DOCSLIB.ORG

The Muscidae of Puerto Rico (Insect&: Dipter&I

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Muscidae of Puerto Rico (Insect&: Dipter&I Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 1978 The uM scidae of Puerto Rico (Insecta: Diptera) Silverio Medina Gaud Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Entomology Commons Recommended Citation Gaud, Silverio Medina, "The usM cidae of Puerto Rico (Insecta: Diptera) " (1978). Retrospective Theses and Dissertations. 6574. https://lib.dr.iastate.edu/rtd/6574 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. INFORMATION TO USERS This material was produced from a microfilm copy of the original document. While the most advanced technological means to photograph and reproduce this document have been used, the quality is heavily dependent upon the quality of the original submitted. The following explanation of techniques is provided to help you understand markings or patterns which may appear on this reproduction. 1. The sign or "target" for pages apparently lacking from the document photographed is "Missing Page(s)". If it was possible to obtain the missing page(s) or section, they are spliced into the film along with adjacent pages. This may have necessitated cutting thru an image and duplicating adjacent pages to insure you complete continuity. 2. When an image on the film is obliterated with a large round black mark, it is an indication that the photographer suspected that the copy may have moved during exposure and thus cause a blurred image. You will find a good image of the pa^ in the adjacent frame. 3. When a map, drawing or chart, etc., was part of the material being photographed the photographer followed a definite method in "sectioning" the material. It is customary to begin photoing at the upper left hand corner of a large sheet and to continue photoing from left to right in equal Sections with à small overlap, if necessary, sectioning I? continued again — beginning below the first row and continuing on until complete. 4. The majority of users indicate that the textual content is of greatest value, however, a somewhat higher quality reproduction could be made from "photographs" if essential to the understanding of the dissertation. Silver prints of "photographs" may be ordered at additional charge by writing iiic VIUGF iiiiciii, yiviiiy uic uaiaiuy liuniuBf, liUB, BiJincr âiîù specific pages you wish reproduced. 5. PLEASE NOTE: Some pages may have indistinct print. Filmed as received. University Microfilms Internationa! 300 North Zeeb Road Ann Arbor, Michigan 48106 USA St. John's Road, Tyler's Green High Wycombe, Bucks, England HP10 8HR 7904001 MEDINA G&UD, SILVERID THE MUSCIDAE OF PUERTO RICO (INSECT&: DIPTER&I. IOWA STATE UNIVERSITY, PH.D., 1978 UniversiW Micrçjiilms International 300 M. ^EEB ROAD, AN'N ARBOR, MI 48IO6 The Muscidae of Puerto Rico (Insecta; Diptera) by Silverio Medina Gaud A Dissertation Submitted to the Graduate Faculty in Partial Fulfillment of The Requirements for the Degree of DOCTOR OF PHILOSOPHY Major: Entomology Approved: Signature was redacted for privacy. Major Work Signature was redacted for privacy. For the Major Department Signature was redacted for privacy. Iowa State University Ames, Iowa 1978 ii TABLE OF CONTENTS Page INTRODUCTION 1 REVIEW OP LITERATURE 4 MATERIALS AND METHODS 8 Material Studied 8 Abbreviations 9 Collecting and Rearing Techniques 11 Mounting Techniques 12 Mounting material from alcohol 13 Preparation and mounting mouth parts 13 Mounting wings 14 Genitalia preparation 14 Labelling 15 THE FAMILY MUSCIDAE AND ITS ECONOMIC IMPORTANCE 16 EXTERNAL MORPHOLOGY OF THE MUSCIDAE 19 Head 20 Mouth parts 27 Thorax 30 Wings 37 Legs 