27 in BTBR ob/ob mice treated with enarodustat. Obesity is associated with chronic inflammation in adipose Enarodustat Activated HIF in the Kidney of BTBR tissue, which plays a critical role in the development of ob/ob Mice obesity-linked insulin resistance and dysregulation of adipo- We confirmed that administration of enarodustat to male kines.28 In this study, the number of infiltrating macrophages BTBR ob/ob mice at a concentration of 0.05 mg/g from 4 to in the epididymal WAT tended to be smaller in the
4 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH
A B 70 *** *** *** * 60 30 * * 50 *
40 20 30 Vehicle Hematocrit (%) 20 Low (0.015 mg/g) 10 Intermediate (0.05 mg/g) 10 High (0.15 mg/g) 0 Plasma erythropoietin (mIU/ml) 0 4101622 Vehicle Enarodustat Age (weeks) (0.05 mg/g)
C Vehicle Low (0.015 mg/g) Intermediate (0.05 mg/g) High (0.15 mg/g)
30 μm
100 μm
Figure 1. Enarodustat activated HIF and induced erythropoietin production in BTBR ob/ob mice. (A) Hematocrit levels of BTBR ob/ob mice treated with either vehicle only or different doses of enarodustat at 4, 10, 16, and 22 weeks of age. Enarodustat was administered from 4 to 22 weeks of age. (B) Plasma erythropoietin of BTBR ob/ob mice at 22 weeks of age. They were treated with either vehicle only or enar- odustat at a concentration of 0.05 mg/g food. (C) HIF-1a staining of kidney. Data are expressed as means6SEM; vehicle only, n54–6; low (0.015 mg/g), n58; intermediate (0.05 mg/g), n57; high (0.15 mg/g), n58. *P,0.05; ***P,0.001 compared with the vehicle-only group. enarodustat-treated group (Figure 3E). The mRNA levels of profiles of isolated glomeruli from each group. The initial Tnf-a in the epididymal WAT were suppressed in the drug- screening process revealed 8965 probes whose absolute values treated group, and Ccl2/Mcp1 expression exhibited the same of log2 (BTBR ob/ob mice treated with enarodustat/BTBR ob/ob tendency (Figure 3F). mice treated with vehicle only) exceeded 0.5, i.e.,theirex- pression levels in the enarodustat group increased more than Enarodustat Reduced Albuminuria and Ameliorated 1.4-fold, or decreased to ,0.7-fold, compared with the Glomerular Epithelial and Endothelial Injury in BTBR vehicle-only group. We then compared the expression levels ob/ob Mice of those 8965 probes between BTBR ob/ob and wild-type The goal of treating metabolic disorders is to prevent the devel- mice to identify molecules that were likely to be involved opment of complications, including kidney disease. In this study, in the pathogenesis of glomerular injury. Such analysis revealed enarodustat reduced the amounts of urinary albumin at 16 and 71 genes that were significantly upregulated and 47 genes that 22 weeks (Figure 4A). Electron microscopy observation revealed were significantly downregulated in BTBR ob/ob mice com- amelioration of foot process effacement as well as preservation of pared with wild-type mice (Figure 5A). The genes were ranked endothelial fenestrations in BTBR ob/ob mice treated with enar- according to their fold-change values, and the top five upregu- odustat (Figure 4B). However, there was no improvement in lated and downregulated genes are listed in Table 1. glomerular hyperfiltration at 22 weeks (Figure 4C), indicating This analysis presented Ccl2/Mcp1 as the second-most that enarodustat’s renoprotective effects were independent of upregulated gene in BTBR ob/ob mice; its mRNA expression hemodynamics. Glomerular hypertrophy and mesangial expan- level increased by 24.42-fold in BTBR ob/ob compared with sion were also unchanged (Supplemental Figure 1). Interstitial wild-type mice, and its expression in enarodustat-treated fibrosis was not exacerbated in the kidney of BTBR ob/ob mice BTBR ob/ob mice was decreased to 0.62 of the vehicle-only treated with enarodustat (Figure 4D). BTBR ob/ob mice (Figure 5A). Because upregulation of CCL2/MCP-1 is one of the earliest renal inflammatory re- Glomerular CCL2/MCP-1 Production and Macrophage sponses that promotes kidney injury in diabetes and high-fat Infiltration were Suppressed in Enarodustat-Treated diet–induced obesity,29–32 we further investigated the asso- BTBR ob/ob Mice ciation between enarodustat and this molecule. Urinary ex- To identify molecules that contribute to the amelioration of cretion of CCL2/MCP-1 at 22 weeks of age was reduced glomerular injury by enarodustat, we analyzed gene expression in BTBR ob/ob mice treated with enarodustat (Figure 5B).
JASN 31: ccc–ccc,2020 PHD Inhibitors in Obesity-Related Kidney Disease 5 atn lo lcs n lsaislnlvl,epesdrltv ota fwl-yemc.Dt r xrse smeans as expressed are Data mice. BTBR wild-type and of wild-type that BTBR to of relative levels expressed insulin levels, plasma insulin (E) plasma and and A1c glucose Hemoglobin blood (D) fasting reference. for shown is weeks ob/ob 20 at mice wild-type BTBR 0wesi hw o eeec.()Fsigbodguoelvl fBTBR of levels glucose blood Fasting (C) reference. BTBR for by shown intake is food weeks of 20 amount The (B) reference. type, 6 BTBR 2. Figure AI RESEARCH BASIC n ob/ob ietetdwt ihrvhceol reaoutta 2wes F nui eitneidxwsdtrie stepoutof product the as determined was index resistance Insulin (F) weeks. 22 at enarodustat or only vehicle either with treated mice 5 JASN 5; nrdsa upesdbd egtices n mrvdguoemtbls nBTBR in metabolism glucose improved and increase weight body suppressed Enarodustat ob/ob iea ,8 2 6 0 n 2weso g.Bd egt fBB idtp iea n 2wesaesonfor shown are weeks 22 and 4 at mice wild-type BTBR of weights Body age. of weeks 22 and 20, 16, 12, 8, 4, at mice vehicle, C A
E Fasting blood glucose (mg/dl) www.jasn.org
100 200 300 400 500 600 700 800 900 Body weight (g) 10 30 40 50 Plasma insulin (ng/ml) 20 60 70 80 0 0 0 2 4 6 8 n 5 5 wild type 4 – 4 6; ← wildtype ob/ob enarodustat ob/ob enarodustat ob/ob vehicle ob/ob vehicle ob/ob 8 ** *** 8121620 Age (weeks) Age (weeks) 21 20 16 12 enarodustat, * vehicle ob/ob p =0.07 * wild type→ wild type→ ob/ob * enarodustat * n p =0.07 ob/ob 5 iea ,8 2 6 n 0weso g.Itk fBB idtp ieat mice wild-type BTBR of Intake age. of weeks 20 and 16, 12, 8, 4, at mice 6 22 – 7. *P , .5 * 0.05; F D B Insulin resistance index HbA1c (%) Intake (g/day) 10 20 30 40 10 12 10 12 0 0 2 4 6 8 0 2 4 6 8 *P ob/ob , wild type .1 ** 0.01; wild type 21 20 16 12 8 4 iea ,8 2 6 n 0weso g.Dt for Data age. of weeks 20 and 16, 12, 8, 4, at mice ob/ob enarodustat ob/ob vehicle *P *** *** Age (weeks) , 0.001. vehicle vehicle ob/ob ob/ob wild type→ p =0.0589 ** ob/ob enarodustat enarodustat ob/ob ob/ob ie A oywihsof weights Body (A) mice. JASN 31: 6 ccc E;wild- SEM; – ccc ,2020 www.jasn.org BASIC RESEARCH
A B 400 **** 4.0 ***** 300 3.0 200 2.0
100 WAT/BW (%) 1.0 Total cholesterol (mg/dl) 0 0 wild type ob/ob ob/ob wild type ob/ob ob/ob vehicle enarodustat vehicle enarodustat
C wild type ob/ob vehicle ob/ob enarodustat
50 µm
60 p < 0.0001 D 15 50 ob/ob vehicle ** * ob/ob enarodustat 40 10 30
total cells) 20 5 10 Relative Frequency (% of
0 Plasma adiponectin (ng/ml) 0 wild type ob/ob ob/ob vehicle enarodustat <5000 >20000 5000~7500 7500~10000 10000~1250012500~1500015000~1750017500~20000 Adipocyte area (µm2)
Figure 3. Enarodustat ameliorated adipose tissue inflammation and improved lipid metabolism. (A) Plasma total cholesterol levels at 22 weeks of age. (B) Weight of epididymal WAT per body weight at 22 weeks of age. (C) Representative images of hematoxylin and eosin staining performed on epidydimal WAT. The areas of 100 adipocytes per mouse were measured, and their size distribution is shown. The Cochran–Armitage trend test was performed to examine the change in frequency distribution of adipocyte area. (D) Plasma adiponectin levels at 22 weeks of age. (E) Representative images of F4/80 staining performed on epididymal WAT. The numbers of F4/80-positive cells in ten randomly chosen fields per mouse were counted. (F) The mRNA expression levels of cytokines in epididymal WAT, shown as means relative to wild-type after normalization to Actb (b-actin). Data are expressed as means6SEM; wild-type, n55; ob/ob vehicle, n55–6; ob/ob enar- odustat, n57. Modest changes in brightness and contrast were applied to the images for visual purposes. *P,0.05; **P,0.01; ***P,0.001.
