DETERMINANTES DA ESTRUTURAÇÃO POPULACIONAL EM ESPÉCIES BRASILEIRAS DO GÊNERO Necromys (RODENTIA, CRICETIDAE) JÂNIO CORDEIRO

DETERMINANTES DA ESTRUTURAÇÃO POPULACIONAL EM ESPÉCIES

BRASILEIRAS DO GÊNERO Necromys (RODENTIA, CRICETIDAE)

JÂNIO CORDEIRO MOREIRA

RIO DE JANEIRO

SETEMBRO, 2015

JÂNIO CORDEIRO MOREIRA

DETERMINANTES DA ESTRUTURAÇÃO POPULACIONAL EM ESPÉCIES

BRASILEIRAS DO GÊNERO Necromys (RODENTIA, CRICETIDAE)

Tese de Doutorado apresentada ao Programa de Pós-

Graduação em Biodiversidade e Biologia Evolutiva,

Universidade Federal do Rio de Janeiro, como parte

dos requisitos necessários à obtenção do título de

Doutor em Biodiversidade e Biologia Evolutiva.

Orientador: Prof. Dr. João Alves de Oliveira

RIO DE JANEIRO

SETEMBRO, 2015 iii

Jânio Cordeiro Moreira

DETERMINANTES DA ESTRUTURAÇÃO POPULACIONAL EM ESPÉCIES

BRASILEIRAS DO GÊNERO Necromys (RODENTIA, CRICETIDAE)

Tese de Doutorado apresentada ao Programa de Pós-Graduação em Biodiversidade e

Biologia Evolutiva, Universidade Federal do Rio de Janeiro, como parte dos requisitos necessários à obtenção do título de Doutor em Biodiversidade e Biologia Evolutiva

Orientador: Dr. João Alves de Oliveira, Museu Nacional/UFRJ

Aprovada por:

Presidente da Banca

FICHA CATALOGRÁFICA

MOREIRA, Jânio Cordeiro Determinantes da estruturação populacional em espécies brasileiras

do gênero Necromys (Rodentia, Cricetidae)

Rio de Janeiro, UFRJ, 2015. xvii+107pp. Orientador: Prof. Dr. João Alves de Oliveira Tese de Doutorado, Programa de Pós-Graduação em Biodiversidade e Biologia Evolutiva, UFRJ, 2015. Palavras-chave: 1. Necromys lasiurus 2. Necromys lenguarum 3. Sigmodontinae 4. ratadas 5. estruturação geográfica 6. Pleistoceno I. João Alves de Oliveira II. Universidade Federal do Rio de Janeiro, Programa de Pós-Graduação em Biodiversidade e Biologia Evolutiva III. Determinantes da estruturação populacional em espécies brasileiras do gênero Necromys (Rodentia, Cricetidae) v

AGRADECIMENTOS

Antes de qualquer coisa, o período de quatro anos referente ao desenvolvimento dessa tese representou um tempo de amadurecimento profissional e pessoal. Durante o curso tive contato com novas técnicas e procedimentos. Todo esse aprendizado não seria possível sem o suporte e o apoio de diversas pessoas. O presente trabalho é, sem dúvida, o somatório do esforço, ajuda e experiência que recebi de todas elas ao longo desses últimos anos. Embora muitas dessas pessoas não sejam citadas nominalmente aqui, gostaria de registrar o meu agradecimento pela contribuição de cada uma delas.

Sou grato ao meu orientador Dr. João Alves de Oliveira por mais de uma década de orientação e amizade em que partilhamos o entusiasmo pelo estudo das “ratadas” e por outras questões envolvendo os pequenos mamíferos.

À Drª Cibele R. Bonvicino pela amizade e incentivo, pelas oportunidades oferecidas, pela paciência em esperar o demorado processo de análise dos dados e de escrita de manuscritos, pelas amostras cedidas e por viabilizar o acesso à estrutura laboratorial do Inca e da Fiocruz.

Ao Dr. Hector Abreu por possibilitar o acesso à estrutura laboratorial do Inca e por ter solicitado uma bolsa de capacitação técnica junto à FAPERJ que permitiu meu treinamento inicial nas técnicas de Biologia Molecular e foi fundamental para o meu ingresso no doutorado. Ao Dr. Miguel Moreira por estar sempre disposto a esclarecer as dúvidas em relação ao uso dos equipamentos e das análises moleculares.

Aos Drs. Marcelo Weksler, Paulo Buckup e Bryan Jennings por possibilitarem o acesso à estrutura laboratorial do Departamento de Vertebrados do Museu Nacional. vi

Ao Dr. Paulo Sérgio D’Andrea pelas amostras cedidas e por possibilitar a utilização das instalações e equipamentos do Laboratório de Biologia e Parasitologia de Mamíferos

Silvestres Reservatórios do IOC-Fiocruz.

Ao Roberto Vilela e Daniela Dias pela ajuda na localização das amostras na

Fiocruz.

Aos amigos Júlio, Bia Mello, Fabrícia Nascimento, Albert Menezes, Ana Lazar,

Fernanda Pedone, Fabiana Caramaschi, Fabiana Batalha, Maria Carolina, Carolina

Furtado, Sergio Amaro, Leila Monnerat, Kelly Rose, Michel Faria et al., por partilharem seu conhecimento sobre os métodos moleculares e pelas conversas sempre bem- humoradas.

Ao Pablo Gonçalves pela amizade, pela cessão de amostras, pela participação na minha banca de qualificação e por ter sido meu mentor inicial no mundo da

Mastozoologia.

Aos Drs. Carlos Guerra, Carlos Renato Ventura, Maria Lucia Lorini e Carlos Grelle pela participação na banca de qualificação e pelas críticas e sugestões que contribuíram para aumentar a qualidade do manuscrito que compõe o capítulo II dessa tese.

Aos membros da banca de tese por aceitarem o convite e pelas valiosas sugestões que ajudarão a melhorar esse documento.

A todos os professores que em todos os níveis de minha caminhada escolar influenciaram-me, dividindo comigo seus conhecimentos.

Ao Heber pela ajuda e esclarecimento nos procedimentos burocráticos relativos à tese.

Aos colegas de laboratório no Museu Nacional, Inca e Fiocruz pelos excelentes anos de convivência, pelo bom humor constante e pela presteza em ajudar no que fosse preciso. vii

Aos colegas do Instituto Federal do Paraná/Campus Palmas, especialmente aos membros do colegiado do curso de Licenciatura em Ciências Biológicas, pelo esforço em viabilizar minha chegada em Palmas, pela acolhida e pelo apoio durante a minha instalação na cidade.

A meus pais Jair & Eldiris pelo exemplo, carinho, esforço, dedicação e incentivo ao longo de toda a minha vida. Sem vocês não teria sido possível alcançar tantas vitórias. Às minhas irmãs Janice e Jeíce, ao meu cunhado José Antônio e meu sobrinho Olavo pelo carinho e companheirismo.

À minha querida esposa Giselle pelo carinho, compreensão e incentivo. Ao meu filho Paulo Henrique por sua curiosidade e alegria espontâneas, por sua inocência infantil que me traziam de volta ao mundo real estimulando-me a buscar ser cada dia melhor. Ao

Sr. João, Dona Vera e João Diego pela acolhida e amizade.

À FAPERJ por ter concedido ao meu orientador uma bolsa de apoio à pesquisa 1

(APQ1) cujos recursos custearam boa parte do fase laboratorial dessa tese. À CAPES pela bolsa de doutorado.

viii

RESUMO

Determinantes da estruturação populacional em espécies brasileiras

do gênero Necromys (Rodentia, Cricetidae)

Jânio Cordeiro Moreira

Orientador: João A. de Oliveira

A escassez de informações sobre diferentes aspectos da biologia básica (e.g. estratégia reprodutiva, vagilidade) dos roedores da subfamilia Sigmodontinae tem dificultado um melhor entendimento tanto dos padrões de demografia, distribuição geográfica e diversidade atuais quanto de sua história evolutiva. Uma alternativa eficaz para acessar essas informações tem sido o uso de ferramentas moleculares como a análise de sequencias de genes mitocondriais e nucleares bem como a genotipagem de locos de microssatélites. Dentre os alvos potenciais para tais estudos destacam-se espécies sujeitas a uma dinâmica populacional complexa, caracterizada por explosões populacionais em curtos intervalos de tempo denominadas "ratadas". Nesse sentido, o objetivo do presente projeto foi avaliar o impacto dessas irrupções populacionais sobre a estrutura populacional e diversidade genética em Necromys lasiurus (Lund, 1840), espécie ubíqua e comprovadamente sujeita a “ratadas”, e Necromys lenguarum (Thomas, 1898), sua espécie-irmã geralmente não associada a tais oscilações demográficas. Foram obtidas sequências de cit b, adh1 e fgbi7 de amostras representativas da distribuição das espécies bem como genótipos de espécimes N. lasiurus de oito localidades. As análises filogenéticas com citocromo b revelaram a ocorrência de N. lenguarum no centro-oeste e norte do Brasil bem como alta estruturação em N. lasiurus com cinco grupos populacionais segundo disjunções norte-sul e leste-oeste do Cerrado. Esse arranjo geográfico foi confirmado nas análises multivariadas envolvendo o cit b e os locos de microssatélites. Embora estruturados, esses grupos apresentaram alta diversidade genética. Em N. lenguarum, há pouca diferenciação entre as populações e baixa diversidade genética. Infere-se que essas diferenças entre as espécies sejam reflexo de diferenças em sua biologia básica, especialmente no que se refere às ratadas. Em N. lasiurus, as ratadas podem permitir a conexão de subpopulações próximas mantendo elevados níveis diversidade genética em um nível regional. Essa hipótese precisa ser testada a partir de estudos de longo prazo visando analisar a variação temporal na ix

diversidade genética da espécie em escala local e regional. Esses estudos devem amostrar o período antes, durante e depois das ratadas.

Palavras–chave: Necromys, akodontini, ratadas, análises multivariadas, estruturação geográfica, biologia molecular. x

ABSTRACT

Determinants of population structure in Brazilian species

the genus Necromys (Rodentia, Cricetidae)

Jânio Cordeiro Moreira

Orientador: João A. de Oliveira

Some aspects of the natural history of the rodents of the subfamily Sigmodontinae remain elusive (e.g., reproductive strategies, vagility) hindering a better understanding of their demography, geographic range and evolutionary history. The use of molecular tools such as the analysis of sequences of mitochondrial and nuclear markers and genotyping of microsatellite loci has been pointed as an efficient way to deal with this issue. This approach is potentially useful to study some species experiencing population outbreaks locally termed as “ratadas”. In this sense, the present study aimed to assess the relevance of these density fluctuations on the population structure and genetic diversity in Necromys lasiurus, an ubiquitous species subjected to “ratadas”, and its sister species Necromys lenguarum for which there are no reports of such demographic oscillations. We obtained sequences of the markers cytochrome b, alcohol desydrogenase 1 and the beta fibrinogen intron 7, for an extended geographic sampling of these species as well as the genotypes of N. lasiurus specimens from eight localities. The phylogenetic analyses using cyt b revealed the occurrence of N. lenguarum in Central Brazil and the strong genetic structure of N. lasiurus in five haplogroups according north-south and west-east disjunctions in Cerrado. Multivariate analyses on both cyt b and microsatellite loci also revealed this geographic arrangement. These five haplogroups show high genetic diversity. N. lenguarum showed no geographic structure and low genetic diversity. We hypothesize that the distinct patterns of population structure and genetic diversity in N. lasiurus and N. lenguarum are due to subtle differences in the biology of these species including the occurrence of “ratadas”. In N. lasiurus, the outbreaks might allow the connection of neighbor subpopulations guaranteeing the maintenance of high levels of genetic diversity in a regional scale. However, this hypothesis requires additional tests in long term surveys aiming to assess the temporal variation in the genetic diversity of the species in both a local and regional scales. Future studies should include pre-outbreak, outbreak and post-outbreak samples. xi

Key words: Necromys, akodontini, “ratadas”, rodent outbreaks, multivariate analysis, genetic structure, molecular biology.

xii

LISTA DE FIGURAS

Figure 1. Geographical provenance of the Necromys lasiurus (black circles) and Necromys lenguarum (black diamonds) samples examined used in this study in relation to the current geographic boundaries of the three major Dry Diagonal formations mentioned in the text (Chaco, Cerrado and Caatinga). Localities are numbered sequentially from north to south (see Appendix S1).

Figure 2. a) Bayesian and maximum likelihood cytochrome b (cytb) gene tree for Necromys lasiurus (800–1140 bp) and Necromys lenguarum (800 bp). Each N. lasiurus lineage for the mtDNA revealed by phylogenetic analyses was represented by a different color (green, central northern clade; red, western Cerrado clade; orange, central Cerrado clade; light blue, central eastern clade; dark blue, south-southeastern clade). Other Necromys (N. amoenus, N. lactens, N. obscurus and N. urichi) and akodontine species were included as outgroups (see Appendix S1 for details). For SH-aLRT (left semi-circles), grey indicate values from 0.7–0.9, black indicate values ≥ 0.9. For Bayesian statistics (right semi-circles), white indicate Bayesian Posterior Probability (BPP) 0.75–0.95, whereas black indicates BPP > 0.95. b) Geographic range of the lineages based on the examined samples highlighting their similarity with c) the phytogeographical regions of Cerrado and d) presumably stable areas in the Last Glacial Maximum.

Figure 3. a) N. lasiurus Neighbour-Net networks showing haplotypes arranged in five groups corroborating the results of phylogenetic analysis (b). Haplogroups are colored according the Fig. 2 and labelled such as defined in the text. Large loops imply areas of phylogenetic uncertainty or reticulations. Their frequency in the network suggests that the relevance of hybridization for the evolution of the species still needs to be evaluated.

Figure S1. ML and BI topology based on cytochrome b sequence data showing the phylogenetic relationships in Necromys.

Figure S2. ML trees for beta fibrinogen intron 7 (a) and alcohol desydrogenase (b). Colours correspond to N. lasiurus haplogroups colours in Fig. 1a. Grey circles indicate SH- aLRT estimates from 0.7–0.9, black indicate SH-aLRT ≥ 0.9. xiii

Figure S3: Neighbor-Net network reconstructed with basis on the cytb sequence data from Necromys lenguarum individuals. The star-shape of the network suggests the absence of geographic structure and a demographic expansion in this species.

Figure S4 – Results of sPCA based on the cytochrome b sequence data of Necromys lenguarum. (a–b) First and second global scores of sPCA. Positive and negative sPC scores are depicted as black and white squares respectively. The size of squares is proportional to the absolute value of the sPC scores. Plots also show the connection network produced by Delaunay triangulation based on geographic coordinates of the 11 sampling localities examined in this study, (c) bar plots showing each component ordered by eigenvalue, and (d) scree plots of sPC eigenvalues decomposed into their variance and spatial autocorrelation components.

Figure S5 – Results of sPCA based on the cytochrome b sequence data of Necromys lasiurus. (a–b) First and second global scores of sPCA. Positive and negative sPC scores are depicted as black and white squares respectively. The size of squares is proportional to the absolute value of the sPC scores. Plots are positioned according to the spatial coordinates of all 37 sampling localities examined in this study, (c) bar plots showing each component ordered by eigenvalue, and (d) scree plots of sPC eigenvalues decomposed into their variance and spatial autocorrelation components.

Figure S6. Observed (white bars) and expected (dashed lines) mismatch distributions for the 4 main clades of N. lasiurus (a-d) and for N. lenguarum. Additional details are provided in the Table 1.

Figure S7. Collecting localities for the Necromys lasiurus specimens which were genotyped in this study. Localities are numbered sequentially from north to south such as listed in the Table S7.

Delaunay triangulation based on geographic coordinates of the 8 sampling localities examined in this study, (c) bar plots showing each component ordered by eigenvalue, and (d) Scree plots of sPC eigenvalues decomposed into their variance and spatial autocorrelation components.

LISTA DE TABELAS

Table 1. Molecular diversity indices. neutrality and demographic tests to investigate population size changes for samples of N. lenguarum, N. lasiurus and all N. lasiurus haplogroups. Sample size (n); number of haplotypes (nh); haplotype diversity (h); nucleotide diversity (π); standard deviation (SD); Tajima’s D (D); Fu’s Fs ( Fs); sum of squared deviation (SSD); Harpending’s raggedness index (Hr); probability values (p); non- applicable (NA). Bold values are statistically significant.

Table 2. Analysis of molecular variance (AMOVA) results of variation partitioning in N. lasiurus according four tested scenarios: a) 3 groups: (CE+CC), (CN+CW), SS; b) 4 groups A: CE, CC, (CN+CW), SS; c) 4 groups B: (CE+CC), CN, SS, CW; d) 5 groups: CE, CC, CN, SS, CW. Bold values were statistically significant with p < 0.001.

Table 3. Pairwise Fst values (below diagonal) among the Necromys lasiurus mt-DNA haplogroups. Bold values of Fst were statistically significant with p < 0.001.

Table S1 Sample identification, genetic information (cytb haplotype and mtDNA clade assignment), geographic references (latitude, longitude, localities), and source for each (a) Necromys lasiurus and (b) N. lenguarum specimens. Acronyms refer to collector’s name: LG and CD= L. Geise (Departamento de Zoologia, Instituto de Biologia, Universidade Estadual do Rio de Janeiro - UERJ, Brazil); CRB, SVS and LBCE= C.R. Bonvicino (LBCE, Instituto Oswaldo Cruz – Fiocruz, Rio de Janeiro, Brazil); ARB = A. Bezerra (Instituto Oswaldo Cruz – Fiocruz, Rio de Janeiro, Brazil).

Table S2 (a) List of samples of Necromys lasiurus with sequences of nuclear markers and examined cytb sequences of other Necromys species; (b) outgroup species in both phylogentic and molecular dating analyses. Acronyms refer to collector’s number: LG and CD= L. Geise (Departamento de Zoologia, Instituto de Biologia, Universidade Estadual do Rio de Janeiro - UERJ, Brazil); CRB, SVS and LBCE= C.R. Bonvicino (LBCE, Instituto Oswaldo Cruz – Fiocruz, Rio de Janeiro, Brazil); ARB = A. Bezerra (Instituto Oswaldo xvi

Cruz – Fiocruz, Rio de Janeiro, Brazil); LMT = Liliani Marília Tiepolo (Universidade Federal do Paraná - UFPR, Paraná, Brazil). Na = non-aplicable

Table S3 Gazetteer of collecting localities and specimens examined in the microsatellite analysis. Numbers in brackets refers to localities mapped in Figure S7. Localities are numbered from north to south, followed by latitude and longitude (south and west, respectively, in negative decimal degrees). States are listed in bold uppercase, followed by specific localities in roman and municipalities in bold, with reference coordinates of the municipality headquarters. Uncatalogued specimens will be deposited in the collections of the Museu Nacional, Universidade Federal do Rio de Janeiro (CRB and LBCE) and Museu João Moojen, Universidade Federal de Viçosa (PRG = Pablo Rodrigues Gonçalves, NUPEM/UFRJ).

Table S4. Estimated geographic range size for N. lenguarum, N. lasiurus and all N. lasiurus lineages. Most Necromys species have medium-sized ranges (Pardiñas et al., 2015) and only two haplogroups (CC and CW) appear to follow this pattern. The other lineages have ranges larger than 500,000 km2.

Table S5. Uncorrected average pairwise sequence divergence among (below diagonal) and within (bold in diagonal) cytb clades of Necromys lasiurus.

Table S7. Characteristics of the six polymorphic microsatellite markers amplified in Necromys lasiurus. Ta (⁰C) = annealing temperature, NC= number of cycles.

xvii

SUMÁRIO

Agradecimentos...... V

Resumo...... VIII

Abstract...... X

Introdução...... 1

1.1 Objetivos...... 8

CAPÍTULO I: 1º Artigo – Isolation of polymorphic microsatellite loci in Akodon cursor

(Cricetidae, Sigmodontinae) and cross-amplification in other akodontine rodents…...... 19

CAPÍTULO II: 2º Artigo – Pleistocene climate changes and the diversification of lowland species of the rodent genus Necromys in South American Dry Diagonal formations...... 31

Considerações Finais...... ,,...... 104

Conclusões...... 106

1. Introdução

Amplamente distribuídos pela América do Sul e contando com representantes nas

Américas Central e do Norte, os roedores da Subfamília Sigmodontinae formam um grupo bastante heterogêneo com relação a características como hábitos alimentares, seleção e uso do habitat, estratégia reprodutiva, padrões de migração e dispersão, entre outros (Pardiñas et al.,

2002). Grupos apresentando tal nível de heterogeneidade podem exibir padrões de estruturação populacional bastante distintos (Costello et al., 2003). A capacidade de uma espécie de modificar o seu padrão reprodutivo e, consequentemente, seu tamanho populacional e níveis de migração em resposta a estímulos ambientais dependem de quão flexível sua história natural pode ser, Desse modo, conhecer a biologia básica da espécie a ser estudada é importante para a compreensão tanto dos padrões de demografia e diversidade atuais quanto de sua história evolutiva (Costello et al.,2003).

Nesse sentido, uma questão relativa aos roedores da subfamília Sigmodontinae que se enquadra na situação descrita acima refere-se ao fenômeno das ratadas – episódios de flutuação populacional durante os quais, em um curto intervalo de tempo, as populações desses organismos podem atingir um tamanho várias vezes maior do que o normal – e o seu impacto sobre a ecologia e evolução das espécies (Pearson et al., 2002). Uma ideia da dimensão desse aumento populacional pode ser obtida pela análise dos números registrados por Gallardo & Mercado (1999) durante um desses eventos em Puerto Cárdenas/Chile, onde, em apenas uma noite, 2000 espécimes foram coletados. Após uma semana de irrupção o número de indivíduos coletados chegou a aproximadamente 12000 e outros milhares invadiram habitações humanas. Apesar de sua amplitude e da existência de registros de tais irrupções populacionais em diferentes regiões da América do Sul desde o período colonial, o

2 conhecimento sobre esse fenômeno permanece limitado (Pearson, 2002). Na ausência de uma definição quantitativa do que pode ser considerado uma "ratada", essa classificação têm sido feita de modo arbitrário e os registros de sua ocorrência muitas vezes são realizados por acaso

(Jaksic & Lima, 2003).

Aparentemente, as ratadas constituem um fenômeno efêmero, não necessariamente sincrônico, tipicamente local, afetando localidades contíguas ou estendendo-se por distâncias de até 300 quilômetros, cuja ocorrência está associada a uma disponibilidade aumentada de fontes alimentares utilizadas por esses roedores (González et al., 2000; Pearson, 2002). Esse suprimento adicional pode estar relacionado à produção maciça de flores e sementes de algumas espécies de bambu ou ao incremento na produtividade ambiental primária decorrente de mudanças no regime pluviométrico durante períodos de El Niño e La Niña e, não necessariamente, produz os mesmos efeitos em todas as espécies de uma localidade (Lima et al., 1999; Jaksic & Lima, 2003; Sage et al., 2007).

