Moustiques Et Dirofilariose: Mise Au Point Et Utilisation D'outils Innovants

AVANT PROPOS

Le format de présentation de cette thèse correspond à une recommandation de la spécialité Maladies Infectieuses et Microbiologie, à l’intérieur du Master des Sciences de la Vie et de la Santé qui dépend de l’Ecole Doctorale des Sciences de la Vie de Marseille. Le candidat est amené à respecter des règles qui lui sont imposées et qui comportent un format de thèse utilisé dans le Nord de l’Europe et qui permet un meilleur rangement que les thèses traditionnelles. Par ailleurs, la partie introduction et bibliographie est remplacée par une revue envoyée dans un journal afin de permettre une évaluation extérieure de la qualité de la revue et de permettre à l’étudiant de commencer le plus tôt possible une bibliographie exhaustive sur le domaine de cette thèse. Par ailleurs, la thèse est présentée sur article publié, accepté ou soumis, associé d’un bref commentaire donnant le sens général du travail. Cette forme de présentation a paru plus en adéquation avec les exigences de la compétition internationale et permet de se concentrer sur des travaux qui bénéficieront d’une diffusion internationale.

Pr Didier RAOULT

REMERCIEMENTS

Au terme de ce travail de thèse, je tiens à remercier tout particulièrement : Monsieur le Pr Philippe PAROLA, mon directeur de thèse. Son encadrement, sa rigueur scientifique et sa disponibilité m’ont permis de réaliser ce travail. Pour les efforts qu’il a consentis lors de la correction de mes manuscrits d’articles. Il m’a fait découvrir d’autres horizons scientifiques au cours de ma formation doctorale. Je le prie d’accepter l’expression de mes sincères remerciements. Monsieur le Dr vétérinaire Bernard DAVOUST pour avoir co-encadré ce travail. Sa disponibilité, son soutien et ses conseils m’ont permis de mener à bien mes travaux de recherche. Je lui suis reconnaissant pour la confiance qu'il m'a accordée et j’espère avoir été à la hauteur de ses attentes. Qu’il trouve ici l’expression de ma profonde gratitude. Monsieur Lionel ALMERAS pour le soutien qu’il m’a apporté tout au long de cette thèse. Pour le suivi constant de mes travaux et sa contribution scientifique. Ce travail de thèse a été réalisé en collaboration avec CEVA Santé Animale. Aussi, je remercie, vivement, Madame Marie VARLOUD, responsable technique Parasitologie pour les animaux de compagnie, Monsieur le Dr vétérinaire Gautier BARTHELEMY directeur de l’évaluation des projets pour les animaux de compagnie et Monsieur le Dr vétérinaire Hamadi KAREMBE, directeur de l’innovation au département R&D Pharmacologie. Votre appui scientifique ainsi que votre soutien moral et financier ont été déterminants dans la réussite de ce travail. Je vous prie d’accepter tous, ainsi que la Direction de CEVA, l’expression de mes sincères remerciements.

Mes remerciements s’adressent aux membres de mon jury : Madame le Pr Florence FENOLLAR, qui me fait le très grand honneur de présider le jury de cette thèse. Qu'elle trouve ici l'expression de ma parfaite reconnaissance et mes vifs remerciements. Monsieur le Dr Arezki IZRI pour avoir accepté de juger mon travail. Sincères remerciements.

Monsieur Fabrice CHANDRE qui a accepté d’évaluer mon travail. Veuillez trouver ici l’expression de ma profonde reconnaissance. Monsieur le Dr vétérinaire Radu BLAGA pour avoir bien voulu examiner mon travail. Sincères remerciements. Mes sincères remerciements vont aussi à Monsieur le Pr Didier RAOULT, directeur de l’URMITE, pour m’avoir accueilli au sein de son laboratoire.

Je remercie chaleureusement l’ensemble de mes collègues pour leur soutien et leurs encouragements dans l’achèvement de ce travail. Je ne saurais terminer mes propos sans adresser un grand merci à tous ceux qui ont contribué, de près ou de loin, à la réussite de ce travail, tout au long des trois dernières années.

DÉDICACES

A MES TRES CHERS PARENTS pour leurs encouragements et leur soutien permanent.

A MES FRÈRES & SŒURS pour tous les bons moments passés ensemble et pour tous ceux à venir… pour leur soutien et leur aide. SOMMAIRE

RÉSUMÉ/ABSTRACT 2/4 I – INTRODUCTION 7 Article N° 1 : Revue de la littérature. Tahir D, Davoust B and 17 Parola P. Vector-borne helminth diseases in pets and humans in the Mediterranean Basin: an update.

II- MISE AU POINT D’UN OUTIL MOLÉCULAIRE 59 POUR LA DETECTION DE DIROFILARIA SPP.

Article N° 2 : Tahir D, Bittar F, Barré-Cardi H, Mediannikov O, Raoult D, Davoust B and Parola P. Molecular survey of 63 Dirofilaria immitis and D. repens by Taqman real-time PCR in dogs and mosquitoes (Diptera: Culicidae) in Corsica. Vet. Parasitol. 2017, 235:1–7.

Article N° 3 : Tahir D, Damene H, Davoust B and Parola P. First molecular detection of Dirofilaria immitis (Spirurida: 73 Onchocercidae) infection in dogs from Northern Algeria. Comp. Immunol. Microbiol. Infect. Dis. 2017, 51:66-68.