41 Abdomen 42 SYSTEMATIC TREATMENT 46 Systematic List of Puerto Rican Muscidae 47 Key to the Muscidae Subfamilies 50 Subfamily Scatophaginae 54 iii Page Genus Scatophaga 56 Scatophaga Meigen, 1803 56 Scatophaga stercoraria Linnaeus 58 Subfamily Fucellinae 61 Subfamily Anthomyiinae 61 Key to the Genera of Subfamily Anthomyiinae 62 Genus Hylemya (Craspedochaeta) 63 Hylemya (Craspedochaeta) Macquart, 1851 63 Hylemya (Craspedochaeta) confusa (Albuquerque) 64 Genus Calythea 68 Calythea Schnabl & Dziedzicki, 1911 68 Calythea minuta Medina Gaud, n. sp. 69 Subfamily Coenosiinae 73 Key to the Genera of Coenosiinae 74 Genus Neodexiopsis 75 Neodexiopsis Malloch, 1920 75 Key to Puerto Rican Neodexiopsis species 79 Neodexiopsis cavalata Snyder 83 Neodexiopsis crassicrurus Snyder 87 Neodexiopsis crispiseta Snyder 91 Neodexiopsis discolorisexus Snyder 95 Neodexiopsis ditiportus Snyder 99 Neodexiopsis drewryi Medina Gaud, n. sp. 104 Neodexiopsis ebenifemur Snyder 106 Neodexiopsis flavipes (Williston) 108 Neodexiopsis rnaldonadoi Snyder 110 Neodexiopsis medinai Snyder 113 Neodexiopsis micans Snyder 115 Neodexiopsis neoflavipes Snyder 118 Neodexiopsis priscipagus Snyder 122 Neodexiopsis puertoricensis Medina Gaud, n. sp. 124 Neodexiopsis rex Curran 127 iv Page Neodexiopsis wolcotti Medina Gaud n. sp. 131 Genus Bithoracochaeta 134 Bithoracochaeta Stein 1911 134 Key to the species of Bithoracochaeta 135 Bithoracochaeta leucoprocta (Wiedemann) 135 Bithoracochaeta varicornis (Coquillett) 139 Genus Atherigona 145 Atherigona Rondani 1856 145 Atherigona (Acritochaeta) orientalis Schiner 148 Subfamily Lispinae 156 Genus Lispe 156 Lispe Latreille, 1796 156 Key to the species of Lispe 158 Lispe nasoni Stein 159 Lispe serotina Wulp 162 Subfamily Liranophorinae 165 Key to the Genera of Liranophorinae 165 Genus Gymnodia 166 Gymnodia Robineau-Desvoidy, 1863 166 Key to the species of Gymnodia 167 Gymnodia arcuata (Stein) 167 Gymnodia debilis (Williston) 172 Genus Limnophora 176 Limnophora Robineau-Desvoidy, 1830 176 V Page Key to the species of Limnophora 178 Limnophora corvina (Giglio-Tos) 179 Limnophora laffooni Medina Gaud n. sp. 182 Limnophora narona (Walker) 185 Genus Spilogona 188 Spilogona Schnabl & Dziedzicki, 1911 188 Subfamily Mydaeinae 189 Key to the Genera of Mydaeinae 190 Genus Helina 190 Helina Robineau-Desvoidy, 1830 190 Key to the species of Helina 192 Helina borinquensis Medina Gaud, n. sp. 192 Helina yunquensis Medina Gaud, n. sp. 196 Genus Myospila 199 Myospila Rondani, 1856 199 Myospila obsoleta (Brauer S Bergenstamm) 200 Subfamily Fanniinae 204 Key to the Genera of Fanminse 205 Genus Fannia 206 Fannia Robineau-Desvoidy, 1830 206 Key to the species of Fannia (males) 208 Fannia pusio (Wiedemann) 208 Fannia triïïiaculata (Stein) 213 Genus Euryomma 217 Euryomma Stein, 1899 217 Euryomma sp. 219 Subfamily Phaoniinae 219 Key to the genera of Phaoniinae 220 vi Page Genus Ophyra 220 Ophyra Robineau-Desvoidy, 1830 220 Ophyra aenescens (Wiedemann) 222 Genus Scenetes 227 Seenetes Malioch, 1936 227 Scenetes cardini Mailoch 228 Genus Cyrtoneurina 232 Cyrtoneurina Giglio-Tos, 1895 232 Cyrtoneurina rescita (Walker) 234 Subfamily Muscinae 239 Key to the Genera of Muscinae 240 Genus Graphomya 241 Graphomya Robineau-Desvoidy, 1830 241 Graphomya stipata (Walker) 243 Genus Synthesiomyia 247 Synthesiomyia Brauer & Bergenstamm, 1893 247 Synthesiomyia nudiseta (Wulp) 248 Neomuscina Townsend, 1919 253 Neomuscina farri Dodge (new status) 255 Genus Neomusca 259 Neomusca Malloch, 1921a 259 Neomusca pici (Macquart) 262 Genus I-torellia 266 Morellia Robineau-Desvoidy, 1830 266 Key to the species of Morellia 269 Morellia basalis (Walker) 269 Morellia maculipennis (Macquart) 275 vii Page Genus Musca 