Reduced Expression of Glutathione S-Transferase Α4 Promotes Vascular Neointimal Hyperplasia In

BASIC RESEARCH www.jasn.org

Reduced Expression of Glutathione S-Transferase a4 Promotes Vascular Neointimal Hyperplasia in CKD

Jinlong Luo,1,2 Guang Chen,2,3 Ming Liang,2,4 Aini Xie,2 Qingtian Li,2 Qunying Guo,2 Rajendra Sharma,3 and Jizhong Cheng2

1Department of Emergency, Tongji Hospital, Huazhong University of Science and Technology, Wuhan, China; 2Selzman Institute for Kidney Health, Section of Nephrology, Department of Medicine, Baylor College of Medicine, Houston, Texas; 3Department of Integrative Traditional Chinese & Western Medicine, Tongji Hospital, Tongji Medical College, Huazhong University of Science & Technology, Wuhan, China; and 4Department of Nephrology, Guangzhou First People’s Hospital, Guangzhou Medical University, China

ABSTRACT Neointima formation is the leading cause of arteriovenous ﬁstula (AVF) failure. We have shown that CKD accelerates this process by transforming the vascular smooth muscle cells (SMCs) lining the AVF from a contractile to the synthetic phenotype. However, the underlying mechanisms affecting this transformation are not clear. Previous studies have shown that the a-class glutathione transferase isozymes have an important role in regulating 4-hydroxynonenal (4-HNE)–mediated proliferative signaling of cells. Here, using both the loss- and gain-of-function approaches, we investigated the role of glutathione S-transferase a4 (GSTA4) in modulating cellular 4-HNE levels for the transformation and proliferation of SMCs. Com- pared with non-CKD controls, mice with CKD had downregulated expression of GSTA4 at the mRNA and protein levels, with concomitant increase in 4-HNE in arteries and veins. This effect was associated with upregulated phosphorylation of MAPK signaling pathway proteins in proliferating SMCs. Overexpressing GSTA4 blocked 4-HNE–induced SMC proliferation. Additionally, inhibitors of MAPK signaling inhibited the 4-HNE–induced responses. Compared with wild-type mice, mice lacking GSTA4 exhibited increased CKD-induced neointima formation in AVF. Transient expression of an activated form of GSTA4, achieved using a combined Tet-On/Cre induction system in mice, lowered levels of 4-HNE and reduced the proliferation of SMCs. Together, these results demonstrate the critical role of GSTA4 in blocking CKD- induced neointima formation and AVF failure.

J Am Soc Nephrol 29: 505–517, 2018. doi: https://doi.org/10.1681/ASN.2017030290

The success of hemodialysis depends on a function- Thus, AVF is an Achilles heel for patients on hemo- ing arteriovenous ﬁstula (AVF), but in the 2 years dialysis.5 It can amount to .$1 billion per year in since its creation, nearly 50% fail, generally due to surgical and radiologic interventions.6 We have accumulation of vascular smooth muscle cells shown that dedifferentiation and proliferation of (SMCs) and the formation of a neointima.1–4

Signiﬁcance Statement Received March 16, 2017. Accepted September 27, 2017. Neointima formation is the leading cause of arteriove- J.L. and G.C. contributed equally to this work. nous ﬁstula (AVF) failure. This article reports evidence that loss of glutathione S-transferase a4 in CKD causes Published online ahead of print. Publication date available at the accumulation of 4-hydroxynonenal, which in turn, www.jasn.org. stimulates proliferation of vascular smooth muscle cells. Correspondence: Dr. Jizhong Cheng, Department of Medicine, These responses result in neointima formation and ac- Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030. celerate AVF failure. Increasing glutathione S-transferase Email: [email protected] a4 expression may provide a protective strategy to improve AVF maturation. Copyright © 2018 by the American Society of Nephrology

J Am Soc Nephrol 29: 505–517, 2018 ISSN : 1046-6673/2902-505 505 BASIC RESEARCH www.jasn.org the SMCs plays a major role in neointima formation, and GSTA4 expression (Figure 1E). In arteries, CKD decreased serves as a trigger for the transition from a contractive to the the GSTA4 protein (Figure 1F), accompanied by an increase synthetic status.7,8 in 4-HNE level and proteins bound by 4-HNE (Figure 1, G and CKD is recognized as one of the most consistent predictors H). We also found that CKD decreased the GSTA4 mRNA in of cardiovascular disease. We have found that CKD causes AVFs (Figure 1I). Moreover, immunofluorescence analysis in- an endothelial barrier dysfunction and extracellular matrix dicated that there was a strong GSTA4 expression in endothe- deposition around the peripheral vasculature.6,9 There is in- lial cells and SMCs in control AVFs, whereas GSTA4 level was creasing evidence to show that CKD also increases the pro- markedly decreased in AVFs from CKD mice (Figure 1J). More duction of reactive oxygen species (ROS).10,11 Formation of 4-HNE–positive signals were detected in AVFs from mice with ROS is a major cause of DNA damage that correlates well with CKD (Figure 1, K and L). several human diseases. Recent studies have shown that there is an increase in 4-hydroxynonenal (4-HNE) levels in kidney Deficiency of GSTA4 Leads to Loss of Quiescent Status disease.12 4-HNE is a highly reactive but stable aldehyde, gen- of SMCs erated during oxidative degradation of fatty acids such as ar- The above results indicate that CKD-induced SMC accumu- achidonic and linoleic acids.13 It has been shown to stimulate lation in the AVF could be associated with a decreased expres- cellular proliferation as well as to block cell terminal differen- sion of GSTA4. We then studied the effect of GSTA4 expression tiation.14,15 In fact, the reported association between levels of on SMC phenotype transition and proliferation. The segments 4-HNE and the magnitude of tumor promotion response from common carotid arteries and jugular vein were seeded suggests that 4-HNE–induced oxidative stress may play an onto plates, and cells outgrown from the artery or vein showed important role in the growth of cells. similar morphology and proliferation rates (Supplemental Normally, cellular 4-HNE is regulated by glutathione S- Figure 1). These outgrowing cells were positive for SMC mark- transferase a4 (GSTA4), a member of the a class of antioxidative ers calponin and SMA-a (Figure 2A). Compared with the qui- enzymes called the glutathione S-transferases (GSTs). The GSTs escent SMCs in the artery, expression of GSTA4 was dramatically play a major role in cellular detoxification. By catalyzing the ablated in the outgrowth SMCs. In contrast, proliferative mark- conjugation of 4-HNE with an important cellular thiol-glutathione ers PCNA and cyclin D1 were significantly increased in the out- and facilitating its exclusion out of the cells, GSTs are able to growth SMCs (Figure 2B). SMCs from GSTA4 KO mice grew protect cells against oxidative damage. Thus, by neutralizing the faster in ex vivo cultures compared with cells from wild-type reactive electrophilic sites and conjugating 4-HNE with gluta- (WT) mice, as measured at days 3 and 7 (Figure 2, C–E). thione, GSTA4 is a major regulator of cellular 4-HNE levels.16,17 Further, GSTA4 KO in venous SMCs resulted in increased In its absence, levels of 4-HNE increase and promote disease, Ki67-positive SMCs, and this progrowth response was blocked such as cancer and kidney disease.18,19 by overexpressing GSTA4 (Figure 2F). Finally, GSTA4 KO- Although it is well agreed that activated SMCs are a major induced expression of proliferation markers was found to be factor in neointima formation, the role of 4-HNE in CKD- inhibited in GSTA4-expressing SMCs (Figure 2G). Consis- induced AVF failure is poorly understood. In this study, we tently, GSTA4 KO in artery SMCs also increased the prolifer- created CKD and AVF mouse models in GSTA4 knockout ating cell number (Ki67+) and the expression of proliferation (GSTA4 KO) and inducible transgenic mice, and investigated markers (PCNA and cyclin D1), whereas overexpression of the potential role of GSTA4 in SMC activation and neointima GSTA4 blocked these responses (Supplemental Figure 2, A formation in AVFs. The downstream signals that mediate and B). Together, these results indicate that loss of GSTA4 these processes were also determined. expression is associated with gain of the synthetic phenotype in SMCs.