III- APPLICATION DU MALDI-TOF MS POUR LA DETECTION DES FILAIRES DANS LES MOUSTIQUES 79

Article N° 4 : Tahir D, Almeras L, Varloud M, Raoult D, Davoust B and Parola P. Assessment of MALDI TOF mass spectrometry for filariae detection in Aedes aegypti mosquitoes. 83 Accepted to PloS Neglected Tropical Diseases: Vector-borne diseases.

IV- EVALUATION DES INSECTICIDES CONTRE LES 123 VECTEURS

Article N° 5 : Tahir D, Davoust B, Almeras L, Berenger JM, Varloud M and Parola P. Anti-feeding and insecticidal efficacy of a topical administration of dinotefuran-pyriproxyfen- 129 permethrin spot-on (Vectra® 3D) on mice against Stegomyia albopicta (= Aedes albopictus). Med. Vet. Entomol. 2017, 31(4):. Article N° 6 : Tahir D, Davoust B, M. Varloud M, Berenger JM, Raoult D, Almeras L and Parola P. Assessment of the anti-feeding 139 and insecticidal effects of the combination of dinotefuran, permethrin and pyriproxyfen (Vectra® 3D) against Triatoma infestans on rats. Med. Vet. Entomol. 2017, 31(2):132-139.

IV- CONCLUSION GENERALE ET PERSPECTIVE 149

REFERENCES 153

ANNEXES 159 Article N° 7 : Tahir D, Alwassouf S, Loudahi A, Davoust B and Charrel RN. Seroprevalence of Toscana virus in dogs from 163 Kabylia (Algeria). Clin. Microbiol. Infect. 2016, 22/e16-e17.

Article N° 8 : Tahir D, Socolovschi C, Marié JL, Ganay G, Berenger JM, Bompar JM, Blanchet D, Cheuret M, Mediannikov O, Davoust B and Parola P. New Rickettsia species in soft ticks 167 collected from bats in French Guiana. Ticks Tick Borne Dis. 2016, 7(6):1089-1096.

Article N° 9 : Dahmani M, Davoust B, Tahir D, Fenollar F, and Mediannikov O. Molecular investigation and phylogeny of 177 Anaplasmataceae species infecting domestic animals and ticks in Corsica, France. Parasit. Vectors. 2017, 10(1):302.

Article N° 10 : Tahir D, Davoust B, Heu K, Lamour T, Marié JL and Blanchet D. Molecular and serological investigation of 191 Trypanosoma cruzi infection in dogs in French Guiana. Vet. Parasitol. Reg. Stud. Rep. 2017. RÉSUMÉ

2 Le deuxième objectif était d'évaluer l’intérêt de la spectrométrie de masse, MALDI-TOF MS, pour la détection de changements dans les profils protéiques d'Aedes aegypti infectés expérimentalement avec des nématodes filaires (D. immitis, Brugia malayi et B. pahangi) par rapport à ceux qui ne sont pas infectés, et ce, en testant différentes parties des moustiques. Les résultats obtenus montrent la capacité du MALDI-TOF MS à différencier des moustiques infectés et non infectés par les filaires. Ainsi, les meilleurs taux de classification correcte ont été obtenus à partir de la partie « tête-thorax » du moustique avec 94,1%, 86,6%, 71,4% et 68,7% pour les non infectés versus ceux infectés, respectivement, par D. immitis, B. malayi et B. pahangi. Le troisième objectif de ce travail était l’évaluation de l'efficacité anti-gorgement et insecticide d'un ectoparasiticide (Vectra® 3D) contenant trois principes actifs : le dinotéfurane, le pyriproxyfène et la perméthrine (DPP) contre Ae. albopictus, l'une des principales espèces vectrices de Dirofilaria spp. ceci en utilisant un modèle murin. Les résultats ont démontré que le DPP a une efficacité anti-gorgement et insecticide significative contre Ae. albopictus pendant au moins un mois, suggérant que cette combinaison (DPP) aurait une bonne efficacité contre un des vecteurs de la dirofilariose canine. Mots-clés : Moustiques, Dirofilaria spp., PCR en temps réel, MALDI-TOF MS, ectoparasiticide et surveillance.

3 ABSTRACT

The second aim was to assess whether the matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) can detect changes in the protein profiles of

4 Aedes aegypti infected experimentaly with filarial nematodes (D. immitis, Brugia malayi and B. pahangi) compared to those uninfected by testing different parts of mosquitoes. Obtained results showed the potential of MALDI-TOF MS as a reliable tool for differentiating non-infected and filariae-infected Ae. aegypti mosquitoes with a best correct classification rate obtained from the thorax-head part with 94.1% and 86.6%, 71.4% and 68.7% for non-infected and D. immitis, B. malayi and B. pahangi infected mosquitoes respectively.

The third aim of this work has focused on the evaluation of the anti-feeding and insecticidal efficacy of an ectoparasiticide (Vectra® 3D) containing three active ingredients: dinotefurane, pyriproxyfen and permethrin (DPP) against Ae. albopictus, one of the main vector species of Dirofilaria spp. and this by using a murine model. Results demonstrated that the DPP combination has significant anti-feeding and insecticidal efficacy against Ae. albopictus for at least 4 weeks, suggesting that DPP will show good efficacy against this mosquito species in dog.

Key words: Mosquitoes, Dirofilaria spp., real-time PCR, MALDI-TOF MS, ectoparasiticide and monitoring.