279 Musca Linnaeus, 1758 279 Musca domestica Linnaeus 281 Subfamily Stomoxyiinae 290 Key to the Genera and Species of Stomoxyiinae 291 Genus Haematobia 292 Haematobia Lepeletier and Serville, 1828 292 Haematobia irritans (Linnaeus) 293 Genus Stomoxys 299 Stomoxys Geoffroy, 1762 299 Stomoxys calcitrans (Linnaeus) 300 ILLUSTRATIONS 309 Plates 309 Tables 348 LITERATURE CITED 360 ACKNOWLEDGMENTS 385 1 INTRODUCTION No comprehensive treatise on the family Muscidae of any part of the West Indies is available. Only a few papers, mainly listings, descrip­ tions of new species and scattered economic reports have recorded the West Indian muscid fauna. The works of Wolcott (1923a, 1923c, 1924, 1933, 1936, 1941, 1948, and 1955); Curran (1928); Snyder (1940, 1954a, 1954b, 1957a, 1958a) and Albuquerque (1945, 1953, 1954a, 1954b, 1955, 1956a, 1956b, 1956d, 1958a, 1958b, 1959) have served Puerto Rican zoologists as authoritative works of reference for many years. Wolcott (1948) listed the Puerto Rican insects including the Muscidae, with some annotations on their biology and taxonomy, but little has been added to this subject since then. Due to the lack of adequate information on the local species in this family, it is apparent that further studies should be pursued. The writer is convinced that bringing together the hitherto scattered information and the search for new taxonomic and morphological data concerning the species would not only be desirable, but a very practical undertaking. Other objectives of the work are; 1) to properly identify the members of the family Muscidae occurring in Puerto Rico; 2) to compile the meager literature on the muscids of the island; 3) to bring up-to-date the synonymy of the local muscid species; 2 4) to clarify old concepts, as well as bring up some new perti­ nent facts about the general morphology and other general characteristics of the
Load more

Recommended publications
  • Agricultural Abandonment, Suburban Growth, and Forest Expansion in Puerto Rico Between 1991 and 2000
    Copyright © 2008 by the author(s). Published here under license by the Resilience Alliance. Parés-Ramos, I. K., W. A. Gould, and T. Mitchell Aide. 2008. Agricultural abandonment, suburban growth, and forest expansion in Puerto Rico between 1991 and 2000.. Ecology and Society 13(2): 1. [online] URL: http://www.ecologyandsociety.org/vol13/iss2/art1/ Research, part of a Special Feature on The influence of human demography and agriculture on natural systems in the Neotropics Agricultural Abandonment, Suburban Growth, and Forest Expansion in Puerto Rico between 1991 and 2000 Isabel K. Parés-Ramos 1, William A. Gould 2, and T. Mitchell Aide 1 ABSTRACT. The response of local economies to the globalization process can have a large effect on population and land-use dynamics. In countries with a high population density and relatively high levels of education, the globalization process has resulted in a shift in the local economy from agriculture to manufacturing, technology, and service sectors. This shift in the economy has impacted land-use dynamics by decreasing agricultural lands, increasing urban growth, and in some cases, increasing forest cover. This process of economic and forest transition has been well documented in Puerto Rico for the period 1950 to 1990, but some authors predicted that poor planning and continued urban growth would eliminate the gains in forest cover. To investigate the impacts of recent economic changes, we evaluated demographic and land-use changes for 880 “barrios” (i.e., neighborhoods), the smallest administrative unit, in Puerto Rico using government census data from 1990 and 2000 and land-cover classifications from 1991 and 2000.