RESULTS GSTA4 KO Accelerates Neointima Formation AVFs were performed in WT and GSTA4 KO mice with or CKD Decreases Expression of GSTA4 in AVF without CKD. GSTA4 KO alone induced neointima forma- CKD was induced with subtotal nephrectomy. The levels of tion; there was more neointima formation and accumula- BUN and serum creatinine were significantly higher in uremic tion of SMA-a–positive cells in AVFs created in GSTA4 KO mice than those in control mice (Figure 1, A and B). There mice (Figure 3A). The lumen area and the ratio of lumen- was a significant induction of neointima formation and de- to-neointima area were significantly decreased in AVFs from creased ratio of lumen-to-neointima area in CKD compared GSTA4 KO mice with CKD compared with that from WT with control mice (Figure 1, C and D). GSTA4 is an antiox- mice with CKD (Figure 3, B and C). PCNA-positive cells were idative stress protein that plays a role in maintaining cellular found in the neointima area. Statistical analysis revealed that homeostasis. We measured levels of GSTA4 in jugular veins of although CKD increased the PCNA-positive cell numbers in control and CKD mice with or without AVF, and found that the neointima area of AVFs, there were more proliferating cells CKD decreased GSTA4 mRNA expression whereas AVF sur- (PCNA positive) in AVFs created in GSTA4 KO mice (Figure 3, D gery had no effect on CKD-mediated downregulation of and E).

506 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 505–517, 2018 www.jasn.org BASIC RESEARCH

Figure 1. CKD-induced neointima formation is associated with decreased GSTA4 expression in AVFs. (A and B) BUN and serum creatinine were detected in control (CTL) and CKD mice (n=6). (C) AVFs were created in control and CKD mice. The morphology of AVFs was analyzed by hematoxylin and eosin staining. Representative images from AVFs are presented. (D) The area of lumen and neointima were measured and the ratio of lumen-to-neointima was calculated (n=6). (E) Contralateral jugular veins were collected from control or CKD mice that had sham or AVF surgeries, and the mRNA levels of GSTA4 were determined by real-time RT-PCR (*P,0.05 versus control mice, n=6). (F) Arteries were collected from control or CKD mice that had sham or AVF surgeries, and the protein levels of GSTA4 were determined by Western blotting (*P,0.05 versus control mice, n=6). (G and H) The 4-HNE adduct levels in the artery were detected by ELISA (G) (*, P,0.05 versus control mice, n=6) and Western blotting (H). (I) RNAs were collected from AVFs created in control and CKD mice and the expression of GSTA4 was detected by real-time RT-PCR. (J) The expression of GSTA4 protein was determined by immunoﬂuorescence staining in AVFs. GSTA4 was colocalized with a-SMA in neointima cells in AVFs. (K and L) 4-HNE levels were detected by immunostaining in AVFs from control and CKD mice (K), and the density of the positive signal was analyzed (L) (n=6).

4-HNE Mediated Proliferation of SMCs (Figure 4, B and C). 4-HNE at doses of 1–5 mM also stimulated 4-HNE is the major substrate of GSTA4.20 We found that the expression of PCNA and cyclin D1 in SMCs (Figure 4D). GSTA4 KO mice have increased 4-HNE adduct levels in These responses were blocked by overexpression of GSTA4, AVFs (Figure 4A). Although the level of 4-HNE adducts in- but not by the vector control in SMCs (Figure 4, E and F). creased in the AVFs of uremic mice when compared with sham It has been reported that 4-HNE induces cell death. To de- control mice, 4-HNE levels were further upregulated in termine the effect of 4-HNE on apoptosis, mouse vein SMCs GSTA4 KO mice (Figure 4A). In cultured cells, treatment were treated with different doses of 4-HNE. Flow cytometry with 4-HNE induced an increase in total cell number of analysis showed that a high concentration of 4-HNE (20 mM) SMCs and Ki67-positive cells in a dose-dependent manner induces the annexin V exposure in SMCs (Supplemental

J Am Soc Nephrol 29: 505–517, 2018 4-Hydroxynonenal and CKD Risk 507 BASIC RESEARCH www.jasn.org

4-HNE–Induced SMC Proliferation Is Regulated through the MAPK Signaling Pathway MAPK signaling is one of the important factors in neointima formation in arteriovenous grafts or vascular injury.21–23 It can be upregulated under various stimuli.24 The MAPK pathway was investigated to ex- plain the mechanism of 4-HNE–induced SMC proliferation. Treatment with 4- HNE stimulated the phosphorylation of ERK1/2, p38, and JNK, which were specif- ically blocked by inhibitors U0126, SB202580, and SP600125, respectively (Figure5A).Because4-HNEinduces MAPK activation, we next tested whether MAPK mediates 4-HNE–induced SMC proliferation. We found that pretreatment with ERK and p38 inhibitors reduced 4- HNE–induced PCNA expression in SMCs, whereas the JNK inhibitor had no effect on 4-HNE–induced SMC proliferation (Figure 5B). p27kip1 blocks cell cycle progression and is located in the nucleus.25,26 In quiescent SMCs, treatment with 4-HNE led to a cytoplasmic translocation of p27kip1. However, treatment with an MEK inhibitor kept p27 kip1 in the nuclei even in the presence of 4-HNE (Figure 5C). Similar results were observed in Western blot analysis of the proteins isolated from the cytosol and nucleus (Figure 5D). These data indicate that 4-HNE–induced p27kip1 cytoplasmic Figure 2. Loss of GSTA4 promoted SMC phenotype switch from quiescent to synthetic translocation and proliferation are status. (A) Artery segments were cultured in DMEM complete medium for 7 days ex kip1 vivo; the outgrowth cells were characterized and stained positively with the SMC regulated through the MAPK/p27 markers a-SMA and calponin (original magnification, 3600). (B) Common carotid ar- signaling pathway. teries were dissected and half of the arteries were cultured and half were kept for later use. After 7 days, proteins from the artery and outgrowth SMCs were isolated and Tissue-Specific Induction of GSTA4 Western blotting was performed (n=3), depicting loss of GSTA4 expression and in- via a Combined Tetracycline-On/Cre creasing expression of PCNA and Cyclin D1 in the outgrowth SMCs. (C) No GSTA4 System protein was detected in arteries from GSTA4 KO mice. (D) Artery segments from WT To test whether overexpression of GSTA4 and GSTA4 KO mice were seeded onto 24-well plates and photographs were taken at can protect against CKD-induced AVF indicated time points. Representative pictures are presented. (E) The cell numbers in failure, we used both the tetracycline-on (D) were counted and summarized (*P,0.05 versus WT, n=5). (F and G) Mouse venous (Tet-On) system and the Cre-LoxP system SMCs from WT and GSTA4 KO mice were transfected with AdGSTA4 or GFP adenovirus. (F) Ki67 expression was detected by immunostaining (upper panel), and quanti- (Supplemental Figure 4A). A conditional tation analysis was performed of Ki67-positive cells from three experiments (lower panel). GSTA4 allele can be transactivated in a fi (G) Inhibition of the proliferation markers PCNA and Cyclin D1 in GSTA4 expressing SMCs tissue-speci c and doxycycline-dependent was determined by Western blotting. Representative data from three experiments are manner. We obtained four Tet-On-GSTA4 shown. *P,0.05 versus WT; #P,0.05 versus GSTA4 KO. transgenic founders. Two of the founders transmitted the transgene in a Mendelian Figure 3, A and B). Increased expression of Bax and activated fashion. To test the performance of the Tet-On-GSTA4 alleles, caspase 3 were only observed in cells that were treated with we bred founder Tet-On-GSTA4 transgenic mice with rtTA- 4-HNE at $20 mM for 24 hours (Supplemental Figure 3C). stop/SM22-Cre transgenic mice proven to be Cre-positive for These data indicate that exposure to different doses of 4-HNE SMCs.27 The triple transgenic mice in both lines showed an leads to different responses in SMCs. upregulation of GSTA4 expression in multiple organs after

508 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 505–517, 2018 www.jasn.org BASIC RESEARCH

administration (Figure 6, A and B). In veins, the peak in GSTA4 mRNA level was at 7 days, and the GSTA4 protein level in the arteries peaked at 2 weeks after doxycycline induction (Figure 6, A and B). Immu- nostaining analysis of arteries removed from triple transgenic GSTA4/rtTA- stop/SM22-Cre mice conﬁrmed that the GSTA4 transgene was expressed only in the SMC of the triple transgenic mice treated with doxycycline (Figure 6C). Ex- pression of GSTA4 in SMCs isolated from thetripletransgenicmicewasinducedby doxycycline in a dose- and time-dependent manner (Figure 6, D and E). Induced overexpression of GSTA4 by doxycycline inhibited 4-HNE–induced PCNA and cyclin D1 expression (Figure 6G). How- ever, withdrawing doxycycline from these triple transgenic mice decreased GSTA4 to baseline levels within 2 weeks (Figure 6F).