De modo geral, a falta de conhecimento sobre os mecanismos desencadeantes, periodicidade, tempo de duração, amplitude geográfica e magnitude dificulta a caracterização e detecção adequada desses eventos de explosão demográfica (Jaksic & Lima, 2003). Assim, para que se possa compreender a dinâmica das ratadas bem como suas possíveis consequências ecológicas e evolutivas é necessário empreender estudos para conhecer os fatores exógenos como o clima e floração de bambus, mas principalmente os fatores intrínsecos responsáveis não apenas por capacitar uma espécie a responder ao estímulo ambiental e produzir tal aumento populacional como também por regular a intensidade dessa resposta (Vessey & Vessey, 2007).

Todavia, tal informação sobre a biologia básica está ausente para a maior parte das espécies, sendo necessária a realização de estudos de campo visando o monitoramento das populações in loco, que geralmente apresentam alto custo devido ao longo prazo de estudo necessário, e/ou de estudos de genética de populações para a obtenção de estimativas de parâmetros populacionais tais como taxa de migração e tamanho efetivo que possibilitem a redução dessa lacuna de conhecimento (Slatkin, 1985, 1987; Neigel, 1997). Nas últimas décadas, o desenvolvimento da Biologia Molecular tem contribuído para modificar esse cenário por possibilitar o aperfeiçoamento dos métodos baseados na análise de marcadores genéticos tornando-os mais acurados, rápidos e baratos (Johnson & Black, 1995).

Dentre esses marcadores destacam-se as unidades de sequências repetidas em tandem, os microssatélites, devido a propriedades como alta variabilidade alélica, densa distribuição no genoma e possibilidade de amplificação a partir de iniciadores desenvolvidos para outras espécies (Jarne & Lagoda, 1996; Garza et al., 1997; Chapuis et al., 2008, 2011; Cullingham et al., 2008). Em conjunto, essas características tornam os microssatélites marcadores adequados para a realização de análises populacionais em uma escala temporal e espacial mais refinada em relação àquela considerada no sequenciamento de genes (Deter et al., 2008). Nesse sentido, considerando-se a complexidade das ratadas, analisar a variabilidade genética de algumas espécies associadas a esse fenômeno usando tanto locos de microssatélites quanto sequencias de genes como o citocromo b pode ajudar a esclarecer a relação entre explosões populacionais e estruturação geográfica.

Apesar de seu potencial, ainda há poucos locos de microssatélites descritos para os membros da Subfamília Sigmodontinae, destacando-se: Akodon azarae (Vera et al., 2011),

Calomys musculinus (Chiappero et al., 2005, 2011), Nectomys squamipes (Almeida et al.,

2001; Maroja et al., 2003) e Oligoryzomys longicaudatus (González-Ittig et al., 2008). Alguns desses locos foram amplificados com sucesso em outros representantes da subfamília, incluindo algumas espécies envolvidas em ratadas, sendo potencialmente úteis como ferramentas para estudos de genética de populações nesses organismos. Entre os fatores possivelmente responsáveis pela escassez de estudos avaliando a variação temporal na diversidade genética de espécies envolvidas em ratadas pode-se destacar a falta desses marcadores ou a ausência de testes efetivos da utilidade de iniciadores heterólogos para esses estudos. De fato, até o momento, avaliações desse tipo estão limitadas a dois estudos em

Oligoryzomys longicaudatus em que foram utilizadas sequências da região controle da mitocôndria (Boric-Bargetto et al., 2012) e locos de microssatélites (González-Ittig et al.,

2015). Contudo, a análise concomitante de sequencias e locos de microssatélites ainda não foi realizada em nenhum estudo.

Apesar disso, parece haver uma conexão entre uma dinâmica populacional complexa envolvendo oscilações dramáticas no tamanho populacional, padrões de dispersão e estruturação populacional em espécies de roedores sinantrópicos como Mus musculus

(Singleton et al., 2010) e Rattus rattus (Aplin & Lalsiamliana, 2010), com representantes das demais subfamílias de Cricetidae registrados no hemisfério norte como Arvicola (Berthier et al., 2005, 2006), Lemmus (Ehrich & Jorde, 2005), Myodes (Guivier et al., 2011) e Peromyscus

(Vessey & Vessey, 2007) e em insetos (Harrison, 1997; Lovett et al., 2002; Chapuis et al.,

2008, 2009). De modo geral, estas pesquisas revelam que, durante os episódios de alta populacional, pode haver um incremento na intensidade e distância de movimentos migratórios e o restabelecimento de fluxo gênico entre populações anteriormente isoladas

5 provocando a recuperação da diversidade genética da espécie e reduzindo as diferenças entre as populações (Ehrich & Jorde, 2005; Dong et al., 2010; Chapuis et al., 2011). No entanto, tanto a abrangência geográfica quanto a intensidade do possível efeito homogeneizante dessas irrupções populacionais dependerão da habilidade da espécie de dispersar tendendo a serem mais acentuados em espécies altamente vágeis e mais restritas naquelas espécies com menor capacidade de migração (Ronnàs et al., 2011).

De fato, diferenças sutis em fatores como vagilidade e generalismo relativo à seleção, uso e preferência por determinados hábitats parecem ser uma explicação plausível para os padrões de estruturação espacial distintos observados em algumas espécies envolvidas em ratadas (Palma et al., 2010; Boric-Bargetto et al., 2012; Gonzalez-Ittig et al., 2015). Dentre esses padrões, destacam-se: 1) a ausência de diferenciação populacional pronunciada em diferentes marcadores verificada em espécies com ampla distribuição geográfica como

Oligoryzomys longicaudatus (Palma et al., 2005; González-Ittig et al., 2010) e Necromys lasiurus (Macêdo & Mares, 1987; D'Elia et al., 2008), 2) o contraste entre tendências de conservadorismo citogenético e morfológico e de divergência molecular em espécies como

Abrothrix longipilis (Palma et al., 2010), Akodon montensis (Lara et al., 2005) e

Euryoryzomys russatus (Miranda et al., 2007; Libardi & Percequillo, 2008), 3) a falta de suporte morfológico e/ou molecular (Ventura et al., 2010; Moreira & Oliveira, 2011) para a possível descontinuidade cromossômica de uma população de Thaptomys nigrita localizada no extremo setentrional da distribuição com relação às amostras do sul e sudeste do Brasil

(Ventura et al., 2004). Esses resultados reforçam a necessidade de aprofundar o conhecimento sobre a história natural das espécies envolvidas ou não em ratadas como forma de entender a relação entre tais fatores intrínsecos e esse fenômeno bem como delimitar seu papel no

6 processo de evolução e estruturação populacional desses organismos e na disseminação de agentes patogênicos aos quais alguns deles estão associados (e.g. esquistossomose, hantavirose).

Nesse sentido, considerando-se a escassez de informações relativas à biologia básica das espécies de roedores da subfamília Sigmodontinae, especialmente aquelas envolvidas em ratadas, e da importância desse conhecimento para a caracterização adequada, detecção precoce e compreensão desse fenômeno e de suas possíveis consequências ecológicas, epidemiológicas e evolutivas, a presente tese de doutorado propôs a obtenção de sequencias de citocromo b, de dois marcadores nucleares (álcool desidrogenase I e intron 7 da cadeia do beta-fibrinogênio) e a genotipagem de locos de microssatélites previamente desenvolvidos para outros representantes da subfamília Sigmodontinae para realizar estudos de genética de populações e filogeografia em Necromys lasiurus (Lund, 1840), espécie ubíqua e comprovadamente sujeitas a tais oscilações demográficas, e Necromys lenguarum (Thomas,

1898), sua espécie-irmã geralmente não associada a ratadas.

A tese está estruturada em uma introdução geral do tema a ser estudado – as ratadas e estruturação populacional, dois capítulos referentes aos artigos produzidos ao longo do estudo, considerações finais e conclusões. O primeiro capítulo apresenta a descrição de sete locos de microssatélites desenvolvidos para Akodon cursor (Winge, 1887) e os resultados dos testes de amplificação cruzada dos mesmos em três outras espécies da tribo Akodontini, incluindo N. lasiurus. Esses locos foram utilizados para análises populacionais em N. lasiurus e N. lenguarum. Os resultados dessas análises, especialmente em relação à estruturação populacional, e sua comparação com os dados obtidos a partir de sequências de citocromo b

7 fazem parte do capítulo final da tese. Nesse segundo capítulo, são discutidas as possíveis causas dos padrões de estruturação populacional observados em N. lasiurus e N. lenguarum e infere-se a possível contribuição dos eventos climáticos do Pleistoceno e das ratadas na determinação das diferenças de diversidade genética dessas duas espécies.

1.1. Objetivos

Este estudo objetivou avaliar a relação entre os padrões de estruturação populacional em Necromys lasiurus e N. lenguarum e as irrupções populacionais localmente conhecidas ratadas.

1.1.1 Objetivos específicos

 Padronizar a amplificação e testar a utilidade de locos heterologos de microssatélites

para estudos populacionais nas espécies de Necromys e outros akodontinos;

 Ampliar a amostragem geográfica de Necromys no território brasileiro analisando

amostras do Brasil Central por meio de sequencias do gene mitocondrial citocromo b e

marcadores nucleares tais como álcool desidrogenase e intron-7 do beta-fibrinogênio;

 Examinar os padrões de variação genética em N. lasiurus e N. lenguarum, medidos por

meio de sequencias dos marcadores acima citados e da genotipagem de microssatélites,

comparando-os entre as duas espécies e com àqueles relacionados com outras espécies

envolvidas ou não em ratadas;

 Investigar os fatores envolvidos na origem e manutenção dos padrões revelados;

1.2. Referências Bibliográficas

Almeida, F.C.; Maroja, L.S.; Seuánez, H.N.; Cerqueira, R. & Moreira, M.A.M. 2000. Identification of microsatellite loci in the water-rat Nectomys squamipes (Rodentia Sigmodontinae). Molecular Ecology, 9: 2172–2173.

Aplin, K.P. & Lalsiamliana, J. 2010. Chronicle and impacts of the 2005-09 mautam in Mizoram. Pp. 13–48. In: Singleton, G.; Belmain, S.; Brown, P. & Hardy, B. (Eds.) Rodent Outbreaks: Ecology and Impacts. Los Baños (Philippines), International Rice Research Institute.

Berthier, K.; Charbonnel, N.; Galan, M.; Chaval, Y. & Cosson, J-F. 2006. Migration and recovery of the genetic diversity during the increasing density phase in cyclic vole populations. Molecular Ecology, 15; 2665–2676.

Berthier, K.; Galan, M.; Foltête, J-C.; Charbonnel, N. & Cosson, J-F. 2005. Genetic structure of the cyclic fossorial water vole (Arvicola terrestris): Landscape and demographic influences. Molecular Ecology, 14: 2861–2871.

Bonvicino, C.R.; Oliveira, J.A. & D´Ándrea, P.S. 2008. Guia dos Roedores do Brasil com chaves para gêneros baseadas em caracteres externos. Rio de Janeiro, Centro Pan- Americano de Febre Aftosa-OPAS/OMS, 120 pp..

Chapuis, M-P; Lecoq, M.; Michalakis, Y.; Loiseau, A.; Sword, G.A.; Piry, S. & Estoup, A. 2008. Do outbreaks affect genetic population structure? A worldwide survey in Locusta migratoria, a pest plagued by microsatellite null alleles. Molecular Ecology, 17: 3640– 3653.

Chapuis, M-P; Loiseau, A.; Michalakis, Y.; Sword, G.A.; Lecoq, M.; Franc, A. & Estoup, A. 2009.Outbreaks, gene flow and effective population size in the migratory locust, Locusta migratoria: a regional-scale comparative survey. Molecular Ecology, 18: 792–800.

Chapuis, M-P; Popple, J.A.M.; Berthier, K.; Simpson, S.J.; Deveson, E.; Spurgin, P.; Steinbauer, M.J & Sword, G.A. 2011.Challenges to assessing connectivity between massive populations of the Australian plague locust. Proceedings of the Royal Society of London B, 278 (1721): 3152–3160.

Chiappero, M.B.; Gardenal, C.N. & Panzetta-Dutari, G.M. 2005. Isolation and characterization of microsatellite markers in Calomys musculinus (Muridae, Sigmodontinae, Phyllotini), the natural reservoir of Junin virus. Molecular Ecology Notes, 5: 593–595.

Chiappero, M.B.; Panzetta-Dutari, G.M.; Gómez, D.; Castillo, E.; Polop, J.J. & Gardenal, C.N. 2011. Contrasting genetic structure of urban and rural populations of the wild rodent Calomys musculinus (Cricetidae, Sigmodontinae). Mammalian Biology, 76: 41–50.

Costello, A.B; Down, T.E.; Pollard, S.M.; Pacas, C.J. & Taylor, E.B. 2003. The influence of history and contemporary stream hydrology on the evolution of genetic diversity within

species: an examination of microsatellite DNA variation in bull trout, Salvelinus confluentus (Pisces: salmonidae). Evolution, 57: 328–244.

Cullingham, C.I.; Pond, B.A: Kyle, C.J.; Rees, E.E.; Rosatte, R.C. & White, B.N. 2008. Combining direct and indirect genetic methods to estimate dispersal for informing wildlife disease management decisions. Molecular Ecology, 17: 4874–4886.

D’Elia, G.; Pardiñas, U.F.J.; Jayat, J.P. & Salazar-Bravo, J. 2008. Systematics of Necromys (Rodentia, Cricetidae,Sigmodontinae): species limits and groups, with comments on historical biogeography. Journal of Mammalogy, 89(3): 778–790.

Deter, J.; Chaval, Y.; Galan, M.; Gauffre, B.; Morand, S.; Henttonen, H.; Laakkonen, J.; Voutilainen, L.; Charbonnel, N. & Cosson, J.F. 2008. Hinship, dispersal and hantavirus transmission in bank and common voles. Archives of Virology, 153: 435–444.

Dong, J.; Li, C. & Zhang, Z. 2010. Density-dependent genetic variation in dynamic populations of the greater long-tailed hamster (Tscherskia triton). Journal of Mammalogy, 91(1): 200–207.

Ehrich, D. & Jorde, E. 2005. High genetic variability despite high-amplitude population cycles in lemmings. Journal of Mammalogy, 86: 380–385.

Gallardo, M. & Mercado, C. 1999. Mast seeding of bamboo shrubs and mouse outbreaks in southern Chile. Mastozoologia Neotropical, 6: 103–111.

Garza, J.C.; Dallas, J.; Duryadi, D.; Gerasimov, S.; Croset, H. & Boursot, P. 1997. Social structure of the mound-building mouse Mus spicilegus revealed by genetic analysis with microsatellites. Molecular Ecology, 6:1009–1017.

González, L.A.; Murúa, R. & Jofré, C. 2000. Habitat utilization of two muroid species in relation to population outbreaks in southern temperate forests of Chile. Revista Chilena de Historia Natural, 73: 489–495.

González-Ittig, R.; Salazar-Bravo, J.; Polop, J. & Gardenal, C.N. 2008. Isolation and characterization of microsatellite markers in Oligoryzomys longicaudatus (Muridae, sigmodontinae, Oryzomyini), the natural reservoir of genotype Andes hantavirus. Molecular Ecology Resources, 8: 1466–1468.

González-Ittig, R.E.; Rossi-Fraire, H.J.; Cantoni, G.E.; Herrero, E.R.; Benedetti, R.; Gallardo, M.H. & Gardenal, C.N. 2010. Population genetic structure of long-tailed pygmy rice rats (Oligoryzomys longicaudatus) from Argentina and Chile based on the mitochondrial control region. Canadian Journal of Zoology, 88: 23–35.

Guivier, E.; Galan, M.; Chaval, Y.; Xuéreb, A.; Salvador, A.R.; Poulle, M.L.; Voutilainen, L.; Henttonen, H.; Charbonnel, N. & Cosson, J.F. 2011. Landscape genetics highlights the role of bank vole metapopulation dynamics in the epidemiology of Puumala hantavirus. Molecular Ecology, 20, 17, 3569-3583.

Harrison S (1997) Persistent, localized outbreaks in the western tussock moth (Orgyia vetusta): the roles of resources, predation and poor dispersal. Ecological Entomology, 22: 158–166.

Jaksic, F.M. & Lima, M. 2003. Myths and facts on ratadas: bamboo blooms, rainfall peaks and rodent outbreaks in South America. Austral Ecology, 28: 237–251.

Jarne, P. & Lagoda, P.J.L. 1996. Microsatellites from molecules to populations and back. Trends in Ecology and Evolution, 11: 424–429.

Johnson, M.S. & Black, R. 1995. Neighbourhood size and the importance of barriers to gene flow in an intertidal snail. Heredity, 45: 142–154.

Lara, M.C.; Geise, L. & Schneider, C.J. 2005. Diversification of small mammals in the Atlantic Forest of Brazil. Pp. 311–353. In: Lacey, E.A. & Myers, P., (Eds). Mammalian Diversification: From Chromosomes to Phylogeography (a celebration of the career of James L. Patton). Berkeley, University of California Press.

Libardi, G.S. & Percequillo, A.R. 2008. Variação geográfica e não-geográfica de Euryoryzomys russatus (Rodentia: Sigmodontinae). In: Anais da XVI Simposio Internacional de Iniciação Científica. São Paulo, Universidade de São Paulo.

Lima, M.P.; Marquet, A. & Jaksic, F.M. 1999. El Niño events, precipitation patterns, and rodent outbreaks are statistically associated in semiarid Chile. Nordic Society Oikos, 22(2): 213-218

Lovett, G.M.; Christenson, L.M.; Groffman, P.M.; Jones, C.G.; Hart, J.E. & Mitchell, M.J. 2002. Insect defoliation and nitrogen cycling in forests Bioscience, 52(4): 335–341.

Macêdo, R.H. & Mares, M.A. 1987. Geographic variation in the south american cricetine rodent Bolomys lasiurus. Journal of Mammalogy, 68(3): 578–594.

Maroja, L.S.; Almeida, F.C.; Cerqueira, R.; Seuánez, H.N. & Moreira, M.A.M. 2003. Nectomys squamipes microsatellites and homologous loci in sigmodontine rodents. Journal of Heredity, 94(2): 171–174.

Miranda, G.B.; Andrades-Miranda, J.; Oliveira, L.F.B.; Langguth, A. & Mattevi, M.S. 2007. Geographic patterns of genetic variation and conservation consequences in three south American rodents. Biochemical Genetics, 45: 839–856.

Neigel, J.E. 1997. A comparison of alternative strategies for estimating gene flow from genetic markers. Annual Review of Ecology and Systematics, 28: 105–128.

Palma, R.E.; Cancino, R.A. & Rodríguez-Serrano, E. 2010. Molecular systematics of Abrothrix longipilis (Rodentia: Cricetidae: Sigmodontinae) in Chile. Journal of Mammalogy, 91(5): 1102–1111.

Palma, R.E.; Rivera-Milla, E.; Salazar-Bravo, J.; Torres-Pérez, F.; Pardiñas, U.F.J.; Marquet, P.A.; Spotorno, A.E.; Meynard, A.P. & Yates, T.L. 2005. Phylogeography of Oligoryzomys longicaudatus (Rodentia: Sigmodontinae) in temperate South America. Journal of Mammalogy 86: 191–200.

Pardiñas, U.F.J.; D’Elía, G. & Ortiz, P.E. 2002. Sigmodontinos fósiles (Rodentia, Muroidea, Sigmodontinae) de América del Sur: estado actual de su conocimiento y prospectiva. Mastozoologia Neotropical, 9(2): 209–252.

Pearson, O.P. 2002. A perplexing outbreak of mice in Patagonia, Argentina. Studies on Neotropical Fauna and Environment, 37: 187–200.

Ronnàs, C.; Cassel-Lundhagen, A.; Battisti, A.; Wallen, J. & Larsson, S. 2011. Limited emigration from an outbreak of a forest pest insect. Molecular Ecology, 20: 4606–4617.

Sage, R.D.; Pearson, O.P.; Sanguinetti, J. & Pearson, A.K. 2007. Ratada 2001: a rodent outbreak following the flowering of bamboo (Chusquea culeou) in southern Argentina. Pp. 177–224 In: Kelt, D.A.; Lessa, E.P.; Salazar-Bravo, J. & Patton, J.L. (Eds.). The quintessential naturalist: honoring the life and legacy of Oliver P. Pearson. Berkeley, University of California Press.

Singleton, G.; Belmain, S.; Brown, P. & Hardy, B. (Eds.). 2010. Rodent Outbreaks: Ecology and Impacts. Los Baños (Philippines), International Rice Research Institute, 289 p.

Slatkin, M. 1985. Gene flow in natural populations. Annual Review of Ecology and Systematics. 16: 393–430.

Slatkin, M. 1987. Gene flow and the geographic structure of natural populations. Science, 236: 787–792.

Ventura, K..; Silva, M.J.J.; Fagundes, V.; Pardini, R. & Yonenaga-Yassuda, Y. 2004. An undescribed karyotype for Thaptomys (2n = 50) and the mechanism of differentiation from Thaptomys nigrita (2n = 52) evidenced by FISH and Ag–NORs. Caryologia, 57: 89–97.

Ventura, K.; Silva, M.J.J. & Yonenaga-Yassuda, Y. 2010. Thaptomys Thomas 1915 (Rodentia, Sigmodontinae, Akodontini) with karyotypes 2n=50, FN=48 and 2n=52, FN=52: Two monophyletic lineages recovered by molecular phylogeny. Genetics and Molecular Biology, 33(2): 256–261.

Vera, N.S.; Chiappero, M.B.; Priotto, J.W. & Gardenal, C.N. 2011. Isolation of microsatellite loci in Akodon azarae (Muridae,Sigmodontinae) and cross-amplification in other Akodontini species. Journal of Genetics, 90(1): 25–29.

Vessey, S.H. & Vessey, K.B. 2007. Linking behavior, life history and food supply with the population dynamics of white-footed mice (Peromyscus leucopus). Integrative Zoology. 2: 123–130.