    [Show full text]
  • The Role of the Brown Bear Ursus Arctos As Seed Disperser: a Case Study with the Bilberry Vaccinium Myrtillus
    The role of the brown bear Ursus arctos as seed disperser: a case study with the bilberry Vaccinium myrtillus Rola niedźwiedzia brunatnego Ursus arctos w rozprzestrzenianiu nasion: studium przypadku na przykładzie borówki czarnej Vaccinium myrtillus PhD thesis Alberto García-Rodríguez Kraków, 2021 To the memory of José Ignacio and Javier Rodríguez Val Female brown bear with two cubs of the year feeding on bilberry fruits in Tatra National Park (July 2020) “They thought they were burying you, they did not know they were burying a seed” Ernesto Cardenal, Nicaraguan priest, poet and politician PhD CANDIDATE mgr. ALBERTO GARCÍA-RODRÍGUEZ Institute of Nature Conservation of the Polish Academy of Sciences Al. Adama Mickiewicza 33, 31-120, Krakow, Poland SUPERVISOR dr. hab. NURIA SELVA FERNÁNDEZ Institute of Nature Conservation of the Polish Academy of Sciences Al. Adama Mickiewicza 33, 31-120, Krakow, Poland CO-SUPERVISOR dr. JÖRG ALBRECHT Senckenberg Biodiversity and Climate Research Centre (SBiK-F) Senckenberganlage 25, 60325, Frankfurt am Main, Germany. The PhD thesis was prepared during doctoral studies in the Doctoral Study of Natural Sciences of the Polish Academy of Sciences in Kraków. CONTENTS SUMMARY…………..……………..…………………………...………………………………………………...5 STRESZCZENIE……...………….……………………………………………………………………………….8 INTRODUCTION……………………...………………………………………………….……………………...11 PAPER I The role of the brown bear Ursus arctos as a legitimate megafaunal seed disperser………………..…30 PAPER II The bear-berry connection: ecological and management implications of
    [Show full text]
  • Issn: 1412-033X
    ISSN: 1412-033X THIS PAGE INTENTIONALLY LEFT BLANK PENERBIT: Jurusan Biologi FMIPA Universitas Sebelas Maret Surakarta, Puslitbang Bioteknologi dan Biodiversitas Universitas Sebelas Maret Surakarta ALAMAT PENERBIT/REDAKSI: LABORATORIUM PUSAT MIPA UNIVERSITAS SEBELAS MARET Jl. Ir. Sutami 36A Surakarta 57126. Tel. & Fax.: +62-271-663375; Tel.: +62-271-646994 Psw. 398, 339; Fax.: +62-271-646655. E-mail: [email protected]; [email protected]. Online: www.unsjournals.com TERBIT PERTAMA TAHUN: 2000 ISSN: 1412-033X TERAKREDITASI BERDASARKAN KEPUTUSAN DIRJEN DIKTI DEPDIKNAS RI No. 52/DIKTI/Kep/2002 PEMIMPIN REDAKSI/PENANGGUNGJAWAB: Sutarno SEKRETARIS REDAKSI: Ahmad Dwi Setyawan, Ari Pitoyo PENYUNTING PELAKSANA: Suranto (Biologi Molekuler), Marsusi, Solichatun (Botani), Edwi Mahajoeno, Sugiyarto (Zoologi), Wiryanto, Kusumo Winarno (Ilmu Lingkungan) PENYUNTING AHLI: Prof. Ir. Djoko Marsono, Ph.D. (UGM Yogyakarta) Prof. Dr. Hadi S. Alikodra, M.Sc. (IPB Bogor) Prof. Drs. Indrowuryatno, M.Si. (UNS Surakarta) Prof. J.M. Cummins, M.Sc., Ph.D. (Murdoch University Australia) Prof. Dr. Jusup Subagja, M.Sc. (UGM Yogyakarta) Prof. Dr. R.E. Soeriaatmadja, M.Sc. (ITB Bandung) Dr. Setijati Sastrapradja (Yayasan KEHATI Jakarta) Dr. Dedi Darnaedi (Kebun Raya Bogor) Dr. Elizabeth A. Wijaya (Herbarium Bogoriense Bogor) Dr. Yayuk R. Suhardjono (Museum Zoologi Bogor) BIODIVERSITAS, Journal of Biological Diversity mempublikasikan tulisan ilmiah, baik hasil penelitian asli maupun telaah pustaka (review) dalam lingkup keanekaragaman hayati (biodiversitas) pada tingkat gen, spesies, dan ekosistem. Setiap naskah yang dikirimkan akan ditelaah oleh redaktur pelaksana, redaktur ahli, dan redaktur tamu yang diundang secara khusus sesuai bidangnya. Dalam rangka menyongsong pasar bebas, penulis sangat dianjurkan menuliskan karyanya dalam Bahasa Inggris, meskipun tulisan dalam Bahasa Indonesia yang baik dan benar tetap sangat dihargai.