Conditional GSTA4 Transgenic Mice Inhibit CKD-Induced Neointima Formation Because the GSTA4 overexpression cassette was randomly inserted into the mouse ge- nome, we used two GSTA4 overexpression mouse lines (line 1 and line 2) to deter- mine the specific effect of GSTA4 on CKD- induced neointima formation in AVFs. AVFs were performed in WT and the two GSTA4 transgenic mice lines with or with- outCKD.The4-HNElevelsintheAVFs from mice with overexpression of GSTA4 were lower compared with that in controls (Figure 7A). The morphology showed that thicker walls and smaller lumens were found near the venous anastomosis area in Figure 3. Knocking out GSTA4 accelerated CKD-induced neointima formation. (A) AVFsin mice with CKD (Figure 7B). GSTA4 AVFs were created in WT and GSTA4 KO mice, with and without CKD. The mor- expression was increased in doxycycline- phology (hematoxylin and eosin) and a-SMA immunostaining were performed in the inducedtripletransgenicmiceandcos- 1-month-old AVFs. (B and C) The area of lumen and neointima were measured and the tained with SMA-a in neointima cells in ratio of lumen-to-neointima was calculated (*P,0.05 versus WT mice; #P,0.05 versus AVFs (data not shown). Overexpression of WT with CKD mice, n=6). (D and E) The proliferation marker PCNA was detected by GSTA4 in SMCs ameliorated neointima immunostaining in AVFs (D) (original magnification, 3400). (E) Cells depicting positive formation and accumulation of SMA- # staining were counted and summarized (*P,0.05 versus WT mice; P,0.05 versus WT a–positive cells in AVFs (Figure 7B). The with CKD mice, n=6). lumen area and the lumen-to-neointima area ratio were increased significantly in administration of doxycycline for 10 days, and the organs mice overexpressing GSTA4 (Figure 7, C and D). Fewer containing more SMCs (artery, intestine, and lung) PCNA-positive cells were found in the neointima in AVFs showed a higher level of induced GSTA4 expression (Supple- fromGSTA4transgenicmicewithCKD(Figure7,EandF),in- mental Figure 4B). Expression of GSTA4 was gradually indicating that a higher GSTA4 level results in lower SMC growth duced in veins and arteries from both lines after doxycycline potential.

J Am Soc Nephrol 29: 505–517, 2018 4-Hydroxynonenal and CKD Risk 509 BASIC RESEARCH www.jasn.org

neointima is critical for designing preven- tive therapeutic strategies. By using the loss- and gain-of-function approaches in transgenic mice, we demonstrate for the first time that GSTA4 is critical for the SMC phenotype transition, and can regulate the maturation of an AVF in CKD mice. The major finding from this study is that CKD decreases the expression of GSTA4. Loss of GSTA4 induced an accumulation of 4-HNE that formed 4-HNE adducts with proteins, and thereby interfered with normal protein function. MAPK was identified as a critical signaling pathway of 4-HNE, which triggered the p27kip1 cytoplasmic translocation and release from the cell cycle arrest, resulting in SMC proliferation. Further, the gain in functions of GSTA4 helped to maintain the SMC quiescent status and inhibit their migration and proliferation. Uremia is a state of increased oxidative stress characterized by circulating tissue proteins altered by oxidative activity.31 CKD is associated with accelerated atherosclerosis and cardiovascular disease, which is also largely mediated by oxidative stress and formation of ROS.32 ROS initiate a complex series of molecular events that may cause neointima formation. Earlier reports indicated that loss of the glutathione peroxidase 1 induced neointima formation through increased ROS production. This, in turn, led to vascular SMC proliferation and decreased endothelial regeneration in an arterial injury model.33 Although the uremic condition is Figure 4. Low dose of 4-HNE treatment stimulates SMC proliferation. (A) Increased 4- linked to AVF failure, the actual events affect- HNE adduct level in AVFs was detected by ELISA in GSTA4 KO mice, with or without ing the AVF during dialysis are compli- – CKD (*P,0.05 versus WT mice; #P,0.05 versus WT with CKD mice, n=6). (B and C) cated.34 37 Treatment with 4-HNE at indicated dose increased SMC numbers (B) and Ki67-positive 4-HNE is a highly reactive, unsaturated cells (C) (*P,0.05 versus no treatment, n=3). (D) 4-HNE induced a dose-dependent ex- hydroxyalkenal produced bylipid peroxida- pression of PCNA and Cyclin D1 in mouse SMCs (n=3). (E and F) Overexpression of tion in cells. A uremic toxin, spermine, – GSTA4 abolishes 4-HNE induced cell proliferation. SMCs were infected with AdGSTA4 increases 4-HNE and impairs glucose me- or GFP adenovirus before 4-HNE treatment, and the Ki67-positive cell number (E) and tabolism through reduction in pyruvate proliferation proteins (F) were detected by immunostaining and Western blotting, regeneration and transamination.38 CKD- spectively. Data shown was from three repeat experiments (*P,0.05 versus no treatment; #P,0.05 versus 4-HNE treatment only). associated oxidative species (e.g.,thead- vanced glycation end products) enhance DISCUSSION lipid peroxidation and, eventually, 4-HNE in tissues.39,40 There are two ways that 4-HNE exerts its effects on macro- AVF provides the best access for longevity and the lowest molecules: firstly, by direct binding with macromolecules to association with morbidity and mortality in patients on he- form 4-HNE adducts that interfere with the function of these modialysis.28 However, formation of neointima from prolif- molecules; and secondly, 4-HNE itself is an active oxidizing eration of SMCs is a hallmark of AVF failure.29,30 Among a molecule. We found that CKD induced formation of 4-HNE host of multiple factors, CKD is one of the most important adducts in the AVF (Figure 4A). Increased 4-HNE modifies factors that accelerates AVF failure. Hence, understanding the intracellular proteins, causing cytoskeletal disorganization mechanisms leading to SMCs accumulating in the forming and VE-cadherin dissociation and stimulating SMC

510 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 505–517, 2018 www.jasn.org BASIC RESEARCH