The number of infiltrating macrophages within the glomer- enarodustat-mediated protection against glomerular uli was expectedly lower in enarodustat-treated mice injury. (Figure 5C). There was also a tendency for reduced macro- phage infiltration in the tubulointerstitium, but Ccl2/Mcp1 Both HIF-1 Activation and Restoration of Adiponectin mRNA expression in the kidney cortex was unchanged by Enarodustat Contributed to CCL2/MCP-1 Reduction (Supplemental Figure 2). These findings indicated that sup- in Mesangial Cells pressed production of CCL2/MCP-1 and macrophage in- Mesangial cells produce CCL2/MCP-1 in response to various filtration in glomeruli may have contributed to the stimuli, such as high glucose, palmitate, and TGF-b.29,33,34
JASN 31: ccc–ccc,2020 PHD Inhibitors in Obesity-Related Kidney Disease 7 BASIC RESEARCH www.jasn.org
E wild type ob/ob vehicle ob/ob enarodustat
50 µm
F 9 ob/ob vehicle * p = 0.0815 30 8 p = 0.0954 ob/ob enarodustat 25 7 20 6 5 15 * 4 10 3 5 2 (Relative to wild type) F4/80-positive cells (/field) mRNA expression (AU) 0 1 wild type ob/ob ob/ob vehicle enarodustat 0 Tnfα Ccl2/ Il6 Il1ββTgf Il10 Mcp1
Figure 3. Continued.
Although podocytes also secrete CCL2/MCP-1,31 a previous C–E). In line with these in vitro findings, increased glomerular study by Declèves et al. demonstrated that mesangial cells pAMPK levels were observed in BTBR ob/ob mice treated with are the major source of increased glomerular CCL2/MCP-1 enarodustat (Figure 7F). These results indicated that restoration expression in murine obesity–related kidney disease.29 There- of adiponectin by enarodustat may also have contributed to the fore, we conducted in vitro experiments with a murine me- suppression of CCL2/MCP-1 in mesangial cells through activa- sangial cell line, SV40 MES 13, to elucidate if enarodustat di- tion of the AMPK signaling pathway. rectly inhibits CCL2/MCP-1 production in mesangial cells. The expression of CCL2/MCP-1 was significantly upregulated when mesangial cells were stimulated with palmitate for DISCUSSION 12 hours, and this increase was suppressed by enarodustat (Figure 6, A and B). Because PHD enzymes hydroxylate other This study demonstrated that administration of a PHD inhibi- molecules in addition to HIF and HIF-1a is the dominant HIF tor, enarodustat, resulted in the amelioration of obesity and in- isoform in mesangial cells (Figure 6C), we further explored if sulin intolerance, and improvement in lipid metabolism in this effect was mediated by HIF-1. When Hif-1a was knocked BTBR ob/ob mice. These metabolic improvements were likely down by siRNA, enarodustat’s suppressive effect on palmitate- to be mediated by mitigation of adipose tissue inflammation, as induced CCL2/MCP-1 production was abolished (Figure 6, D we previously reported.8 The beneficial effects of enarodustat and E), indicating that enarodustat’s regulatory effects on further extended to metabolic disorder–related kidney disease, CCL2/MCP-1 expression were dependent on HIF-1. as shown by reduced albuminuria and amelioration of glomer- In addition to HIF-1 activation, elevated adiponectin levels ular epithelial and endothelial damage. This renoprotection was in enarodustat-treated mice may also have contributed to the mediated through both indirect and direct pathways: the former suppression of CCL2/MCP-1, because adiponectin is known was the improvement in glucose and lipid metabolism, includ- to activate AMP-activated protein kinase (AMPK), which has ing increased adiponectin, and the latter was enarodustat’s sup- anti-inflammatory effects.27,35 As previously reported,29 incubat- pressive effect on CCL2/MCP-1 production in mesangial cells ing mesangial cells with an AMPK activator, 5-aminoimidazole-4- via HIF-1 activation. Decreased glomerular CCL2/MCP-1 ex- carboxamide ribonucleotide, suppressed palmitate-induced pression was accompanied by reduced macrophage infiltration CCL2/MCP-1 expression (Figure 7, A and B). Similarly, an (Figure 8). Furthermore, renal interstitial fibrosis was not exac- adiponectin receptor agonist, AdipoRon,36 demonstrated an erbated at the end of the 18-week treatment. increase in pAMPK and suppression of palmitate-induced The significance of CCL2/MCP-1 and its receptor, C-C CCL2/MCP-1 expression in a dose-dependent manner (Figure 7, chemokine receptor type 2, has received much attention for
8 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH
A B wild type ob/ob vehicle ob/ob enarodustat
ob/ob vehicle 8000 ob/ob enarodustat
6000
4000 1.0 µm
2000 ** wild* type Urinary albumin (µg/mgCr) 0 10 16 22 Age (weeks)
C D wild type ob/ob vehicle ob/ob enarodustat
1200 *** 1000
800 PAS 600 50 µm 400 GFR (µl/min) 200 0 wild type ob/ob ob/ob vehicle enarodustat Sirius red
50 µm
8
6 ** 4
2
Sirius red-positive area (%) 0 wild type ob/ob ob/ob vehicle enarodustat
Figure 4. Enarodustat-treated BTBR ob/ob mice were protected from glomerular injury. (A) Urinary albumin of BTBR ob/ob mice at 10, 16, and 22 weeks of age. Data for BTBR wild-type mice at 22 weeks is shown for reference. (B) Representative electron microscopic images of kidney glomeruli. (C) GFR of BTBR wild-type and BTBR ob/ob mice treated with either vehicle only or enarodustat at 22 weeks of age. (D) Representative images of periodic acid–Schiff (PAS; top panels) and Sirius red (bottom panels) staining of kidney. Sirius red–positive areas were evaluated in ten randomly chosen fields per mouse. Data are expressed as means6SEM; wild-type, n53–5; ob/ob vehicle, n56; ob/ob enarodustat, n57. Modest changes in brightness and contrast were applied for visual purposes. *P,0.05; **P,0.01; ***P,0.001. their roles in the progression of metabolic disorder–related present less albuminuria and milder histologic damage after kidney disease.30,31 In situ hybridization and immunohisto- administration of streptozotocin.32 Similar results are ob- chemical analysis reveal increased CCL2/MCP-1 expression tained in Ccl2/Mcp1-deficient db/db mice,37 leading to the in both glomeruli and tubules in diabetes and in high-fat diet development of a selective C-C chemokine receptor type 2 models.29,32 Thepathologicroleofthiscytokineishigh- inhibitor as a novel therapeutic agent for diabetic kidney lighted by mice genetically deficient for Ccl2/Mcp1,which disease. Indeed, a phase 2 clinical trial of the drug
JASN 31: ccc–ccc,2020 PHD Inhibitors in Obesity-Related Kidney Disease 9 BASIC RESEARCH www.jasn.org
A ob/ob enarodustat 8965 probes with log2 > 0.5 ob/ob vehicle
Ccl2/Mcp1 wild type vs ob/ob vehicle Ccl2/Mcp1 4.0 2.0 3.0 1.5
1.0 2.0
(adjusted p value) 0.5 1.0 10
-log 0 0 Normalized expression value -4 -2 0 2 4 wild type ob/ob ob/ob vehicle enarodustat log2 (fold change)
B p = 0.0641 600 **
500
400
300
(pg/mgCr) 200
100 Urinary CCL2/MCP-1
0 wild type ob/ob ob/ob vehicle enarodustat
C wild type ob/ob vehicle ob/ob enarodustat
50 µm
6 ** 5
4
3
2
1 CD68-positive cells/glomerulus 0 ob/ob ob/ob vehicle enarodustat