    [Show full text]
  • Intelligence Memorandum Re: El Salvador-Honduras, July 15, 1969
    . No Objection To Declassification 2008/06/12 : NLN-NSC-786-2-367-5 sc-J 7g- ti~~r..ICJt:J1-- .. I .... -. !> . ' .•..•... , ... ' . •• ..... '.' . '. SeSRI'! MORAY . OCI No.·0671/6~ CENTRAL INTELLIGENCE AGENCY . Dir.ectorate. of Intelli.gencQ · '- . lS July 1969' .. INTELLIGENCE MEMORANDUM ~ . .. ~ - . El Salvador·-Ho·nduras (S~ t\.1Ation R'eport41 - As ' of h 00 PM EDT) '1. 'rhe OAS commission is'· Arrivin9 in Guatemala at . about 1300 hours and h.aving lunch before· proceeding to San Salvador • . Their plane will attempt a landing ' in San $alvador despi·te · continuing t"eportsof attack on the airport • . 2. AirratJ:..a.aks and around fi qht:.ina on t.h_e,-""-==r-=d=e=r~a=r--,,f;J_· _ --, 25Xl · continuing. \ [ . ' Honduras is sendi'-n-g-""--~ 100 troops to the area to augment .t e: 2S~man force already there. The HondUran army has repor.tealy suffered 12 deaQ. 3 • Honduras. claims to have downed three Salvadoran · fig-.hter. pla.nes. · 1he Salvadorans had att,aoked 'l'~9'uci9'alpa at dawn and. made. ~ddit1onal forays against localities in Olancha and in f3olJthwes.t.ern Honduras. Salvadoran planes were reported making machine qun runs against the oivilian population in th~ NueVa oootepegue area. HondUran aircraf~ have st.ruok the airport at San Salv~dCir, the port of LaUn1.on., an~ the f\cajlitla oil refinery and port. ' 4. Salvadora.n President Fidel Sanchez' ' e:peecl) early this · morning m~inta . ined . a belligerent. tone. The Salvador-an oo~gress has instituted a: state of 'siege for 30 days • . 5. The Honduran ro~nister of defense has sent orders to all stations to e~pel1 ' all Salvr;\doran nationals res!di~g.in .Honduras.
    [Show full text]
  • 1 Appendix 3. Grasslands National Park Taxonomy Report
    Appendix 3. Grasslands National Park Taxonomy Report Class Order Family Genus Species Arachnida Araneae Araneidae Metepeira Metepeira palustris Neoscona Neoscona arabesca Clubionidae Clubiona Clubiona kastoni Clubiona mixta Clubiona moesta Clubiona mutata Gnaphosidae Drassodes Drassodes neglectus Micaria Micaria gertschi Nodocion Nodocion mateonus Linyphiidae Erigone Erigone aletris Spirembolus Spirembolus mundus Lycosidae Alopecosa Alopecosa aculeata Pardosa Pardosa mulaiki Schizocosa Schizocosa mccooki Mimetidae Mimetus Mimetus epeiroides Philodromidae Ebo Ebo iviei Philodromus Philodromus cespitum Philodromus histrio Philodromus praelustris Titanebo Titanebo parabolis Salticidae Euophrys Euophrys monadnock 1 Habronattus Habronattus sp. 2GAB Phidippus Phidippus purpuratus Tetragnathidae Tetragnatha Tetragnatha laboriosa Thomisidae Mecaphesa Mecaphesa carletonica Xysticus Xysticus ampullatus Xysticus ellipticus Xysticus emertoni Xysticus luctans Mesostigmata Blattisociidae Cheiroseius Parasitidae Phytoseiidae Opiliones Phalangiidae Phalangium Phalangium opilio Sclerosomatidae Togwoteeus Trombidiformes Anystidae Bdellidae Erythraeidae Abrolophus Leptus Eupodidae Hydryphantidae Pionidae Piona Pygmephoridae Stigmaeidae Collembola Entomobryomorpha Entomobryidae Entomobrya Entomobrya atrocincta Lepidocyrtus Lepidocyrtus cyaneus Symphypleona Bourletiellidae Insecta Coleoptera Anthribidae 2 Brentidae Kissingeria Kissingeria extensum Microon Microon canadensis Trichapion Trichapion centrale Trichapion commodum Cantharidae Dichelotarsus Dichelotarsus
    [Show full text]
  • Some Aspects of the Biology of a Predaceous Anthomyiid Fly, Coenosia Tigrina
    The Great Lakes Entomologist Volume 22 Number 1 - Spring 1989 Number 1 - Spring 1989 Article 2 April 1989 Some Aspects of the Biology of a Predaceous Anthomyiid Fly, Coenosia Tigrina Francis A. Drummond University of Maine Eleanor Groden University of Maine D. L. Haynes Michigan State University Thomas C. Edens Michigan State University Follow this and additional works at: https://scholar.valpo.edu/tgle Part of the Entomology Commons Recommended Citation Drummond, Francis A.; Groden, Eleanor; Haynes, D. L.; and Edens, Thomas C. 1989. "Some Aspects of the Biology of a Predaceous Anthomyiid Fly, Coenosia Tigrina," The Great Lakes Entomologist, vol 22 (1) Available at: https://scholar.valpo.edu/tgle/vol22/iss1/2 This Peer-Review Article is brought to you for free and open access by the Department of Biology at ValpoScholar. It has been accepted for inclusion in The Great Lakes Entomologist by an authorized administrator of ValpoScholar. For more information, please contact a ValpoScholar staff member at [email protected]. Drummond et al.: Some Aspects of the Biology of a Predaceous Anthomyiid Fly, <i>Co 1989 THE GREAT LAKES ENTOMOLOGIST 11 SOME ASPECTS OF THE BIOLOGY OF A PREDACEOUS ANTHOMYIID FLY. COENOSIA TIGRINAI 2 2 3 3 Francis A. Drummond , Eleanor Groden , D.L. Haynes , and Thomas C. Edens ABSTRACT The results of a two-year study in Michigan on the incidence of Coenosia tigrina adults under different onion production practices is presented. In Michigan, C. tigrina has three generations and is more abundant in organic agroecosystems than chemically-intensive onion production systems. Adults of the tiger fly, Coenosia tigrina (F.), are primarily predators of Diptera.