Figure 5. MAPK signaling pathway mediates 4-HNE-induced SMC proliferation. (A) SMCs were pretreated with U0126 (5 mM), SB203580 (10 mM), or SP600125 (5 mM) for 30 minutes before exposure to 4-HNE. The phosphorylation of MAPKs was detected by Western blotting. (B) SMCs were treated as above and the PCNA expression after 4-HNE treatment (24 hours later) was determined by Western blotting (*P,0.05 versus no treatment; #P,0.05 versus 4-HNE treatment only, n=3). (C and D) SMCs were seeded onto coverslips and treated as above, and the p27kip1 expression and localization were determined by immunofluorescence staining (C) (original magnification, 3600) and Western blotting (D). Representative data were shown from three repeated experiments. C, cytoplasm; N, nuclei. growth.41,42 The CKD-induced neointima formation is in in SMCs. On the other hand, under uremic conditions, expres- parallel with an increased 4-HNE levels in GSTA4 KO mice sion of GSTA4 is inhibited. Decreased GSTA4 expression is (Figures 4 and 7). This observation is supported by a previous linked with dysfunction of tubule cells and SMC activation. report, demonstrating higher 4-HNE levels in failed AVFs and We found that GSTA4 levels have an inverse relationship with expanded polytetrafluoroethylene grafts in patients.43 In- loss of the SMC quiescent status: abundant GSTA4 protein creased 4-HNE levels in patients with CKD was also one of expression was observed in normal vasculature (where the the factors that induced neointima formation in the vein it- SMCs and ECs are quiescent), however, when the artery or self.44 Taken together, these facts indicate that 4-HNE could vein was ex vivo cultured to activate the SMCs, the GSTA4 be a potential tool for alleviating the vascular complications of expression was dramatically decreased in the outgrowth CKD. SMCs (Figure 2). Thus, overexpression of GSTA4 can inhibit The a class isozyme GSTA4 exhibits a high catalytic effi- SMC proliferation and ameliorate CKD-induced neointima ciency toward 4-HNE. The normal level of GSTA4 expression formation in AVFs created in GSTA4 transgenic mice (Figure in tissues determines the concentration of 4-HNE. GSTA4 is a 7). Consistent with our findings, overexpression of human protein linked to cellular transformation; its expression level GSTA4 in carotid artery has been reported to prevent neoin- has been observed to be altered during podocyte differentiation tima formation after carotid allograft in rabbits.46 These results or cancer cell transformation.15,45 Under normal conditions, the confirm that GSTA4 expression suppresses SMC activation. body contains “protectors” including the redox-sensitive thiols, 4-HNE has been reported to phosphorylate EGFR and such as glutathione and phase 2 detoxifying proteins (e.g., thereby increase retinal epithelial cell growth.41 We found GSTA4), which function as putative sensors of oxidative stress that that 4-HNE increased MAPK activity and thus mediated

J Am Soc Nephrol 29: 505–517, 2018 4-Hydroxynonenal and CKD Risk 511 BASIC RESEARCH www.jasn.org

mentioning the importance of antioxidant transcription factor Nrf2 in the regulation of phase 2 enzymes, including GSTA4.50 Activation of Nrf2 in tissues can prevent the progression of CKD.51 However, the beneficial effects of antioxidant compounds to prevent the failure of AVF are yet to be evaluated. We believe that treatment with antioxidants before the placement of AVF could suppress SMC activation and neointima formation in AVFs. This study has several limitations: Firstly, BP data is missing because BP in CKD mice may affect the biologic and histologic changes in neointima formation in AVF. Secondly, the cultured cells do not completely mimic the high flow and shear stress environment in vivo.Thirdly,we found that although GSTA4 overexpression improves the lumen-to-neointima area in CKD mice, the level of lumen-to- neointima area ratio is still lower than that in AVFs from WT control mice, indicating that other factors, such as the changes in sheer stress of dynamic flow, could not be overcome by GSTA4 overexpression. Figure 6. Conditional inducible expression of GSTA4 inhibits SMC proliferation. (A In summary, GSTA4 is involved in the and B) Time-dependent expressions of GSTA4 in the veins (RT-PCR) and arteries CKD-induced acceleration of SMC prolif- (Western blot) were detected after doxycycline treatment (*, P ,0.05 versus no DOX eration and neointima formation. Under treatment, n=6). (C) GSTA4 expression was detected after doxycycline induction by uremic conditions, GSTA4 is inhibited double immunostaining of GSTA4 and a-SMA in SMCs in the common carotid artery and its substrate, 4-HNE, is upregulated, in WT and iGSTA4 transgenic mice (original magnification, 3400). (D and E) GSTA4 which leads to SMC proliferation. Further, expression was induced in cultured SMCs. SMCs from GSTA4/rtTA/SM22-Cre mice MAPK is the mediator of 4-HNE. Upregu- (iGSTA4) were isolated and the expression of GSTA4 was induced by doxycycline in a lated expression and activation of MAPK (D) dose- and (E) time-dependent manner. (F) GSTA4 overexpression was reduced lead to AVF failure. The proposed – after stop adding doxycycline. (G) Doxycycline treatment blocks 4-HNE induced ex- 4-HNE/MAPK signaling pathway in pression of the proliferation markers. Representative data were shown from three GSTA4 KO mice with CKD will advance repeated experiments. our understanding on SMC activation and neointima formation, and could be ex- the translocation of p27kip1 out of the nucleus and into the ploited as a target for development of medicines that could help cytoplasm, and after its degradation, cell cycle progression in to control CKD-induced AVF failures. SMCs was promoted.47 Moreover, in studies conducted in GSTA4 KO mice, there was an increased 4-HNE leading to MAPK, SMC proliferation, and neointima formation in CONCISE METHODS AVFs. These results indicate that CKD-mediated alteration of GSTA4 expression is associated with neointima formation. Reagents On the basis of our findings in this study, one of the ther- Penicillin, streptomycin, DMEM, and FBS were obtained from Invi- apeutic strategies to attenuate CKD-induced neointima trogen Life Technologies (Carlsbad, CA). The protein assay kit was formation in AVFs could be the induction of GSTA4 by anti- from Bio-Rad (Hercules, CA). The anti-mouse GSTA4 antibody was oxidants and chemopreventive agents. Several antioxidants, generated from rabbit.19 The antibodies against pERK1/2, pp38, such as butylated hydroxyanisole and butyrate, have been pJNK, and cyclin D1, MEK inhibitor U0126 were purchased from shown to induce GSTA4 in cell culture and animal models.48 Cell Signaling Technology (Beverly, MA). The antibodies against Dietary chemopreventive agents, including sulforaphane, a-SMA, caspase 3, and p27kip1 were purchased from Abcam (Cam- benzyl isothiocyanate, and some flavones, have been shown bridge, MA); the antibodies against PCNA, calponin, GAPDH, and to induce GSTA4.48,49 Additionally, it is also worth the secondary antibodies horseradish peroxidase–linked anti-mouse

512 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 505–517, 2018 www.jasn.org BASIC RESEARCH

Figure 7. Overexpression of GSTA4 in SMCs suppresses neointima formation in AVF. CKD and AVFs were performed in WT or GSTA4 transgenic mouse lines. Doxycycline was applied 7 days before the AVF surgery. (A) The levels of 4-HNE adducts in AVFs were detected in GSTA4 overexpression mice (*P,0.05 versus WT without CKD mice; #P,0.05 versus WT with CKD mice, n=6). (B) The AVFs were collected after 1 month, and hematoxylin and eosin and a-SMA immunostaining were performed (n=6) (original magniﬁcation, 3400). (C and D) The area of lumen and neointima were measured and summarized (C), and the ratio of lumen-to-neointima area was calculated (D) (*P,0.05 versus WT without CKD mice; #P,0.05 versus WT with CKD mice, n=6). (E and F) Immunostaining of PCNA was detected and shown in brown color in these AVFs (E) (original magniﬁcation, 3400), and the PCNA-positive cells were counted and summarized (F) (*P,0.05 versus WT without CKD mice; #P,0.05 versus WT with CKD mice, n=6).