Figure 5. Glomerular CCL2/MCP-1 expression and macrophage infiltration were suppressed in the enarodustat-treated BTBR ob/ob mice. (A) Transcriptome analysis of isolated glomeruli (n53 for each group). The initial screening identified 8965 probes, whose ab- solute values of log2 (BTBR ob/ob mice treated with enarodustat/BTBR ob/ob mice treated with vehicle only) exceeded 0.5. Com- parison of their expression levels between BTBR ob/ob mice and wild-type mice revealed 71 genes that were significantly upregulated (red) and 47 that were significantly downregulated (green) in BTBR ob/ob mice compared with wild-type mice. Normalized expression values of Ccl2/Mcp1 are shown as individual value plots. (B) Urinary CCL2/MCP-1 at 22 weeks of age. (C) Representative images of
10 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH
Table 1. Genes upregulated and downregulated in the glomeruli of BTBR ob/ob mice Symbol Gene Name FC P Value Aff. ID Top 5 genes upregulated in BTBR ob/ob mice ranked by FC Mmp10 Matrix metalloproteinase-10 32.00 1.94E-02 120,830 Ccl2/Mcp1 C-C motif chemokine ligand 2/Monocyte chemoattractant protein-1 24.42 1.17E-02 286,737 Fpr2 N-formyl peptidase receptor 2 22.26 2.61E-02 288,138 Angpt4 Angiopoietin-4 21.61 1.94E-02 372,393 Pcdh7 Protocadherin-7 21.31 3.46E-02 260,740 Top 5 genes downregulated in BTBR ob/ob mice ranked by FC Lypd1 Ly6/Plaur domain containing 1 0.02 6.59E-03 497,395 Cacna2d2 Calcium channel, voltage-dependent, alpha 2/delta subunit 2 0.04 6.59E-03 171,711 Creg2 Cellular repressor of E1A-stimulated genes 2 0.08 3.64E-02 387,056 Adamdec1 ADAM-like, decysin 1 0.12 4.49E-02 164,296 Cdx2 Caudal type homeobox 2 0.15 2.59E-02 177,490 FC, fold change; Aff. ID, Affymetrix ID. demonstrated a significant reduction in albuminuria in pa- abundantly expressed in the liver and activates the peroxisome tients with type 2 diabetes.38 proliferator-activated receptor-a pathway.27 Electron micros- The regulatory effects of the PHD-HIF system on CCL2/ copy using immunogold labeling reveals that AdipoR1 is ex- MCP-1 production seem to be dependent on cell type and pressed in mesangial cells as well as glomerular endothelial context; hypoxia increases CCL2/MCP-1 expression in astro- cells and podocytes.48 Many preclinical studies have demonstrated cytes,39 but reduces CCL2/MCP-1 abundance in macrophages renoprotective effects of adiponectin; adiponectin-deficient mice and renal proximal tubular cells in vitro.40,41 Similarly, global exhibit increased albuminuria after streptozotocin injection,49 activation of HIF by genetic deletion of Vhl reduces Ccl2/Mcp1 and administration of AdipoRon ameliorates kidney injury expression and the number of infiltrating macrophages within in diabetic db/db mice.50 Our in vitro findings supported the kidney in a unilateral ureteral obstruction model.42 Our thenotionthatadiponectincanprotectagainstmetabolic findings agree with the latter notion that HIF downregulates disorder–related kidney disease, possibly through AMPK ac- CCL2/MCP-1 production. Unlike the previously mentioned tivation and suppression of CCL2/MCP-1productioninme- in vitro experiments, however, enarodustat itself had no influ- sangial cells. Therefore, it is anticipated that enarodustat’s ence on the basal expression levels of CCL2/MCP-1 in mesan- potential to increase adiponectin levels may provide addi- gial cells; it demonstrated its suppressive effects only under the tional benefits to patients with diabetes- and obesity-related stimulation of palmitate. Because HIF is a transcription factor kidney disease. that mostly upregulates its target genes by binding to the hyp- Although we focused mainly on CCL2/MCP-1 in this study, oxia response element in the promoter regions of those the transcriptome analysis identified several other molecules genes,43 HIF is likely to affect CCL2/MCP-1 production by that might be involved in enarodustat’s renoprotection. Ma- an indirect pathway. Palmitate-induced CCL2/MCP-1 pro- trix metalloproteinase-10 (MMP-10) was the most upregula- duction is mediated by several factors, including toll-like re- ted gene in BTBR ob/ob mice (Table 1); its mRNA expression ceptor 4, NF-kB, and endoplasmic reticulum stress.44–47 level increased by 32.00-fold compared with wild-type mice, Enarodustat may intervene in one or more of these pathways and its expression in enarodustat-treated BTBR ob/ob mice was via HIF activation, and further investigation is required to decreased to 0.31 in vehicle-only BTBR ob/ob mice elucidate this complex regulatory mechanism involving the (Supplemental Figure 3A). MMP-10 is now recognized as PHD-HIF system on CCL2/MCP-1 production. an important modulator of macrophage activity, and it affects In addition to enarodustat’s direct effect on the kidney, it is the course of various diseases, including lung infection, skin likely that improved glucose and lipid metabolism also con- injury, and colitis.51–53 In patients with type 1 diabetes, serum tributed to renoprotection. Among many circulating factors MMP-10 levels are positively associated with nephropathy.54 that may be involved in this process, we focused on adiponec- Similarly, renal function and morphology are better main- tin, an adipokine known for its protective roles against meta- tained in Mmp10-deficient diabetic mice compared with bolic syndrome.27 Two subtypes of adiponectin receptors have wild-type mice, with less macrophage infiltration in the kid- been identified to date: AdipoR1 and AdipoR2. AdipoR1 is ney.54 Taken together, the decrease in glomerular MMP-10 ubiquitously expressed and transduces its signal mainly may have contributed to enarodustat’s renoprotection. Both through the AMPK pathway, whereas AdipoR2 is most cultured podocytes and mesangial cells produce MMP-10.55,56
CD68 staining of kidney. The numbers of CD68-positive cells in ten glomeruli were counted for each mouse. No CD68-positive cells were detected in the glomeruli of BTBR wild-type mice. Data are expressed as means6SEM; wild-type, n53; ob/ob vehicle, n56; ob/ob enarodustat, n57. **P,0.01.
JASN 31: ccc–ccc,2020 PHD Inhibitors in Obesity-Related Kidney Disease 11 BASIC RESEARCH www.jasn.org
A B 70 5.0 *** *** ** *** 60 4.0 50
3.0 40
30 2.0 20 1.0
Ccl2/Mcp1 mRNA (AU) 10 CCL2/MCP-1 (ng/mg protein) 0 0 palmitate (100 µM) --++palmitate (100 µM) --++ enarodustat (10 µM) -+-+enarodustat (10 µM) -+-+
C Mesangial Mouse D Sample cells Kidney
Primer HIF-1α HIF-2α siRNA Control Hif-1α Control Hif-1α Enarodustat (-) Enarodustat (+)
α 311bp HIF-1 151bp actin
E Control siRNA α 2.5 Hif-1 siRNA *** * 2.0 *** N.S.
1.5
1.0
0.5 Ccl2/Mcp1 mRNA (AU)
0 palmitate (100 µM) --++--++ enarodustat (10 µM) - + ---+ ++
Figure 6. Enarodustat suppressed palmitate-induced CCL2/MCP-1 production in cultured mesangial cells via HIF-1 activation. (A) Quantitative real-time PCR was performed to assess mRNA expression levels of Ccl2/Mcp1 in murine mesangial cells after 12-hour stimulation by palmitate, with or without enarodustat (n56 for each group). (B) Quantitative analysis of CCL2/MCP-1 content in the culture supernatants, normalized to the total protein in the cells (n56 for each group). (C) Qualitative PCR analysis of Hif-1a and Hif-2a in cultured mesangial cells and mouse kidney. (D and E) Mesangial cells were transfected with control siRNA or siRNA targeting Hif-1a. Expression of HIF-1a was examined by Western blot (D). The mRNA expression levels of Ccl2/Mcp1 after 12-hour stimulation by palmitate with or without enarodustat (n53 for each group) (E). The mRNA expression levels are shown as means relative to the control after normalization to Actb (b-actin). Data are expressed as means6SEM *P,0.05; **P,0.01; ***P,0.001.