    [Show full text]
  • The Occurrence of Stalk-Eyed Flies (Diptera, Diopsidae) in the Arabian Peninsula, with a Review of Cluster Formation in the Diopsidae Hans R
    Tijdschrift voor Entomologie 160 (2017) 75–88 The occurrence of stalk-eyed flies (Diptera, Diopsidae) in the Arabian Peninsula, with a review of cluster formation in the Diopsidae Hans R. Feijen*, Ralph Martin & Cobi Feijen Catalogue and distribution data are presented for the six Diopsidae species known to occur in the Arabian Peninsula: Sphyracephala beccarii, Chaetodiopsis meigenii, Diasemopsis aethiopica, Diopsis arabica, Diopsis mayae and Diopsis sp. (ichneumonea species group). The biogeographical aspects of their distribution are discussed. Records of Diopsis apicalis and Diopsis collaris are removed from the list for Arabia as these were based on misidentifications. Synonymies involving Diasemopsis aethiopica and Diasemopsis varians are discussed. Only one out of four specimens in the D. elegantula type series proved conspecific with D. aethiopica. The synonymy of D. aethiopica and D. varians is rejected. A lectotype for Diasemopsis elegantula is now designated. D. elegantula is proposed as junior synonym of D. varians. A fly cluster of more than 80,000 Sphyracephala beccarii, observed in Oman, is described. The occurrence of cluster formations in the Diopsidae is reviewed, while a possible explanation is indicated. Hans R. Feijen*, Naturalis Biodiversity Center, P.O. Box 9517, 2300 RA Leiden, The Netherlands. [email protected] Ralph Martin, University of Freiburg, Münchhofstraße 14, 79106 Freiburg, Germany Cobi Feijen, Naturalis Biodiversity Center, P.O. Box 9517, 2300 RA Leiden, The Netherlands Introduction catalogue for Diopsidae, Steyskal (1972) only re- Westwood (1837b) described Diopsis arabica as ferred to Westwood and Hennig as far as Diopsidae the first stalk-eyed fly from the Arabian Peninsula. in Arabia was concerned.
    [Show full text]
  • Next-Generation Barcoding of Bulked Arthropod Samples
    We’re getting there: a first look at (cheap!) next-generation barcoding of bulked arthropod samples Matt Bowser1 Eighth annual meeting of the Alaska Entomological Society January 24, 2015 Fairbanks, Alaska 1USFWS Kenai National Wildlife Refuge, [email protected] Outline • Background: working through the taxonomic impediment • Conventional (morphological) workflow • Classical DNA barcoding workflow • Next-gen DNA barcoding workflow • A trial of NGS methods on bulked samples • Methods • Results • Discussion Conventional Workflow Classical DNA Barcoding Workflow TACCTTATACTTCTTATTTGGAGCTTGAGCTGGAATAGT AGGAACTTCTTTAAGTATCTTAATTCGAGCCGAATTAGG ACATCCAGGAGCCTTAATTGGAGATGACCAAATTTATAA CGTAATTGTAACTGCCCATGCTTTTGTCATAATTTTTTT TATAGTTATACCTATTATAATTGGTGGATTTGGAAATTG ATTGGTACCCTTAATATTAGGAGCTCCAGATATAGCATT TCCTCGAATAAATAATATAAGCTTCTGAATACTTCCCCC TTCTCTTACGCTACTATTAATGAGCAGTATAGTTGAAAA TGGGGCTGGTACAGGTTGAACTGTATACCCTCCCCTATC TTCCACTATTGCACATGGGGGAGCTTCAGTTGATTTAGC AATTTTTAGTTTACATCTAGCTGGAATTTCATCTATTTT AGGAGCTGTAAATTTTATTACTACAGTAATTAATATACG TTCTAACGGAATTACTTTTGATCGAATACCCCTATTTGT TTGATCGGTAGTAATTACAGCTCTTTTATTACTATTGTC TTTACCTGTATTGGCTGGAGCAATTACAATATTACTTAC AGACCGAAATTTAAATACTTCTTTTTTTGACCCCGCTGG AGGAGGAGATCCAATTTTATACCAACATTTATTT Next-Gen DNA Barcoding Workflow Methods: field 3 samples, all from Headquarters Lake, Soldotna • 2 sweep net (one 100 m2 circular plot split in half), 16.Sept.2013 KNWR:Ento:10656, KNWR:Ento:10657 • 1 malaise (leftovers), 27-28.June.2011 KNWR:Ento:7114 Methods: lab • Vial contents recorded (quick, coarse identifications).