I - INTRODUCTION

Les maladies à transmission vectorielle sont des maladies infectieuses transmises par des arthropodes hématophages (moustique, tique, puce, phlébotome...). Ces vecteurs assurent une transmission active (mécanique ou biologique) d’un agent infectieux d’un vertébré vers un autre vertébré. Ils peuvent être vecteurs de parasites (Plasmodium, Leishmania, Dirofilaria) de bactéries (Rickettsia, Borrelia, Yersinia) ou de virus (virus de la dengue, chikungunya, West Nile) responsables de maladies infectieuses à fort impact humain et/ou animal [1]. Les moustiques de la famille des Culicidés, qui regroupent environ 3500 espèces, sont considérés comme étant les principaux vecteurs d’agents pathogènes [2]. Les dirofilarioses dues à Dirofilaria immitis et Dirofilaria repens sont des infections parasitaires vectorielles, fréquemment rencontrées chez le chien, hôte habituel. D’autres espèces de canidés domestiques et sauvages s'infectent et peuvent jouer le rôle de réservoir, tels les chats, les renards, les coyotes et les loups [3,4]. Leur cycle évolutif fait intervenir des hôtes intermédiaires de la famille des Culicidés qui transmettent les parasites au cours d’un repas sanguin. D. immitis a une distribution mondiale avec une endémicité dans les régions tropicales et tempérées. Cette espèce est surtout pathogène chez le chien car elle est responsable de la dirofilariose cardio-

9 pulmonaire (souvent mortelle) dont les vers adultes sont localisés dans les artères pulmonaires et le cœur droit [3]. Cliniquement, cette affection se caractérise par une hypertension pulmonaire compliquée d’une insuffisance cardiaque droite. Par ailleurs, D. repens, exclusif de l’Ancien Monde, est une espèce peu pathogène qui provoque une infection sous-cutanée, le plus souvent asymptomatique. Néanmoins, il s’agit de l’espèce la plus fréquemment impliquée dans les dirofilarioses humaines [5]. De nombreuses espèces de moustiques, appartenant à différents genres, comme Aedes, Anopheles, Culex, Ochlerotatus, Armigeres, Coquillettidia et Mansonia, sont incriminées dans la transmission de D. immitis et D. repens [3]. Ces deux espèces de filaires sont zoonotique, d’où l’importance de protéger, dépister et traiter les animaux de compagnie afin d’éviter qu’ils ne servent de source à d’éventuelles infections humaines. Aussi, la lutte anti-vectorielle est un élément essentiel de la prévention des dirofilarioses. Chez le chien, le meilleur moyen de réduire la transmission des dirofilaires est de le protéger contre les piqûres de moustiques infectants. Les stratégies adoptées pour atteindre cet objectif reposent essentiellement sur la protection individuelle impliquant l'application régulière de répulsifs et d'insecticides. La réduction

10 de la densité de la faune culicidienne en utilisant des produits adulticides et larvicides constitue une stratégie de lutte collective, complémentaire à la protection individuelle. Dans la première partie de mes travaux de thèse, nous nous sommes intéressés à développer une PCR duplex en temps réel, capable de détecter simultanément les microfilaires de D. immitis et de D. repens et permettant de les différencier à partir d’un échantillon de moustiques ou d’un prélèvement de sang périphérique chez les carnivores. Dans la deuxième partie, nous avons évalué la capacité du MALDI-TOF MS pour la détection des changements dans les profils protéiques de moustiques Aedes aegypti infectés par des nématodes filaires comparativement à ceux qui ne sont pas infectés. Cette partie vient compléter la première partie, dans laquelle la détection de l’ADN du parasite par biologie moléculaire chez les moustiques est appliquée comme un outil de surveillance « xenomonitoring » des filarioses dans les zones enzootiques. Il est important de noter que des travaux antérieurs ont montré que le MALDI-TOF MS était capable de différencier, à partir des protéines extraites des pattes, des tiques non infectées des tiques infectées par des Rickettsia et des Borrelia [6,7]. Le MALDI-TOF MS était également capable de différencier les spectres protéiques obtenus sur des moustiques Anopheles

11 stephensi infectés ou non infectés par les parasites de Plasmodium berghei [8]. Dans la troisième partie, nous nous sommes intéressés à l’évaluation de l’efficacité anti-gorgement et insecticide d’un ectoparasiticide (Vectra® 3D) contenant trois principes actifs : le dinotéfurane, le pyriproxyfène et la perméthrine contre Ae. albopictus. En effet, des études antérieures ont montré que le moustique tigre est un vecteur compétent pour D. immitis et D. repens. De plus, Ae. albopictus est classé parmi les 100 espèces les plus envahissantes dans le monde [9]. Ceci sous- entend que dans les régions de forte enzootie canine, on peut s’attendre à des ré-émergences de cas de dirofilarioses animales et humaines. Enfin, en annexe, des résultats obtenus lors d’autres études sur des maladies à transmission vectorielle sont présentés. Tous ces travaux ont été réalisés durant les trois années de préparation de cette thèse.