Unlike CCL2/MCP-1, however, palmitate-induced MMP-10 A similar improvement in metabolic dysfunction reported production was not suppressed by either enarodustat or Adi- with another PHD inhibitor, FG-4497,6 indicates that this is poRon in cultured mesangial cells (Supplemental Figure 3, B likely to be a class effect of PHD inhibitors, although the de- and C), suggesting that a different mechanism may be involved tailed mechanism has yet to be determined. It has been pre- in its regulation. viously reported that both systemic and adipocyte-specific
12 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH
A B *** *** 60 2.5 *** *** 50 2.0 40 1.5 *** 30 p = 0.2411 1.0 20
0.5 10 Ccl2/Mcp1 mRNA (AU) CCL2/MCP-1 (ng/mg protein) 0 0 palmitate (100 µM) - -++ palmitate (100 µM) - - + + AICAR (1 mM) - ++- AICAR (1 mM) --++
C AdipoRon (µM) 01310
pAMPK
AMPK
actin
D E *** * 90 4.0 *** 80 *** * 70 3.0 60 50 2.0 40 30 1.0 20 Ccl2/Mcp1 mRNA (AU)
CCL2/MCP-1 (ng/mg protein) 10 0 0 palmitate (100 µM) - + + + + palmitate (100 µM) - + + + + AdipoRon --1 µM 3 µM 10 µM AdipoRon --1 µM3 µM 10 µM
Figure 7. AdipoRon (a small-molecule adiponectin receptor agonist) suppressed palmitate-induced CCL2/MCP-1 production in cul- tured mesangial cells via AMPK activation. (A) Quantitative real-time PCR was performed to assess mRNA expression levels of Ccl2/ Mcp1 in murine mesangial cells after 12-hour stimulation by palmitate, with or without 5-aminoimidazole-4-carboxamide ribonucle- otide (AICAR) (n56 for each group). (B) Quantitative analysis of CCL2/MCP-1 content in the culture supernatants, normalized to the total protein in the cells (n54 for each group). (C) The expression levels of pAMPK and AMPK were assessed by Western blot. (D) The mRNA expression levels of Ccl2/Mcp1 after 12-hour stimulation by palmitate, with or without AdipoRon (n54–5 for each group). (E) Quantitative analysis of CCL2/MCP-1 content in the culture supernatants, normalized to the total protein in the cells (n54–6 for each group). (F) Representative images of pAMPK staining of kidney glomeruli. The percentage of pAMPK-positive area within each glo- merulus was evaluated for ten glomeruli per mouse. Wild-type, n54; ob/ob vehicle, n56; ob/ob enarodustat, n57. The mRNA ex- pression levels are shown as means relative to the control after normalization to Actb (b-actin). Data are expressed as means6SEM; *P,0.05; **P,0.01; ***P,0.001.
Phd2-deficient mice were resistant to high-fat diet–induced we did not observe similar increases in the expression of those obesity and metabolic disorders; increased expression of genes in WAT of enarodustat-treated BTBR ob/ob mice glycolysis-related enzymes in WAT was proposed to be one (Supplemental Figure 4A). One possible explanation for this of the factors contributing to this protection.6,57 However, discrepancy is the tissue-specific distribution pattern of the
JASN 31: ccc–ccc,2020 PHD Inhibitors in Obesity-Related Kidney Disease 13 BASIC RESEARCH www.jasn.org
F wild type ob/ob vehicle ob/ob enarodustat
50 µm
30 *** ** 25
20
15
10
5
0 pAMPK-positive area/glomerulus (%) wild type ob/ob ob/ob vehicle enarodustat
Figure 7. Continued. drug, because its concentration in WAT is relatively low com- may have been partially mediated by increased hematocrit pared with kidney (unpublished data). and erythropoietin levels. By contrast, reduced macrophage infiltration in WAT was Another possible mechanism for mitigation of hyperglyce- observed in both our study and in the previous study using mia is increased urinary glucose excretion. Although urinary systemic PHD2 hypomorphic mice,6 suggesting that adipose glucose at 10, 16, and 22 weeks of age did not differ signifi- tissue inflammation may be a key to elucidate enarodustat’s cantly between vehicle-only and enarodustat-treated groups protective role against obesity-related metabolic disorders. (Supplemental Figure 5), these data were not sufficient to draw Enarodustat could have directly suppressed cytokine produc- adefinite conclusion. For the collection of urine, the mice tion in adipocytes, similar to the effect observed in mesangial were housed in metabolic cages for 3–4 hours with food and cells. However, considering its relatively low concentration in water ad libitum, without blood glucose monitoring. Because WAT, it seems more likely that this anti-inflammatory effect urinary glucose excretion increases in a proportional manner was mediated by some other factors, such as circulating cyto- with increasing blood glucose in type 2 diabetes,65 simulta- kines and macrophages themselves. Indeed, a previous study neous measurement of blood and urinary glucose levels is re- demonstrated that elevation of macrophage HIF-2a sup- quired to clarify if enarodustat affects renal glucose handling. pressed the expression of proinflammatory cytokines.58 Although our findings indicate potential advantageous effects Erythropoietin was also reported to reduce macrophage of enarodustat in CKD patients with metabolic disorders, several infiltration in WAT and improve insulin sensitivity in mice limitations need to be considered. First, the dose used in this fed a high-fat diet, independent of erythropoiesis.59 One of study was much higher than that used in human trials. BTBR the proposed mechanisms is that erythropoietin restores the ob/ob mice were given 8–10 mg/kg body wt per day, whereas balance between M1 and M2 macrophages,59 although we human patients took only 2–8 mg of enarodustat, which corre- did not findobviouschangesinM1/M2markersin sponded to 0.03–0.13 mg/kg body wt.7 In terms of erythropoiesis, enarodustat-treated BTBR ob/ob mice (Supplemental drug response seems to vary between species: our dose-finding Figure 4, B and C). In addition, erythropoietin was reported study revealed that the drug-admixed concentration of to increase energy expenditure by regulating hypothalamic 0.015 mg/g (approximately 2.5–3.0 mg/kg body wt per day) neuropeptides,60 thermogenesis in brown adipose tissue,61 was not sufficient to increase hematocrit levels (Figure 1A), and skeletal muscle insulin sensitivity.62 Furthermore, in- and previous reports showed that 1–3 mg/kg body wt of enar- creased hematocrit was likely to have mitigated adipose tis- odustat was required to increase hemoglobin in both healthy sue hypoxia, which is a potential driver of adipose tissue and CKD model rats.66,67 The optimal drug concentration to inflammation.63,64 These previous works suggest that im- achieve metabolic improvement may also vary from mice to proved glucose and lipid metabolism observed in this study human, and further research is necessary to clarify whether the
14 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH
Administration of PHD inhibitors Mr.Fukui,andDr.Shimizuperformedexperiments.Dr.Sugahara, Dr. Tanaka, Dr. Tanaka, Mr. Ueda, Dr. Inagi, and Dr. Nangaku an- alyzed the data. Dr. Sugahara, Dr. Tanaka, Mr. Ueda, Dr. Shimizu fi Macrophage infiltration in WAT ↓ made the gures. Dr. Sugahara, Dr. Tanaka, Dr. Tanaka, Dr. Yamauchi, Improved glucose/lipid metabolism Dr. Kadowaki, and Dr. Nangaku drafted and revised the paper. All au- thors approved the final version of the manuscript. We thank Kahoru Amitani, Satoru Fukuda (The University of Tokyo), and Arimi Ishikawa (Nippon Medical School) for technical Plasma adiponectin ↑ support. Enarodustat was provided by Japan Tobacco Inc.