Capítulo 1

Artigo publicado no Boletim da Sociedade Brasileira de Mastozoologia, 71,

Isolamento de locos de microssatélites em Akodon cursor (Cricetidae, Sigmodontinae) e

amplificação cruzada em outros roedores akodontinos

Isolation of polymorphic microsatellite loci in Akodon cursor (Cricetidae, Sigmodontinae) and

cross-amplification in other akodontine rodents

Isolamento de locos de microssatélites em Akodon cursor (Cricetidae, Sigmodontinae) e

amplificação cruzada em outros roedores akodontinos

Isolation of polymorphic microsatellite loci in Akodon cursor (Cricetidae, Sigmodontinae) and

cross-amplification in other akodontine rodents

Título abreviado: Novel polymorphic microsatellite loci in Akodon cursor

Jânio C. Moreira1,2,3, Ana Beatriz A. da Cunha4,5,6, Miguel A. M. Moreira5, João A. de Oliveira1,2,

Cibele R. Bonvicino5, Rui Cerqueira6

1 Setor de Mastozoologia, Departamento de Vertebrados, Museu Nacional/UFRJ, Quinta da Boa

Vista s/n,São Cristovão, Rio de Janeiro, RJ, Brazil, CEP 20940-040,

2 Programa de Pós-Graduação em Biodiversidade e Biologia Evolutiva, UFRJ, Ilha do Fundão,

Cidade Universitária, Rio de Janeiro, RJ, Brazil

3 Corresponding author: e-mail: [email protected]

4 Programa de Pós-Graduação em Ciências Biológicas (Genética), UFRJ, Ilha do Fundão, Cidade

Universitária, Rio de Janeiro, RJ, Brazil

5 Programa de Genética, Instituto Nacional de Câncer, Rio de Janeiro, RJ, Brazil

6 Laboratório de Vertebrados, Departamento de Ecologia, IB, CCS, Universidade Federal do Rio de

Janeiro, Ilha do Fundão, Rio de Janeiro, RJ, Brazil

Resumo (até 100 palavras)

Oito novos locos de microssatélites foram isolados para Akodon cursor, tendo sido testada a amplificação cruzada em Akodon serrensis, Necromys lasiurus e Thaptomys nigrita. A espécie foco

desse estudo apresentou um número de alelos por loco variando de 2 a 20 e valores de heterozigosidades observada (0,1–1) e esperada (0,1 – 0,94) similares. O número de locos com amplificação cruzada bem sucedida variou de 4 (A. serrensis) a 7 (N. lasiurus). Os elevados níveis de polimorfismo reportados sugerem a utilidade dos marcadores testados para estudos futuros de estrutura populacional e genética da paisagem em todas as espécies estudadas.

Palavras chave: genética da paisagem, microssatelites, amplificação heteróloga, Sigmodontinae,

Mata Atlântica.

Abstract (100 words)

We characterized 8 novel polymorphic microsatellite markers for Akodon cursor, and tested their cross-amplification in Akodon serrensis, Necromys lasiurus and Thaptomys nigrita. The focal species displayed a number of alleles per locus varying from 2 to 20, and observed and expected heterozygosities ranging from 0.1 to 1 and from 0.1 to 0.94, respectively. The number of successfully cross-amplified markers varied from 4 (A. serrensis) to 7 (N. lasiurus). The high levels of polymorphism found suggest that these markers are potentially useful for future studies of population structure and landscape genetic studies in all tested species.

Key words: landscape genetics, microsatellite, cross-amplification, Sigmodontinae, Atlantic Forest.

Akodon cursor (Winge, 1887) is one of the most common species in the Sigmodontinae assemblages inhabiting the Atlantic Rainforest in eastern Brazil between latitudes 8⁰S and 26⁰S

(Geise, 2012). Its wide distribution encompasses both natural environments and areas with different levels of anthropogenic influence (Bonvicino et al., 2008). This environmental heterogeneity is reflected in high levels of both chromosomal (Fagundes et al., 1998) and molecular polymorphisms

(Geise et al., 2001, 2007; Nogueira & Fagundes, 2008), characteristics shared by other species in the genus (Coyner et al., 2013). Interestingly, geographic analyses in Akodon cursor have disclosed

a marked incongruence among morphological, chromosomal, and molecular data (Geise, 2012).

While morphological and chromosomal data reveal a lack of geographic structure (Geise et al.,

2007), molecular analyses employing mitochondrial markers delineated two geographically distinct groups of haplotypes: a northern clade comprising samples from northeastern Brazil and a southern clade composed of specimens from southeastern Brazil (Nogueira & Fagundes, 2008). Although mitochondrial markers proved useful in revealing the existence of these two haplogroups in Akodon cursor, they were not sufficiently variable to resolve, for example, the relationships among populations within these groups.

The use of highly variable microsatellite nuclear markers in fine-scale spatial genetic studies can provide valuable insights into the role of factors such as geographic barriers (Nogueira &

Fagundes, 2008), geographic distance (Colombi et al., 2010; Yazbeck et al., 2011), habitat fragmentation, population dynamics, demography and vagility in shaping the patterns of genetic diversity of a species (Freeland et al., 2011). For this purpose, we here characterize eight polymorphic microsatellite loci isolated from A. cursor, and report the results of cross-species amplification tests carried out in three other Akodontini: Akodon serrensis Thomas 1902, Necromys lasiurus (Lund, 1841) and Thaptomys nigrita (Lichtenstein, 1829).

We extracted genomic DNA for library construction and genotyping from ethanol-preserved liver tissue using the standard proteinase-K/phenol-chloroform protocol (Sambrook & Russell,

2000). Microsatellite loci were isolated from an enriched genomic library following the protocols described in Almeida et al. (2000) and Maroja et al. (2003). Briefly, a high-quality genomic DNA sample (10µg) from a single A. cursor specimen was digested with AluI (New England Biolabs); size-selected fragments (ranging from 200 to 600 bp) were then excised from agarose gel and linked into SmaI-digested, dephosphorylated pUC18 and transferred to E. coli DH5 competent cells.

DNA from recombinant colonies was transferred to nylon membranes (NEN) and hybridized to

[γ32P]-ATP labeled (GT)10, (CT)10, (AGG)7, (GAA)7 and (GATA)5 oligonucleotide-probes. We isolated plasmids from 45 positive colonies by the miniprep alkaline-lysis procedure (Sambrook &

Russell, 2000). Inserts were amplified by polymerase chain reaction (PCR) using M13 universal primers (Forward: 5’GTAAAACGACGGCCAGT3’ and Reverse:

5’CCCAGTCACGTTGTAAAACG3’) following a pre-denaturation step at 94°C for 2 min, and 35 cycles at 94°C for 30 sec, 55°C for 30 sec and 72°C for 30 sec, with a final extension of 72°C for 10 min. PCR was carried out with 1U of Tth DNA Polymerase (Biotools), 100ng of DNA template, 5l of 10X PCR Buffer (75 mM Tris-HCl, 2.0 mM MgCl2, 50 mM KCl, 20 mM (NH4)SO4), 10 picomoles of each M13 primer and 0.3mM of each dNTP in a final volume of 50 l. Amplicons were purified with GFX™ PCR DNA and Gel Band Purification kit (GE Healthcare), labeled with

Big Dye™ Terminator Cycle Kit (Applied Biosystems) and sequenced in both directions using an

ABI Prism 377 automated sequencer. Sequences from thirteen different plasmids were selected for the design of primers flanking the microsatellite regions using the program Primer3 (Rozen &

Skaletsky, 2000). To optimize amplification conditions, PCR was performed in final volumes of

15µl with approximately 40 ng of genomic DNA, 1.5µl of 10X PCR Buffer (75 mMTris–HCl, 2.0 mM MgCl2, 50 mM KCl, 20 mM (NH4)SO4), 6–10 pmol of each primer, 300µmol of each dNTP, and 0.5U of Tth DNA Polymerase (Biotools),with an initial denaturation step of 3 min at 94⁰C followed by 30–35 cycles of 30 sec at 94⁰C, 30 sec at the specific annealing temperatures for primer pairs [Ta⁰C, see Table 1], 30 sec at 72⁰C, and a final extension period of 4–7 min at 72⁰C.

Eight primer pairs (Table 1) produced good quality amplification patterns and were evaluated in 30 A. cursor specimens from a natural population from southeastern Brazil

(Guapimirim, Rio de Janeiro: 22⁰02'S, 42⁰59'W). For this step, we labeled the forward primer with a 6-FAM fluorescent dye. These primer sets were also tested for amplification in three other akodontine species (Table 2): Akodon serrensis, Necromys lasiurus and Thaptomys nigrita. We

separated and electrophoresed Amplicons on a Megabace 1000 automated sequencer (GE

Healthcare) using ET400-ROX size standard. We carried out allele sizing and genotype confirmation in Genetic Profiler v.2.2 (GE Healthcare). To calculate observed and expected heterozygosities we used Cervus 3.0.3 (Kalinowski et al., 2007), and checked for the presence of null alleles with the program Microchecker (van Oosterhout et al., 2004); deviations from Hardy-

Weinberg and linkage equilibrium between loci were tested with GENEPOP 4.2 (Raymond &

Rousset, 1995). To control for the false discovery rate (type I error) we adjusted the significance criteria for all multiple comparisons by using the Bonferroni correction (Rice, 1989). Thus, only loci showing significant p-values after correction are highlighted in the results paragraphs and in table 2.

Genotyping of the eight microsatellite loci in 30 individuals of Akodon cursor (Table 2) revealed an average of 14.25 alleles per locus with a minimum of 2 (AkH1) and a maximum of 20

(AkC1), totaling 114 alleles. Values for the observed (Ho) and expected (He) heterozygosities ranged from 0.1 to 1 and from 0.1 to 0.94, respectively. The polymorphism information content

(PIC) per locus ranged from 0.09 (AkH1) to 0.92 (AkC1), with an average of 0.795. PIC is an index of the potential locus suitability of a given molecular marker in population genetics studies

(Botstein et al., 1980). The most useful markers are those with PIC values higher than 0.5 (Souza et al., 2012; Mishra et al., 2014). With PIC values exceeding 0.85, seven of the eight tested loci met this condition while locus AkH1 was considered slightly informative (PIC<0.25). None of the 8 loci departed significantly from Hardy-Weinberg equilibrium but significant linkage disequilibrium was found between both AkJ1/AkL1 (p=0) and AkJ1/AkPQAc1 (p=0.0002), even after Bonferroni correction (adjusted alpha=0.0008). In addition, Micro-checker analyses failed to reveal any evidence of scoring errors, large allele dropout, or the presence of null alleles for any loci. Together, these results suggest that, with the exception of AkH1, the new loci described here are highly polymorphic (Table 2) and extremely promising for evaluating the genetic variability of the studied

species. Nevertheless, given that these results are based on the analysis of a single population, their potential should be further tested in a more detailed population study, which should include larger sample sizes and additional populations. Such an investigation could also clarify if the linkage disequilibrium reported here is due to null alleles or to demographic factors such as inbreeding, bottlenecks, or immigration (Sabatti & Risch, 2002; Falush et al., 2007; Bucher et al., 2009).

Interestingly, the high levels of heterozygosis and polymorphism at the microsatellite loci herein described are similar to those reported for other sigmodontine rodents such as Nectomys squamipes

(mean Ho=0.704 - Almeida et al., 2000; Maroja et al., 2003), Calomys musculinus (mean Ho=0.525

- Chiappero et al., 2005), Akodon azarae (mean Ho=0.664 - Vera et al., 2011), and Oligoryzomys longicaudatus (mean Ho=0.635 - Gonzalez-Ittig et al., 2008).

Results of cross-amplification analyses, detailed in Table 2, were similar to those observed in Akodon cursor, with highly polymorphic loci. A single locus, AkH1, failed to amplify in the three species tested. Cross-amplification proceeded best in Necromys lasiurus (7 loci), followed by

Thaptomys nigrita (6) and Akodon serrensis (4). In these species, amplified loci exhibited values of

Ho and He exceeding 0.78, and PIC values ranging from 0.7 (A. serrensis) to 0.93 (N. lasiurus and

T. nigrita). There was no significant deviation from Hardy-Weinberg equilibrium but significant linkage disequilibrium was found between AkJ1/AkL1 in both Necromys lasiurus (p=0.00069; adjusted α=0.0011) and Thaptomys nigrita (p=0.0004; adjusted α=0.0017).

The successful transferability evidenced by such results points to these novel markers as promising tools for future population genetics and molecular ecology studies investigating dispersal patterns, genetic connectivity among populations, social structure and population dynamics in

Akodon cursor and closely related species. Because some of these species (e.g., Necromys lasiurus) are associated with Hantaviruses and plague, such studies could provide a better understanding of

the role of genetic diversity in susceptibility for these zoonoses, thus contributing to improved management, epidemiological surveillance, and prevention strategies.

Acknowledgments:

Original conception and experiments to isolate loci, design primers and optimize amplification in

Akodon cursor took place during the development of a MS dissertation by A.B.A. da Cunha in the

Genetics Graduate Program of the Federal University of Rio de Janeiro (UFRJ). Development of cross-amplification experiments in Akodon serrensis, Necromys lasiurus, and Thaptomys nigrita is part of the DS requirements of J.C. Moreira at the Biodiversity and Evolutionary Biology Graduate

Program of the UFRJ. We are indebted to Dr. Hector Seuanez for providing laboratory facilities.

We are also grateful to K. Lobo, L. Monnerat, K. Moura and C. Furtado for assistance during the genotyping procedure. F. Pedone, S. Amaro, C. Furtado and F. Knackfuss helped with valuable suggestions during PCR optimization and the statistical analyses. Two anonymous referees thoroughly reviewed the submitted manuscript providing valuable comments that greatly improved the quality of this manuscript. Special thanks are due to Christopher J. Tribe for revising the English grammar and structure of the final version. Financial support was provided by CAPES (RC), CNPq

(CRB, JAO, MAMM, RC), FAPERJ (CRB, JAO – process number E26/111.720/2012),

PPBio/CNPq/Rede BioM.A, and PROBIO II/MCT/MMA/GEF (RC). JCM benefited from a doctoral scholarship from CAPES and ABAC benefited from a MS fellowship from CNPq.

References:

Almeida FC, Maroja LS, Seuánez HN, Cerqueira R, Moreira MAM. 2000. Identification of microsatellite loci in the water-rat Nectomys squamipes (Rodentia Sigmodontinae). Molecular Ecology 9(12): 2172–2173.

Bonvicino CR, Oliveira JA, D´Ándrea PS. 2008. Guia dos Roedores do Brasil com chaves para gêneros baseadas em caracteres externos. Centro Pan-Americano de Febre Aftosa-OPAS/OMS, Rio de Janeiro.

Botstein D, White RL, Skolnick M, Davis RW. 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. The American Journal of Human Genetics 32(3): 314–331.

Bucher TB, Wandeler P, Hegelbach J, Keller LF. 2009. Development of microsatellite loci in the European Dipper, Cinclus cinclus. Conservation Genetics Resources, 1(1): 309–312

Chiappero MB, Gardenal CN, Panzetta-Dutari GM. 2005. Isolation and characterization of microsatellite markers in Calomys musculinus (Muridae, Sigmodontinae, Phyllotini), the natural reservoir of Junin virus. Molecular Ecology Notes 5(3): 593–595. http://dx.doi.org/10.1111/j.1471-8286.2005.01003.x

Colombi VH, Lopes SR, Fagundes V. 2010. Testing the Rio Doce as a riverine barrier in shaping the Atlantic rainforest population divergence in the rodent Akodon cursor. Genetics and Molecular Biology 33(4): 785–789. http://dx.doi.org/10.1590/S1415-47572010000400029

Coyner BS, Braun JK, Mares MA, Van Den Bussche RA. 2013. Taxonomic validity of species groups in the genus Akodon (Rodentia, Cricetidae). Zoologica Scripta 42(4): 335–350. http://dx.doi.org/10.1111/zsc.12014

Fagundes V, Christoff AU. and Yonenaga-Yassuda Y. 1998. Extraordinary chromosomal polymorphism with 28 different karyotypes in the neotropical species Akodon cursor (Muridae, Sigmodontinae), one of the smallest diploid number in rodents (2n = 16, 15 and 14).-Hereditas, 129: 263–274.

Falush D, Stephens M, Pritchard JK 2007. Inference of population structure using multilocus genotype data: dominant markers and null alleles. Molecular Ecology Notes, 7: 574–578.

Freeland JR, Kirk H and Petersen S. 2011. Molecular Ecology, 2nd edition. John Wiley & Sons, Chichester, West Sussex, United Kingdom.

Geise L. 2012. Akodon cursor (Rodentia: Cricetidae). Mammalian Species 44(1): 33–43. http://dx.doi.org/10.1644/893.1

Geise L, Smith MF, Patton JL. 2001. Diversification in the genus Akodon (Rodentia, Sigmodontinae) in southeastern South America: Mitochondrial DNA sequence analysis. Journal of Mammalogy 82(1): 92–101. http://dx.doi.org/10.1644/1545– 1542(2001)082<0092:DITGAR>2.0.CO;2

Geise L, Marroig G, Pereira LG. 2007. Comparative craniofacial morphometry, karyotypic and mtDNA in the Akodon cursor (Rodentia, Muridae) from the South American Atlantic Forest: integrative approaches. Journal of Morphology 268: 1076.

González-Ittig R, Salazar-Bravo J, Polop J, Gardenal CN. 2008. Isolation and characterization of microsatellite markers in Oligoryzomys longicaudatus (Muridae, Sigmodontinae, Oryzomyini), the natural reservoir of genotype Andes hantavirus. Molecular Ecology Resources 8(6): 1466– 1468. http://dx.doi.org/10.1111/j.1755-0998.2008.02231.x

Kalinowski ST, Taper ML, Marshall TC. 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology 16(5): 1099–1006. http://dx.doi.org/10.1111/j.1365-294X.2007.03089.x

Maroja LS, Almeida FC, Cerqueira R, Seuánez HN, Moreira MAM. 2003. Nectomys squamipes microsatellites and homologous loci in sigmodontine rodents. Journal of Heredity, 94(2): 171– 174. http://dx.doi.org/10.1093/jhered/esg017

Mishra S, Sharma R, Singh SK, Munjal AK, Goyal SP. 2014. A comparative study of the use of tiger-specific and heterologous microsatellite markers for population genetic studies of the Bengal tiger (Panthera tigris tigris). African Journal of Biotechnology 13 (8): 936–943. http://dx.doi.org/10.5897/AJB12.2977

Nogueira CDA, Fagundes V. 2008. Akodon cursor Winge, 1887 (Rodentia, Sigmodontinae): One or two species? New evidences based on molecular data. Zootaxa 1768: 41–51.

Raymond M, Rousset F. 1995. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity 86(3): 248–249.

Rice WR. 1989. Analyzing tables of statistical tests. Evolution, 43(1): 223–225.

Rozen S, Skaletsky H. 2000. Primer3 on the WWW for general users and for biologist programmers. Pp. 365–386, in Krawetz S, Misener S (Eds.), Bioinformatics Methods and Protocols in the series Methods in Molecular Biology. Humana Press, Totowa, NJ.

Sabatti C, Risch N. 2002: Homozygosity and linkage disequilibrium. Genetics, 160: 1707–1719.

Sambrook J, Russell DW. 2000. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Souza ASMC, Mino CI, Lama SND. 2012. Polymorphic heterologous microsatellite loci for population genetics studies of the white-faced ibis Plegadis chihi (Vieillot, 1817) (Pelecaniformes, Threskiornithidae). Genetics and Molecular Biology 35(1): 74–80. http://dx.doi.org/10.1590/S1415-47572012005000018.

Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. 2004. MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4(3): 535–538. http://dx.doi.org/10.1111/j.1471-8286.2004.00684.x

Vera NS, Chiappero MB, Priotto JW, Gardenal CN. 2011. Isolation of microsatellite loci in Akodon azarae (Muridae, Sigmodontinae) and cross-amplification in other Akodontini species. Journal of Genetics, 90(1): 25–29. http://www.ias.ac.in/jgenet/OnlineResources/90/e25.pdf

Yazbeck GM, Brandão RL, Cunha HM, Paglia AP. 2011. Detection of two morphologically cryptic species from the cursor complex (Akodon spp; Rodentia, Cricetidae) through the use of RAPD markers. Genetics and Molecular Research 10 (4): 2881–2892. http://dx.doi.org/10.4238/2011.November.22.2

Table 1. Characteristics of the seven polymorphic microsatellite markers isolated in Akodon cursor. Ta Ak= annealing temperature in Akodon cursor, Ta het = heterologous annealing temperature, NC= number of cycles.

Ta Ak Ta het NC Allele Size Primer (5’ → 3’) Motif (⁰C) (⁰C) Range F-GCCAAAGTCTGCAAGCAA (CA) (GA) 55 55 35 225-303 AkC1 R-CTTTCTTAAGGCTTGTGGCC 6 29 F-GAGATTTAGTTTGGATGACCG AkH1 (CA) 58 58 30 230-234 R-GATGTTTTCCTTGGATTCC 6 F-GTATGGGTCCAACCTAACTTG AkJ1 (CA) 55 55 35 131-167 R-CAGGATTGAACTCAGTTTCTC 28 F- AkL1 GTAGTGGGTCCAACCTAACTTG (CA)15(17) 58 58 30 111-147 R-CATACTTGTAAGGGAAGCGTC F-CACCGCCCTGCTTTTATTTA (TAAA) and AkLi1.2 4 60 61 35 195-253 R-ACAAAAAGGTGGTGGTGCAT (TC)7 AkPQAc F-AGGTACCCGCAACTCTTACA (TG) 63 45 30 188-252 1 R-GGCAAGTTCTAAGCCAACGA 23 AkPQAs F-CTCCTGCCCTGTGTTTATCA (CA) 60 60 35 164-214 1 R-CTTGAAGGGCTTCCAGACAC 24 F-GGGAAAGCACGACAACTGAT (GT) and AkPQT1 24 65 60 30 191-235 R-TTCCTCTTTCCCCTTCCTGT (CA)4

Table 2. Results of genotyping in Akodon cursor showing which loci worked best and were polymorphic in cross-amplification tests in three other akodontine species. N=sample size, Na=observed number of alleles, Ho=observed heterozygosity, He=expected heterozygosity, p=p value for Hardy-Weinberg Equilibrium, PIC=polymorphism information content. Cells with dashes (-) denote amplification failure. Significant linkage disequilibrium: a and b: Akodon cursor (corrected α=0.05/56=0.0008) - aAkJ1 & AkL1(p=0), b AkJ1 & AKPQAc1(p=0.0002); c: Necromys lasiurus (corrected α=0.05/42=0.0011) - cAkJ1 & AkL1(p=0.00069); and d: Thaptomys nigrita (corrected α=0.05/30=0.0017) - dAkJ1 & AkL1(p=0.0004).

Cross-amplification experiments Akodon cursor Necromys lasiurus Thaptomys nigrita Akodon serrensis

Na Ho He PIC p N Na Ho He PIC p N Na Ho He PIC p N Na Ho He PIC p

AkC1 20 0.97 0.94 0.92 0.84 27 19 1.00 0.95 0.93 0.55 ------15 10 1.00 0.88 0.84 0.67 AkH1 2 0.10 0.10 0.09 0.77 ------AkJ1a,b,c,d 18 0.97 0.93 0.91 0.78 26 20 0.96 0.94 0.92 0.77 23 17 0.91 0.93 0.90 0.31 11 10 1.00 0.90 0.84 0.34 AkL1a,c,d 17 0.97 0.91 0.89 0.80 19 16 1.00 0.93 0.93 0.04 21 11 1.00 0.89 0.85 0.52 2 4 1.00 1.00 0.70 1.00 AkLi1.2 16 1 0.92 0.90 0.93 18 18 0.94 0.95 0.91 0.80 18 21 1.00 0.96 0.93 1.00 18 8 0.89 0.84 0.79 0.14 AkPQAc1b 13 0.97 0.91 0.89 0.45 13 13 0.78 0.92 0.89 0.14 21 14 0.99 0.89 0.86 0.12 ------AkPQAs1 17 0.96 0.94 0.91 0.18 27 16 1.00 0.93 0.90 0.66 19 14 1.00 0.86 0.82 0.31 ------AkPQT1 11 1 0.88 0.85 0.29 23 16 0.96 0.92 0.89 0.71 26 12 0.85 0.87 0.84 0.59 ------Mean 14.25 0.87 0.82 0.80 16.86 0.95 0.93 0.91 14.83 0.96 0.90 0.87 8.00 0.97 0.90 0.79

Capítulo 2

Artigo a ser submetido ao periódico Journal of Biogeography

Pleistocene climate changes and the diversification of lowland species of the rodent

genus Necromys in South American Dry Diagonal formations

ORIGINAL ARTICLE

Pleistocene climate changes and the diversification of lowland species of the rodent

genus Necromys in South American Dry Diagonal formations

Jânio C. Moreira1,2, Júlio F. Vilela3, Fabrícia F. Nascimento4, Alexandra Bezerra5,

Cibele R. Bonvicino5 & João A. de Oliveira1,2,6

1. Programa de Pós-Graduação em Biodiversidade e Biologia Evolutiva,

Universidade Federal do Rio de Janeiro, Ilha do Fundão, Cidade Universitária,

Rio de Janeiro, RJ, Brazil

2. Setor de Mastozoologia, Departamento de Vertebrados, Museu Nacional/UFRJ,

Quinta da Boa Vista s/n, São Cristovão, Rio de Janeiro, RJ, Brazil, CEP 20940-

040

3. Laboratório de Biologia Evolutiva Teórica e Aplicada, Departamento de

Genética – Instituto de Biologia – CCS, UFRJ, Bloco A, Sala A2-095, Rua Prof.