12 REVUE DE LITTÉRATURE

Vector-borne helminth diseases in pets and humans in the Mediterranean Basin: an update

Djamel TAHIR, Bernard DAVOUST B

and Philippe PAROLA

Les agents pathogènes responsables de maladies à transmission vectorielle sont transmis à l'homme et aux animaux par le biais d’arthropodes vecteurs hématophages. Selon l’Organisation Mondiale de la Santé (OMS, 2016) [10], les maladies à transmission vectorielle (MTV) représentent plus de 17% de toutes les maladies infectieuses connues, causant plus d'un million de décès par an. Parmi les maladies infectieuses émergentes, environ 60% sont zoonotiques [10]. L'importance des MTV augmente partout dans le monde, y compris dans le Bassin méditerranéen, région exposée aux changements climatiques. En effet, les conditions météorologiques pourraient influencer l'abondance et la distribution des vecteurs [11] . Les helminthoses à transmission vectorielle (HTV) touchant les animaux de compagnie (chiens et chats) sont, de plus en plus, rapportées dans la région méditerranéenne. La dirofilariose, l'onchocerciose, la thélaziose, les infections par Cercopithifilaria et Acanthocheilonema font partie de ces maladies vectorisées dont plusieurs sont des zoonoses. Elles sont toutes causées par des nématodes parasites transmis par des arthropodes, tels que les moustiques, les mouches noires, les drosophiles, les puces ou les tiques. Ainsi, le contrôle et la prévention de ces maladies nécessitent une approche multidisciplinaire basée sur le renforcement des collaborations entre les différents acteurs (santé, recherche, sociologie, économie, gouvernements, citoyens) pour améliorer la santé humaine et animale comme

15 celle des écosystèmes ; c'est le concept d’une santé globale «One Health».

L'objectif de cette revue est de fournir des données générales et actualisées sur la répartition spatiale et temporelle des HTV affectant l’homme et les animaux de compagnie ainsi que les vecteurs incriminés dans la région méditerranéenne. Les symptômes cliniques et certains paramètres épidémiologiques, le diagnostic, le traitement et la prévention de ces maladies, selon le concept de «One Health», sont aussi discutés.

! "!#$%&'&(

)( $%! * +, -.! / ! 0 1

# 2

! " 3!4 4 ).' 6! 77(+!

-*+ 0 1

128779) 7'9: :

2 1 ; .1

< .= <" = / /

1 < >

! > - 1 >

/ = = 1 .=

<3"

? ?

> ?1 =/

=/ @ 1" =A.

" " A

1" "1#

/ = =

=> / /

? / 1

BC3 D1

> ..

= <3 >

! 1% /

= BC3 D>

= 1

? C3

! 1

18 !

< .= <" =/=

= = =A

@ A 1" =1

&FA>

/G H1, - /:*F ? G'H1

< / =. /

1 /

/ # / "

== / "1 =

=> > "1

- /-? 71

< .= = % = %

91 / ! "#$ %"

> / 71

! = =/

> +1, /

> /

- A . .= G:.(H1C <3

> /=

/) *1 /

= *1, >

% " ? <3 >

A>BC /> D" =

19 -" ? (1,

B# /> D"/

13> I %, 1

= =/.=

> / 1

/ = > = ? 1 =

> / % '1 ?

> =/ A/

'* '1

1 >

= 2 > , , >

> = G 7H1 > >

/ = = ?

= 91! = =

, / 91C 1 =

> 7 +1 >

/ => /

! =:1 =

/ /= = :1

! <3 =

A /. = /

? 1 / = !

/ A 1"<3 => /

= == (13>

! = / ? ..1

20 > > <3 =

! 1 / /

<31

%$ &'

@ .= />

=/ % 2 "1

=A> >

@/ > &1 ? //

> 2 / " =

" * ( $ / J

=. / >

/G ) '*H1

3 /

=> "

/ @ = "#$ ("1 =

@ . K7"

A > / *1 K7

= > > K9 / "1

'*L (*/ ()L'+)/

21 *10 / /

"#$ )"1, /'7*L7 *=/7+*M

> N / '*L )*=/7**M> 1#

> = "#$ *"1, / **L &*

=/9:*L:+*M> N /+*L&*=/7&*L9+*M> 1 =

L=> / 1C

= == =

G' H1! =/@ = /

@ . . K7 1

@ .N'&O# A

= *L 9/> / => 9O#

*1 = / (P# /

1 > = =>

9P#" / @

G''H1 @

> G''H1% >

= =

> G'7H1

> = 1

%, / % , , ,

1!> =- CI

G'7 '9H1

22 ! ?=/ - =

G':H

> @/ ! G'&H1$ =

/> >

" > " ! 10 -

> +F(*F /G'(H1

/ </ =

> 1 % (F7:FG')H1

% >. % " = =

> =

+1(F %7F ! " / G7* 7 H1 >

+F &F # 0 " *F79F Q " 7F 9F

A " 1+'F9:1'F A/"G7' 77H1C

! = 91&F 91+F " 19F'91+F

, " '1 F :1 F ! "G79.7:H1, >

= /G 7H == 1

= / > >

/> %G7&H1

0> == =

/ > A G'(H1# >

= G7(H % G7)H /G9*H 0 G9 H Q G9'H

A/G97H A G99H1C !

= G79H , G9+H G9:H1

=> > G7 H10

23 - /= > >

*1'F % G7 H 91(L +F G9& 9(H *17F /G9)H 91:F /

G+*H % =

! /G9) + H1

# ! =

/ > - > - >

> = 1

'*** > ! / 0

Q % "> / G+'H1C

> > !

A/ % = # ,= % G'7H1 =J

1 =

> '* +G+7H1 % =

= '* &G+9H1 0

= / / # G++H1

> / /

= /> 10 - =

= / 91+ / )(:L ))( +1:

/ )))L'**)G'7H1

= >/1

R *1

% =

24 > G+'H =

>= > // > A>

G+:H1C /

/ 2 = / =

= / /" / >

> >

" / = . =

/ ? ? @- "G+&H1

> #@# =

> =

= => 1

/=> / -

> > G+(H1

== ?