IgG and anti-rabbit IgG, were purchased from Santa Cruz Biotech- Calbiochem (Gibbstown, NJ). The doxycycline hyclate and Bax an- nology (Santa Cruz, CA). The anti–Ki67-Alexa Fluor 565 antibody tibody were purchased from Sigma-Aldrich (St. Louis, MO). The was from BD Bioscience (San Jose, CA). The MAPK p38 inhibitor adenovirus mGSTA4 expression vector was constructed by inserting (SB203580) and JNK inhibitor (SP600125) were obtained from mGSTA4 cDNA into pTracker-CMV vector as reported previously.19

J Am Soc Nephrol 29: 505–517, 2018 4-Hydroxynonenal and CKD Risk 513 BASIC RESEARCH www.jasn.org

Flow Cytometry and Apoptosis 2. rtTA-EGFP transgenic mice (Jackson Laboratory), in which the Cell apoptosis was assessed using the annexin V-FITC apoptosis de- expression of floxed-rtTA was under the control of the ubiqui- tection kit (BestBio, Shanghai, China). Briefly, vein SMCs were col- tously expressed ROSA26 promoter, and a floxed stop cassette was lected after treatment with different doses of 4-HNE for 24 hours, and present between the ROSA26 promoter and rtTA, which confined after washing twice in ice-cold PBS, the cells were resuspended with rtTA expression to the cells in which Cre recombinase was present, annexin V binding buffer. Then, the cell suspension was mixed with and an internal ribosome entry site followed by the EGFP gene was 5 ml annexin V-FITC for 15 minutes at 2–8°C, and counterstained located downstream of rtTA, thereby allowing tracking of the with 10 ml propidium iodide for 5 minutes in the dark. Apoptotic cells rtTA-expressing cells by EGFP expression; and 2 (FITC+/propidium iodide ) was determined on flow cytometer and analyzed with CellQuest software (BD Biosciences). 3. the GSTA4 allele in the TetO-GSTA4 transgenic mice, driven by the tetracycline inducible promoter (TetO). Animals All studies were approved by the Institutional Animal Care and Use The genotyping was performed according to the protocol provided Committee of Baylor College of Medicine (Houston, TX) and performed by the Jackson Laboratory. in accordance with National Institutes of Health guidelines. Mice were housed in a conventional animal facility with a 12-hour light/dark cycle. Induction of GSTA4 Expression in Transgenic Mice WTmice were from Jackson Laboratory (Bar Harbor, Maine) and GSTA4 Transgenic founders were generated by standard techniques, and two KO mice were obtained as previously described.19,52 independent founder lines were evaluated, each giving equivalent results. The resulting line is hereafter referred to as iGSTA4/SMC. Transgenic littermates were treated with doxycycline-containing wa- Generation of Transgenic Mice ter (0.5 mg/ml, with 5% sucrose added; Sigma Chemicals) and con- To construct the GSTA4 inducible expression vector, the cDNA en- trol mice were given 5% sucrose solutions. The expression of GSTA4 coding mGSTA4 was amplified by GCGGGGCCCATGGCAGC- were determined by Western blotting. CAAACCTAAG CTC (ApaI restriction site is underlined) and GCGTGGCCACTACTTATCGTCGTCA TCCTTGTAATCGAACTT- CAGGACAGTCCTG (MscI restriction site is underlined). The PCR CKD Model products were cut with ApaIandMscI, and cloned into pLVX-Tet-On CKD was induced by subtotal nephrectomy in anesthetized mice as 6,9 fl vector (catalog no. 632162; Clontech), where the BamH I site was previously described. Brie y, mice were fed 20% protein chow and, changed to the ApaI site using the site-directed mutation kit. To test after matching for body weight, subtotal nephrectomy was per- the inducible expression of GSTA4, HEK293 cells were transfected formed in anesthetized mice in a two-step surgery method (Rodent with pLVX-Tet-On/GSTA4 and rtTA plasmids, and the induced ex- III Combo). First, the left kidney was decapsulated to avoid ureter and pression of GSTA4 was confirmed after doxycycline treatment (0.2 adrenal damage, and approximately three quarters of the left kidney mg/ml) for 24 hours by Western blot. was removed. During recovery, mice were given two doses of bupre- – To generate GSTA4 inducible expression mice, pLVX-Tet-On/ norphine (0.1 2.5 mg/kg body wt) after surgery and 12 hours later. GSTA4 was linearized with EcoR1 and MscI and the big fragments The diet was changed to 6% Protein Rodent Diet Chow (Harlan were gel-purified for comicroinjection into fertilized C57BL/6 CBA Teklad, Madison, WI) ad libitum to reduce mortality and limit hy- oocytes by the Transgenic Core Facility of Baylor College of Medicine. pertrophy of the injured kidney. Second, the right kidney was re- TetO-GSTA4 vector was created and injected into embryos at the moved 1 week later, and after 1 week, the mice with CKD were same facility. Among four founders and 23 babies, we obtained two pair-fed 40% protein chow with sham-operated control mice to in- colonies that were confirmed by genotyping (data not shown). The duce uremia that includes metabolic acidosis. The BUN was mea- genotype of the offspring was performed by genotyping using the sured by the Comparative Pathology Laboratory Center at Baylor forward and reverse primers (CGGCCAAGTACCCTT GGTTGAAAT College of Medicine. The serum creatinine level was detected by using and AATGGAGCCACGGCAATCATCATC). The PCR conditions the QuantiChrom Creatinine Assay Kit (BioAssay Systems, Hayward, were as follows: 4 minutes at 95°C, followed by 32 cycles of 95°C for CA). After 4 weeks, AVFs were created. 1 minute, 56°C for 1 minute, and 72°C for 1.5 minute, with a final extension step at 72°C for 10 minutes. The positive fragment is 260 bp. AVF Model Mouse AVFs were created as previously described.6 Briefly, mice of 12 GSTA4 Overexpression Mice weeks of age were anesthetized, and the right internal jugular vein was We used the TetOn/rtTA (reverse tetracycline transactivator) inducible isolated using a dissecting microscope (Leica MZ6). Its distal end was system and Flox-Cre recombination techniques to create SMC-specific, clamped and ligated, the common carotid artery was ligated below its conditional, inducible GSTA4 transgenic mice. To achieve this goal, three bifurcation, and the proximal end was clamped. An end-to-end anas- strains of mice were required (Supplemental Figure 4A): tomosis was created using 12–0 nylon suture with an interrupted stitch. After unclamping, patency was confirmed visually. The mice 1. SM22-Cre mice (Jackson Laboratory) that constitutively ex- were kept warm after surgery, and the analgesic (buprenorphine) was pressed Cre recombinase, driven by the tissue-specific promoter given two times, at 12 hours apart. At 4 weeks after surgery, the mice in SMCs; were anesthetized by intraperitoneal injection and euthanized by