Rodolpho Paulo Rocco, S/N, Cidade Universitária, CEP: 21941-617, Rio de

Janeiro, RJ, Brazil.

4. Department of Zoology, University of Oxford, South Parks Road, OX1 3PS,

United Kingdom

5. Laboratório de Biologia e Parasitologia de Mamíferos Reservatórios Silvestres,

Instituto Oswaldo Cruz, Fiocruz, 21045-900, Rio de Janeiro, RJ, Brazil,

6. Corresponding author: [email protected]

ABSTRACT

Aim: We analyzed phylogeographic patterns in the widely distributed sigmodontine rodent Necromys lasiurus and its closest relative N. lenguarum to unveil the relative role of climate-driven environmental shifts in shaping the diversification processes in the South American diagonal of open vegetation formations.

Location: Open South American vegetation formations: Chaco, Cerrado and Caatinga.

Methods: We used a comparative phylogeographic approach to understand the biogeographical and demographic history of N. lasiurus and N. lenguarum.

Mitochondrial and nuclear data of a a widespread sampling were analyzed by phylogenetics, networks and statistical tests. A molecular clock was used to obtain divergence time estimates. Finally, demographic changes were assessed by neutrality tests and mismatch distributions.

Results: Molecular analyses revealed N. lenguarum as a genetically non-structured species under fast recent demographic expansion. In contrast, N. lasiurus is structured in five geographical groups highly coincident with phytogeographic provinces of Cerrado and Caatinga and putatively long-term climate stable areas in the diagonal of dry formations. Molecular dating suggested that both the divergence between N. lasiurus and N. lenguarum as well as their main intraspecific demographic processes took place during the Pleistocene coinciding with periods of climate-driven environmental shifts.

Main conclusions: Regional singularities in the Pleistocene climate dynamics and species-specific differences on ecological features presumably caused N. lenguarum and

N. lasiurus to develop distinct phylogeographic patterns. A key intrinsic feature to understand these differences is the large density fluctuations termed as "ratadas" which would maintain large effective population sizes and high genetic diversity in N.

lasiurus. These findings underscore the role of the Pleistocene oscillating climates in shaping and originating diversity in Neotropics. Our results have also implication on public health policies, as N. lasiurus is implied as one of the most relevant reservoir of diseases, such as bubonic plague and hantaviruses.

Keywords

Comparative phylogeography, Dry Diagonal, Neotropical Region, widely distributed species, climate change, Pleistocene Refugia, secondary contact, rodent outbreaks, public health, bubonic plague.

Introduction

Pleistocene climate cycles profoundly altered the spatial distribution of vegetation formations worldwide by repeatedly subjecting them to expansion- fragmentation events (Bryja et al., 2014; Lanier et al., 2015). During these episodes, many species have expanded their ranges while others were confined to more stable areas (refugia) and rapidly (re)colonized suitable habitats after glacial retreat (Hewitt,

2004). Together with fossil, palynological, and climatic data, phylogeographical studies can help to clarify whether their current genetic structuring patterns represent a legacy of the Pleistocene (Avise, 2000). Despite this relevance, such assessments are still scarce in the highly diverse biomes of the Neotropics, preventing a better understanding of the evolutionary history of their biota (Beheregaray, 2008). In South America, this is particularly true for the Dry Diagonal (“DD”) (Prado & Gibbs, 1993), a diagonal belt of seasonally drought-stressed vegetation formations comprising the Cerrado, the Caatinga and the Chaco (Werneck, 2011). These formations separate the Amazon and Atlantic

forests and currently occupy, altogether, an area larger than that encompassed by these forest environments (Werneck, 2011). Despite their relevance, the DD vegetation formations remain understudied in relation to the Amazon or Atlantic Forest (Santos et al., 2014). Vegetation formations composing the DD share features such as a remarkable environmental heterogeneity, and xeric-adapted vegetations distributed in a complex mosaic pattern, but are distinguished by particular characteristics (Furley &

Metcalfe, 2007; Werneck, 2011).

The Cerrado is the second largest biome in South America covering an area of approximately 2 million km2, which includes diverse climatic, topographic and edaphic conditions (Werneck et al., 2011, 2012a). Its environmental heterogeneity results in a quite variable phytophysiognomy with a singular fire-tolerant grass layer, which includes open grasslands, woodlands and forests (Eiten, 1972; Oliveira & Marquis,

2002). Phytogeographic studies reveal both east-west and north-south disjunctions in

Cerrado, supporting the division of this vegetation formation in four or five phytogeographic provinces (Ratter et al., 2003; Durigan, 2006). The climate is nowadays markedly seasonal with well-defined dry and wet periods (Felfini et al.,

2005). However, both palynological (Ledru et al., 2006) and paleodistribution modeling evidence (Werneck et al., 2012a) suggest that climate conditions were more irregular during the Pleistocene.

The Caatinga covers an area of more than 800,000 km² and it is characterized by a highly unpredictable climate with erratic rainfall and extensive droughts of irregular periodicity (Prado, 2003). Caatinga phytophisiognomies range from the prevailing shrublands (< 1m tall) to less common tree-dominated vegetations (> 25-30m tall)

(Sampaio, 1995). Finally, the Chaco is an alluvial plain distributed by around 840,000

km2 in northern Argentina, western Paraguay, south-eastern Bolivia and a western fraction of the Brazilian state of Mato Grosso do Sul (Prado, 1993a,b; Pennington et al.,

2000). The climate is highly seasonal, with very hot summers contrasting with severe winters; both annual rainfall and temperature decrease following an eastern-western gradient (Prado, 1993a). This environmental heterogeneity is reflected by the Chaco vegetation, which includes both forest and savanna-like formations (Prado, 1993a,b).

Despite still incipient, the available information suggests that the complex evolution in the Neotropics was shaped by multiple factors acting at different spatial and temporal scales (Rull, 2011; d’Horta et al., 2013). In fact, the remarkable environmental heterogeneity and diversity in the DD vegetation formations appear to have been molded by a combined effect of the Paleogene-Neogene geomorphological events and the Pleistocene climate cycles (Werneck, 2011; Rull, 2011). For instance, the presence of geographical barriers, such as rivers and mountains (Faria et al., 2013;

Nascimento et al., 2011, 2013), have also impacted the diversification within both

Cerrado and Caatinga. In the Cerrado, its compartmentalization in plateaus (> 500m) and depressions (< 500m) due to Late Tertiary tectonic movements was also relevant

(Colli et al., 2005; Nogueira et al., 2011). During the Pleistocene, DD vegetation formations and their associated biota have experienced shifts in their distributions according to an expansion-retraction dynamics (Turchetto-Zolet et al., 2013). During this time, some species have persisted in presumably stable areas (Bonatelli et al.,

2014). Such climate-induced refugia have acted as biotic refugia in the context of the

Pleistocene Refuge Hypothesis (Haffer, 2008; Vanzolini & Williams, 1981). In the

Cerrado, phylogeographic surveys on both plant (Ramos et al., 2007; Novaes et al.,

2010, 2013; Bonatelli et al., 2014) and animal taxa (Prado et al., 2012; Machado et al.,

2014) have revealed both east-west and north-south disjunctions, corroborating the results of Ratter et al. (2003). Molecular dating analyses performed in these studies suggest that divergence events reflected by this pattern took place in the Middle

Pleistocene. In the Seasonally Dry Tropical Forest (SDTF), successive expansion- fragmentation episodes during the Pleistocene have also likely occurred. However, the

Caatinga has apparently maintained stable conditions during the Last Glacial Maximum

(Werneck et al., 2011). In the Chaco, severe range shifts could have been caused by successive marine transgressions during Pleistocene, affecting many of its low-altitude regions (Werneck et al., 2011). However, Chaco biogeography is still controversial and poorly understood, since it is undoubtedly the least studied among the DD formations focused here (Werneck, 2011).

Valuable insights on the biogeography of the DD formations could be gained from phylogeographic analyses of widely distributed species. The genome of such widespread species is expected to carry genetic signatures of historic shifts in environmental conditions throughout their ranges, contributing to unveil evolutionary processes at a continental scale (Lougheed et al., 2013). Unfortunately, molecular surveys concerning widespread species from the South American DD formations are still uncommon (Quijadas-Mascareñas et al., 2007; Gehara et al., 2014). In this context, the sigmodont rodent Necromys lasiurus (Lund, 1840) shows one of the largest ranges in the rodent subfamily Sigmodontinae (around 4 million km2), extending from the

Amazon basin to northern Patagonia (Pardinãs et al., 2015). This wide geographic distribution is quite heterogeneous, encompassing a large environmental range that includes the DD formations and transitional areas among them and with adjoining vegetation formations such as the Amazon and Atlantic forests.

Necromys lasiurus is usually amongst the most common and abundant mammalian species in the DD formations (Streilein, 1982 a,b,c,d,e; Carmignotto et al.,

2014). The species is also a typical inhabitant of grassy areas in early stages of succession, which are ephemeral in nature, as well as in the vicinities of more stable mesic environments (Streilein, 1982b). As N. lasiurus lacks physiological adaptations to conserve water, it is highly dependent on free water in its diet to persist within the geographic limits of the DD (Streilein, 1982b). This feature makes the species remarkably sensitive to environmental shifts reducing humidity (Streilein, 1982b).

Ecological studies show that N. lasiurus can vary from rare to abundant and sometimes even become locally extinct depending on the climate conditions (Streilein, 1982c;

Asfora & Pontes, 2009). Contrastingly, the species may reach extremely high densities during population outbreaks locally named “ratadas" (Karimi et al., 1976). The abundant fossil record of N. lasiurus in both Pleistocene and Holocene deposits indicates that relevant demographic and distribution changes in the species have also occurred in the past due to environmental fluctuations (Galliari & Pardiñas, 2000).

Based on the complex Pleistocene demography of the species and the environmental heterogeneity encompassed by its wide distribution range, one might expect to find evidence of population structuring in N. lasiurus. Indeed, a previous analysis of the geographic variation in this rodent species indicated the occurrence of two morphometrically distinct groups (Macedo & Mares, 1987). The first group includes samples from Amazonian localities and the second cluster comprises specimens from the remaining of the species range. Since the geographic sampling of the specimens in the study of Macedo and Mares (1987) was clearly uneven, with a large sampling gap between samples allocated to distinct clusters, the biological

significance of their results still require a critical appraisal of additional evidence (e.g.,

Moreira and Oliveira, 2011). In a previous molecular study using cytochrome b gene sequence data, D'Elia et al. (2008) found a large N. lasiurus clade including representatives of N. benefactus (Thomas, 1919) and N. temchuki (Massoia, 1982) with no phylogeographic structure. Based on these results, these authors suggested the synonymy of these N. benefactus and N. temchuki, formerly thought to be valid species, under the name N. lasiurus. Despite geographically representative, the dataset of D'Elia et al. (2008) did not include samples from extensive areas in the heterogeneous landscapes of Central Brazil.

In the present study, we examine the phylogeographic structure of Necromys lasiurus using mitochondrial (cytb) and nuclear (Adh1 and FGBI7) sequences together with microsatellite genotypes (6 loci) from a widely sampled dataset of the species.

Specifically, this study aims to: (1) investigate to what degree the genetic structure of N. lasiurus was affected by Pleistocene climate cycles, and (2) compare the observed patterns in this species with those previously reported for other taxa in the DD formations in search for additional insights into the evolutionary patterns of their biota.

If climate-driven diversification has occurred in this species, genetic analyses should reveal lineage formations and divergence time estimates coinciding with major

Pleistocene climate events.

MATERIAL AND METHODS

Sampling and alignment

In the present study, sequences of the mitochondrial cytochrome b (cytb) gene were obtained from a total of 93 Necromys specimens from 18 Brazilian localities (Fig.

1, Tables S1 and S2). Genomic DNA was extracted from ethanol-preserved liver tissues using the proteinase-K/phenol-chloroform protocol (Sambrook et al., 1989).

Cytb was amplified using external primers L14724 (Irwin et al., 1991) and

MVZ14 (Smith & Patton, 1993). Individual polymerase chain reactions (PCRs) were prepared at final volumes of 25µl, with approximately 80ng of genomic DNA, 0.2µM of each primer, 1.5mM of MgCl2, 0.2mM of dNTPs, 1x of PCR buffer, and 1U Platinum

Taq (LifeTechnologies Corp.). Amplifications were carried out under the following conditions: pre-denaturation at 94°C for 3 min, 35 cycles of denaturation at 94°C for 45 sec, annealing at 48°C for 60 sec and extension at 72°C for 1.5 min, followed by a final extension at 72°C for 10 min.

Two additional nuclear markers, the intron 7 of the beta-fibrinogen (FGBI7, ca.

800 bp) and the intron 2 of the alcohol dehydrogenase 1 (Adh1, ca. 600 bp), were amplified for a subset of samples (Table S2). The concentration and volume of reagents were the same previously described for cytb. We used primers β17-mammL and β fib- mammU (Matocq et al., 2007) for the FGBI7 and primers Adh-2340-I and Adh-2340-II

(Amman et al., 2006) for the Adh1. Amplification of FGB17 and Adh1 were carried out under the following conditions: pre-denaturation at 94°C for 3 min, 35 cycles of denaturation at 94°C for 45 sec, annealing at 60°C for 45 sec and extension at 72°C for

1.5 min, followed by a final extension at 72°C for 10 min.

Amplicons of cytb, FGB17 and Adh1 were purified using the GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Brazil), and sequencing were carried out using a ABI Prism™ 3130XL platform using the same PCR primers. Electropherograms

were checked using Chromas 1.45 (MacCarthy, 1998) and Chromas Pro 1.41

(Technelysium Pty Ltd).

Specimens newly sequenced in this study were compared with sequence data for

Necromys species (N. lasiurus, N. lenguarum, N. urichi, N. amoenus, N. lactens and N. obsucurus) retrieved from Genbank. Outgroup sequences (Table S2) were also included in our analyses (Abrothrix longipilis, A. jelski, Akodon azarae, A. cursor, A. montensis,

A. paranaensis, Brucepattersonius soricinus, Deltamys kempi, Oxymycterus rufus,

Podoxymys roraimae, Thalpomys cerradensis, Thalpomys lasiotis and Thaptomys nigrita). Alignments for each marker were carred out with Mega 6 (Tamura et al., 2011) using the Clustal algorithm (Thompson et al., 1994). Alignment of cytb sequences was also verified at aminoacid level to check the occurrence of spurious stop codons. All alignments were also visually inspected.

Phylogenetic analyses

Cytochrome b genealogies were estimated through Maximum Likelihood (ML) and Bayesian (BI) analyses implemented, respectively, on PhyML 3.0 for Server

(Guindon & Gascuel, 2003) and on MrBayes 3.2.2 (Ronquist & Huelsenbeck, 2003) at

Cipres (Miller et al., 2010). For both analyses, we assumed a GTR+I+Γ (4) model, that was selected using ModelGenerator 0.85 (Keane et al., 2006) and the Bayesian

Information Criterion (BIC).

Maximum likelihood trees were recontructed based on an heuristic search using the best of Nearest Neighbor Interchange (NNI) and Subtree Pruning and Regrafting

(SPR) algorithms from five random starting trees generated by the BioNJ algorithm

(Guindon et al., 2010). Consistency of nodes was assessed with the approximate likelihood ratio test with SH-like interpretation (SH-aLRT) (Anisimova et al., 2011).

Bayesian analyses were carried out using two independent runs each of which with one cold and five hot Markov chains. Runs were allowed to proceed for five million generations and sampled every 500 generations per chain, with burn-in of 1000 trees/parameters. Convergence and mixing was checked using Tracer version 1.6

(Rambaut et al., 2014).

Divergence date estimates

Divergence times were simultaneously estimated with tree topology using a

Bayesian inference implemented in Beast version 1.8.1 (Drummond & Rambaut, 2007).

For these analyses, we employed a GTR+I+ Γ (4) model of nucleotide substitution on the cytb dataset including all N. lasiurus, and one sequence for each of the other

Necromys species, and outgroups. Divergence times were estimated under an uncorrelated lognormal relaxed clock (Drummond et al., 2006) and a coalescent tree prior. For the coalescent tree prior, we tested both the expansion growth and the constant size tree priors in independent runs.

The nodes of the phylogeny were calibrated by incorporating the information of the fossils of Abrothrix kermacki [(3.5 Ma) - Pardiñas et al., 2002], Akodon lorenzinii

[(2.7 Ma) - Pardiñas et al., 2002], Necromys cf. lasiurus [(0.78 Ma) - Galliari &

Pardiñas, 2000] and Oxymycterus cf. rufus [(1.0 Ma) - Pardiñas et al., 2002] were constrained by a lognormal prior (Ho & Phillips, 2009). Estimates of the posterior distribution were obtained by a Markov Chain Monte Carlo (MCMC) sampled every

1,000 MCMC steps for a total of 5x107 steps. Acceptable mixing and convergence to the stationary distribution were checked using Tracer 1.6 (Rambaut et al., 2014) and the

first 10% samples were discarded as burn-in. The Maximum-Clade-Credibility (MCC) tree was computed with the utility TreeAnnotator in Beast.

Intraspecific patterns of variability, spatial structuring and demography

The identification of haplotypes in Necromys lasiurus was performed in DNAsp

5.10.01 (Librado & Rozas, 2009). Pairwise uncorrected p-distances were calculated in

Mega 6.0 to investigate genetic divergence within populations of these two species.

Intraspecific geographic structuring trends were examined by reconstructions of

Neighbor-Net (NN) networks (Bryant & Moulton, 2004) using the SplitsTree 4.13.1

(Huson & Bryant, 2006). To further explore the relationship between genetic diversity, population structure and landscape features, we use the function “spca” of the R package 'adegenet' version 3.1.2 (Jombart, 2008; Jombart & Ahmed, 2011) to perform a

Spatial Principal Component Analysis “sPCA” (Jombart et al., 2008) on cytb sequence data in N. lasiurus and N. lenguarum. This ordination method is designed to search for a set of independent variables summarizing spatial structure in the examined dataset by optimizing the product of the genetic variance and spatial autocorrelation measured by the index I of Moran (Moran, 1948, 1950). We also carried out 9999 Monte Carlo permutations to test whether patterns revealed reflect significant global or local structures. To evaluate if the isolation-by-distance model adequately describes the patterns of geographical variation in N. lasiurus, we assessed the correlation between spatial and genetic distance matrices for this species using Mantel’s test (Mantel, 1967) performed by algorithm “mantel” in the R-package ‘Vegan’ Version: 2.2-1 (Oksanen et al., 2015).

Haplotype (h) and nucleotide diversity (π) estimates for both N. lasiurus and N. lenguarum were carried out with Arlequin (version 3.5.1.2; Excoffier & Lischer, 2010).

Arlequin was also used to assess demographic patterns in both species by mismatch distribution analyses (Rogers & Harpending 1992), Tajimas' D (Tajima, 1989) and Fs neutrality tests (Fu, 1996). This program was also used to perform an Analysis of

Molecular Variance (AMOVA) for N. lasiurus.

We also estimated the distribution range of N. lenguarum and N. lasiurus mitochondrial DNA (mtDNA) lineages. The results were compared to general patterns of geographic distribution size described for other Necromys species (Pardinas et al.

(2015)). To calculate these areas, we generate minimum convex polygons based on species occurrences, followed by the calculation of each polygon area in km2, using the function “earth.poly” in the R package 'fossil' version 0.3.7 (Vavrek, 2011).

Microsatellite

Six primer pairs originally designed to Akodon cursor (Moreira et al., 2014) were PCR-amplified in 192 specimens of N. lasiurus from eight localities. PCR amplifications were carried out according to the protocol described in Moreira et al.

(2014). We separated and electrophoresed amplicons on a Megabace 1000 automated sequencer (GE Healthcare) using ET400-ROX size standard. We carried out allele sizing and genotype confirmation in Genetic Profiler v.2.2 (GE Healthcare). To calculate observed and expected heterozygosities we used Cervus 3.0.3 (Kalinowski et al., 2007), and checked for the presence of null alleles with the program Freena

(Chapuis & Estoup, 2007); deviations from Hardy-Weinberg and linkage equilibrium between loci were tested with GENEPOP 4.2 (Raymond & Rousset, 1995). To control

for the false discovery rate (type I error) we adjusted the significance criteria for all multiple comparisons by using the Bonferroni correction (Rice, 1989). Finally, we performed a sPCA on the microsatellite dataset of N. lasiurus to investigate the patterns of allelic variation in the species in the space.

RESULTS

Molecular diversity and genealogical reconstructions

Analysis of ML and BI based on cytb sequences rendered similar topologies.

These phylogenetic trees showed a strongly supported monophyletic Necromys clade

(Fig. S1) with species arranged in two main groups: ((N. urichi, N. amoenus), N. lactens) and (N. obscurus, (N. lenguarum, N. lasiurus)). In all topologies, both N. lenguarum and N. lasiurus were recovered as highly supported monophyletic sister lineages (Fig. S1 and Fig. 2). These trees also revealed that samples recently collected in five western Brazil localities ((locs 2, 5, 10, 13 and 14 in Fig. 1) belong to the lineage previously referred to as Necromys lenguarum (Thomas, 1898) by D’Elia et al. (2008).

In contrast, sequence data of nuclear markers (Adh1 and FGBI7) revealed low variability and extensive haplotypes sharing among N. lasiurus and N. lenguarum. All topologies to these markers were non-informative and consistently failed in depicting N. lasiurus and N. lenguarum as distinct species (Fig. S2). Thereby, all results henceforth reported refer to the molecular analyses based on cytb data. These analyses identified a total of 46 and 18 haplotypes (Table S1) for N. lasiurus (n=83) and N. lenguarum

(n=50), respectively. These two species showed an average genetic distance of 7.1%

(varying from 4.0% to 10.0%). Intraspecific genetic distance estimates for N. lasiurus were higher (mean = 2.9%; ranging from a minimum 0.0% to a maximum 6.2%) than

for N. lenguarum (mean = 0.4%; 0.0%–2.0%). Similarly, N. lasiurus showed higher haplotype (h=0.96±0.01) and nucleotide (π=0.029±0.001) diversity estimates than N. lenguarum (h=0.78±0.054; π=0.005±0.001) (Table 1).