> . / =/ 1 /

> =/ / /

/ S. / >

/ G+'H10 /

? = " /

/ = =

. / > /G ) '*H

= / 1

25 - @/

A/ > = G+'H1

= / /

/10 >

/ '1+JA=/> > =/

> '9 " / =

*1$ , 3 > % /G+)H

-// / .

> = /

/ 1,/ / >.A

1 / == =@

/ = = =/ -

/ 7*L9*/"=/ . /

> /*1+JA

>A*1+JA / >A >=/*1+JA / /

>>AG+)H1 ,3% -// *

JA> / >A= 1 /

-// ! ./= = / 1

= / =

= . =/ Q0.= A /

G+'H1 /

G:*H1- >

> / : :L '

JAJ " )+F / /

=7* *1

26 % > > =

= /

= "G'9H1, / > >>A. /

/ > G+)H1

# /

> A ? 1,

/ ! A /= 1

= > T "1 > / =

> =/=/

I= > G: H1

> "

-// 1C/> = =

> > 2-// *

JAJ/ 7*/ :JA / +/ - G:'H1

> G+'H1

=?>

/ =? 13>

G'9 :7H1% >

G'9H1 = >

= -

/ . G'9H1

27 , J ?

,3% / . / G+)H1

/ /

K7"K9>

> / =/ > 1%

/ "1 =/ -

- " = >

= (10 / -

/ /

/ =

@ " / = = - /

G:9.::H1C = . ./ -/=

= > / G:&H1

/ / >=

@ = 1

($ '

? % "/>

=/# $ " %" "

/ G:(H1 > > =

=/ 3 / ) *"G:)H

= > = 1 =

28 = >

> /- G&*H1 >

= 2 C /> "

# /> "1 = /

> /G& H1

G&'H1 - > /

> / > ! 1

-G&7HG&9H1

= / > 11 "

11 A "/G:(H1

3 /

R? ):'"G&+H / > 1 = -

> == 10

> = . K "

/ =/ 1 .

K " =/ / ,

U " "1

> / 1, >A>

= . K7"1%=@/ K7 = A

/T > / /

1 K7 /

== >

=7+/G&7H1

29 / > / =/C

'**7G&7H1 - / /

> J= = 1

> > /

/= =/ /G&7H1

= = /

0 # R 6!/

G&:H1

! = / =

> )()

/G&'H1%=@/ >

/ :*F "G&7H1 =

= =/ &' 1# ? > 0

'**:G&&H1 .> 0 >

? / = '* : > /

1, / > K

:*> '* :G&(H1

? >= > % '* *

'* ' /G&) (* (*H1 ? >

'* 7G( H1 / >

- ( $ "G('H1 ?

Q > '* +G(7H1!> / > '* 9'* : 30 9: >

Q G(9H1 =

$U+ " $U'" A #

3 ? % = 1 / =>'* '* 9 ?

>= + J (9 '&1& F" -G(+H1#

! = 1

, ? ? >

/0 '**+G(:H % '* 'G(&H1/ > >

% = G((H # G()H1, ?

= 6L," >

/ "G)*H1 A>

= ! 1

# $ " / !

> = G&7H1,/=/C

'**:"G) H /> ?

):)#$ " =>, $= / =

>A/> 1

/ " / 1

= #$ " > 6/, +*&J):)"G) H1

= / ! " A/ = =

G) H1

31 ? =

= /G&7H1 /

= J /> /

/ "#$ +"> -

G)'H13> ? /=

> =/= =

/ A / K7

J K9 G)' )7H1

? 1 A/

=G)7H1 / 'L (1+

7&*L+ *V > ?=/

. 1, &1&L '1( 77(L9'(V

> =/ . G)7H1

/ >= K = /

/ G)'H1

= /=/

> / > F G)'H1

, =

- F G)9H1

% *F"- '1+F".

= ? > )*19&F"

)+1'7F"/ G)+H1 /=/K

32 '* +"G):H > / . *F

'1+F- > /

0 1 / /

/ / > =/ - >)*F /

G)&H1# /-

/> =/ 1

)$ '

% "

11 > = - "

G)(H1 > = ):&

# > " Q 1,

'* A/ ' > ? ? >

= %C

I ! G)) **H1A % "

% ! = 1

3 /

/ 1 > =A L

" "1$

T / / A>

G)(H1, =A //

33 = / = >

- G * H1

/ % > ' 7

=A % ! " -

$, > > 1

# = > > / %

1 = =/ =

10 - / Q *&

(F"> A . G *'H1/ >

% > 91(F +J *9"- G *7H10

! > '* + G *9H1

, ?

> '**' > ,= G *+H1

3> >/ / '* > =

A/ G ' ** *:H1C !

= %Q /G *&. *)H

/ >

1 - = > =

== > /

> G *H1 = 11

- = >

"1 > .=. ?=

34 / ==

= = / G H1

?=/ == = 1

/> = 1

A > / 11

" / >=/ J

G( )(H1 /= A A

= A > 7&O# > /=

G 'H1 /

?=/ =/)(L (M=/+L&M> >

- /= / = 1&MG 'H13> @

@ = A

/ (1/ /K %,"=

=G 7H >

/ / = 1!