AMPK activation HIF-1 activation DISCLOSURES in mesangial cells in mesangial cells
Mr. Fukui has a patent WO2016190420 issued (Method for treating or preventing diabetic nephropathy). Dr. Nangaku reports grants from Japan Tobacco Inc., during the conduct of the study. Dr. Tanaka reports grants Mesangial CCL2/MCP-1 production ↓ Macrophage infiltration in glomeruli ↓ from Japan Tobacco Inc., outside the submitted work.
FUNDING Glomerular epithelial and endothelial cell damage ↓ Albuminuria ↓ The study was supported by grants-in-aid for scientific research from the ’ Japan Society for the Promotion of Science (18H02824 to Dr. Nangaku and Figure 8. Proposed mechanism for enarodustat s renoprotection fi – ’ 17K09688 to Dr. Tanaka), a grant-in-aid for scienti c research on innovative against metabolic disorder related kidney disease. Enarodustat s areas from the Japan Society for the Promotion of Science (26111003 to renoprotective effect was mediated by improvements in both glu- Dr. Nangaku), and a research grant from Biological and Pharmacological cose and lipid metabolism, and its direct effects on mesangial cells. Research Laboratories, Central Pharmaceutical Research Institute, Japan Tobacco Inc. current clinical dose is effective in ameliorating metabolic dis- orders in human patients. Second, it should be noted that the drug was begun at a very young age, when the mice were still in SUPPLEMENTAL MATERIAL the growth period. Although we confirmed that BTBR ob/ob mice already exhibited increased body weight at the age of This article contains the following supplemental material online at 4 weeks (Figure 2A), a previous study reported that signs of http://jasn.asnjournals.org/lookup/suppl/doi:10.1681/ASN.2019060582/-/ metabolic and renal disorders became evident 2–4 weeks later; DCSupplemental. hyperglycemia and proteinuria were detected at 6 and 8 weeks Supplemental Figure 1. Enarodustat did not reduce glomerular of age, respectively.20 This study, therefore, demonstrated enar- hypertrophy or mesangial expansion. odustat’s preventive effects, rather than mitigating effects of Supplemental Figure 2. Enarodustat tended to decrease macro- already established metabolic and renal disorders. The conse- phage infiltration in the tubulointerstitium, but Ccl2/Mcp1 mRNA quences of enarodustat treatment starting at different time expression in the kidney cortex was unchanged. points need to be investigated. Supplemental Figure 3. Glomerular expression of MMP-10 was Despite these limitations, our study demonstrated potential suppressed in enarodustat-treated BTBR ob/ob mice, but its expression in renoprotective effects of a PHD inhibitor, enarodustat, in addition cultured mesangial cells was not affected by enarodustat or AdipoRon. to improved glucose and lipid metabolism in mice with obesity Supplemental Figure 4. Enarodustat did not change the expression and type 2 diabetes, possibly through amelioration of chronic levels of metabolism-related genes or M1/M2 macrophage markers in WAT. inflammation in glomeruli and adipose tissue. The precise mech- Supplemental Figure 5. The urinary glucose levels did not differ anisms mediating metabolic and inflammatory regulation by the significantly between vehicle-only and enarodustat-treated groups. PHD-HIF system, and whether our findings would apply to real- Supplemental Table 1. List of primers used in this study. world clinical settings, warrant further investigation. Supplemental Table 2. Hematocrit and intake of BTBR ob/ob mice treated with different doses of enarodustat.
REFERENCES ACKNOWLEDGMENTS
1. Hasegawa S, Tanaka T, Nangaku M: Hypoxia-inducible factor stabilizers Dr. Sugahara, Dr. Tanaka, Dr. Tanaka, and Dr. Nangaku designed the for treating anemia of chronic kidney disease. Curr Opin Nephrol Hy- study. Dr. Sugahara, Dr. Tanaka, Dr. Saito, Dr. Ishimoto, Mr. Wakashima, pertens 27: 331–338, 2018
JASN 31: ccc–ccc,2020 PHD Inhibitors in Obesity-Related Kidney Disease 15 BASIC RESEARCH www.jasn.org
2. Haase VH: HIF-prolyl hydroxylases as therapeutic targets in erythropoiesis metabolism and suppresses oxidative stress in the kidneys of diabetic and iron metabolism. Hemodial Int 21[Suppl 1]: S110–S124, 2017 mice. Kidney Int 94: 912–925, 2018 3. Rabinowitz MH: Inhibition of hypoxia-inducible factor prolyl hydroxy- 22. Takemoto M, Asker N, Gerhardt H, Lundkvist A, Johansson BR, Saito Y, lase domain oxygen sensors: Tricking the body into mounting orches- et al.: A new method for large scale isolation of kidney glomeruli from trated survival and repair responses. JMedChem56: 9369–9402, 2013 mice. Am J Pathol 161: 799–805, 2002 4. Ratcliffe PJ: HIF-1 and HIF-2: Working alone or together in hypoxia? 23. Motonishi S, Nangaku M, Wada T, Ishimoto Y, Ohse T, Matsusaka T, JClinInvest117: 862–865, 2007 et al.: Sirtuin1 maintains actin cytoskeleton by deacetylation of cor- 5. Sugahara M, Tanaka T, Nangaku M: Prolyl hydroxylase domain inhibi- tactin in injured podocytes. JAmSocNephrol26: 1939–1959, 2015 tors as a novel therapeutic approach against anemia in chronic kidney 24. Anusornvongchai T, Nangaku M, Jao TM, Wu CH, Ishimoto Y, Maekawa disease. Kidney Int 92: 306–312, 2017 H, et al.: Palmitate deranges erythropoietin production via transcription 6. Rahtu-Korpela L, Karsikas S, Hörkkö S, Blanco Sequeiros R, factor ATF4 activation of unfolded protein response. Kidney Int 94: Lammentausta E, Mäkelä KA, et al.: HIF prolyl 4-hydroxylase-2 in- 536–550, 2018 hibition improves glucose and lipid metabolism and protects against 25. Maxwell PH, Osmond MK, Pugh CW, Heryet A, Nicholls LG, Tan CC, obesity and metabolic dysfunction. Diabetes 63: 3324–3333, 2014 et al.: Identification of the renal erythropoietin-producing cells using 7. Akizawa T, Nangaku M, Yamaguchi T, Arai M, Koretomo R, Matsui A, transgenic mice. Kidney Int 44: 1149–1162, 1993 et al.: A placebo-controlled, randomized trial of enarodustat in patients 26. Gruber M, Hu CJ, Johnson RS, Brown EJ, Keith B, Simon MC: Acute with chronic kidney disease followed by long-term trial. Am J Nephrol postnatal ablation of Hif-2a results in anemia. Proc Natl Acad Sci U S A 49: 165–174, 2019 104: 2301–2306, 2007 8. Saito H, Tanaka T, Sugahara M, Tanaka S, Fukui K, Wakashima T, et al.: 27. Yamauchi T, Kadowaki T: Adiponectin receptor as a key player in Inhibition of prolyl hydroxylase domain (PHD) by JTZ-951 reduces healthy longevity and obesity-related diseases. Cell Metab 17: obesity-related diseases in the liver, white adipose tissue, and kidney in 185–196, 2013 mice with a high-fat diet. Lab Invest 99: 1217–1232, 2019 28. Fuentes E, Fuentes F, Vilahur G, Badimon L, Palomo I: Mechanisms of 9. Provenzano R, Besarab A, Sun CH, Diamond SA, Durham JH, Cangiano chronic state of inflammation as mediators that link obese adipose tissue