Phylogenetic trees based on cytb depicted N. lenguarum as a well-supported monophyletic clade showing low divergence between haplotypes and populations. The lack of geographic structure was also supported by the star-like shape of the Neighbor-

Net network (Fig. S3). Notwithstanding, the sPCA based on cytb sequence data indicated the occurrence of a north-east to south-west genetic cline differentiating the examined populations (Fig. S4). Permutation tests confirmed the existence of a significant global structure (p=0.048) in N. lenguarum with populations accumulating differences with the increase in geographic distances separating them.

A more complex scenario was present for all cytb topologies for N. lasiurus.

This species was geographically structured in five well-supported monophyletic groups

(aLRT ≥ 0.7 and posterior probabilities (pp) ≥ 0.9) diverging from each other by an average genetic distance of 3.6% (Table S5). These east-west and north-south population disjunctions in N. lasiurus were also recovered by both the NN network (Fig.

3) and the first two principal components of sPCA performed with cytb sequence data

(Fig. S5). sPCA components accounted for approximately 39% of the observed variance in N. lasiurus detecting a significant global structure (p=0.04) for this species. These results resemble the geographical arrangement of the biogeographic units of Cerrado proposed by Ratter et al (2003). Based on the names of these phytogeographic provinces, N. lasiurus haplogroups, which were also consistently recovered by the NN network (Fig. 3), are henceforth designated as "south-southeastern" (SS), "central- northern" (CN), "central-Cerrado" (CC), “western-Cerrado” (CW) and "central-eastern"

(CE) clades. These five N. lasiurus lineages were largely allopatric throughout most of their geographic distribution, however some cases of sympatry and syntopy were observed (e.g., locality 11 in Fig. 1). Clade SS corresponds to the most widely distributed lineage (approximately 1.3 million km2 - Table S3) including populations occupying open habitats, such as the Chaco, Cerrado and SDTFs, ranging from western and central Argentina throughout Paraguay to southern and southeastern Brazil where they inhabit open environments inside and at the edge of the Atlantic Forest. Showing the second largest geographic range (1.1 million km2), clade CN comprised the northernmost samples from Brazil (loc. 1), individuals from the Caatinga in northeastern Brazil (locs. 3 and 4), from ecotonal areas between the Caatinga, Cerrado and Atlantic Forest in the region of the Chapada Diamantina (loc. 11), and populations from western Brazil in the Amazonia-Cerrado transition (locs. 6 and 7). The clade CE comprised samples inhabiting the core of Cerrado in central Brazil plateaus, and ecotonal areas between the Cerrado and Atlantic Forest located in the Brazilian states of

Minas Gerais and São Paulo, totalizing an area of approximately 520,000 km2. The clade CC covered an area of 45,000 km2, including haplotypes ranging from the core region of Cerrado in the state of Goiás (locs. 16, 17, 20, 22) to the ecotonal areas between Cerrado, Caatinga and Atlantic Forest in the region of the Chapada Diamantina

(locs. 8 and 9). Finally, a single haplotype (H28) was shared between populations from western Brazil (loc. 14) and Paraguayan Cerrado (locs. 29 and 35) covering an area of ca. 89,000 km2. This haplotype was highly divergent in relation to the other clades

(Table S4) that was herein treated as clade.

Geographic structure and demography

Four different geographical arrangements were tested for N. lasiurus using

AMOVA (Table 2), but differentiation among groups was maximized (70.93%) when samples were arranged according to the five haplogroups revealed by phylogenetic and network analyses. Significant pairwise FST values also suggested genetic differentiation among these clades (Table 3). The Mantel test (Table S6) evidenced a significant isolation by distance for the entire N. lasiurus dataset (r2=0.46; p=0.000) and for CN

(r2=0.57; p=0.000) and CE (r2=0.70; p=0.000) clades. On the other hand, there was no significant correlation between genetic and geographical distances in SS (r2=0.004; p=0.47) and CC (r2=0.3; p=0.08) clades.

Demographic analyses indicated that N. lenguarum populations are under expansion as suggested by the unimodal mismatch distribution (Fig. S6) and non- significant values for the sum of squared deviation (SSD) and raggedness index tests

(Table 1). The significant negative values for Fu’s Fs and Tajima’s D were also consistent with population expansion (Table 1). These results are in agreement with the star-like shape of the NN network (Fig. S3). For the SS, CE, and CC haplogroups, almost all historical demographic tests were consistent with the demographic expansion hypothesis (Table 1; Fig. S6). However, for the CN clade, statistical tests suggested demographic stability (Table 1).

Divergence date estimates

The ancestor of Necromys diverged from other akodontines in the Early

Pleistocene [2.55 Ma (95% highest posterior density (HPD) = 1.91 to 3.13 Ma)] (Fig.

4). The initial cladogenesis has occurred approximately 1.90 Ma (1.29 to 2.56 Ma) with the split between the ancestor of N. urichi/N. amoenus clade and those composing the

other species. Also in the Early Pleistocene [ca. 1.60 Ma (1.09 to 2.17 Ma)], N. lactens diverged from the clade of lowland species (N. obscurus, N. lasiurus), N. lenguarum) and the N. urichi/N. amoenus splitted [1.05 Ma (0.41 to 1.78 Ma)]. This period also set the stage for the diversification for N. obscurus in relation to the N. lasiurus/N. lenguarum clade [1.29 Ma (0.88 to 1.79 Ma)] and for the split between N. lenguarum and N. lasiurus [0.92 Ma (0.64 to 1.26 Ma)]. Intraspecific divergence in N. lasiurus took place almost simultaneously around the Middle Pleistocene. The initial cladogenesis within N. lasiurus have occurred approximately 640,000 years (0.46 to

0.82 Ma) ago, when the clade uniting the ancestors of the lineages CW and CN diverged from those assembling the remaining populations. This first event was followed by the splits between CW and CN [0.49 (0.30 to 0.69)] and between SS and the CE+CC [0.41

(0.25 to 0.61)]. Finally, approximately 100,000 years later, CE diverged from CC clade

[0.32 (0.18 to 0.51)].

Microsatellite descriptive statistics and spatial Principal Component analysis

Genotypying of six microsatellite loci (Table S7) in 192 N. lasiurus individuals from eight localities (Table S3 and Fig. S7) revealed high levels of genetic diversity in the species with an average of 37 alleles per locus, with a minimum of 27 (AkPQAs1) and a maximum of 49 (AkC1), totaling 222 alleles. Values for the observed (Ho) and expected (He) heterozygosities ranged from 0.78 to 0.96 and from 0.93 to 0.97, respectively. After Bonferroni correction, none of the six loci departed significantly from Hardy-Weinberg equilibrium. Within populations, significant departures from

Hardy-Weinberg equilibrium were found in Brasilia (loci AkJ1, AkL1, AkPQLi1.2,

AkPQAs1), UHE Volta Grande (AkJ1 and AkL1), Pedreira (locus AkC1) and Anapólis

(AkPQLi1.2). Such deviation could be due to population structure (Wahlund effect), null alleles or demographic factors such as inbreeding, bottlenecks and immigration

(Sabatti & Risch, 2002; Falush et al., 2007; Bucher et al., 2009). Since sPCA is not constrained by the assumption of Hardy-Weinberg and linkage equilibria, we use this ordination method to explore the population structure in N. lasiurus.

The first two principal components of sPCA performed with microsatellite data accounted for approximately 22.4% of the observed variance in N. lasiurus without evidence of significant global (p=0.64) or local structure in the species. However, the plot of scores of these principal components reveals the same north-south (sPC1) and east-west (sPC2) population differentiation pattern revealed by the analysis on the cytb sequence data (Fig. S8).

DISCUSSION

Necromys lasiurus occupies an area of about 4 million km2, mostly within the

Dry Diagonal formations. This wide range is quite heterogeneous with respect to vegetation types, soils, current and past climates. Additionally, there are mountains and rivers, such as the Rio São Francisco, which proved to be relevant to the diversification of some co-distributed small mammals genera such as the marsupial Gracilinanus

(Faria et al., 2013) and the rodents Calomys (Nascimento et al., 2011) and Thrichomys

(Nascimento et al., 2013). Thus, it is intriguing that no trace of these processes was found by previous studies using morphological characters (Macedo & Mares, 1987) or cytb gene sequence data (D'Elia et al., 2008). It should be recalled that these assessments did not include samples from extensive areas in the heterogeneous Central

Brazil landscapes. Thus, the absence of geographic structuring in N. lasiurus reported

by these previous studies could represent a sampling artifact without any biological significance. Another possible reason to these findings is a very recent diversification in

N. lasiurus which could make the DNA sequences analysed in this study less effective in detecting the differences between populations. In this case, we would expect that the addition of fast evolving markers, such as microsatellites, would help to identify geographical structure in N. lasiurus.

All phylogenetic methods retrieved similar topologies showing both a monophyletic Necromys clade, and Necromys lasiurus and N. lenguarum as sister clades with high branch supports. These findings corroborate a previous study using cytb sequence data (D'Elia et al., 2008). As expected, by examining samples from geographical localities absent in this previous assessment, our results revealed both the presence of another species in Brazil, N. lenguarum, and strong geographic structure in

N. lasiurus. Comparison of patterns of genetic diversity and population structuring of these two species underscored the role of the Pleistocene oscillating climates in shaping and originating diversity in the Neotropics. Finally, these findings contribute to improve our understanding of both historical patterns of diversification and speciation processes in the Neotropics.

Nuclear and mitochondrial discordance

Similar phylogenetic topologies were obtained for both nuclear markers (Adh1 and FGBI7). These topologies did not recover the divergence between N. lasiurus and

N. lenguarum and the intraspecific differentiation in N. lasiurus as observed for the cytb dataset. Discrepancy between nuclear and mitochondrial gene trees is common in phylogenetic and phylogeographic studies (e.g., Nascimento et al., 2013). Such pattern

can be a result of factors such as introgression, sex-biased asymmetries and the smaller effective population size in mitochondrial DNA related to nuclear genome rendering incomplete lineage sorting in nuclear markers (Toews & Bresford, 2012).

Geographic range, population structure and taxonomy

Phylogenetic analyses for cytb and concatenate sequence data confirmed the monophyly of Necromys and the sister relationship between N. lasiurus and N. lenguarum, as suggested by D'Elia et al. (2008). Divergence time estimates placed the split between N. lenguarum/N. lasiurus in the Early Pleistocene [1.12 Ma (0.43 to 1.88

Ma)]. As a consequence, main events on demography and intraspecific diversification in these species took place during the Pleistocene, a time marked by pronounced climate oscillation worldwide (Collevatti et al., 2015; Lanier et al., 2015; Kohli et al., 2015).

Molecular analyses confirmed the occurrence of N. lenguarum in Brazil adding five localities to the known geographic range of this species. These new records revealed a distribution area (approximately 341,000 km2) for N. lenguarum that is larger than those in most Necromys species in which geographic ranges varies from small

(10,000 km2) to medium-sized (100,000 km2) (Pardiñas et al., 2015). This wide distribution encompasses different morphoclimatic domains such as the Chaco, Cerrado, and SDTFs, as well as ecotones between them and with adjoining Amazon, and peripheral Cerrado isolates in southwestern Brazilian Amazon. In view of this environmental heterogeneity, we expected to find geographic structure in N. lenguarum, but cytb phylogenetic tree and the NN haplotype network consistently indicated a low intraspecific genetic divergence (mean = 0.4%) in the species. On the other hand, the first sPCA indicated an ongoing differentiation process between distant populations in

N. lenguarum. Incipient differentiation between populations and the relatively high haplotype (but low nucleotide) diversity (Table 1) observed in N. lenguarum suggest that much of its current distribution may have been recently colonized after a rapid demographic expansion (Zhang et al., 2014). Strong signatures of demographic expansion in N. lenguarum were provided by its star-shaped NN network, unimodal mismatch distribution, non-significant values of SSD and raggedness index and significantly negative Fu's Fs and Tajima´s D values (table 1) (Zigouris et al., 2013).

On the other hand, phylogenetic and network analyses indicated that N. lasiurus was structured in five haplogroups showing an averaged genetic divergence of 3.6%

(minimum 2.6% – maximum 4.3%). Interpopulation genetic differentiation was also suggested by AMOVA (Table 2), in which most of the genetic variance was due to among population variation (70.93%) and by a significant pairwise FST values for all haplogroups (Table 3). Our results reveal two lineages (CC and CW) in N. lasiurus with geographic distribution areas smaller than 100,000 km2, similarly to the majority of

Necromys species (Pardiñas et al., 2015). On the other hand, the other three haplogroups

(SS, CN and CE) are widespread, occupying areas larger than 500,000 km2 (Table S3).

Notwithstanding being largely allopatric throughout most of their distributions, three of these lineages occur in sympatry and syntopy in some localities (e.g., CN, CC and CE in the loc. 11; Fig. 1). Such complex phylogenetic patterns with the coexistence of highly divergent intraspecific lineages could represent (1) artifacts due to pseudogenes occurrence, (2) hybridizations with congeneric species, (3) haplogroups of distinct species, or (4) haplogroups that have diverged due to long-term isolation, coming later into secondary contact (Webb et al., 2011; Hogner et al., 2012; Kvie et al., 2013).

If the occurrence of nuclear mitochondrial insertions (numts – Lopez et al.,

1994; Bertheau et al., 2011; Filipi et al., 2015) had caused the mtDNA variation pattern observed in this study, we would expect to find double peaks and stop codons when analyzing electropherograms and sequence alignments, respectively (Bensasson et al.,

2001). Although numts amplification could not be absolutely excluded, the lack of double peaks and stop codons further support that pseudogenes should not be used as an explanation to our results. Since no N. lasiurus haplogroups did cluster with any of the other Necromys species analyzed, the occurrence of hybridization between closely related species with introgression of mtDNA (Taylor et al., 2011) was also dismissed as a possible explanation to the high mtDNA variation observed for N. lasiurus.

The coexistence of N. lasiurus haplogroups showing such level of intergroup divergence suggests that they represent distinct subspecies or species (Bradley & Baker,

2001; Baker & Bradley, 2006). To characterize the occurrence of reproductive barriers and ongoing speciation in N. lasiurus, high mtDNA divergence should be followed by consistent differentiation either in nuclear DNA or in morphological, ecological and behavioral traits (Kvie et al., 2013). However, phylogenies retrieved from the nuclear markers were clearly discrepant from the cytb phylogenetic tree. Patterns of geographic variation in cranial morphology (Macedo & Mares, 1987) and in reproductive period

(Cerqueira et al., 1993; Bergallo & Magnusson, 1999; Couto & Talamoni, 2005) were also not congruent with the mtDNA differentiation, failing to reveal clear morphological or ecological discontinuities within this species. These results suggest either incipient speciation or that the time since isolation may not have been sufficient to generate effective reproductive barriers for the haplogroups in the form of different morphological, physiological or behavioral traits (Coyne & Orr, 2004).

Finally, mtDNA haplogroups observed for N. lasiurus might represent genetically differentiated lineages evolving in isolation, but remerged when the extinction of barriers to gene flow and/or recent re-expansion of their distributions allowed them to come into secondary contact (Avise, 2000; Webb et al., 2011; Bhat et al., 2014). In this case, we would expect to find population structure and different demographic histories between mtDNA haplogroups, as well as nuclear markers failing to reveal distinct groups (Kvie et al., 2013). Our analysis did not detect genetic structure in FGBI7 and Adh1 sequence data whereas mtDNA lineages were highly divergent displaying different demographic patterns with signatures of expansion in SS, CE and

CC clades in opposition to demographic stability in CN. Furthermore, due to the small effective population size of mitochondrial markers, low mtDNA allele diversity would be expected at intrapopulation level, caused by an enhanced effect of the genetic drift in promoting haplotype fixation/extinction (Avise et al., 1987). The detection of such divergent sympatric mtDNA haplotypes suggests relatively high levels of gene flow among mtDNA haplogroups of N. lasiurus. These findings suggest that the evolutionary history of this species was marked by a complex dynamics with populations alternating periods of geographic isolation rendering divergence with others of high connection allowing free interbreeding. Such a pattern seems to reflect the successive cycles of expansion-retraction of South American open vegetation formations during the

Pleistocene (Collevatti et al., 2013a,b; Werneck et al., 2011, 2012a,b) which affected their biota by providing repeated opportunities for population retraction, geographical isolation and vicariance (Prado et al., 2012; Machado et al., 2014), range expansion

(Caetano et al., 2008) or a combination of both (Bonatelli et al., 2014; Lopez-Uribe et al., 2014).

Although beyond the scope of this paper, a thorough integrative evaluation of N. lasiurus haplogroups revealed in our analyses is required to clarify their taxonomy and properly distinguish between the hypotheses of distinct species and secondary introgression as an explanation to the patterns found in this study.

Phylogeography, demography and biogeographic scenario

Similar to other species in the genus, the geographic range of N. lenguarum and

N. lasiurus appear to be closely associated to the current distribution of open phytophysiognomies of South America (Pardinãs et al., 2015). Due to the fluctuating climates, the occurrence area of these physiognomies was quite variable during the

Pleistocene glacial cycles, when these areas were repeatedly subjected to climatically- driven expansion-fragmentation events (Behling, 2002; de Vivo & Carmignotto, 2004;

Collevatti et al., 2015). Indeed, our divergence time estimates placed both the N. lenguarum/N. lasiurus split and their intraspecific diversification in the Pleistocene. Our molecular analyses also revealed patterns of geographic distribution and population genetic structure for N. lenguarum and N. lasiurus that were in accordance with recent results of phylogeographic studies on several animal (Moraes et al., 2009; Prado et al.,

2012; Franco & Manfrin, 2013; Machado et al.,, 2014; Santos et al., 2014) and plant taxa (Novaes et al., 2013; Bonatelli et al., 2014; Lima et al., 2014) associated to South

American open vegetation formations. These surveys underlined the relevant role of the complex Pleistocene climate dynamics in shaping the evolutionary history of the biota of the DD formations.

The geographic arrangement of N. lasiurus in five haplogroups was quite similar to the phytogeographical provinces of Cerrado proposed by Ratter et al. (2003). This

distribution pattern also matches long-term stable areas of open formations (Werneck et al., 2011, 2012a,b), as well as the phylogeographic structure observed in Dalbergia miscolobium, a widespread tree species in the Cerrado (Novaes et al., 2013). The clear separation between CN and SS corroborates previous floristic (Ratter et al., 2003;

Durigan, 2006) and phylogeographic studies (Ramos et al., 2007; Novaes et al., 2010) in underscoring the uniqueness of north-northeastern Cerrado + Caatinga and south- southeastern Cerrado, respectively, in relation to the remaining Cerrado. Besides this north-south disjunction, N. lasiurus shows a consistent separation between western

Cerrado (CW) and eastern Cerrado populations (CC and CE). This same pattern of east- west structuring was recovered by the sPCA performed on both cytb and microsatellite datasets. Similar results were previously found when analysing morphometric differentiation on the rodent genus Clyomys Thomas, 1916 (Bezerra & Oliveira, 2010) and phylogeographic patterns on the tree Hymenaea stigonocarpa (Ramos et al., 2007), the shrubs Lychnophora ericoides (Collevatti et al., 2009), the cactus complex

Pilosocereus aurisetus (Bonatelli et al., 2014), the frog Hypsiboas albopunctatus (Prado et al., 2012) and the snake complex Bothrops neuwiedii (Machado et al., 2014). In addition to the geographical range, intraspecific diversification in N. lasiurus shares the same origin and diversification time with these plant and animal taxa, which were consistently estimated to have occurred during the Middle Pleistocene. The complex evolutionary history of N. lasiurus seems to have been shaped by repeated events of isolation and expansion in multiple refugia during different Pleistocene glacial cycles.

Despite the inclusion of molecular markers other than cytb can modify the divergence dates, there is little doubt that main intraspecific differentiation events in N. lasiurus coincide with major climate changes during the Pleistocene. Possibly, the

isolation of populations during colder and drier phases of the Gunz Glaciation (0.68 to

0.62 Ma – Gibbard & Van Kolfschoten, 2005) would have contributed to the divergence between the CW and CN ancestors related to SS, CE and CC ancestors (0.67 Ma).

Subsequently, despite the prevailing warm conditions of the Gunz-Mindel Interglacial, the longest and warmest interglacial for the past 0.5 Ma (Tzedakis et al., 1997), eventual periods of cold and dry conditions might have favored the splits of CW from CN (0.48

Ma). There is evidence that warm pulses associated to moister conditions of some periods of this interglacial have affected some Brazilian rodent taxa by favoring their southward dispersal (Verzi et al., 2004). Finally, the differentiation of SS from CC+CE

(0.41 Ma) and CE to CC clade [0.32 (0.18 to 0.51)] took place during the Mindel glaciation (0.455–0.300 Ma), which is considered one of the most intense Pleistocene glaciations (Gibbard & van Kolfschoten, 2005), when the warm environments of the previous period were most likely replaced by colder and drier conditions. Under such circumstances, this glaciation may have still caused more drastic consequences on the species demography and geographic range of the southern hemisphere than those of the more recent glacial period, the Wurm Glaciation (0.11 to 0.012 Ma) (Collevatti et al.,

2009). If the environmental conditions observed in the most recent interglacial-glacial cycle have been similar to those observed in the most recent one, Caatinga and other

STDF nuclei plus occurring during these earlier ones, the Cerrado are expected to have increased their ranges under warm and moister or not too dry climates, whereas colder and drier glacial conditions would be expected to generate their retraction (Werneck et al., 2011, 2012 a,b). The genetic structuring pattern observed in this study for N. lasiurus might reflect such climate changes. However, it is relevant to keep in mind that

the genetic legacy of more ancient events could be erased by the last glacial-interglacial cycle (Bonnatelli et al., 2014).

Although in a likely lesser degree, N. lasiurus also faces variable environmental conditions throughout its current distribution. These conditions range from the marked seasonality in moisture and pluviosity of the Cerrado, allowing a continuous successful reproduction and the maintenance of high population densities, to the unique unpredictability of the Caatinga, with its extensive droughts of irregular periodicity in which the species vary from rare to abundant depending on the extension of the moister periods (Streilein, 1982a,b,c,d,e; Mares et al., 1985). Previous surveys assessed the distinct responses of N. lasiurus to these heterogeneous conditions in terms of demography, viability and reproductive strategy in light of its high dependence on free water in its diet (Streilein, 1982b). As the highly unpredictable climates currently observed in the Caatinga might resemble the shifting environments during the

Pleistocene, the findings of Streilein (1982a,b,c,d,e) and Mares et al. (1985) can provide key insights into the effects of the Pleistocene climate dynamics on N. lasiurus populations. In the Caatinga, the abundance of N. lasiurus is usually higher in grassy areas in the vicinities of mesic enclaves, which have a more stable climate, decreasing with increased distance from such microclimatic refugia (Streilein, 1982a,b,c,d; Mares et al., 1985). During the moister periods of the year, individuals emigrate from the large populations inhabiting such mesic enclaves to colonize distant suitable habitats (Mares et. al., 1985).