#$,@ =

)) 1

/ >

1 > -

/ / =>= =

1% = =

> / = ? G *H10 /

35 11

> = > G))H1%/ > /

= / >

/ > =

G +H1

0 - 1- /

+*VJRJ =

/ / "J =? +JRJ/

'/" = G *( :H1 /

> = A>A $ $

> G &H .= = =

10 / - /=

/ / /= ? G *&H1

= /

A1 =/ >

/ A>1 > ==/

A = / K7 A>1

RR '**&"G +H / =/

- , C= > A=A/ /"

1, //

G))H1

*$ '

36 /

/1 " Q (()"

/1 1" #== (&*"

/ /A>

G 9 (H1 / /

// A/ 91

='(*M 91&L+1(M > >

=/ A =

1, 7 &L7'G )H1

='(&M *M > > -

A 1! +L7'

*1 L*1'> > 7*L:**1 L*17> G '*H1

3 /

=/ # *+ " " A ,

"" -" .*" =/

.! "" A , ""

))/))) 1,> =

- / =/ A /

91 /

/G ' H1%-/ K . >

= 1! =

K7./

1 > = =/

37 G )H1 >

> A>G '7H1

> > = % %

, C /, 91,1

, , G ( ''H1 =

Q G9'H % G '9H0 G '+H /G ': '&H >

*1+F +1)F1, !

= 1! >

( $ " = / >

> *1().)1*)FG '( ')H10 / "

/= ? / /

/ 9 = A> =

! = 1

> ,1 = G'+H % G '9H /

G 7*H , G 7 H ! G 7'H G 77H1

=>'1&F 71 )F1$ =

! 1$ =

- ( $ " /G ')H1, >

= ! 1

! = . = =1

= =/ = >

38 RT @> > >=/

G 79 7+H1

3 . =

G 7+ 7:H1# / > A

= 10 /

/ G 9H1

= A

> 1 G 7&H .

,W - " =/

2 =/

=/ 1 - . / >

/ G 7(H1

+$ ! '

'( =

G + 7)H13> !

= 2 "

! C '* 7"G 9*H1

= / / ?G + 9 H1,

/>= G 7)H

> =/ /

39 A A G 9'H1 1

= G 9'H1

" +:&L::*V '1'L +1+V> >

= - /1! (+1'V=/:1:V> > = 1

! 1 ('L )*V=/(1+L V> > =

3 /

/ =/ = > A,

" > = G 97H1

/ K7" T > /

K "1 = A

> K7"> - /7*/G 97H1

> = =/ 1

$X )*&"G 9*H = >

" /1 " "1 '* C +

% / /" C '* " 1"

> > / " +1K

1"> % Q

% /"> *1+F +F

@ 11 /A #A "

G: 99H1, / U *'" ,

40 1>

A> 2! )1(F" " 71)F" 00

C 1 '* 7 71&F"G 9+H1# !

= 1

> / =/- A A

:13 /A>

/ / =

$ = 1$

=- = , " A

1 = > ! >

/ > / >

=/ - G 9:H1

=>/ A

=/ / - 1 A= ,

"" @/ 1

><3 !

41 <3= / =

/ / / 0 % "=

. / , ! "

! > @ !" > =

= 1 A

. ! 1

! =/ = /

= ? = / >

= A/ '** '* ' /1

B# $ " D

> =

! 1

0 / 1 1 =

<3= - "

= 1

1 = /Q 1 =-

=/ > C "1

/ .

> / G 7& 9&H1 / =/

1 =>/ / A/==

/=A 1

, #

42 /

"# #

"#$ %$ -# ' " !. " ! .

!$ /

"#$ )$ 0 #

"#$ )$ ' " ! ' #$

"#$ *$ , ' " ! $

1 ' #$ ' #

"#$ +$ , 2 3 #

4 %$ 0 ' " ! "$ $

!"#$%" &'(%)%*!, &-.,//000 0&! /1#% /% & ///

2!3456% "7859:;<5= !:(%#<5>%"?@58-"1%25@%)%?6, 5A

>B( C,

@B9%"" 85>!%B6, ! " # $! 5% A

="%(&D53%B;5%.*@53BE5=&B?B""%45$%1"@56F 35&H=,'! ( $ # (# # " # ) 5*

' % !@5>%*45% !%;=5<!%85 ("=5%658%("!857%.!"458%-!=5 6%.%#!.!B"!4 %" , # , ( $- # . 5

8&D5;! %!;5%"#5D(!"85I%"#858&;,0 ! " 1# 2# 5*3 A

' % !@5@% %AI!C5>%*45I%9%@56 @58&D5D%.""8,4 " 2# 53

@% %AI!C5' % !@,5 . ) ! 5 . 6 53

;D%""2 58&D53%1$58B!25J!,7 - 533A

$%%$35>!"=53BH!?257B 1%I>54H&%#;5;##" !35 ?%2 5B#% 857"!325@BH")( %" ,8 5 9:; $ 0 $<') !" # 5=A

' % !@5=%?B75I*858B"BJ65K%?%35%65@% %AI!C5>%',0 # ; ! ? ( @'# $ A ! $ % &'"5B A

8&D53%1$5 !8,+ "1

$B:&I5I&%25;%, ( $ (! 5BA

' % !@5>%*45@% %AI!C5 ("=5% !%;=58%("!85D%BLB"58%-!=5 >%',C# . # ' ( 5B=A

44 ' % !@5>%*45@% %AI!C5;!85% !%;=5;B %&9K5>%','# ! ( . C "'5DA

>% &85I&%1H!(=;5' % !@58B""! 25>"%(%5@."%)65=!"%!A8%""(!,CE G H ) - 5 0 2# $ )! 5= A =

CB&$65

>)%LB;5>%M!@5@"!#;5K75>-%C5I!(%E5>H656%!"%6,0 # ( . $ ! 5*%A

C!%;5;""!;5;%:D5@%"265=!B%B#2>56%!BO56%!"%6,'