    [Show full text]
  • Do Tsetse Flies Only Feed on Blood?
    Infection, Genetics and Evolution 36 (2015) 184–189 Contents lists available at ScienceDirect Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid Do tsetse fliesonlyfeedonblood? Philippe Solano a,ErnestSaloub,c, Jean-Baptiste Rayaisse c, Sophie Ravel a, Geoffrey Gimonneau d,e,f,g, Ibrahima Traore c, Jérémy Bouyer d,e,f,g,h,⁎ a IRD, UMR INTERTRYP, F-34398 Montpellier, France b Université Polytechnique de Bobo Dioulasso (UPB), Burkina Faso c CIRDES, BP454 Bobo-Dioulasso, Burkina Faso d CIRAD, UMR CMAEE, Dakar-Hann, Sénégal e INRA, UMR1309 CMAEE, F-34398 Montpellier, France f CIRAD, UMR INTERTRYP, F-34398 Montpellier, France g ISRA, LNERV, Dakar-Hann, Sénégal h CIRAD, UMR CMAEE, F-34398 Montpellier, France article info abstract Article history: Tsetse flies (Diptera: Glossinidae) are the vectors of trypanosomes causing sleeping sickness in humans, and Received 17 June 2015 nagana (animal trypanosomosis) in domestic animals, in Subsaharan Africa. They have been described as being Received in revised form 15 September 2015 strictly hematophagous, and transmission of trypanosomes occurs when they feed on a human or an animal. Accepted 16 September 2015 There have been indications however in old papers that tsetse may have the ability to digest sugar. Available online 25 September 2015 Here we show that hungry tsetse (Glossina palpalis gambiensis) in the lab do feed on water and on water with sugar when no blood is available, and we also show that wild tsetse have detectable sugar residues. We showed Keywords: Tsetse in laboratory conditions that at a low concentration (0.1%) or provided occasionally (0.1%, 0.5%, 1%), glucose Hematophagous had no significant impact on female longevity and fecundity.
    [Show full text]
  • Contribution to the Knowledge of the Clown Beetle Fauna of Lebanon, with a Key to All Species (Coleoptera, Histeridae)
    ZooKeys 960: 79–123 (2020) A peer-reviewed open-access journal doi: 10.3897/zookeys.960.50186 RESEARCH ARTICLE https://zookeys.pensoft.net Launched to accelerate biodiversity research Contribution to the knowledge of the clown beetle fauna of Lebanon, with a key to all species (Coleoptera, Histeridae) Salman Shayya1, Tomáš Lackner2 1 Faculty of Health Sciences, American University of Science and Technology, Beirut, Lebanon 2 Bavarian State Collection of Zoology, Münchhausenstraße 21, 81247 Munich, Germany Corresponding author: Tomáš Lackner ([email protected]) Academic editor: M. Caterino | Received 16 January 2020 | Accepted 22 June 2020 | Published 17 August 2020 http://zoobank.org/D4217686-3489-4E84-A391-1AC470D9875E Citation: Shayya S, Lackner T (2020) Contribution to the knowledge of the clown beetle fauna of Lebanon, with a key to all species (Coleoptera, Histeridae). ZooKeys 960: 79–123. https://doi.org/10.3897/zookeys.960.50186 Abstract The occurrence of histerids in Lebanon has received little specific attention. Hence, an aim to enrich the knowledge of this coleopteran family through a survey across different Lebanese regions in this work. Sev- enteen species belonging to the genera Atholus Thomson, 1859,Hemisaprinus Kryzhanovskij, 1976, Hister Linnaeus, 1758, Hypocacculus Bickhardt, 1914, Margarinotus Marseul, 1853, Saprinus Erichson, 1834, Tribalus Erichson, 1834, and Xenonychus Wollaston, 1864 were recorded. Specimens were sampled mainly with pitfall traps baited with ephemeral materials like pig dung, decayed fish, and pig carcasses. Several species were collected by sifting soil detritus, sand cascading, and other specialized techniques. Six newly recorded species for the Lebanese fauna are the necrophilous Hister sepulchralis Erichson, 1834, Hemisap- rinus subvirescens (Ménétriés, 1832), Saprinus (Saprinus) externus (Fischer von Waldheim, 1823), Saprinus (Saprinus) figuratus Marseul, 1855, and Saprinus (Saprinus) niger (Motschulsky, 1849) all associated with rotting fish and dung, and the psammophilousXenonychus tridens (Jacquelin du Val, 1853).