JL, et al.: Oral hypoxia-inducible factor prolyl hydroxylase inhibitor and metabolic syndrome. Mediators Inflamm 2013: 136584, 2013 roxadustat (FG-4592) for the treatment of anemia in patients with CKD. 29. Declèves AE, Mathew AV, Cunard R, Sharma K: AMPK mediates the Clin J Am Soc Nephrol 11: 982–991, 2016 initiation of kidney disease induced by a high-fat diet. JAmSoc 10. Provenzano R, Besarab A, Wright S, Dua S, Zeig S, Nguyen P, et al.: Nephrol 22: 1846–1855, 2011 Roxadustat (FG-4592) versus epoetin alfa for anemia in patients re- 30. Tesch GH: MCP-1/CCL2: A new diagnostic marker and therapeutic ceiving maintenance hemodialysis: A phase 2, randomized, 6- to target for progressive renal injury in diabetic nephropathy. Am J Physiol 19-week, open-label, active-comparator, dose-ranging, safety and Renal Physiol 294: F697–F701, 2008 exploratory efficacy study. Am J Kidney Dis 67: 912–924, 2016 31. Haller H, Bertram A, Nadrowitz F, Menne J: Monocyte chemoattractant 11. Chen RL, Ogunshola OO, Yeoh KK, Jani A, Papadakis M, Nagel S, et al.: protein-1 and the kidney. Curr Opin Nephrol Hypertens 25: 42–49, 2016 HIF prolyl hydroxylase inhibition prior to transient focal cerebral is- 32. Chow FY, Nikolic-Paterson DJ, Ozols E, Atkins RC, Rollin BJ, Tesch GH: chaemia is neuroprotective in mice. J Neurochem 131: 177–189, 2014 Monocyte chemoattractant protein-1 promotes the development of 12. Vogler M, Zieseniss A, Hesse AR, Levent E, Tiburcy M, Heinze E, et al.: diabetic renal injury in streptozotocin-treated mice. Kidney Int 69: Pre- and post-conditional inhibition of prolyl-4-hydroxylase domain 73–80, 2006 enzymes protects the heart from an ischemic insult. Pflugers Arch 467: 33. Min D, Lyons JG, Bonner J, Twigg SM, Yue DK, McLennan SV: Me- 2141–2149, 2015 sangial cell-derived factors alter monocyte activation and function 13. Rahtu-Korpela L, Määttä J, Dimova EY, Hörkkö S, Gylling H, through inflammatory pathways: Possible pathogenic role in diabetic Walkinshaw G, et al.: Hypoxia-inducible factor prolyl 4-hydroxylase-2 nephropathy. Am J Physiol Renal Physiol 297: F1229–F1237, 2009 inhibition protects against development of atherosclerosis. Arte- 34. Cheng J, Diaz Encarnacion MM, Warner GM, Gray CE, Nath KA, rioscler Thromb Vasc Biol 36: 608–617, 2016 Grande JP: TGF-b1 stimulates monocyte chemoattractant protein-1 14. Matsumoto M, Makino Y, Tanaka T, Tanaka H, Ishizaka N, Noiri E, et al.: expression in mesangial cells through a phosphodiesterase isoenzyme Induction of renoprotective gene expression by cobalt ameliorates is- 4-dependent process. Am J Physiol Cell Physiol 289: C959–C970, 2005 chemic injury of the kidney in rats. J Am Soc Nephrol 14: 1825–1832, 2003 35. Salt IP, Hardie DG: AMP-activated protein kinase: An ubiquitous sig- 15. Kapitsinou PP, Sano H, Michael M, Kobayashi H, Davidoff O, Bian A, naling pathway with key roles in the cardiovascular system. Circ Res et al.: Endothelial HIF-2 mediates protection and recovery from is- 120: 1825–1841, 2017 chemic kidney injury. JClinInvest124: 2396–2409, 2014 36. Okada-Iwabu M, Yamauchi T, Iwabu M, Honma T, Hamagami K, 16. Yang Y, Yu X, Zhang Y, Ding G, Zhu C, Huang S, et al.: Hypoxia- Matsuda K, et al.: A small-molecule AdipoR agonist for type 2 diabetes inducible factor prolyl hydroxylase inhibitor roxadustat (FG-4592) and short life in obesity. Nature 503: 493–499, 2013 protects against cisplatin-induced acute kidney injury. Clin Sci (Lond) 37. Chow FY, Nikolic-Paterson DJ, Ma FY, Ozols E, Rollins BJ, Tesch GH: 132: 825–838, 2018 Monocyte chemoattractant protein-1-induced tissue inflammation is 17. Kimura K, Iwano M, Higgins DF, Yamaguchi Y, Nakatani K, Harada K, critical for the development of renal injury but not type 2 diabetes in et al.: Stable expression of HIF-1a in tubular epithelial cells promotes obese db/db mice. Diabetologia 50: 471–480, 2007 interstitial fibrosis. Am J Physiol Renal Physiol 295: F1023–F1029, 2008 38. de Zeeuw D, Bekker P, Henkel E, Hasslacher C, Gouni-Berthold I, 18. Nordquist L, Friederich-Persson M, Fasching A, Liss P, Shoji K, Nangaku Mehling H, et al.CCX140-B Diabetic Nephropathy Study Group;: The M, et al.: Activation of hypoxia-inducible factors prevents diabetic ne- effect of CCR2 inhibitor CCX140-B on residual albuminuria in patients phropathy. J Am Soc Nephrol 26: 328–338, 2015 with type 2 diabetes and nephropathy: A randomised trial. Lancet Di- 19. Nayak BK, Shanmugasundaram K, Friedrichs WE, Cavaglierii RC, Patel abetes Endocrinol 3: 687–696, 2015 M, Barnes J, et al.: HIF-1 mediates renal fibrosis in OVE26 type 1 di- 39. Mojsilovic-Petrovic J, Callaghan D, Cui H, Dean C, Stanimirovic DB, Zhang abetic mice. Diabetes 65: 1387–1397, 2016 W: Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia- 20. Hudkins KL, Pichaiwong W, Wietecha T, Kowalewska J, Banas MC, stimulated expression of monocyte chemoattractant protein-1 (MCP-1/ Spencer MW, et al.: BTBR Ob/Ob mutant mice model progressive di- CCL2) and MCP-5 (Ccl12) in astrocytes. J Neuroinflammation 4: 12, 2007 abetic nephropathy. J Am Soc Nephrol 21: 1533–1542, 2010 40. Bosco MC, Puppo M, Pastorino S, Mi Z, Melillo G, Massazza S, et al.: 21. Tanaka S, Sugiura Y, Saito H, Sugahara M, Higashijima Y, Yamaguchi J, Hypoxia selectively inhibits monocyte chemoattractant protein-1 pro- et al.: Sodium-glucose cotransporter 2 inhibition normalizes glucose duction by macrophages. J Immunol 172: 1681–1690, 2004
16 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH
41. Li X, Kimura H, Hirota K, Sugimoto H, Yoshida H: Hypoxia reduces 55. Delimont D, Dufek BM, Meehan DT, Zallocchi M, Gratton MA, Phillips constitutive and TNF-a-induced expression of monocyte chemo- G, et al.: Laminin a2-mediated focal adhesion kinase activation triggers attractant protein-1 in human proximal renal tubular cells. Biochem Alport glomerular pathogenesis. PLoS One 9: e99083, 2014 Biophys Res Commun 335: 1026–1034, 2005 56. McLennan SV, Kelly DJ, Schache M, Waltham M, Dy V, Langham RG, 42. Kobayashi H, Gilbert V, Liu Q, Kapitsinou PP, Unger TL, Rha J, et al.: et al.: Advanced glycation end products decrease mesangial cell MMP- Myeloid cell-derived hypoxia-inducible factor attenuates inflammation 7: A role in matrix accumulation in diabetic nephropathy? Kidney Int 72: in unilateral ureteral obstruction-induced kidney injury. J Immunol 188: 481–488, 2007 5106–5115, 2012 57. Matsuura H, Ichiki T, Inoue E, Nomura M, Miyazaki R, Hashimoto T, et al.: 43. Mole DR, Blancher C, Copley RR, Pollard PJ, Gleadle JM, Ragoussis J, Prolyl hydroxylase domain protein 2 plays a critical role in diet-induced et al.: Genome-wide association of hypoxia-inducible factor (HIF)-1a obesity and glucose intolerance. Circulation 127: 2078–2087, 2013 and HIF-2a DNA binding with expression profiling of hypoxia-inducible 