Eventually, longstanding favorable conditions such as successive periods of water surplus (Streilein, 1982c) allow N. lasiurus to major reproductive efforts and the generation of extremely high population densities (e.g., 187 ind./ha - Karimi et al.,

1976), which retreat abruptly by the increased mortality or migration since the favorable conditions have ceased (Mares et. al., 1985; Pearson et al., 2002; Sage et al., 2007).

Such large density fluctuations are locally termed as "ratadas" (Jaksic & Lima, 2003).

During these episodes, the role of such mesic enclaves as a source of emigrants to

(re)colonize suitable habitat patches which might have became empty during times of reduced rainfall, is intensified (Mares et. al., 1985). Indeed, long distance emigration from distinct outbreak populations was pointed as the most plausible explanation to the record of an outlying population of N. lasiurus more than 20 km distant from the closest mesic enclave in Chapada do Araripe (Streilein, 1982c). Thus, a dynamic metapopulation system such as those observed in cyclic cricetids (Norén & Angerbjörn,

2014) might occur in species such as N. lasiurus and other sigmodontines presenting

"ratadas". In those cyclic rodents, the increased dispersal distance during peak phases reconnects previously isolated subpopulations, restoring the local genetic diversity through gene flow (Boric-Bargetto et al., 2012). Thereby, genetic diversity of the species remains constant at a regional scale while fluctuating at local scale (Gauffre et al., 2014).

If "ratadas" have a similar role in sigmodontines, they might guarantee a high connectivity between subpopulations of N. lasiurus, thus reducing substantially the effects of genetic drift and the loss of genetic diversity (Boric-Bargetto et al., 2012;

Norén & Angerbjörn, 2014; Gauffre et al., 2014). The maintenance of large effective population sizes in a regional scale (Rikalainen et al., 2012) would explain the high genetic diversity observed within all haplogroups when they were expected to be genetically empoverished due population decline and isolation during the unfavorable colder, drier or unforeseeable climate phases of the Pleistocene. Notwithstanding, this

hypothesis needs to be further investigated in a context of long-term studies sampling different population phases and different localities (Gonzalez-Ittig et al., 2015)

Necromys lenguarum and N. lasiurus seem to share ecological traits such as the inability to conserve water and the high susceptibility to environmental shifts reducing free water (Emmons, 2009). Thus, we would expect that they had been similarly affected by the Pleistocene climate cycles. However, N. lenguarum showed signals of weak population genetic structure and strong signatures of rapid demographic expansion, which are in accordance with a scenario of genetic bottleneck and confinement in a single or few refuges followed by a rapid colonization of suitable areas after glacial retreat (Cañon et al., 2010; Alarcon et al., 2011; Palma et al., 2012). In addition, the current geographic range of N. lenguarum is close to some historically stable areas estimated by palaeomodeling for DD formations (Werneck et al., 2011,

2012a, b) which have been pointed as putative Pleistocene glacial refugia.

Distinct genetic legacies of the Pleistocene climate changes can reflect regional singularities in climate dynamics (Werneck et al., 2011; Bonatelli et al., 2014) and/or subtle inter-specific differences in intrinsic attributes (Brown et al., 1996; Lopez-Uribe et al., 2014; Collevatti et al., 2015). Given the lack of reports of population outbreaks in

N. lenguarum, the occurrence of "ratadas" could represent a key feature in determining the substantially distinct patterns between this species and N. lasiurus. By lacking such a recovery mechanism, N. lenguarum may have experienced a more severe loss of diversity during population retractions caused by the Pleistocene climate changes, which would explain the lower values of nucleotide diversity and interpopulation divergence.

CONCLUSIONS

This study provides evidence that at least two distinct Necromys species, N. lenguarum and N. lasiurus, inhabit Brazilian open vegetation formations. The phylogeographical structure and demographic history in this sister species pair were mostly shaped by Pleistocene climate shifts. Regional singularities in climate dynamics and differences on intrinsic attributes between these species are the likely causes of the distinct genetic legacies of the Pleistocene. In this context, we infer that a complex demographic dynamics in N. lasiurus with large density fluctuations which are termed as “ratadas” might represent a key feature contributing to these differences. Since, so far, we could not define whether N. lasiurus haplogroups represent new species or long- term isolated lineages which came later into secondary contact, the causes of the genetic differentiation observed between the five haplogroups deserve further investigation using additional nuclear markers and morphological analyses. In summary, our findings reinforced the potential of widely distributed species such as N. lasiurus to provide a better understanding of both the determinants of the historical patterns of diversification in South American open formations and the speciation process. They also underscored the role of the Pleistocene oscillating climates in shaping and originating diversity in the

Neotropics. Additionally, future surveys might contrast the geographic structure in N. lasiurus revealed here with the genetic diversity of the parasites causing zoonoses such as plague and hantaviruses (Tavares et al., 2012; Oliveira et al., 2014). The results of such investigations will have important implications on public health and epidemiological surveillance policies across the distribution of the species.

ACKNOWLEDGEMENTS

This paper is part of the DS requirements of Jânio Cordeiro Moreira at the Biodiversity

and Evolutionary Biology Graduate Program of the Federal University of Rio de

Janeiro. We are grateful to H.N. Seuánez, M.A. Moreira. P.S. D'Andrea for providing

laboratory facilities. While conducting this work, JCM benefited from a doctoral

scholarship from CAPES. We thank the financial support of CNPq (CRB, JAO),

FAPERJ (CRB, JAO – process number E26/111.720/2012), the Royal Society and the

British Academy (FFN). Instituto Chico Mendes de Conservação da Biodiversidade

(ICMBio) granted license to collect the specimens.

REFERENCES

Alarcon, O., D’Elia, G., Lessa, E.P. & Pardiñas, U.F.J. (2011) Phylogeographic Structure of the Fossorial Long-Clawed Mouse Chelemys macronyx (Cricetidae: Sigmodontinae). Zoological Studies, 50(5), 682–688.

Amman, B.R., Hanson, J.D., Longhofer, L.K., Hoofer, S.R. & Bradley, R.D. (2006). Intron 2 (Adhl-I2) of the alcohol dehydrogenase gene: a potential nuclear DNA phylogenetic marker for mammals. Occasional Papers. Museum of Texas Tech University, 256, 1–16.

Anisimova, M., Gil, M., Dufayard, J.F., Dessimoz, C., Gascuel, O., (2011). Survey of branch support methods demonstrates accuracy, power, and robustness of fast likelihood-based approximation schemes. Systematic Biology, 60, 685–699.

Asfora, P.H. & Pontes, A.R.M. (2009) The small mammals of the highly impacted North- eastern Atlantic Forest of Brazil, Pernambuco Endemism Center. Biota Neotropica, 9(1), 31–35.

Avise, J.C., Arnold, J., Ball, R.M., Bermingham, E., Lamb, T., Neigel, J.E., Reeb, C.A. & Saunders, N.C. (1987) Intraspecific phylogeography: the mitochondrial DNA bridge between population genetics and systematics. Annual Review of Ecology and Systematics, 18, 489–522.

Avise, J.C. (2000) Phylogeography: The History and Formation of Species. Harvard University Press, Cambridge, MA,.447 pp.

Baker, R.J. & Bradley, R.D. (2006) Speciation in mammals and the Genetic Species Concept. Journal of Mammalogy, 87(4), 643–662.

Beheregaray, L.B. (2008) Twenty years of phylogeography: the state of the field and the challenges for the Southern Hemisphere. Molecular Ecology, 17, 3754–3774

Behling, H. (2002). South and southeast Brazilian grasslands during Late Quaternary times: a synthesis. Palaeogeography, Palaeoclimatology, Palaeoecology, 177, 19–27.

Bensasson, D., Zhang, D-X., Hartl, D.L., Hewitt, G.M. (2001) Mitochondrial pseudogenes: evolution’s misplaced witnesses. Trends in Ecology and Evolution, 16(6), 314–321.

Bergallo, H.G. & Magnusson, W.E. (1999) effects of climate and food availability on four rodent species in southeastern Brazil. Journal of Mammalogy, 80(2), 472–486.

Bertheau, C., Schuler, H,, Krumbock, S. Arthofer, W. & Stauffer, C. (2011) Hit or miss in phylogeographic analyses: the case of the cryptic NUMTs. Molecular Ecology Resources, 11, 1056–1059.

Bezerra, A.M.R & Oliveira, J.A. (2010) Taxonomic implications of cranial morphometric variation in the genus Clyomys Thomas, 1916 (Rodentia: Echimyidae). Journal of Mammalogy, 91(1), 260–272.

Bhat, S., Amundsen, P-A., Knudsen, R., Gjelland, K.Ø., Fevolden, S-E., Bernatchez, Louis, Præbel, Kim (2014) Speciation Reversal in European Whitefish (Coregonus lavaretus(L.)) Caused by Competitor Invasion. PLoS ONE, 9(3), e91208.

Bonatelli, I.A.S., Perez, M.F., Peterson, A.T., Taylor, N.P., Zappi, D.C., Machado, M.C., Koch, I., Pires, A.H.C. & Moraes, E.M. (2014) Interglacial microrefugia and diversification of a cactus species complex: phylogeography and palaeodistributional reconstructions for Pilosocereus aurisetus and allies. Molecular Ecology, 23, 3044– 3063.

Boric-Bargetto, D., Rodríguez-Serrano,,E., Hernández, CE, Jaksic,,FM (2012) Temporal variation in genetic diversity during an outbreak of Oligoryzomys longicaudatus (Rodentia, Sigmodontinae) in a temperate forest of southern Chile. Biochemical Systematics and Ecology, 44, 383–389

Bradley, R.D., and Baker., R.J. (2001) A test of the Genetic Species Concept: cytochrome-b sequences and mammals. Journal of Mammalogy, 82, 960–973.

Brown, J.H. G.C., Stevens & Kaufman, D.M. (1996) The geographic range: size, shape, boundaries, and internal structure. Annual Review of Ecology and Systematics, 27, 597– 623.

Bryant, D. & Moulton, V. (2004) Neighbor-net: an agglomerative method for the construction of phylogenetic networks. Molecular Biology and Evolution, 21, 255–265.

Bryja, J., Mikula, O., Patzenhauerov, H., Oguge, N.O., Sumbera, R. & Verheyen, E. (2014) The role of dispersal and vicariance in the Pleistocene history of an East African mountain rodent, Praomys delectorum. Journal of Biogeography, 41, 196–208.

Caetano, S., Prado, D.E.; Pennington, R.T., Beck, S., Oliveira-Filho, A.T., Spichiger, R., Naciri Graven, Y. (2008) The history of Seasonally Dry Tropical Forest in eastern South America: inferences from the genetic structure of the tree Astronium urundeuva (Anacardiaceae).. Molecular Ecology, 17, 3147–3159.

Cañon, C., D’Elia, G., Pardiñas, U.F.J. & Lessa, E.P. (2010) Phylogeography of Loxodontomys micropus with comments on the alpha taxonomy of Loxodontomys (Cricetidae: Sigmodontinae). Journal of Mammalogy, 91(6), 1449–1458.

Carmignotto, A.P., Bezerra, A.M.R., Rodrigues, & Flávio, H.G. (2014). Nonvolant small mammals from a southwestern area of Brazilian Cerrado: diversity, habitat use, seasonality, and biogeography. Therya, 5, 535–558.

Cerqueira, R., Gentile, R.,Fernandez, F. & D'Andrea, P.S. 1993. A Five-Year Population Study Of An Assemblage Of Small Mammals In Southeastern Brazil. Mammalia, 57, 507–517.

Chapuis, M.P. & Estoup, A. (2007) Microsatellite null alleles and estimation of population differentiation. Molecular Biology and Evolution, 24(3), 621-631.

Collevatti, R.G., Rabelo, S.G., Vieira, RF.(2009) Phylogeography and disjunct distribution in Lychnophora ericoides Mart. (Asteraceae), an endangered Cerrado shrub species. Annals of Botany, 104, 655–664

Collevatti, R.G., Lima-Ribeiro, M.S., Diniz-Filho, J.A.F., Oliveira, G., Dobrovolski, R. & Terribile, L.C (2013a).Stability of Brazilian Seasonally Dry Forests under Climate Change: Inferences for Long-Term Conservation. American Journal of Plant Sciences, 04, 792–805.

Collevatti, R.G., Terribile, L.C., Oliveira, G., Lima-Ribeiro, M.S., Nabout, J.C., Rangel, T.F., Diniz-Filho, J.A.F. (2013b) Drawbacks to palaeodistribution modelling: the case of South American seasonally dry forests. Journal of Biogeography, 40, 345–358, 2013.

Collevatti, R.G. ; Terribile, L.C., Diniz-Filho, J.A.F. & Lima-Ribeiro, M.S. (2015). Multi-model inference in comparative phylogeography: an integrative approach based on multiple lines of evidence. Frontiers in Genetics, 6, 31.

Colli, G.R., (2005). As origens e a diversificação da herpetofauna do Cerrado. In: Scariot, A., Sousa-Silva, J.C., Felfili, J.M. (Eds.), Cerrado: Ecologia, Biodiversidade e Conservação. Ministério do Meio Ambiente, Brasília, Distrito Federal, pp. 249–264.

Condamine, F.L., Silva-Brandão, K.L., Kergoat, G.J. & Sperling, F.A.H. (2012) Biogeographic and diversification patterns of Neotropical Troidini butterflies (Papilionidae) support a museum model of diversity dynamics for Amazonia. BMC Evolutionary Biology, 12, 2–16.

Couto, D. & Talamoni, S.A. 2005. Reproductive condition of Akodon montensis Thomas and Bolomys lasiurus (Lund) (Rodentia, Muridae) based on histological and histometric analyses of testes and external characteristics of gonads. Acta Zoologica, 86, 111–118.

Coyne, J.A., & Orr, A.H..2004. Speciation. Sinauser Associates, Inc., Sunderland.

D'Elia, G., Pardiñas, U.F.J., Jayat, J.P., Salazar-Bravo, J., 2008. Systematics of Necromys (Rodentia, Cricetidae,Sigmodontinae): species limits and groups, with comments on historical biogeography. Journal of Mammalogy, 89, 778–790. de Vivo, M., Carmignotto, A.P., (2004) Holocene vegetation change and the mammal faunas of South America and Africa. Journal of Biogeography, 31, 943–957.

Domingos, F.M.C.B., Bosque, R.J., Cassimiro, J., Colli, G.R., Rodrigues, M.T., Santos, M.G.,& Beheregaray, L.B. (2014) Out of the deep: Cryptic speciation in a Neotropical gecko (Squamata, Phyllodactylidae) revealed by species delimitation methods. Molecular Phylogenetics and Evolution, 80, 113–124.

Drummond, A.J. Ho, S.Y., Phillips, M.J. & Rambaut, A. (2006) Relaxed phylogenetics and dating with confidence. PLoS Biology, 4, e88.

Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology,7, 214.

Durigan, G (2006) Observations on the Southern Cerrados and their Relationship with the Core Area. In: Pennington RT, Ratter JA, Lewis GP, editors. Neotropical savannas and seasonally dry forests: plant diversity, biogeography, and conservation. Boca RatonFL: CRC/Taylor & Francis, 484 pp.

Eiten, G. (1972) Cerrado vegetation of Brazil. Botanical Review, 38, 201–341.

Emmons, L.H. (2009) Long-Term Variation in Small Mammal Abundance in Forest and Savanna of Bolivian Cerrado. Biotropica, 41, 493–502.

Excoffier L, Lischer HEL. 2010. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources, 10, 564–567.

Faria, M.B., Nascimento, F.F.; Oliveira, J.A. & Bonvicino, C.R. (2013) Biogeographic Determinants of Genetic Diversification in the Mouse Opossum Gracilinanus agilis (Didelphimorphia: Didelphidae). Journal of Heredity, 104, 613–626.

Filipi, K., Marková, S., Searle, J.B. & Kotlík, P. (2015) Mitogenomic phylogenetics of the bank vole Clethrionomys glareolus, a model system for studying end-glacial colonization of Europe. Molecular Phylogenetics and Evolution, 82, 245–257.

Franco, F.F. & Manfrin, M.H. (2013) Recent demographic history of cactophilic Drosophilaspecies can be related to Quaternary palaeoclimatic changes in South America. Journal of Biogeography, 40, 142–154

Fu, Y. (1996). New statistical tests of neutrality for DNA samples from a population. Genetics, 143, 557–570.

Furley, P.A. & Metcalfe, S.E. (2007) Dynamic changes in savanna and seasonally dry vegetation through time. Progress in Physical Geography, 31, 633e642.

Galliari, C. A., & Pardiñas, U.F.J..(2000) Taxonomy and distribution of the sigmodontine rodents of genus Necromys in central Argentina and Uruguay. Acta Theriologica, 45, 211–232.

Gauffre, B., Berthier, K., Inchausti, P., Chaval, Y., Bretagnolle, V. & Cosson, J-F. (2014) Short-term variations in gene flow related to cyclic density fluctuations in the common vole. Molecular Ecology, 23, 3214–3225.

Gehara, M., Crawford, A.J., Orrico VGD, Rodrıguez A, Lotters S, et al. (2014) High Levels of Diversity Uncovered in a Widespread Nominal Taxon: Continental Phylogeography of the Neotropical Tree Frog Dendropsophus minutus. PLos One, 9(9), e103958.

Gibbard, P. & van Kolfschoten. T. (2005) The Pleistocene and Holocene epochs. In: Gradstein F.M., Ogg. J.G. & Smith, A.G. (eds) A geologic time scale 2004. Cambridge: Cambridge University Press, 441– 452

Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O. (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic Biology, 59, 307–321.

Guindon, S. & Gascuel, O. (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology, 52, 696–704.

Haffer, J. (2008) Hypotheses to explain the origin of species in Amazonia. Brazilian Journal of Biology, 68(4), 917–947.

Hewitt, G.M. (2004) Genetic consequences of climatic oscillations in the Quaternary. Philosophical Transactions of the Royal Society B: Biological Sciences, 359,183–195.

Hogner, S., Laskemoen, T., Lifjeld, J.T., Porkert, J., O. Kleven, Albayrak, T. et al. (2012) Deep sympatric mitochondrial divergence without reproductive isolation in the common redstart Phoenicurus phoenicurus. Ecology and Evolution, 2(12), 2974–2988.

D'Horta, F.M., Cuervo, A.M., Ribas, C.C., Brumfield, R.T. & Miyaki, C.Y.(2013) Phylogeny and comparative phylogeography of Sclerurus (Aves: Furnariidae) reveal constant and cryptic diversification in an old radiation of rain forest understorey specialists. Journal of Biogeography, 40(1), 37–49.

Huson, D.H. & Bryant, D. (2006) Application of Phylogenetic Networks in Evolutionary Studies. Molecular Biology and Evolution, 23, 254–267.

Irwin, D.M., Kocher, T.D. & Wilson, A.C. (1991) Evolution of the Cytochrome b gene of mammals. Journal of Molecular Evolution, 32,128–144.

Jaksic, F.M. & Lima, M. (2003) Myths and facts on ratadas: bamboo blooms, rainfall peaks and rodent outbreaks in South America. Austral Ecology, 28, 237–251.

Jombart, T. (2008) adegenet: a R package for the multivariate analysis of genetic markers. Bioinformatics, 24, 1403–1405.

Jombart, T., Devillard, S., Dufour, A.B. & Pontier, D. (2008) Revealing cryptic spatial patterns in genetic variability by a new multivariate method. Heredity, 101, 92–103.

Jombart, T. & Ahmed, I. (2011) adegenet 1.3-1: new tools for the analysis of genome- wide SNP data. Bioinformatics, 27, 3070–3071.

Kalinowski ST, Taper ML, Marshall TC. 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology, 16(5), 1099–1106.

Karimi, Y., Almeida, C.R. & Petter, F. (1976) Note sur les rongeurs du nord-est du Brésil. Mammalia, 40(2), 257–266.

Keane, T.M., Creevey, C., J, Pentony, M.M., Naughton, T.J. & McLnerney, J.O. (2006) Assessment of methods for amino acid matrix selection and their use on empirical data shows that ad hoc assumptions for choice of matrix are not justified. BMC Evolutionary Biology, 6, 29.

Kohli, B.A., Vadim, B., Fedorov, E.W. & Cook, J.A. (2015) Phylogeography of a Holarctic rodent (Myodes rutilus): testing high-latitude biogeographical hypotheses and the dynamics of range shifts. Journal of Biogeography, 42, 377–389.

Kvie, K.S., Hogner, S., Aarvik, L., Lifjeld, J.T. & Johnsen, A. (2013) Deep sympatric mtDNA divergence in the autumnal moth (Epirrita autumnata). Ecology and Evolution, 3(1), 126–144.

Lanier, H.C., Gunderson, A.M., Weksler, M., Fedorov, V.B. & Olson, L.E. (2015) Comparative Phylogeography Highlights the Double-Edged Sword of Climate Change Faced by Arctic- and Alpine Adapted Mammals. PLos One, 10(3), e0118396.

Ledru, M.-P., Ceccantini, G., Gouveia, S.E.M., López-Sáez, J.A., Pessenda, L.C.R. & Ribeiro, A.S. (2006) Millenial-scale climatic and vegetation changes in a northern Cerrado (Northeast, Brazil) since the Last Glacial Maximum. Quaternary Science Reviews, 25: 1110–1126.

Leite, R.N., Kolokotronis, S-O, Almeida, F.C., Werneck, F.P., Rogers, D.S., et al. (2014) In the Wake of Invasion: Tracing the Historical Biogeography of the South American Cricetid Radiation (Rodentia, Sigmodontinae). PLos One, 9(6), e100687.

Leite, Y.L.R., Kok, P.J.R., Weksler, M. (2015) Evolutionary affinities of the -Lost World mouse suggest a late Pliocene connection between the Guiana and Brazilian shields. Journal of Biogeography

Librado, P. & Rozas, J. (2009) DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25,1451–1452.

Lima, N.E.,Lima-Ribeiro, M.S., Faleiro, C.T., Terribile, L.C. & Collevatti, R.G. (2014) Phylogeography and ecological niche modelling, coupled with the fossil pollen record, unravel the demographic history of a Neotropical swamp palm through the Quaternary. Journal of Biogeography, 41, 673–686.

Lopez, J.V., Yuhki, N., Masuda, R., Modi, W. S., & O’Brien, S.J. (1994) Numt, a recent transfer and tandem amplification of mitochondrial DNA to the nuclear genome of the domestic cat. Journal of Molecular Evolution, 39,174 –190.

Lopez-Uribe, M.M., Zamudio, K., Cardoso, C.F. & Danforth, B.N. (2014) Climate, physiological tolerance and sex-biased dispersal shape genetic structure of Neotropical orchid bees. Molecular Ecology, 23, 1874–1890.