    [Show full text]
  • Diptera) of Finland 369 Doi: 10.3897/Zookeys.441.7527 CHECKLIST Launched to Accelerate Biodiversity Research
    A peer-reviewed open-access journal ZooKeys 441: 369–382 (2014)Checklist of the family Anthomyiidae (Diptera) of Finland 369 doi: 10.3897/zookeys.441.7527 CHECKLIST www.zookeys.org Launched to accelerate biodiversity research Checklist of the family Anthomyiidae (Diptera) of Finland Verner Michelsen1 1 Natural History Museum of Denmark (Zoological Museum), Universitetsparken 15, DK-2100, Copenhagen Ø, Denmark Corresponding author: Verner Michelsen ([email protected]) Academic editor: J. Kahanpää | Received 15 March 2014 | Accepted 8 May 2014 | Published 19 September 2014 http://zoobank.org/4946FF28-E271-4E73-BFE5-12B71572C9F3 Citation: Michelsen V (2014) Checklist of the family Anthomyiidae (Diptera) of Finland. In: Kahanpää J, Salmela J (Eds) Checklist of the Diptera of Finland. ZooKeys 441: 369–382. doi: 10.3897/zookeys.441.7527 Abstract An updated checklist of the the genera and species of Anthomyiidae (Diptera) found in Finland is provided. Keywords Checklist, Finland, Diptera, Anthomyiidae Introduction The family Anthomyiidae is a large and taxonomically difficult group of flies that has for the same reason suffered from unstable taxonomy and nomenclature. A checklist of the anthomyiid species known from pre-war Finland was compiled by their leading regional specialist of calyptrate flies Lauri Tiensuu (1906−1980) and published in Frey et al. (1941). The Anthomyiidae were then not recognized as a separate family but combined with the fanniid and true muscid flies in a comprehensive Muscidae fam- ily equivalent of the present Muscoidea less Scathophagidae. Tiensuu’s list included confirmed records of 199 anthomyiid species classified in 41 genera and subgenera. No less than 34% of the species names and 58% of the genus-group names in that list are Copyright Verner Michelsen.
    [Show full text]
  • Your Name Here
    RELATIONSHIPS BETWEEN DEAD WOOD AND ARTHROPODS IN THE SOUTHEASTERN UNITED STATES by MICHAEL DARRAGH ULYSHEN (Under the Direction of James L. Hanula) ABSTRACT The importance of dead wood to maintaining forest diversity is now widely recognized. However, the habitat associations and sensitivities of many species associated with dead wood remain unknown, making it difficult to develop conservation plans for managed forests. The purpose of this research, conducted on the upper coastal plain of South Carolina, was to better understand the relationships between dead wood and arthropods in the southeastern United States. In a comparison of forest types, more beetle species emerged from logs collected in upland pine-dominated stands than in bottomland hardwood forests. This difference was most pronounced for Quercus nigra L., a species of tree uncommon in upland forests. In a comparison of wood postures, more beetle species emerged from logs than from snags, but a number of species appear to be dependent on snags including several canopy specialists. In a study of saproxylic beetle succession, species richness peaked within the first year of death and declined steadily thereafter. However, a number of species appear to be dependent on highly decayed logs, underscoring the importance of protecting wood at all stages of decay. In a study comparing litter-dwelling arthropod abundance at different distances from dead wood, arthropods were more abundant near dead wood than away from it. In another study, ground- dwelling arthropods and saproxylic beetles were little affected by large-scale manipulations of dead wood in upland pine-dominated forests, possibly due to the suitability of the forests surrounding the plots.
    [Show full text]