514 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 505–517, 2018 www.jasn.org BASIC RESEARCH perfusing the left ventricle with PBS and 10% formalin for 10 minutes real-time RT-PCR machine (MJ Research, Waltham, MA). GAPDH (to maintain the endothelium and morphology of the AVF). AVFs was used as an internal standard. Primers for mouse GSTA4 and were collected, and slides from 0.5 to 1 mm from the venous anas- GAPDH were as follows: forward, 59-CGGCCAAGTACCCTTGGTT- tomosis were collected for hematoxylin and eosin staining. All AVF GAAAT-39; reverse, 59-AATGGAGCCACGGCAATCATC ATC-39 and figures in this article were taken from the venous anastomosis because forward, 59-AGTGGGAGTTGCTGTTGAAATC-39; reverse, 59- the arterial anastomosis of AVFs has no significant neointima forma- TGCTGAG TATGTCGTGGAGTCTA-39, respectively. tion in this AVF mouse model.6 The neointima and media were de- fi ned as the regions between the lumen and the adventitia. The vessel Western Blot Analysis wall thickness was determined by measuring the difference between Tissues or cell extracts were prepared in RIPA buffer; protein concen- the area of the lumen and the neointima, using the NIS-Elements BR trations in the extracts were assayed using the Bradford protein assay 3.0 program (Nikon, Melville, NY). Five cross-section slides were kit (Bio-Rad) and 30 mg protein was separated by SDS–PAGE. After obtained by selecting the first of every ten sections from each AVF. transferring to nitrocellulose membranes, immunoblots were probed These slides were used to evaluate neointima formation. separately with various primary antibodies after blocking with 5% skimmed milk in tris-buffered saline. Fluorescence-labeled second- Mouse SMC Isolation and Cell Culture ary antibodies were used for detection by the Odyssey Infrared Im- – Mouse SMCs were isolated as previously described.53 55 Briefly, the aging System (LICOR Inc, Lincoln, NE). artery or vein were dissected free from adipose tissue. The endothelium was removed gently with a cotton swab and the adventitia was Quantification of 4-HNE peeled off. The vessels were cut into small pieces (approximately 4-HNE in mouse AVFs was determined using the OxiSelect HNE-His 2 1mm), and seeded on the culture plate and cultured in DMEM Adduct ELISA Kit (catalog no. STA 338; Cell Biolab, San Diego, CA) supplemented with 20% heat inactivated FBS (Hyclone, Logan, according to the manufacturer’s protocol. By using this kit, instead of m m UT), 100 g/ml penicillin, and 100 g/ml streptomycin (Invitrogen free 4-HNE, the conjugated HNE-His proteins were detected. A series Life Technologies). The medium was refreshed after 7 days. The total of 4-HNE-BSA standards were prepared for each determination. number of outgrown cells from each piece was counted by a blinded AVFs from WT and GSTA4 KO mice were rinsed twice with cold observer. The isolated mouse SMCs were positively stained with PBS and homogenized to a 20% w/v mixture. The homogenates a -SMA and calponin. were centrifuged at 13,0003g for 15 minutes and 0.1 ml supernatant was used for each determination, according to the manufacturer’s Immunohistochemistry instructions. Each sample was diluted to 10 mg/ml in 13 PBS. After For histologic analysis, AVFs were perfused through the left ventricle binding to a 96-well plate at 4°C overnight, the samples were incu- with 10% phosphate-buffered formaldehyde and processed as pre- bated with anti–HNE-His antibody for 1 hour at room temperature. 53 viously described. Sections were blocked with 10% goat serum Reaction mixtures were incubated further with the secondary anti- (Vector Laboratories, Burlingame, CA) for 30 minutes and then in- body horseradish peroxidase conjugate at room temperature for 1 a cubated with primary antibodies (GSTA4, 1:1000; -SMA, 1:500; hour. After halting the enzyme reaction by the addition of the stop kip1 PCNA, 1:300; p27 , 1:300; Calponin, 1:300; and Ki67, 1:500). Sec- solution, the absorbance of the supernatant was determined at tions were washed in 0.5% Tween 20 in PBS and incubated at room 450 nm. temperature with a biotinylated secondary antibody (Vector Labora- tories). After washing in 0.5% Tween 20 in PBS, tissue sections were Statistical Analyses incubated with an Elite ABC reagent (Vector Laboratories) in a per- All data are presented as the mean6SD. Comparison among groups ’ oxidase substrate kit, per manufacturer s instructions (Vector Labo- was made using one-way ANOVA followed by pairwise comparisons ratories). Sections were counterstained by hematoxylin and eosin. For with P value adjustment; P,0.05 was considered to be statistically double immunofluorescence staining of samples, fluorescent secondary fi 9 signi cant. antibodies were applied to sections; 4 , 6-diamidino-2- phenylindole was used in counterstaining. For cell immunofluorescence staining, cells were fixed in 4% paraformaldehyde in PBS for 10 minutes at room temperature. Cells were permeabilized in PBS containing 0.1% Triton ACKNOWLEDGMENTS X-100 and blocked by incubating in 5% BSA for 30 minutes. Fixed cells were washed with PBS and incubated for 60 minutes at room We acknowledge Dr. William E. Mitch for constructive suggestions. temperature or overnight at 4°C with primary antibodies. After wash- This work was supported by grants from the American Heart ing three times, the cells were stained with Alexa Fluor secondary Association (115GRNT25700209 and R01 DK095867 to J.C.), the antibodies. Pictures were recorded using a Nikon Eclipse 80i Fluores- National Institutes of Health (R37DK37175), and a generous grant cence Microscope (Nikon). from Dr. and Mrs. Harold Selzman.

Real-Time RT-PCR Total RNA from AVFs was isolated using the RNeasy kit (Qiagen, DISCLOSURES Valencia, CA). Real-time RT-PCR was performed using the Opticon None.

J Am Soc Nephrol 29: 505–517, 2018 4-Hydroxynonenal and CKD Risk 515 BASIC RESEARCH www.jasn.org