Lougheed, S.C., L. Campagna, P.T. Tubaro, J.A. Davila, L. Campagna, D.A. Lijtmaer & P. Handford. 2013. Continental phylogeography of a neotropical songbird, Zonotrichia capensis. BMC Evolutionary Biology, 13, 58.

McCarthy, C. (1998) Chromas 1.45. Queensland (Australia): School of Health Science, Griffith University.

Macedo, R.H. & Mares, M.A. (1987). Geographic variation in the south american cricetine rodent Bolomys lasiurus. Journal of Mammalogy, 68(3), 578–594.

Machado T, Silva VX, Silva MJJ (2014) Phylogenetic relationships within Bothrops neuwiedi group (Serpentes, Squamata): geographically highly-structured lineages, evidence of introgressive hybridization and Neogene/Quaternary diversification. Molecular Phylogenetics and Evolution, 71, 1–14.

Mantel, R.M. (1967) The detection of disease clustering and a general regression approach. Cancer Research, 27, 209–220.

Mares, M.A., Willig, M.R. & Lacher Jr., T.M. (1985) The Brazilian Caatinga in South American zoogeography: tropical mammals in a dry region. Journal of Biogeography, 12, 57 –69.

Matocq, M.D., Shurtliff, Q.R. & Feldman, C.R. (2007) Phylogenetics of the woodrat genus Neotoma (Rodentia: Muridae): implications for the evolution of phenotypic variation in male external genitalia. Molecular Phylogenetic and Evolution, 42, 637– 652.

Miller, M.A., Pfeiffer, W., and Schwartz, T. (2010) "Creating the CIPRES Science Gateway for inference of large phylogenetic trees" in Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA pp 1–8.

Moraes, E.M., Yotoko, K.S.C., Manfrin, M.H., Solferini, V.N. & Sene, F.M. (2009). Phylogeography of the cactophilic species Drosophila gouveai: demographic events and divergence timing in dry vegetation enclaves in eastern Brazil. Journal of Biogeography, 36, 2136–2147.

Moran P (1948). The interpretation of statistical maps. Journal of the Royal Statistics Society Series B, 10, 243–251.

Moran P (1950). Notes on continuous stochastic phenomena. Biometrika, 37, 17–23.

Moreira, J.C., Cunha, A.B.A, Moreira, M.A.M., Oliveira, J.A., Bonvicino, C.R.. & Cerqueira, R. (2014) Isolation of polymorphic microsatellite loci in Akodon cursor (Cricetidae, Sigmodontinae) and cross-amplification in other akodontine rodents. Boletim da Sociedade Brasileira de Mastozoologia, 71, 33–36.

Nascimento, F.F., Pereira, L.G., Geise, L., Bezerra, A.M.R., D’Andrea, P.S. & Bonvicino, C.R. (2011). Colonization process of the Brazilian common vesper mouse, Calomys expulsus (Cricetidae, Sigmodontinae): a biogeographic hypothesis. Journal of Heredity, 102, 260–268.

Nascimento, F.F., Lazar, A., Menezes, A.N., Durans, A.M., Moreira, J.C., Salazar-Bravo, J., D'Andrea, P.S., Bonvicino, C.R. (2013) The Role of Historical Barriers in the Diversification Processes in Open Vegetation Formations during the Miocene/Pliocene Using an Ancient Rodent Lineage as a Model. PLoS One, 8(4), e61924.

Nogueira, C., Ribeiro, S., Costa, G.C. & Colli, G.R. (2011) Vicariance and endemism in a Neotropical savanna hotspot: distribution patterns of Cerrado squamate reptiles. Journal of Biogeography, 38, 1907–1922.

Norén, K. & Angerbjörn, A. (2014) Genetic perspectives on northern population cycles: bridging the gap between theory and empirical studies. Biological Reviews, 89,493-510.

Novaes, R.M, Lemos-Filho, J,P, Ribeiro, R.A. & Lovato, MB (2010) Phylogeography of Plathymenia reticulata (Leguminosae) reveals patterns of recent range expansion towards northeastern Brazil and southern Cerrados in Eastern Tropical South America. Molecular Ecology, 19, 985–998.

Novaes, R.M.L., Ribeiro, R.A., Lemos-Filho, JP, Lovato MB (2013) Concordance between Phylogeographical and Biogeographical Patterns in the Brazilian Cerrado: Diversification of the Endemic Tree Dalbergia miscolobium(Fabaceae). PLoS ONE, 8(12),: e82198.

Oksanen, J. Guillaume Blanchet, F., Kindt,,Roeland Pierre Legendre, Peter R. Minchin, R. B. O'Hara, Gavin L. Simpson, Solymos,Peter, Henry, M., Stevens, H. & Wagner, Helene (2015) vegan: Community Ecology Package. R package version 2.2-1. http://CRAN.R-project.org/package=vegan

Oliveira, P.S. & Marquis, R.J. (2002) The cerrados of Brazil: ecology and natural history of a Neotropical savanna. New York, Columbia University Press.

Oliveira, R.C., Guterres, A., Fernandes, J., D'Andrea, P.S., Bonvicino, C.R. & Lemos, Elba. (2014). Hantavirus Reservoirs: Current Status with an Emphasis on Data from Brazil. Viruses, 6, 1929–1973.

Palma, R.E. & Boric-Bargetto, D. Torres-Pérez, F, Hernández, C.E. & Yates, T.L. (2012) Glaciation effects on the phylogeographic structure of Oligoryzomys longicaudatus (Rodentia: Sigmodontinae) in the Southern Andes. PloS One, 7 (3), e32206.

Parada, A., Pardiñas, U.F.J., Salazar-Bravo, D'Elia, G., Palma, R.E. (2013). Dating an impressive Neotropical radiation: molecular time estimates for the Sigmodontinae (Rodentia) provide insights into its historical biogeography. Molecular Phylogenetics and Evolution, 66 (3), 960–968.

Pardiñas, U.F.J.; D’Elía, G. & Ortiz, P.E. (2002) Sigmodontinos fósiles (Rodentia, Muroidea, Sigmodontinae) de América del Sur: estado actual de su conocimiento y prospectiva. Mastozoologia Neotropical, 9(2), 209–252.

Pardiñas, U.F.J., Teta, P., Ortiz, P., Jayat, P.Jayat & Salazar-Bravo, J. 2015 Genus Necromys Ameghino, 1889. In: Patton, J.L., D'Elia, Pardiñas, UF.J. (Eds) Mammals of South America, vol. 2.

Pearson, O.P. (2002) A perplexing outbreak of mice in Patagonia, Argentina. Studies on Neotropical Fauna and Environment, 37, 187–200.

Pinheiro, F., Cozzolino, S., Draper, D., Barros, F., Félix, L.P., Fay, M.F. & Palma-Silva, C (2014) Rock outcrop orchids reveal genetic connectivity and diversity of inselbergs of northeastern Brazil. BMC Evolutionary Biology, 14,49.

Prado, D. (1993a) What is the Gran Chaco vegetation in South America?. I. A review. Contribution to the study of flora and vegetation of the Chaco. Candollea, 48,145–172.

Prado, D. (1993b) What is the Gran Chaco vegetation in South America?. II. A redefinition. Contribution to the study of flora and vegetation of the Chaco. Candollea, 48, 615–629.

Prado, D.E., Gibbs, P.E. (1993) Patterns of species distributions in the dry seasonal forests of South America. Annals of the Missouri Botanical Garden, 80, 902–927.

Prado, D.E. (2003). As Caatingas da América do Sul. In: Leal, I.R., Tabarelli, M.,Silva, J.M.C. (Eds.), Ecologia e Conservação da Caatinga. Recife, Editora Universitária UFPE, pp. 3–73.

Prado, C.P.A., Haddad, C.F.B. & Zamudio, K.R. (2012) Cryptic lineages and Pleistocene population expansion in a Brazilian Cerrado frog. Molecular Ecology, 21, 921–941.

Quijada-Mascareñas, J.A., Ferguson, J.E., Pook, C.E., Salomão, M.G., Thorpe, R.S., Wüster, W., (2007) Phylogeographic patterns of trans-Amazonian vicariants and Amazonian biogeography: the Neotropical rattlesnake (Crotalus durissus complex) as an example. Journal of Biogeography, 34, 1296-1312.

Rambaut A, Suchard MA, Xie D & Drummond AJ (2014) Tracer v1.6, Available from http://beast.bio.ed.ac.uk/Tracer

Ramos, A.C.S., Lemos-Filho, J.P., Ribeiro, R.A., Santos, F.R., Lovato, M.B. (2007) Phylogeography of the tree Hymenaea stigonocarpa (Fabaceae: Caesalpinioideae) and the influence of Quaternary climate changes in the Brazilian cerrado. Annals of Botany, 100: 1219–1228

Ratter, J.A., Bridgewater, S., Ribeiro, J.F., 2003. Analysis of the floristic composition of the Brazilian Cerrado vegetation III: comparison of the woody vegetation of 376 areas. Edinburgh Journal of Botany, 60, 57–109.

Raymond, M. & Rousset, F. (1995) GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity, 86(3), 248–249.

Rice, W.R. (1989) Analyzing tables of statistical tests. Evolution, 43(1), 223–225.

Rikalainen, K., Aspi, J., Galarza, J.A., Koskela, E. & Mappes, T. (2012) Maintenance of genetic diversity in cyclic populations–a longitudinal analysis in Myodes glareolus. Ecology and Evolution, 2(7), 1491–1502.

Rogers, A.R., Harpending, H. (1992) Population growth makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution, 9:552–569.

Ronquist, F., & Huelsenbeck, J.P. (2003). MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574

Rull, V. (2011) Neotropical biodiversity: timing and potential drivers. Trends in Ecology and Evolution, 26, 508–513.

Sage, R.D.. Pearson, O.P.. Sanguinetti, J. & Pearson, A.K. (2007) Ratada 2001: a rodent outbreak following the flowering of bamboo (Chusquea culeou) in southern Argentina. Pp. 177–224 In: Kelt, D.A.. Lessa, E.P.. Salazar-Bravo, J. & Patton, J.L. (Eds.). The quintessential naturalist: honoring the life and legacy of Oliver P. Pearson. Berkeley, University of California Press.

Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. New York, Cold Spring Harbor Laboratory Press, Vol. 1, 2, 3.

Sampaio, E.V.S.B. (1995) Overview of the Brazilian Caatinga. In: Bullock, S.H., Mooney, H.A. & Medina, E. (Eds.), Seasonally Dry Tropical Forests. Cambridge, Cambridge University Press, pp. 35–63.

Santos, M.G., Nogueira C., Giugliano, L.G. & Colli, G.R. 2014. Landscape evolution and phylogeography of Micrablepharus atticolus (Squamata, Gymnophthalmidae), an endemic lizard of the Brazilian Cerrado. Journal of Biogeography, 41, 1506–1519.

Silva, M. & Noll, F.B. 2015. Biogeography of the social wasp genus (Hymenoptera: Vespidade: Polistinae). Journal of Biogeography, 42: 833–842.

Smith, M.F. & Patton, J.L. (1993) The diversification of South American murid rodents: evidence from mitochondrial DNA sequence data for the akodontine tribe. Biological Journal of the Linnean Society, 50,149–177.

Streilein, K.E. (1982a) Ecology of small mammals in the semiarid Brazilian Caatinga. I. Climate and faunal composition. Annals of the Carnegie Museum, 51, 70–107.

Streilein, K.E. (1 982b) Ecology of small mammals in the semiarid Caatinga. 11. Water relations. Annals of the Carnegie Museum, 51, 109–126.

Streilein, K.E. (1 982c) The ecology of small mammals in the semiarid Brazilian Caatinga. 111. Reproductive biology and population ecology. Annals of the Carnegie Museum, 51, 251–269.

Streilein, K.E. (1 982d) The ecology of small mammals in the semiarid Brazilian Caatinga. IV. Habitat selection. Annals of the Camegie Museum, 51, 331–343.

Streilein, K.E. (l982e) The ecology of small mammals in the Brazilian Caatinga. V. Agonistic behavior and overview. Annals of the Camegie Museum, 51, 345–369.

Tajima, F. (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123, 585–595.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution, 28, 2731-2739.

Tavares, C.; Aragão, I.; Leal, N.C.; Leal-Balbino, T.C.A.; Oliveira, M.M.; Oliveira, G.M. & Almeida, A. (2012). Plague in Brazil: from now and then. Advances in Experimental Medicine and Biology, 954, 69–77.

Taylor, S., Patirana, A., Birt, T. & Friesen, V. (2011) Cryptic introgression between murre sister species (Uria spp.) in the Pacific low Arctic: frequency, cause, and implications. Polar Biology,. 35, 1–10.

Thompson, J.D., Higgins D.G. & Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22, 4673–4680.

Toews. D.P. & Brelsford, A. (2012) The biogeography of mitochondrial and nuclear discordance in animals. Molecular Ecology, 21, 3907–3930.

Turchetto-Zolet, A.C., Pinheiro, F., Salgueiro, F., Palma-Silva, C. (2013) Phylogeographical patterns shed light on evolutionary process in South America. Molecular Ecology, 22, 1193-1213.

Tzedakis, P.C., Andrieu, V., Beaulieu, J.-L. de et al. (1997) Comparison of terrestrial and marine records of changing climate of the last 500,000 years. Earth and Planetary Science Letters, 150, 171–176.

Vanzolini, P.E. & Williams, E. E. (1981). The vanishing refuge: a mechanism for ecogeographic speciation. Papéis Avulsos de Zoologia, 34, 251–255.

Vavrek, M.J. 2011. Fossil: palaeoecological and palaeogeographical analysis tools. Palaeontologia Electronica, 14:1T.http://palaeo-electronica.org/2011_1/238/index.html

Verzi, D.H., Deschamps, C.M. & Tonni, E.P. (2004) Bioestratigraphic and paleoclimatic meaning of the Middle Pleistocene South American rodent Ctenomys kraglievich

(Caviomorpha, Octodontidae). Palaeogeography, Palaeoclimatology, Palaeoecology, 212: 315– 329.

Vilela, J.F., B, Mello, Voloch, C.M. & Schrago, C.G. (2013) Sigmodontine rodents diversified in South America prior to the complete rise of the Panamanian Isthmus. Journal of Zoological Systematics and Evolutionary Research, 53, 1-8.

Webb, W.C., Marzluff, J.M. and Omland, K.E. (2011) Random interbreeding between cryptic lineages of the common Raven: evidence for speciation in reverse. Molecular Ecology,.20, 2390–2402.

Werneck, F.P., 2011. The diversification of eastern South American open vegetation biomes: historical biogeography and perspectives. Quaternary Science Reviews, 30, 1630-1648.

Werneck, F.P., Costa, G.C., Colli, G.R., Prado, D. and Sites Jr,.J,W. (2011). Revisiting the historical distribution of Seasonally Dry Tropical Forests: new insights based on palaeodistribution modelling and palynological evidence. Global Ecology and Biogeography, 20, 272–288.

Werneck, F.P., Nogueira, C., Colli, G.R., Sites Jr., J.W. & Costa. G.C. (2012a). Climatic stability in the Brazilian Cerrado: implications for biogeographical connection of South American savannas, species richness, and conservation in a biodiversity hotspot. Journal of Biogeography, 39(9), 1695–1706.

Werneck, F.P., Gamble, T., Colli, G.R., Rodrigues, M.T. & Sites, J.W. Jr (2012b) Deep diversification and long-term persistence in the South American ‘dry diagonal’: integrating continent-wide phylogeography and distribution modeling of geckos. Evolution, 66, 3014–3034.

Wuster, W. Ferguson, J.E., Quijada-Mascarenas, J.A., Pook, C.E., Salomao Mda, G., Thorpe, R.S., 2005. Tracing an invasion: landbridges, refugia, and the phylogeography of the Neotropical rattlesnake (Serpentes: Viperidae: Crotalus durissus). Molecular Ecology, 14, 1095–1108.

Zhang, Y., Pham, N.K., Zhang, H., Lin, J. & Lin, Q. (2014) Genetic Variations in Two Seahorse Species (Hippocampus mohnikei and Hippocampus trimaculatus): Evidence for Middle Pleistocene Population Expansion. PLoS One, 9(8), e105494.

Zigouris, J., Schaefer, J.A., Fortin, C. & Kyle, C.J. (2013) Phylogeography and Post- Glacial Recolonization in Wolverines (Gulo gulo) from across Their Circumpolar Distribution. PLoS One, 8(12), e83837. .

21 Figure 1. Geographical provenance of the Necromys lasiurus (black circles) and 22 Necromys lenguarum (black diamonds) samples examined used in this study in relation 23 to the current geographic boundaries of the three major Dry Diagonal formations 24 mentioned in the text (Chaco, Cerrado and Caatinga). Localities are numbered 25 sequentially from north to south (see Appendix S1).

15 Figure 2. a) Bayesian and maximum likelihood cytochrome b (cytb) gene tree for Necromys lasiurus (800–1140 bp) and Necromys lenguarum 16 (800 bp). Each N. lasiurus lineage for the mtDNA revealed by phylogenetic analyses was represented by a different color (green, central northern

1 clade; red, western Cerrado clade; orange, central Cerrado clade; light blue, central eastern clade; dark blue, south-southeastern clade). Other 2 Necromys (N. amoenus, N. lactens, N. obscurus and N. urichi) and akodontine species were included as outgroups (see Appendix S1 for details). 3 For SH-aLRT (left semi-circles), grey indicate values from 0.7–0.9, black indicate values ≥ 0.9. For Bayesian statistics (right semi-circles), white 4 indicate Bayesian Posterior Probability (BPP) 0.75–0.95, whereas black indicates BPP > 0.95. b) Geographic range of the lineages based on the 5 examined samples highlighting their similarity with c) the phytogeographical regions of Cerrado and d) presumably stable areas in the Last 6 Glacial Maximum.

3 Figure 3. a) N. lasiurus Neighbour-Net networks showing haplotypes arranged in five 4 groups corroborating the results of phylogenetic analysis (b). Haplogroups are colored 5 according the Fig. 2 and labelled such as defined in the text. Large loops imply areas of 6 phylogenetic uncertainty or reticulations. Their frequency in the network suggests that 7 the relevance of hybridization for the evolution of the species still needs to be evaluated.

1 Figure 4. Divergence time estimation for Necromys species based on an uncorrelated lognormal relaxed molecular clock using Beast version 2 1.8.1. Boxes indicate the 95% confidence interval of the divergence time. Values above and below the nodes correspond to estimated dates and 3 BPP, respectively. 4

Spatial expansion Sudden expansion

Tajima's D n nh h±SD π±SD Fu's Fs (p) SSD (p) Hr (p) SSD (p) Hr (p) Distribution curve (p) N. lenguarum 50 18 0.78±0.054 0.005±0.001 -2.11 (0.00) -14.08 (0.00) 0.001 (0.71) 0.04 (0.72) 0.001 (0.73) 0.04 (0.72) unimodal unimodal (not N. lasiurus 83 46 0.96±0.01 0.017±0.09 -0.42 ( 0.37) -24.21 (0.00) 0.01 (0.09) 0.01 (0.50) 0.01 (0.04) 0.01 (0.10) shown) clade SS 27 16 0.91±0.04 0.07±0.04 -1.46 (0.06) -8.45 (0.00) 0.002 (0.85) 0.02 (0.86) 0.12 (0.01) 0.02 (1.00) unimodal clade CN 17 12 0.89±0.07 0.09±0.05 -0.84 (0.23) -4.88 (0.00) 0.025 (0.44) 0.08 (0.45) 0.025 (0.26) 0.08 (0.21) multimodal clade CC 17 7 0.60±0.14 0.02±0.01 -1.91 (0.01) -4.25 (0.00) 0.001 (0.86) 0.05 (0.94) 0.001 (0.89) 0.05 (0.93) unimodal clade CE 18 10 0.88±0.063 0.05±0.03 -0.67 (0.29) -4.26 (0.01) 0.008 (0.45) 0.05 (0.62) 0.009 (0.46) 0.05 (0.58) unimodal clade CW 4 1 NA NA NA NA NA NA NA NA NA

3 groups 4 groups A 4 groups B 5 groups % among groups variation 7.99 13.59 18.16 70.92 % among populations within groups 27.63 22.39 18.25 13.93 % within groups 64.37 64.02 63.59 15.15 Φst (among populations) 0.3 0.26 0.22 0.48 Φct (among groups) 0.36 0.36 0.36 0.85 Φsc (among populations within groups) 0.08 0.14 0.18 0.71

Table 3. Pairwise Fst values (below diagonal) among the Necromys lasiurus mt-DNA haplogroups. Bold values of Fst were statistically significant with p < 0.001.

CE CC CN SS CW CE 0 CC 0.26 0 CN 0.12 0.26 0 SS 0.11 0.24 0.10 0 CW 0.39 0.56 0.38 0.35 0

Journal of Biogeography

SUPPORTING INFORMATION

Pleistocene Climate changes and the diversification of lowland species of the rodent genus Necromys in South American Dry Diagonal

formations

Jânio C. Moreira, Júlio F. Vilela, Fabricia F. Nascimento, Alexandra Bezerra, Cibele R. Bonvicino & João A. de Oliveira

APPENDIX S1 Samples used.