58. Choe SS, Shin KC, Ka S, Lee YK, Chun JS, Kim JB: Macrophage HIF-2a transcripts. J Biol Chem 284: 16767–16775, 2009 ameliorates adipose tissue inflammation and insulin resistance in 44. Shi H, Kokoeva MV, Inouye K, Tzameli I, Yin H, Flier JS: TLR4 links innate obesity. Diabetes 63: 3359–3371, 2014 immunity and fatty acid-induced insulin resistance. J Clin Invest 116: 59. Alnaeeli M, Raaka BM, Gavrilova O, Teng R, Chanturiya T, Noguchi CT: 3015–3025, 2006 Erythropoietin signaling: A novel regulator of white adipose tissue in- 45. Ahmad R, Al-Roub A, Kochumon S, Akther N, Thomas R, Kumari M, flammation during diet-induced obesity. Diabetes 63: 2415–2431, 2014 et al.: The synergy between palmitate and TNF-a for CCL2 production 60. Teng R, Gavrilova O, Suzuki N, Chanturiya T, Schimel D, Hugendubler is dependent on the TRIF/IRF3 pathway: Implications for metabolic L, et al.: Disrupted erythropoietin signalling promotes obesity and al- inflammation. J Immunol 200: 3599–3611, 2018 ters hypothalamus proopiomelanocortin production. Nat Commun 2: 46. Cunha DA, Hekerman P, Ladrière L, Bazarra-Castro A, Ortis F, 520, 2011 Wakeham MC, et al.: Initiation and execution of lipotoxic ER stress in 61. Kodo K, Sugimoto S, Nakajima H, Mori J, Itoh I, Fukuhara S, et al.: pancreatic b-cells. J Cell Sci 121: 2308–2318, 2008 Erythropoietin (EPO) ameliorates obesity and glucose homeostasis by 47. Chen J, Guo Y, Zeng W, Huang L, Pang Q, Nie L, et al.: ER stress triggers promoting thermogenesis and endocrine function of classical brown MCP-1 expression through SET7/9-induced histone methylation in the adipose tissue (BAT) in diet-induced obese mice. PLoS One 12: kidneys of db/db mice. Am J Physiol Renal Physiol 306: F916–F925, 2014 e0173661, 2017 48. Cammisotto PG, Bendayan M: Adiponectin stimulates phosphorylation 62. Caillaud C, Mechta M, Ainge H, Madsen AN, Ruell P, Mas E, et al.: of AMP-activated protein kinase a in renal glomeruli. JMolHistol39: Chronic erythropoietin treatment improves diet-induced glucose in- 579–584, 2008 tolerance in rats. JEndocrinol225: 77–88, 2015 49. Sharma K, Ramachandrarao S, Qiu G, Usui HK, Zhu Y, Dunn SR, et al.: 63. Hosogai N, Fukuhara A, Oshima K, Miyata Y, Tanaka S, Segawa K, et al.: Adiponectin regulates albuminuria and podocyte function in mice. Adipose tissue hypoxia in obesity and its impact on adipocytokine JClinInvest118: 1645–1656, 2008 dysregulation. Diabetes 56: 901–911, 2007 50. Kim Y, Lim JH, Kim MY, Kim EN, Yoon HE, Shin SJ, et al.: The adipo- 64.YeJ,GaoZ,YinJ,HeQ:Hypoxiaisapotentialriskfactorforchronic nectin receptor agonist AdipoRon ameliorates diabetic nephropathy in inflammation and adiponectin reduction in adipose tissue of ob/ob a model of type 2 diabetes. J Am Soc Nephrol 29: 1108–1127, 2018 and dietary obese mice. Am J Physiol Endocrinol Metab 293: 51. McMahan RS, Birkland TP, Smigiel KS, Vandivort TC, Rohani MG, E1118–E1128, 2007 Manicone AM, et al.: Stromelysin-2 (MMP10) moderates inflammation 65. Rave K, Nosek L, Posner J, Heise T, Roggen K, van Hoogdalem EJ: by controlling macrophage activation. J Immunol 197: 899–909, 2016 Renal glucose excretion as a function of blood glucose concentration in 52. Rohani MG, McMahan RS, Razumova MV, Hertz AL, Cieslewicz M, Pun SH, subjects with type 2 diabetes--results of a hyperglycaemic glucose et al.: MMP-10 regulates collagenolytic activity of alternatively activated clamp study. Nephrol Dial Transplant 21: 2166–2171, 2006 resident macrophages. JInvestDermatol135: 2377–2384, 2015 66. Ogoshi Y, Matsui T, Mitani I, Yokota M, Terashita M, Motoda D, et al.: 53. Koller FL, Dozier EA, Nam KT, Swee M, Birkland TP, Parks WC, et al.: Discovery of JTZ-951: A HIF prolyl hydroxylase inhibitor for the treat- Lack of MMP10 exacerbates experimental colitis and promotes de- ment of renal anemia. ACS Med Chem Lett 8: 1320–1325, 2017 velopment of inflammation-associated colonic dysplasia. Lab Invest 92: 67. Fukui K, Shinozaki Y, Kobayashi H, Deai K, Yoshiuchi H, Matsui T, et al.: 1749–1759, 2012 JTZ-951 (enarodustat), a hypoxia-inducibe factor prolyl hydroxylase 54. Toni M, Hermida J, Goñi MJ, Fernández P, Parks WC, Toledo E, et al.: inhibitor, stabilizes HIF-a protein and induces erythropoiesis without Matrix metalloproteinase-10 plays an active role in microvascular com- effects on the function of vascular endothelial growth factor. Eur plications in type 1 diabetic patients. Diabetologia 56: 2743–2752, 2013 J Pharmacol 859: 172532, 2019
AFFILIATIONS
1Division of Nephrology and Endocrinology, 4Division of Chronic Kidney Disease Pathophysiology, and 5Department of Diabetes and Metabolic Diseases, The University of Tokyo Graduate School of Medicine, Tokyo, Japan; 2Biological and Pharmacological Laboratories, Central Pharmaceutical Research Institute, Japan Tobacco Inc., Osaka, Japan; and 3Department of Analytic Human Pathology, Nippon Medical School, Tokyo, Japan
JASN 31: ccc–ccc,2020 PHD Inhibitors in Obesity-Related Kidney Disease 17 Table of Contents
Supplemental Figure 1. Enarodustat did not reduce glomerular hypertrophy or mesangial expansion.
Supplemental Figure 2. Enarodustat tended to decrease macrophage infiltration in the tubulointerstitium, but Ccl2/Mcp1 mRNA expression in the kidney cortex was unchanged.
Supplemental Figure 3. Glomerular expression of MMP-10 was suppressed in enarodustat-treated BTBR ob/ob mice, but its expression in cultured mesangial cells was not affected by enarodustat or AdipoRon.
Supplemental Figure 4. Enarodustat did not change the expression levels of metabolism-related genes or M1/M2 macrophage markers in white adipose tissue.
Supplemental Figure 5. The urinary glucose levels did not differ significantly between vehicle-only and enarodustat-treated groups.
Supplemental Table 1. Hematocrit and intake of BTBR ob/ob mice treated with different doses of enarodustat.
Supplemental Table 2. List of primers used in this study. A
wild type ob/ob vehicle ob/ob enarodustat
30 μm
B C
10000 N.S. 50 *** N.S. (%) ) 2 *** 8000
(μm 40
6000 30 positive area/GTA 4000 - 20
Glomerular tuft area tuft Glomerular 2000 10 Collagen IV 0 0 wild type ob/ob vehicle ob/ob enarodustat wild type ob/ob vehicle ob/ob enarodustat
Supplemental Figure 1. Enarodustat did not reduce glomerular hypertrophy or mesangial expansion. (A) Representative images of collagen IV staining of kidney. (B) Glomerular tuft area (GTA) was measured in 10 glomeruli per mouse. (C) The percentage of collagen IV- positive area within each glomerulus was measured as the index of mesangial expansion. Ten randomly chosen glomeruli were evaluated per mouse. Data are expressed as means ± SEM; wild type, n = 5; ob/ob vehicle, n = 6; ob/ob enarodustat, n = 7. ***p < 0.001, N.S. not significant. A
wild type ob/ob vehicle ob/ob enarodustat
50 μm
B p = 0.111 20 * N.S.