REFERENCES and enzymatic characterization of mouse glutathione S-transferase mGSTA4-4 (GST 5.7). J Biol Chem 269: 992–1000, 1994 19. Liang A, Wang Y, Woodard LE, Wilson MH, Sharma R, Awasthi YC, Du J, 1. Allon M, Robbin ML: Increasing arteriovenous fistulas in hemodialysis Mitch WE, Cheng J: Loss of glutathione S-transferase A4 accelerates patients: Problems and solutions. Kidney Int 62: 1109–1124, 2002 obstruction-induced tubule damage and renal fibrosis. J Pathol 228: 2. Cheung AK, Imrey PB, Alpers CE, Robbin ML, Radeva M, Larive B, Shiu 448–458, 2012 YT, Allon M, Dember LM, Greene T, Himmelfarb J, Roy-Chaudhury P, 20. Cheng JZ, Yang Y, Singh SP, Singhal SS, Awasthi S, Pan SS, Singh SV, Terry CM, Vazquez MA, Kusek JW, Feldman HI; Hemodialysis Fistula Zimniak P, Awasthi YC: Two distinct 4-hydroxynonenal metabolizing Maturation Study Group. Intimal hyperplasia, stenosis, and arteriove- glutathione S-transferase isozymes are differentially expressed in nous fistula maturation failure in the hemodialysis fistula maturation human tissues. Biochem Biophys Res Commun 282: 1268–1274, study. JAmSocNephrol28: 3005–3013, 2017 2001 3. Allon M, Litovsky S, Young CJ, Deierhoi MH, Goodman J, Hanaway M, 21. Bornfeldt KE, Campbell JS, Koyama H, Argast GM, Leslie CC, Raines Lockhart ME, Robbin ML: Medial fibrosis, vascular calcification, intimal EW, Krebs EG, Ross R: The mitogen-activated protein kinase pathway hyperplasia, and arteriovenous fistula maturation. Am J Kidney Dis 58: can mediate growth inhibition and proliferation in smooth muscle cells. 437–443, 2011 Dependence on the availability of downstream targets. J Clin Invest 4. Lee T, Chauhan V, Krishnamoorthy M, Wang Y, Arend L, Mistry MJ, 100: 875–885, 1997 El-Khatib M, Banerjee R, Munda R, Roy-Chaudhury P: Severe venous 22. Pintucci G, Saunders PC, Gulkarov I, Sharony R, Kadian-Dodov DL, neointimal hyperplasia prior to dialysis access surgery. Nephrol Dial Bohmann K, Baumann FG, Galloway AC, Mignatti P: Anti-proliferative Transplant 26: 2264–2270, 2011 and anti-inflammatory effects of topical MAPK inhibition in arterialized 5. Riella MC, Roy-Chaudhury P: Vascular access in haemodialysis: vein grafts. FASEB J 20: 398–400, 2006 Strengthening the Achilles’ heel. Nat Rev Nephrol 9: 348–357, 2013 23. Jain M, Singh A, Singh V, Maurya P, Barthwal MK: Gingerol inhibits 6. Liang A, Wang Y, Han G, Truong L, Cheng J: Chronic kidney disease serum-induced vascular smooth muscle cell proliferation and injury- accelerates endothelial barrier dysfunction in a mouse model of an arte- induced neointimal hyperplasia by suppressing p38 MAPK activation. J riovenous fistula. Am J Physiol Renal Physiol 304: F1413–F1420, 2013 Cardiovasc Pharmacol Ther 21: 187–200, 2016 7. Liang M, Liang A, Wang Y, Jiang J, Cheng J: Smooth muscle cells from 24. Ma Y, Zhang L, Peng T, Cheng J, Taneja S, Zhang J, Delafontaine P, Du J: the anastomosed artery are the major precursors for neointima forma- Angiotensin II stimulates transcription of insulin-like growth factor I re- tion in both artery and vein grafts. Basic Res Cardiol 109: 431, 2014 ceptor in vascular smooth muscle cells: Role of nuclear factor-kappaB. 8. Liang M, Wang Y, Liang A, Mitch WE, Roy-Chaudhury P, Han G, Cheng Endocrinology 147: 1256–1263, 2006 J: Migration of smooth muscle cells from the arterial anastomosis of 25. Hong F, Larrea MD, Doughty C, Kwiatkowski DJ, Squillace R, arteriovenous fistulas requires Notch activation to form neointima. Slingerland JM: mTOR-raptor binds and activates SGK1 to regulate Kidney Int 88: 490–502, 2015 p27 phosphorylation. Mol Cell 30: 701–711, 2008 9. Wang Y, Liang A, Luo J, Liang M, Han G, Mitch WE, Cheng J: Blocking 26. Iacovelli J, Lopera J, Bott M, Baldwin E, Khaled A, Uddin N, Fernandez- notch in endothelial cells prevents arteriovenous fistula failure despite Valle C: Serum and forskolin cooperate to promote G1 progression in CKD. JAmSocNephrol25: 773–783, 2014 Schwann cells by differentially regulating cyclin D1, cyclin E1, and 10. Rhyu DY, Yang Y, Ha H, Lee GT, Song JS, Uh ST, Lee HB: Role of re- p27Kip expression. Glia 55: 1638–1647, 2007 active oxygen species in TGF-beta1-induced mitogen-activated pro- 27. Zhang J, Zhong W, Cui T, Yang M, Hu X, Xu K, Xie C, Xue C, Gibbons tein kinase activation and epithelial-mesenchymal transition in renal GH, Liu C, Li L, Chen YE: Generation of an adult smooth muscle cell- – tubular epithelial cells. JAmSocNephrol16: 667 675, 2005 targeted Cre recombinase mouse model. Arterioscler Thromb Vasc 11. Sedeek M, Nasrallah R, Touyz RM, Hébert RL: NADPH oxidases, re- Biol 26: e23–e24, 2006 active oxygen species, and the kidney: Friend and foe. JAmSoc 28. Dixon BS: Why don’t fistulas mature? Kidney Int 70: 1413–1422, 2006 – Nephrol 24: 1512 1518, 2013 29. Kwon SH, Li L, He Y, Tey CS, Li H, Zhuplatov I, Kim SJ, Terry CM, 12. Yeh CH, Chiang HS, Lai TY, Chien CT: Unilateral ureteral obstruction Blumenthal DK, Shiu YT, Cheung AK: Prevention of venous neointimal evokes renal tubular apoptosis via the enhanced oxidative stress and hyperplasia by a multitarget receptor tyrosine kinase inhibitor. JVasc – endoplasmic reticulum stress in the rat. Neurourol Urodyn 30: 472 479, Res 52: 244–256, 2015 2011 30. Dember LM: Fistulas first–but can they last? Clin J Am Soc Nephrol 6: 13. Esterbauer H, Schaur RJ, Zollner H: Chemistry and biochemistry of 463–464, 2011 4-hydroxynonenal, malonaldehyde and related aldehydes. Free Radic 31. Roselaar SE, Nazhat NB, Winyard PG, Jones P, Cunningham J, Blake – Biol Med 11: 81 128, 1991 DR: Detection of oxidants in uremic plasma by electron spin resonance 14. Chaudhary P, Sharma R, Sahu M, Vishwanatha JK, Awasthi S, Awasthi spectroscopy. Kidney Int 48: 199–206, 1995 YC: 4-Hydroxynonenal induces G2/M phase cell cycle arrest by acti- 32. Jourde-Chiche N, Dou L, Cerini C, Dignat-George F, Brunet P: Vascular vation of the ataxia telangiectasia mutated and Rad3-related protein incompetence in dialysis patients–protein-bound uremic toxins and (ATR)/checkpoint kinase 1 (Chk1) signaling pathway. JBiolChem288: endothelial dysfunction. Semin Dial 24: 327–337, 2011 20532–20546, 2013 33. Ali ZA, de Jesus Perez V, Yuan K, Orcholski M, Pan S, Qi W, Chopra G, 15. Abel EL, Angel JM, Riggs PK, Langfield L, Lo HH, Person MD, Awasthi Adams C, Kojima Y, Leeper NJ, Qu X, Zaleta-Rivera K, Kato K, Yamada Y, YC, Wang LE, Strom SS, Wei Q, DiGiovanni J: Evidence that Gsta4 Oguri M, Kuchinsky A, Hazen SL, Jukema JW, Ganesh SK, Nabel EG, modifies susceptibility to skin tumor development in mice and humans. Channon K, Leon MB, Charest A, Quertermous T, Ashley EA: Oxido- J Natl Cancer Inst 102: 1663–1675, 2010 reductive regulation of vascular remodeling by receptor tyrosine kinase 16. Singh SP, Niemczyk M, Saini D, Awasthi YC, Zimniak L, Zimniak P: Role ROS1. J Clin Invest 124: 5159–5174, 2014 of the electrophilic lipid peroxidation product 4-hydroxynonenal in the 34. Kokubo T, Ishikawa N, Uchida H, Chasnoff SE, Xie X, Mathew S, Hruska development and maintenance of obesity in mice. Biochemistry 47: KA, Choi ET: CKD accelerates development of neointimal hyperplasia 3900–3911, 2008 in arteriovenous fistulas. J Am Soc Nephrol 20: 1236–1245, 2009 17. Xu Y, Gong B, Yang Y, Awasthi YC, Woods M, Boor PJ: Glutathione-S- 35. Langer S, Kokozidou M, Heiss C, Kranz J, Kessler T, Paulus N, Krüger T, transferase protects against oxidative injury of endothelial cell tight Jacobs MJ, Lente C, Koeppel TA: Chronic kidney disease aggravates junctions. Endothelium 14: 333–343, 2007 arteriovenous fistula damage in rats. Kidney Int 78: 1312–1321, 2010 18. Zimniak P, Singhal SS, Srivastava SK, Awasthi S, Sharma R, Hayden JB, 36. Bugnicourt JM, Da Silveira C, Bengrine A, Godefroy O, Baumbach G, Awasthi YC: Estimation of genomic complexity, heterologous expression, Sevestre H, Bode-Boeger SM, Kielstein JT, Massy ZA, Chillon JM:

516 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 505–517, 2018 www.jasn.org BASIC RESEARCH