- $; !" # 5 IA

8&D5%"#5;! %!;58&;5D(!"8,0 2# 53%A

#1%75$%( !,C K ! - < ' ! L M ( )! ! % 5 =3A

8&D53%1$59%C,5 . 2# + , 5A

=1!C5="AB%;5;!&!58!)%")A;(B"25;""%#!E5D% !45;! !:%A <"!!2<,7 . ? ) % 5= A

;%%D5<" 5=%!5D !9%!2;5I%H%;@5C%!'5D%#!!5D%1.!5!B% P,C O $. ## G 5I

D%85;%(;58%H""=5<.;5I!"%C5@""Q'1!#%1;56%*;D,P ! . Q $ 8($ % !5% A

8&D5%"#5D%!D5;! %!;5D(!"8,8 - ( # 2# 6 5%%A

' % !@5D%.""858&D,0 #, ! 8( ! . 5='##=

;! !:%A<"!!2<5D% !45D!H%2<52B ;D5;""%#!E5;!&!5=1!C, 0 # ! $ 0 $'# 5*3A

@!#%#!<58!1)6258!)%")A;(B"25=1!C5;!&!,0 . - '# $ &! 5A

45 ;! !:%A<"!!2<5;!&!5C%"!AD!#!K5C%"!AD!#!=5=1!C5D% !4, G ! - C $'# 5D

D%#!!5;#%!D5;%#%#D,G ! $ $ $ ## ! ## ( ( 0495" # G"" ( 5

=1?=5')?%"%K5>%"?%:%E5

MH;5!B% H;5;%H!B?;5I%HHE5??;58&%H;,C ' ( 5 Q !" 53 A

I%&@5@%1$5@%9!B >56%!"%6,; @'# A P ) )! #!! % # 5A

4"&%1%3=53&%""%%:!B354%:?75J%8C5@B&% %B5@%1 =53%&%;54"<$5 <)H5=%&H$,5 ## ## $ ! C 5=%IA

<!&E5!M%<5="!65%9:45=(985>% &8,' " ! ( " ( - " - # # 5=A

;%%D5! )=5D%#!!5' % !@57%B?I2,5 . G 5A

D%85<""#45C%9%85>!%:C5< !C5=1!C,0 . - '# 5I=A

=%%1!))!658%H""=5@6;5=%"%;5=&!""C5D%8,5. O? @0 8(A. # # %) # 5

D&%B9D;,8# ; ( @A " 5%IA

J%?%"7D5$1!%D<,7 . " 5 %IA

=1?=5DR

%)I5@B&854#"&!5>: :>58M!652!%&1<,S) # " # $ # (! $ T ! ) U/ 0 / 5 =D A

46 >A;%&#;;;, 1 !! , , ' " 2 "

$%B=5$%1"<5!#(=5C%9%8, 8 ! $ % &'"53A

;%%D5%1!D5D!1H%;5D%#!!5D%1.!,G ! 5 ! G # 53 A

J%5="9 AC%%"%

I%9%@5< 85;"""!65D%.""856%1.BC5IBD5=% !@56%!"S>5>!%<, ) ( 8( 53IA

<"A3%..%:K;5%..;530!?'D5

I%""! ,R # ! ( # # ( ) 4(3 4 5 5 A

C%#!=1U;=A;28A;E;4D2<;A<,&! ! 1 6 !" + , %

>%.* %AC%#I5!#(B;5@!1(B@5;! !56%O%!656%65I%9%5 !#(B65;%B!E5>"!= %" ,5 . ( # ! - # 53A

!#(B)AD%")%#""%;5B)A> ); 5#AC%!A%1)25#!#!AD%1.!<5 C%#)A. !A7B&458%% I5;!&!,7 . ( ( ) # (7!5I=A

>)%LB;5;%1!-% 456%!"%65>H6,S<# . U ! 5A

=1UC58&D,&3! , ! !

8&D5J!58&;,8 ' " 1 ,

;%(25! )=58B%#!5811C5;%(;57%B?I25@."%)6,C# ( . ( T ,V # # " # . @ ( A " # . 53

<1%$% 0!1=! :,!!' ) ) 8 , 2 " % "! &3! 9 1 !! , : # , "