Cytb Cytb Sample ID Hap. group lat long locality province/state country Loc. number source CRB593 10 CN -1,33333 -48,5667 Arapiranga Pará Brazil 1 this study CRB586 10 CN -1,33333 -48,5667 Arapiranga Pará Brazil 1 this study CRB592 10 CN -1,33333 -48,5667 Arapiranga Pará Brazil 1 this study

Cytb Sample ID Hap. group lat long locality province/state country Loc. number source CRB580 10 CN -1,33333 -48,5667 Arapiranga Pará Brazil 1 this study CRB579 10 CN -1,33333 -48,5667 Arapiranga Pará Brazil 1 this study CRB578 10 CN -1,33333 -48,5667 Arapiranga Pará Brazil 1 this study EF531691 42 CN -1,33333 -48,5667 Arapiranga Pará Brazil 1 genbank EF531692 43 CN -1,33333 -48,5667 Arapiranga Pará Brazil 1 genbank CRB3117 16 CN -7,82083 -38,1528 Santa Cruz da Baixa Verde Pernambuco Brazil 3 this study CRB3106 18 CN -8,28278 -35,9758 Caruaru Pernambuco Brazil 4 this study CRB3108 19 CN -8,28278 -35,9758 Caruaru Pernambuco Brazil 4 this study CRB2820 23 CN -10,8044 -52,7442 São José do Xingu Mato Grosso Brazil 6 this study SVS829 45 CN -12,3858 -54,92 Feliz Natal Mato Grosso Brazil 7 this study LMP242 13 CC -12,4539 -41,4733 Palmeiras Bahia Brazil 8 this study CD238 1 CE -12,5333 -41,3833 Lençois Bahia Brazil 9 this study CD196 1 CE -12,5333 -41,3833 Lençois Bahia Brazil 9 this study CD065 1 CE -12,6115 -41,3641 Lençois Bahia Brazil 9 this study CD021 1 CE -12,6115 -41,3641 Lençois Bahia Brazil 9 this study CD101 2 CE -12,6115 -41,3641 Lençois Bahia Brazil 9 this study LG377 1 CE -13,0447 -41,3494 Mucugê Bahia Brazil 11 this study EF531693 3 CC -13,0447 -41,3494 Mucugê Bahia Brazil 11 genbank LG337 7 CN -13,0447 -41,3494 Mucugê Bahia Brazil 11 this study LG371 8 CE -13,0447 -41,3494 Mucugê Bahia Brazil 11 this study LG322 9 CE -13,0447 -41,3494 Mucugê Bahia Brazil 11 this study LG406 9 CE -13,0447 -41,3494 Mucugê Bahia Brazil 11 this study JAO1199 12 CC -12,989 -41,3402 Mucugê Bahia Brazil 11 this study JAO1203 14 CN -12,989 -41,3402 Mucugê Bahia Brazil 11 this study LG226 24 CE -13,1833 -41,1667 Itaetê Bahia Brazil 12 this study CNPSVS403 28 CW -13,675 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study

Cytb Sample ID Hap. group lat long locality province/state country Loc. number source CRB2704 3 CC -13,908 -45,9438 Correntina Bahia Brazil 15 this study CRB987 3 CC -14,0667 -47,75 Cavalcante Goiás Brazil 16 this study CRB1010 3 CC -14,0667 -47,75 Cavalcante Goiás Brazil 16 this study CRB904 3 CC -14,0667 -47,75 Cavalcante Goiás Brazil 16 this study CRB909 3 CC -14,0667 -47,75 Cavalcante Goiás Brazil 16 this study CRB993 3 CC -14,0667 -47,75 Cavalcante Goiás Brazil 16 this study CRB938 3 CC -14,0667 -47,75 Cavalcante Goiás Brazil 16 this study CRB1014 4 CC -14,0667 -47,75 Cavalcante Goiás Brazil 16 this study CRB998 5 CN -14,0667 -47,75 Cavalcante Goiás Brazil 16 this study CRB1020 6 CC -14,0667 -47,75 Cavalcante Goiás Brazil 16 this study CRB997 11 CC -14,0667 -47,75 Cavalcante Goiás Brazil 16 this study CRB1138 3 CC -14,0667 -47,75 Alto Paraíso de Goiás Goiás Brazil 17 this study CRB1570 1 CE -14,6339 -45,8517 Jaborandi Bahia Brazil 19 this study CRB1603 21 CN -14,6339 -45,8517 Jaborandi Bahia Brazil 19 this study CRB2327 3 CC -15,0561 -48,1614 Mimoso de Goiás Goiás Brazil 20 this study CRB2323 22 CC -15,0561 -48,1614 Mimoso de Goiás Goiás Brazil 20 this study CRB504 3 CC -15,9236 -48,8086 Corumbá de Goiás Goiás Brazil 22 this study ARB133 26 CE -17,9833 -53,0333 Costa Rica Mato Grosso do Sul Brazil 25 this study ARB135 27 CE -17,9833 -53,0333 Costa Rica Mato Grosso do Sul Brazil 25 this study ARB142 46 CE -17,9833 -53,0333 Costa Rica Mato Grosso do Sul Brazil 25 this study LBCE17342 15 CE -18,9189 -48,2769 Uberlândia Minas Gerais Brazil 27 this study EF531673 28 CW -19,6298 -60,6125 Alto Paraguai Paraguay 29 genbank EF531688 15 CE -19,65 -43,9 Lagoa Santa Minas Gerais Brazil 30 genbank EF531690 41 SS -19,79 -42,1389 Caratinga Minas Gerais Brazil 31 genbank EF531663 37 CE -21,3667 -51,6 Tupi Paulista São Paulo Brazil 33 genbank EF531665 20 SS -22,1667 -56,4209 Bella Vista Paraguay 34 genbank

Cytb Sample ID Hap. group lat long locality province/state country Loc. number source EF531664 20 SS -22,1667 -56,4209 Bella Vista Paraguay 34 genbank EF531671 20 SS -22,5992 -57,3547 Concepcion Paraguay 35 genbank AY273912 28 CW -22,6827 -57,3587 Concepcion Paraguay 35 genbank EF531670 28 CW -22,5992 -57,3547 Concepcion Paraguay 35 genbank CRB1418 15 CE -22,7419 -46,9014 Pedreira São Paulo Brazil 36 this study CRB1217 20 SS -22,7419 -46,9014 Pedreira São Paulo Brazil 36 this study U03528 25 SS -23,1 -59,3 Presidente Hayes Paraguay 37 genbank EF531672 25 SS -23,5348 -57,5606 Presidente Hayes Paraguay 37 genbank LBCE10544 17 SS -24,1039 -48,3906 Ribeirão Grande São Paulo Brazil 38 this study EF531667 20 SS -24,4613 -54,6388 Canindeyu Paraguay 39 genbank EF531666 38 SS -24,1488 -55,3 Canindeyu Paraguay 39 genbank EF531668 39 SS -24,1602 -55,2832 Canindeyu Paraguay 39 genbank EF531669 40 SS -24,1602 -55,2832 Canindeyu Paraguay 39 genbank AY273913 25 SS -26,2158 -59,2606 Formosa Argentina 40 genbank CRB1889 20 SS -27,2906 -52,3231 Itá Santa Catarina Brazil 41 this study EF531658 34 SS -27,5256 -55,8719 Misiones Argentina 42 genbank EF531659 35 SS -27,6 -55,3167 Misiones Argentina 42 genbank EF531660 36 SS -27,3833 -55,5833 Misiones Argentina 42 genbank AY273914 44 SS -27,5256 -55,8719 Misiones Argentina 42 genbank EF531661 25 SS -27,7067 -65,9113 Catamarca Argentina 43 genbank EF531662 20 SS -28,7388 -50,2779 Rondinha Rio Grande do Sul Brazil 44 genbank EF531657 25 SS -29,2667 -59,8667 Santa Fé Argentina 45 genbank EF531656 33 SS -29,2667 -59,8667 Santa Fé Argentina 45 genbank EF531651 29 SS -38,0667 -62,0167 Cerro Ventana Argentina 46 genbank EF531652 30 SS -38,0667 -62,0167 Cerro Ventana Argentina 46 genbank EF531653 31 SS -38,6594 -60,9918 San Mateo Argentina 47 genbank

Cytb Sample ID Hap. group lat long locality province/state country Loc. number source EF531654 32 SS -38,7167 -62,2667 Bahia Blanca Argentina 48 genbank EF531655 32 SS -38,7167 -62,2667 Bahia Blanca Argentina 48 genbank

b) Necromys lenguarum

specimen haplotype lat long locality province/state country Loc.number source ARB327 55 -7,50611 -63,0208 Humaitá Amazonas Brazil 2 this study ARB326 55 -7,50611 -63,0208 Humaitá Amazonas Brazil 2 this study ARB316 55 -7,50611 -63,0208 Humaitá Amazonas Brazil 2 this study ARB323 57 -7,50611 -63,0208 Humaitá Amazonas Brazil 2 this study RO65 49 -9,71306 -63,3208 Alto Paraíso de Rondônia Rondônia Brazil 5 this study RO85 51 -9,71306 -63,3208 Alto Paraíso de Rondônia Rondônia Brazil 5 this study RO50 51 -9,71306 -63,3208 Alto Paraíso de Rondônia Rondônia Brazil 5 this study RO35 51 -9,71306 -63,3208 Alto Paraíso de Rondônia Rondônia Brazil 5 this study RO138 51 -9,71306 -63,3208 Alto Paraíso de Rondônia Rondônia Brazil 5 this study RO137 51 -9,71306 -63,3208 Alto Paraíso de Rondônia Rondônia Brazil 5 this study RO13 51 -9,71306 -63,3208 Alto Paraíso de Rondônia Rondônia Brazil 5 this study RO12 51 -9,71306 -63,3208 Alto Paraíso de Rondônia Rondônia Brazil 5 this study RO119 51 -9,71306 -63,3208 Alto Paraíso de Rondônia Rondônia Brazil 5 this study RO132 53 -9,71306 -63,3208 Alto Paraíso de Rondônia Rondônia Brazil 5 this study LBCE7037 59 -9,71306 -63,3208 Alto Paraíso de Rondônia Rondônia Brazil 5 this study JFV276 60 -12,7134 -60,2493 Vilhena Rondônia Brazil 10 this study LBCE12257 47 -13,3758 -58,8142 Sapezal Mato Grosso Brazil 13 this study LBCE12227 47 -13,3758 -58,8142 Sapezal Mato Grosso Brazil 13 this study LBCE12209 47 -13,3758 -58,8142 Sapezal Mato Grosso Brazil 13 this study

specimen haplotype lat long locality province/state country Loc. number source LBCE12207 47 -13,3758 -58,8142 Sapezal Mato Grosso Brazil 13 this study LBCE12205 47 -13,3758 -58,8142 Sapezal Mato Grosso Brazil 13 this study LBCE12202 47 -13,3758 -58,8142 Sapezal Mato Grosso Brazil 13 this study LBCE12200 47 -13,3758 -58,8142 Sapezal Mato Grosso Brazil 13 this study LBCE12199 47 -13,3758 -58,8142 Sapezal Mato Grosso Brazil 13 this study LBCE12198 47 -13,3758 -58,8142 Sapezal Mato Grosso Brazil 13 this study LBCE12176 47 -13,3758 -58,8142 Sapezal Mato Grosso Brazil 13 this study LBCE12169 47 -13,3758 -58,8142 Sapezal Mato Grosso Brazil 13 this study LBCE12219 50 -13,3758 -58,8142 Sapezal Mato Grosso Brazil 13 this study SVS375 47 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study SVS370 47 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study SVS311 47 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study CNPSVS401 47 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study CNPSVS396 47 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study CNPSVS394 47 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study CNPSVS388 47 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study CNPSVS371 47 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study CNPSVS389 48 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study CNPSVS256 51 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study CNPSVS395 52 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study CNPSVS296 56 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study CNPSVS301 58 -13,6750 -57,8919 Campo Novo dos Parecis Mato Grosso Brazil 14 this study EF531679 60 -14,5611 -60,9278 Velasco Bolivia 18 genbank EF531680 64 -14,5611 -60,9278 Velasco Bolivia 18 genbank EF531678 63 -15,8865 -63,1862 Estancia San Marcos Bolivia 21 genbank EF531674 47 -17,2141 -63,6329 Buen Retiro Bolivia 23 genbank EF531675 61 -18,2975 -59,5995 Buen Retiro Bolivia 23 genbank

specimen haplotype lat long locality province/state country Locality number source EF531676 47 -17,7333 -63,6667 Cerro Amboro Bolivia 24 genbank EF531677 47 -19,5475 -64,7996 Rio Limon Bolivia 28 genbank EF531681 62 -21,1436 -59,4143 Alto Paraguai Paraguay 29 genbank

species Cytb Adh1 Fbg N. lasiurus CRB2327 NA CRB2327 N. lasiurus CRB504 CRB504 CRB504 N. lasiurus ARB142 ARB142 ARB142 N. lasiurus CRB1418 CRB1418 CRB1418 N. lasiurus NA CRB3175 CRB3175 N. lasiurus CRB1603 CRB1603 CRB1603 N. lasiurus CRB578 CRB578 CRB578 N. lasiurus CNPSVS403 NA CNPSVS403 N. lasiurus NA SVS142 SVS142 N. lasiurus CRB1217 CRB1217 CRB1217 N. lasiurus CRB1889 CRB1889 CRB1889 N. lasiurus NA LMP210 LMP210 N. lasiurus NA JAO1139 JAO1139 N. lenguarum NA ARB323 ARB323 N. lenguarum JFV276 NA NA N. obscurus EF531682 NA NA N. urichi AY273919 NA NA N. amoenus AY273911 NA NA N. lactens EU260470 NA NA

b) outgroup

species Cytb Adh1 Fbg Akodon azarae DQ444328 NA KJ614619 Akodon cursor EF206814 NA NA Akodon montensis CRB1897 KF815423 LBCE14316 Akodon paranaensis EU251017 EU648966 NA Akodon serrensis EF622508 NA LMT354 Brucepattersonius soricinus KF815439 KF815424 NA Deltamys kempi AY195860 NA NA Oxymycterus rufus AY275127 NA NA Podoxymys roraimae KM816650 NA NA Thalpomys cerradensis AY273915 NA NA

Thalpomys lasiotis AY310349 NA NA Thaptomys nigrita EF206815 KF815434 LBCE2017

DISTRITO FEDERAL, [3] Brasília, Jardim Botânico de Brasília (-15.92, -47.92): CRB3124-29, CRB3131-33, CRB3135-40, CRB3143, CRB3145, CRB3149-59. GOIÁS, [2] Mimoso de Goiás (-15.06, -48.16): CRB2301-02, CRB2312, CRB2315, CRB2323, CRB2327-30, CRB2334-35, CRB2337-38, CRB2347-48, CRB2350-53, CRB2361, CRB2364, CRB2368-69, CRB2371, CRB2375, CRB2381, CRB2383-86, CRB2388; [4] Anapólis (-16.33, -48.97): LBCE9465-68, LBCE9470-71, LBCE9473, LBCE9475-77, LBCE9479-849487, 9488, LBCE9489-96. MATO GROSSO DO SUL, [5] Cassilândia (-19.15, -51.75): LBCE11770-71, LBCE11784-92, LBCE11807- 12, LBCE11944-46, LBCE11963-66, LBCE11969, LBCE11971-72, LBCE12038-44. MINAS GERAIS, [6] Conceição das Alagoas, Usina Hidrelétrica de Volta Grande (- 19.92, -48.38): PRG1270-72, PRG1280-81, PRG1286-87; [7] Viçosa, Mata do Paraíso (-20.75, -42.87): PRG199, PRG975, PRG985, PRG1005-08, PRG1014, PRG1019-20, PRG1022, PRG1027. SÃO PAULO, [8] Pedreira (-22.74, -46.90): CRB1171, CRB1198-99, CRB1203, CRB1212, 1216-18, CRB1223, CRB1241, CRB1244, CRB1386, CRB1389, CRB1392, CRB1394, CRB1413, 1417-18, CRB1429, CRB1456- 60. TOCANTINS, [1] Novo Jardim (-11.82, -46.46): LBCE12754-55, LBCE12757, LBCE12869, LBCE12871, LBCE12876-78, LBCE12898-99, LBCE12901-02, LBCE12905, LBCE12907-09, LBCE12996, LBCE13020-22, LBCE13361-64, LBCE13434, LBCE13456-57, LBCE13464, LBCE13469, LBCE13903.

APPENDIX S2 Supplementary tables

group geographic range (in km2) nlas+nleng 4,666,645 nleng 340,795.8 nlas 4,048,800 CC 45,155.45 CE 521,421.8 CN 1,175,116 CW 89,218.1 SS 1,313,616

Table S5. Uncorrected average pairwise sequence divergence among (below diagonal) and within (bold in diagonal) cytb clades of Necromys lasiurus. Among groups CE CC CN SS CW CE 0.009 CC 0.026 0.003 CN 0.036 0.035 0.014 SS 0.036 0.036 0.036 0.012 CW 0.043 0.037 0.031 0.042 0.000

Table S6. Results of the Mantel tests comparing the matrices of genetic and geographic distances carried out for the five N. lasiurus haplogroups. r2 = Pearson's correlation coefficient; p = probability. group r2 p CC 0.3 0.08 CE 0.7 0.000 CN 0.57 0.000 CW NA NA SS 0.004 0.47 N. lasiurus 0.46 0.000

Table S7. Characteristics of the six polymorphic microsatellite markers amplified in Necromys lasiurus. Ta (⁰C) = annealing temperature, NC= number of cycles.

Allele Size Ta (⁰C) NC n Na Ho He Locus Range

55 35 201-315 165 49 0.96 0.97 AkC1 AkJ1 55 35 103-183 146 48 0.89 0.97

AkL1 58 30 101-171 133 33 0.78 0.95

AkLi1.2 61 35 177-297 141 35 0.82 0.95

AkPQT1 60 30 187-309 159 30 0.89 0.93

AkPQAs1 60 35 150-216 176 27 0.92 0.94

APPENDIX S3 Supplementary figures

Figure S1. ML and BI topology based on cytochrome b sequence data showing the phylogenetic relationships in Necromys.

Figure S2. ML trees for beta fibrinogen intron 7 (a) and alcohol desydrogenase (b). Colours correspond to N. lasiurus haplogroups colours in Fig. 1a. Grey circles indicate SH-aLRT estimates from 0.7–0.9, black indicate SH-aLRT ≥ 0.9.

Figure S6. Observed (white bars) and expected (dashed lines) mismatch distributions for the 4 main clades of N. lasiurus (a- d) and for N. lenguarum. Additional details are provided in the Table 1.

Figure S7. Collecting localities for the Necromys lasiurus specimens which were genotyped in this study. Localities are numbered sequentially from north to south such as listed in the Table S7.

Figure S8 – Results of sPCA based on the genotypes of six microsatellite loci in Necromys lasiurus. (a–b) First and second global scores of sPCA. Positive and negative sPC scores are depicted as black and white squares respectively. The size of squares is proportional to the absolute value of the sPC scores. Plots also show the connection network produced by Delaunay triangulation based on geographic coordinates of the 8 sampling localities examined in this study, (c) bar plots showing each component ordered by eigenvalue, and (d) Scree plots of sPC eigenvalues decomposed into their variance and spatial autocorrelation components.

Considerações Finais

Esse estudo teve por objetivo identificar marcadores moleculares potencialmente úteis para estudos populacionais em Necromys lasiurus e outras espécies envolvidas em ratadas.

Além disso, visava-se a realização de novas análises moleculares nessa espécie considerando uma amostragem geograficamente mais abrangente que os estudos anteriores. Os testes de amplificação cruzada reportados no capítulo I identificaram pelo menos seis locos de microssatélites possivelmente úteis para Necromys lasiurus e outros roedores da tribo

Akodontini. Desse modo, o presente estudo contribui para reduzir a escassez de marcadores disponíveis para estudos de estruturação populacional em uma escala espacial e temporal refinada nas espécies dessa tribo.

No capítulo II, a obtenção de sequências do gene mitocondrial citocromo b de espécimes provenientes de localidades não examinadas no estudo de prévio de D’Elia et al.

(2008), especialmente do Brasil Central, possibilitou a confirmação da ocorrência de

Necromys lenguarum no Brasil. Adicionalmente, a maior abrangência geográfica desse estudo resultou na identificação de uma forte estruturação geográfica em N. lasiurus em cinco grupos populacionais. Essa estruturação foi revelada por diferentes métodos e marcadores não tendo sido encontrada em estudos anteriores. O arranjo geográfico desses cinco grupos populacionais corrobora as disjunções norte-sul e leste-oeste do Cerrado que têm sido sugeridas tanto por estudos botânicos quanto faunísticos. Resultados similares foram encontrados quando os locos de microssatélites identificados no capítulo I foram utilizados para analisar a diversidade genética em oito populações de N. lasiurus. Desse modo, os padrões revelados pelo presente estudo servirão de base para a realização de futuros estudos

98 morfológicos e moleculares aprofundados na espécie visando esclarecer a sua taxonomia e história evolutiva.

Em termos biogeográficos, os resultados reportados no capítulo II sugerem um importante efeito dos ciclos climáticos do Pleistoceno para a diversidade genética tanto de N. lasiurus quanto N. lenguarum. Os dados aqui obtidos poderão ser utilizados futuramente em estudos empregando métodos de modelagem de nicho ecológico, distribuição potencial, entre outros, visando explorar essa questão com maior profundidade. Porém, deve-se ressaltar que a forma como essas espécies foram afetadas pode ter variado conforme sua biologia básica. Por exemplo, assim como é sugerido para outras espécies de Cricetidae e para o sigmodontino

Oligoryzomys longicaudatus (Boric-Bargetto et al., 2012; González-Ittig et al., 2015), as ratadas podem ser relevantes para manter a conectividade entre populações de N. lasiurus e elevados níveis de diversidade genética em uma escala regional. Isso explicaria a elevada diversidade genética em N. lasiurus em contraposição à baixa diversidade em N. lenguarum em que não são reportadas ratadas. Contudo, essa hipótese precisa ser testada formalmente em uma escala local e regional por meio de estudos incluindo séries temporais contemplando os períodos antes, durante e depois das irrupções.

Apesar dos avanços obtidos, os aspectos investigados nessa tese representam uma primeira etapa dos estudos moleculares visando uma melhor compreensão da dinâmica populacional dos roedores envolvidos em ratadas bem como a relação entre esse fenômeno e a sua diversidade genética. Apenas com a continuidade dos estudos será possível reunir evidências para formular novas hipóteses, suportar ou refutar aquelas aqui apresentadas.

CONCLUSÕES

(1) As populações brasileiras de Necromys incluem representantes de

pelo menos duas espécies: N. lenguarum e N. lasiurus.

(2) A divergência entre essas espécies-irmãs deu-se possivelmente

durante o Pleistoceno.

(3) Além do Chaco paraguaio e boliviano e da transição

savana/Amazônia na Bolívia, N. lenguarum também ocorre no Brasil.

(4) Em território brasileiro, a espécie ocupa a transição entre os domínios

do Cerrado e da Amazônia no noroeste do estado do Mato Grosso e

em Rondônia. Além disso, representantes dessa espécie habitam um

enclave de savana em Humaitá, ao sul do estado do Amazonas.

(5) As populações de N. lenguarum não se encontram estruturadas,

possuem baixa diversidade e mostram sinais de expansão recente a

partir de um ou poucos refúgios glaciais. Ainda assim, análises

multivariadas com o citocromo b sugerem a diferenciação das

populações brasileiras em relação àquelas do Paraguai e Bolívia.

(6) As populações de Necromys lasiurus mostraram-se altamente

estruturadas em cinco grupos geográficos segundo disjunções norte-

sul e leste-oeste do Cerrado/Caatinga. Esses resultados corroboram

estudos anteriores com a flora e a fauna do Cerrado e Caatinga.

(7) A hipótese de que essa estruturação ocorreu sob forte influência dos

ciclos climáticos do Pleistoceno deve ser testada em estudos futuros.

(8) A falta de registro de N. lenguarum e de estruturação em N. lasiurus

em estudos anteriores foi causada, possivelmente, pela amostragem

100

incipiente que não incluía amostras de grandes frações do território

brasileiro (e.g., regiões centro-oeste e nordeste).

(9) A diversidade de N. lasiurus pode estar subestimada sendo

necessários novos estudos para esclarecer o significado taxonômico

dos resultados aqui apresentados.

(10) A alta conectividade entre subpopulações durante a fase de expansão

populacional de "ratadas" pode explicar a alta diversidade genética ds

populações de N. lasiurus.

(11) A ocorrência de "ratadas" em N. lasiurus e sua ausência em N.

lenguarum pode ser uma das características responsáveis por

determinar as diferenças observadas entre essas espécies com relação

aos padrões de diversidade genética e estruturação populacional.

(12) O papel das "ratadas" na manutenção de diversidade genética em um

nível regional deve ser investigado em estudos futuros incluindo

séries temporais contemplando os períodos antes, durante e depois das

irrupções.