Chronic renal failure alters endothelial function in cerebral circulation in 47. Cheng J, Wang Y, Ma Y, Chan BT, Yang M, Liang A, Zhang L, Li H, Du J: mice. Am J Physiol Heart Circ Physiol 301: H1143–H1152, 2011 The mechanical stress-activated serum-, glucocorticoid-regulated ki- 37. Wang L, Zhang D, Zheng J, Feng Y, Zhang Y, Liu W: Actin cytoskeleton- nase 1 contributes to neointima formation in vein grafts. Circ Res 107: dependent pathways for ADMA-induced NF-kB activation and TGF-b 1265–1274, 2010 high expression in human renal glomerular endothelial cells. Acta 48. Pool-Zobel BL, Selvaraju V, Sauer J, Kautenburger T, Kiefer J, Richter Biochim Biophys Sin (Shanghai) 44: 918–923, 2012 KK, Soom M, Wölfl S: Butyrate may enhance toxicological defence in 38. Sinha-Hikim I, Shen R, Paul Lee W-NN, Crum A, Vaziri ND, Norris KC: primary, adenoma and tumor human colon cells by favourably modu- Effects of a novel cystine-based glutathione precursor on oxidative lating expression of glutathione S-transferases genes, an approach in stress in vascular smooth muscle cells. Am J Physiol Cell Physiol 299: nutrigenomics. Carcinogenesis 26: 1064–1076, 2005 C638–C642, 2010 49. Ranganna K, Mathew OP, Yatsu FM, Yousefipour Z, Hayes BE, Milton 39. Karimi J, Goodarzi MT, Tavilani H, Khodadadi I, Amiri I: Relationship SG: Involvement of glutathione/glutathione S-transferase antioxidant between advanced glycation end products and increased lipid perox- system in butyrate-inhibited vascular smooth muscle cell proliferation. idation in semen of diabetic men. Diabetes Res Clin Pract 91: 61–66, FEBS J 274: 5962–5978, 2007 2011 50. Hayes JD, Chanas SA, Henderson CJ, McMahon M, Sun C, Moffat GJ, 40. Negre-Salvayre A, Coatrieux C, Ingueneau C, Salvayre R: Advanced Wolf CR, Yamamoto M: The Nrf2 transcription factor contributes both lipid peroxidation end products in oxidative damage to proteins. Po- to the basal expression of glutathione S-transferases in mouse liver and to tential role in diseases and therapeutic prospects for the inhibitors. Br J their induction by the chemopreventive synthetic antioxidants, butylated Pharmacol 153: 6–20, 2008 hydroxyanisole and ethoxyquin. Biochem Soc Trans 28: 33–41, 2000 41. Vatsyayan R, Chaudhary P, Sharma A, Sharma R, Rao Lelsani PC, 51. Noel S, Hamad AR, Rabb H: Reviving the promise of transcription factor Awasthi S, Awasthi YC: Role of 4-hydroxynonenal in epidermal growth Nrf2-based therapeutics for kidney diseases. Kidney Int 88: 1217–1218, factor receptor-mediated signaling in retinal pigment epithelial cells. 2015 Exp Eye Res 92: 147–154, 2011 52. Engle MR, Singh SP, Czernik PJ, Gaddy D, Montague DC, Ceci JD, Yang 42. Usatyuk PV, Parinandi NL, Natarajan V: Redox regulation of 4-hydroxy- Y, Awasthi S, Awasthi YC, Zimniak P: Physiological role of mGSTA4-4, a 2-nonenal-mediated endothelial barrier dysfunction by focal adhesion, glutathione S-transferase metabolizing 4-hydroxynonenal: Generation and adherens, and tight junction proteins. JBiolChem281: 35554–35566, analysis of mGsta4 null mouse. Toxicol Appl Pharmacol 194: 296–308, 2006 2004 43. Weiss MF, Scivittaro V, Anderson JM: Oxidative stress and increased 53. Cheng J, Du J: Mechanical stretch simulates proliferation of venous expression of growth factors in lesions of failed hemodialysis access. smooth muscle cells through activation of the insulin-like growth factor- Am J Kidney Dis 37: 970–980, 2001 1 receptor. Arterioscler Thromb Vasc Biol 27: 1744–1751, 2007 44. Wasse H, Huang R, Naqvi N, Smith E, Wang D, Husain A: Inflammation, 54. Cheng J, Wang Y, Liang A, Jia L, Du J: FSP-1 silencing in bone marrow oxidation and venous neointimal hyperplasia precede vascular injury cells suppresses neointima formation in vein graft. Circ Res 110: 230– from AVF creation in CKD patients. JVascAccess13: 168–174, 2012 240, 2012 45. Sharma R, Brown D, Awasthi S, Yang Y, Sharma A, Patrick B, Saini 55. Wilhelmson AS, Fagman JB, Johansson I, Zou ZV, Andersson AG, MK, Singh SP, Zimniak P, Singh SV, Awasthi YC: Transfection with 4- Svedlund Eriksson E, Johansson ME, Lindahl P, Fogelstrand P, Tivesten hydroxynonenal-metabolizing glutathione S-transferase isozymes leads Å: Increased intimal hyperplasia after vascular injury in male androgen to phenotypic transformation and immortalization of adherent cells. receptor-deficient mice. Endocrinology 157: 3915–3923, 2016 Eur J Biochem 271: 1690–1701, 2004 46. Xu Y, Gong B, Yang Y, Awasthi YC, Boor PJ: Adenovirus-mediated overexpression of glutathione-s-transferase mitigates transplant arte- riosclerosis in rabbit carotid allografts. Transplantation 89: 409–416, This article contains supplemental material online at http://jasn.asnjournals. 2010 org/lookup/suppl/doi:10.1681/ASN.2017030290/-/DCSupplemental.

J Am Soc Nephrol 29: 505–517, 2018 4-Hydroxynonenal and CKD Risk 517 5d 7d

Artery

Vein

Supplemental figure 1. Comparison of the outgrowing cells from artery and vein. Artery and vein segments were seeded onto 24‐ well plates and cultured in DMEM complete medium ex vivo; pictures of the outgrowing cells were taken at indicated time points. Representative pictures are presented. A B PCNA

Cyclin D1 GSTA4 20 GAPDH 18 * * 2.5 16 cellS ** cells) 14 2 * * levels

12 PCNA

total #

positive 10 1.5 CyclinD1

of change)

protein # 8 (% Ki67 6 (fold 1 4 Relative 2 0.5 0 WT GSTA4 KO GSTA4 KO GSTA4 KO 0 Ad GSTA4 Ad GFP WT GSTA4 KO GSTA4 KO GSTA4 KO Ad GSTA4 Ad GFP

Supplemental figure 2. Loss of GSTA4 promoted arterial SMC proliferation. Mouse arterial SMCs were isolated from WT and GSTA4 KO mice. The GSTA4 deficient arterial SMCs were transfected with AdGSTA4 or GFP adenovirus. A. The proliferation of the cells was detected by immunostaining of Ki67 (upper panel), and the quantitative analysis of Ki67 positive cells was summarized (down panel). B. Cell lysates were isolated from the arterial SMCs, and the expression of proliferation markers, PCNA and Cyclin D1, was determined by Western blots. Representative data was shown from 3 experiments (G) (*, p < 0.05 versus WT; #, p < 0.05 versus GSTA4 KO). A 4-HNE 0 5 10 20 40 μM

2.1 2.7 3.2 13.4 16.5

Annexin V Annexin V Annexin V Annexin V Annexin V B 20

18 * C 16 4-HNE 0 5 10 20 40 μM 14 * total)

positive 12 Bax of V

10 8 Cleaved-

cells(% 6 caspase3 Annexin 4 GAPDH 2 0 4‐HNE 0 2 5 10 20 μM Supplemental figure 3. High dose of 4‐HNE induces cell apoptosis. A. vein SMCs were treated with different doses of 4‐HNE for 24 h. The cells were incubated with anti‐annexin V antibody and determined by flow cytometry. B. the annexin V positive populations in Panel A was summarized. C. Vein SMCs were treated with 4‐HNE with indicated doses, and the Bax and cleaved caspase 3 were detected by Western blot analysis. Representative data from 3 experiments (*, p < 0.05 versus control). A

Supplemental figure 4: Doxycline induces GSTA4 expression in GSTA4 transgenic mice: A. Breeding strategy for generating mice with inducible GSTA4 expression in SMCs. Two breeding steps were used to generate these mice. First, Tet‐On‐GSTA4 mice were bred with rtTA‐EGFP mice to obtain double transgenic GSTA4/rtTA mice. Second, the obtained GSTA4/rtTA mice were bred with SM22‐Cre mice to get triple transgenic GSTA4/rtTA/SM22‐Cre mice. The GSTA4 expression can be induced by doxycycline. B. The expression of GSTA4 was detected in tissues in GSTA4/rtTA/SM22‐Cre transgenic mice. Triple transgenic mice from 2 lines were fed with water containing 0.5 mg/ml doxycycline for 14 days, GSTA4 expression was detected from different tissues. Tissues from non‐doxycycline treated mice were used as control. SIGNIFICANCE STATEMENT

Neointima formation is the leading cause of arteriovenous ﬁstula (AVF) failure. This article reports evidence that loss of glutathione S-transferase a4in CKD causes the accumulation of 4-hydroxynonenal, which in turn, stimulates proliferation of vascular smooth muscle cells. These responses result in neointima formation and accelerate AVF failure. Increasing glutathione S-transferase a4expression may provide a protective strategy to improve AVF maturation.