15 15 (/field)
10
10 expression mRNA positive cells 5
5 Ccl2/Mcp1 F4/80 - in kidney the (AU) cortex Relative 0 0 wild type ob/ob vehicle ob/ob enarodustat ob/ob vehicle ob/ob enarodustat
Supplemental Figure 2. Enarodustat tended to decrease macrophage infiltration in the tubulointerstitium, but Ccl2/Mcp1 mRNA expression in the kidney cortex was unchanged. (A) Representative images of F4/80 staining of kidney. The numbers of F4/80-positive cells were evaluated in 10 randomly chosen fields per mouse. (B) The mRNA expression levels of Ccl2/Mcp1 in the kidney cortex, shown as means relative to wild type after normalization to Actb (β-actin). Ccl2, C-C motif chemokine ligand 2; Mcp1, monocyte chemoattractant protein-1. Data are expressed as means ± SEM; wild type, n = 5; ob/ob vehicle, n = 6; ob/ob enarodustat, n = 7. *p < 0.05, N.S. not significant. A Mmp10
0.8
0.6
0.4
0.2 Normalized value Normalized expression
0 wild type ob/ob vehicle ob/ob enarodustat
B C 16 18 N.S. N.S. *** 14 *** 16
12 14
10 12 10 8 mRNA (AU) mRNA mRNA (AU) mRNA 8 6 6 Mmp10 4 Mmp10 4 2 2
0 0 palmitate (100 μM) - + + palmitate (100 μM) - + + enarodustat (10 μM) - - + AdipoRon (10 μM) - - +
Supplemental Figure 3. Glomerular expression of MMP-10 was suppressed in enarodustat- treated BTBR ob/ob mice, but its expression in cultured mesangial cells were not affected by enarodustat or AdipoRon (a small molecule adiponectin receptor agonist). (A) Normalized expression values of Mmp10 in the glomeruli of BTBR wild type and BTBR ob/ob mice treated with either vehicle-only or enarodsutat. The expression levels were obtained from the transcriptome analysis (n = 3 for each group). (B) Quantitative real-time PCR was performed to assess mRNA expression levels of Mmp10 in murine mesangial cells after 12-hour stimulation by palmitate, with or without enarodustat (n = 5-6 for each group). (C) The mRNA expression levels of Mmp10 in murine mesangial cells after 12-hour stimulation by palmitate, with or without AdipoRon (n = 4-5 for each group). The mRNA expression levels are shown as means relative to the control after normalization to Actb (β-actin). ***p < 0.001, N.S. not significant. A Metabolism-related genes
10 ob/ob vehicle ob/ob enarodustat
8
6
4 (Relative to wild to type) (Relative mRNA (AU) expression mRNA
2
0
Glut1 Glut4 Hk1 Pfkl Pgk1 Ldha Pdk1 Pdk4 Pparγ Pparα Lipe Pnpla2
B M1 markers C M2 markers
40 ob/ob vehicle ob/ob vehicle 20 ob/ob enarodustat ob/ob enarodustat 30 15 type)
wild 20 to 10 (Relative to wild type) (Relative mRNA (AU) expression mRNA mRNA (AU) expression mRNA 10 5
0 0
Itgax Tnfα Nos2 Mrc1 Cd163 Arg1 (CD11c) (iNOS)
Supplemental Figure 4. Enarodustat did not change the expression levels of metabolism- related genes or M1/M2 macrophage markers in white adipose tissue. Quantitative real-time PCR was performed to analyze mRNA levels of metabolism-related genes (A), M1 macrophage markers (B), and M2 macrophage markers (C) in WAT. Glut1, glucose transporter type 1; Glut4, glucose transporter type 4; Hk1, hexokinase-1; Pfkl, phosphofructokinase; Pgk1, phosphoglycerate kinase-1; Ldha, lactate dehydrogenase; Pdk1, pyruvate dehydrogenase kinase 1; Pdk4, pyruvate dehydrogenase kinase 4; Pparγ and Pparα, peroxisome proliferator-activated receptors γ and α; Lipe, hormone-sensitive lipase; Pnpla2, patatin-like phospholipase domain-containing protein 2; Itgax, integrin alpha X; Tnfα, tissue necrosis factor-α; Nos2, nitric oxide synthase 2; Mrc2, mannose receptor c-type 1; Arg1, Arginase 1. The mRNA expression levels are shown as means relative to wild type mice after normalization to Actb (β-actin) ± SEM; wild type, n = 5; ob/ob vehicle, n = 6; ob/ob enarodustat, n = 7. 4000 ) 3000 mgCr
2000 Urinary glucose (mg/ 1000
ob/ob vehicle ob/ob enarodustat 0 10 16 22
Age (weeks)
Supplemental Figure 5. The urinary glucose levels did not differ significantly between vehicle-only and enarodustat-treated groups. Urinary glucose of BTBR ob/ob mice treated with either vehicle-only or enarodustat at 10, 16, and 22 weeks of age. Data are expressed as means ± SEM; ob/ob vehicle, n = 6; ob/ob enarodustat, n = 7. Supplemental Table 1. Hematocrit and intake of BTBR ob/ob mice treated with different doses of enarodustat.
Hematocrit (%) Intake (g/day) vehicle 46.8 ± 0.9 10.9 ± 0.2 0.015 mg/g 45.4 ± 0.4 - 0.05 mg/g 49.5 ± 0.7* 10.6 ± 0.1 0.15 mg/g 65.3 ± 1.4*** 8.2 ± 0.1***
Data are expressed as means ± SEM. Hematocrit was measured at 22 weeks of age. Intake was measured at 20 weeks of age. *p < 0.05, ***p < 0.001 compared to the vehicle-only group. Supplemental Table 2. List of primers used in this study.
Gene F/R Sequence (5'→3') Actb Forward AAGATCAAGATCATTGCTCCTCCT Reverse AAACGCAGCTCAGTAACAGTCC Arg1 Forward TTTTTCCAGCAGACCAGCTT Reverse GGAACCCAGAGAGAGCATGA Ccl2/Mcp1 Forward CAGCTCTCTCTTCCTCCACCAC Reverse GCGTTAACTGCATCTGGCTGAG Cd163 Forward TCTCCTGGTTGTAAAAGGTTTGT Reverse TCATTCATGCTCCAGCCGTT Glut1 Forward GTGACGATCTGAGCTACGGG Reverse ACTCCTCAATAACCTTCTGGGG Glut4 Forward CTTATTGCAGCGCCTGAGTC Reverse GGGGGTTCCCCATCGTCAG Hk1 Forward CTGCTCACCAGGGCTACTG Reverse CCCTTTTCTGAGCCGTCCG Hif-1α Forward GTTTACTAAAGGACAAGTCACC Reverse TTCTGTTTGTTGAAGGGAG Hif-2α Forward GTCACCAGAACTTGTGC Reverse CAAAGATGCTGTTCATGG Il1β Forward ACTGTGAAATGCCACCTTTTG Reverse TGTTGATGTGCTGCTGTGAG Il10 Forward GGCGCTGTCATCGATTTCTC Reverse ATGGCCTTGTAGACACCTTGG Il6 Forward ACAAAGCCAGAGTCCTTCAGAGAG Reverse TTGGATGGTCTTGGTCCTTAGCCA Itgax Forward GCTGTTGGCTTGTGGTCCTA Reverse AACTGCATCAGGGAGAACCG Lipe Forward CAGAAGGCACTAGGCGTGATG Reverse GGGCTTGCGTCCACTTAGTTC Ldha Forward GGATGAGCTTGCCCTTGTTGA Reverse GACCAGCTTGGAGTTCGCAGTTA Mmp10 Forward ACTGGAGATTTGATGAGACAAGAC Reverse GTCCTGGCATTGGGGTCAAA Mrc1 Forward TGGATGGATGGGAGCAAAGT Reverse AATGCCAACCTTCCTTGCAG Nos2 Forward CACCTTGGAGTTCACCCAGT Reverse ACCACTCGTACTTGGGATGC Pdk1 Forward GCTACGGGACAGATGCGGTTA Reverse CAGGCGGCTTTATTGTACACAGG Pdk4 Forward AGCTGCTGGACTTTGGTTCA Reverse TGCCTTGAGCCATTGTAGGG Pfkl Forward CAAACCGGGTACACAGGCAG Reverse AGCATTCATACCTTGCGCATC Pgk1 Forward GGAGCGGGTCGTGATGA Reverse GCCTTGATCCTTTGGTTGTTTG Pnpla2 Forward CAACGCCACTCACATCTACGG Reverse GGACACCTCAATAATGTTGGCAC Pparα Forward CTGCAGAGCAACCATCCAGAT Reverse GCCGAAGGTCCACCATTTT Pparγ Forward GCCCACCAACTTCGGAATC Reverse TGCGAGTGGTCTTCCATCAC Tgfβ Forward GGACTCTCCACCTGCAAGAC Reverse CATAGATGGCGTTGTTGCGG Tnfα Forward ACGTCGTAGCAAACCACCAA Reverse ACAAGGTACAACCCATCGGC