47 ;D%""2 ,Q (" (( -# ! ! ! -$ # $ 5%%A

;D%""2 58&D53%158B!25@)1%?;I5=B.%?!#M65;%!B<;5 ;D%""=@5=B.%?!#M758%#8 %" ,7 - # # 5BA

8%#85WB %9%""%D5;%9!.!B"!B<58&;58B#85> !853%1,) 1(( ! - (K - @ A 53IA

6%1.("!=5D% I859%C,7 . @A # ! -- " 5%*A

C%;5%#452%LB 65>!%B=5>!B&%4,2M(.# - # # @2M1A# ! 5A

C%?&%B>5@B1! 65$B 2=5EEE5;D%""2 53%B1%D5;% &<5K!B(@5D%!"" =65;D%""=5D& =I %" ,R # M( - .# # K # @ $ % A 5B

I%0B.=57 &B &%=53%0 &%1%!;,R # M(

DW # DW# % K 5D A

;D%""2 5$!#(?45J%"!B#;5;%!B<5@D! :X5;D%""=5D%1&%"25D%!>5 D% 2,5 " ! ! " ! ; ! ! ; " 2 " , 9 , !' , : !,! 7 " "! 1 !! , ,

' % !@5@% %AI!C,Q ( -& # - ( ( 5B

<1%<!%*!!J %:6%% !"!( ,4

;%%D5D% %!<5<"1#%>5%1!D5D%1.!5D%#!!,2 & 8 5 0 2 "0 G !" 53%A

;%%25' % !@,5 # ( ( # 5*

!5> %("%66,G & R X7 ($ID$ G $ 8( " 5%A

' % !@5C!("!45%65I%9%@5!,0 # ! & @'# $Q ? A $ 1 8( Y Y# 0 6 53 A

48 ' % !@5%65>B!!J5I%9%@58%(%.!<,9 (& @'# $Q ? A ( - ( . ! "'5 =IA

3!)"!9@6, "' 4 & '2 <=

' % !@5%65I*85;"""!65=&25 %(YP,' ! & 1# % ! 5I A

@!&65D&%B#B85=1!<5D%)%"! 85D% %D5' % !@,; # ( - (& @'# $Q ? A ; 5IA

;Z#!"5E5%92C5$%"!58B""! 2 '# & - ;

;!85;! !:%<5$%#)5@%#!@5J%)LB);J5> !;5J""%(%%;5>%*45 ' % !@,& -# '# 5

J%5!#(BCI5D! %<5@)A!.@5;%&%#!25D!B*&!I5IB%25% !%;=5 D%#!!5' % !@,; # ? (& G 5

=!%D5%1%"&!==5<% %!=58!*;;5;%LBE5;%%&%=52!%!J;5# D%9%"&!;5' % !@,; ? (& G 5I3 A

D%"!A>%"5' % !@56)A;%*245=%!C25%@,; #& - '# $ / 5I A

@%?!B<5@D<5I)1!B"%=5I)1!B"%E5I%9%@,& @'# Q ? A. # 5 A

6%.%#!.!B"!453!1!B<5I&!1%<5E!%#!B45D!"""%J5' % !@, '# & !"

$!#)<5% !%;=5<!%85<"<5>?5%65@% %AI!C5' % !@,Q # ? & 9: 5*

' % !@5@B-!;,7 ? $2# !" # 5A

CB E5;! E5=%B(%2;5% !%=58%% I5' % !@,Q ? $ ? $'# $=D !" # 5BA

I%A' %9=58%H""=5I?A>!)!9;56 !9<58%M>5D!"""%J5;!1"!9=5 D%85' % !@,2( - # ' ) 7 ## )! #!! % # 5A

49 6%%#)?;I5=%1%#)35Y9M%?I5;%*?!9C52%M !9Y5;"*A;#9#;,& "". ? 0/ 0 / 5=BA

' % !@5D% %D5I*85%6, ( ) & ! # ( # ! # $ 5%3A

' % !@5>%*45D% %D5%65;%%2,Q ?# Z(( ) * # ($ ( % !5=D A

=&258%>5D&B@5 %(Y5KB%P5D% %D5' % !@,7 ? "" # ( $ 5I=A

' % !@5%65I%9%@58%-!=,& @'# $Q ? A ! # (( #( " 5 A

%65I%9%@5<(!*<5' % !@,; M(1 # & ( 5A

>%%#65' % !@,Q ? (& @'# $Q ? A # # DW 1 =W 5=IA

&% D5=1!756% '5@LB"H 5D&%&!:=5=D58B""! 2,0#! ! ## (! ( -" 1 #" & ( 1# ; 5B

C!("!45!5I!1!45=&?5>%%#6,Q # ## ( M( ( 1 @8 #A & ( 1# 5 A

= I5=)""Y, -( ? 5 A

8%!<25& 253!1!B

' % !@5@% %AI!C5DHY5K%#>5>B:B?H%H%75>!%"'>58B*""<5;!B I5;B %&9K5>%',7 . ! ? 5

' % !@5@% %AI!C56%.%#!.!B"!456 @5DB.%%',Q: ! !" # 5BA

' % !@5@% %AI!C58%""<5% !%;=56%.%#!.!B"!45D%#!!5D! $, H $ G$=D"=D= !" # 5IA

;!85;! !:%<5D&%58%"9)5;(B)225;%!J5' % !@,; '# 5I

50 ;%%D5<!%85% !%;=56%<58%""<56#!!5' % !@, P 0$G !" # 5= A

= I5=)""Y54(:#Y5J%(%E,' E !?

- 6 % 5I3A

E"&%$@5K%1%<5;!&1%K5=B(:%1%$5;B !;5K%1%%?$5$%(%0%$5H>5 >%M;=, Q: ( K # 5BA

;!0"%985C%)H!#C53&?&%&<5;!H#E5>!01%@@57%##%=,7 ( @'# $ A 8 $ &! 5BB A

4H&%#;5' !9%8<5D&B#B35$!H!&1@5C)A4%E5;% &!><5>&!.$=5D% : 6I,H ==" " ) ? . # < ' ! - ! $ % &'"5BBA

>(B%<5$!&H(>5$"#25;B %B>5I%&45I%..@,7 $ ($) =D 5=D

3!1!B<54H&%#;53%"#:1#!B45I%"45@<,' E !. # #=% (!5A

4H&%#;5' (%K5@%"=5=&""D<5=%< 584,

- - < ' 5IDA

' % !@5@% %AI!C58%""<5

8%""<5D% %D58%965>?5D%1.H"">45@% %AI!C5' % !@,) # ( !

5%A

&0;5>%=D5=1.!3 5C!(""!;C5C%);5@!1(B)<".)%2,5 - 1 # . ( #( 5%A

3!1!B<3< # ( C

' % !@58%""<5=!-:I75D&%9?;53%#85% !%;=5>!01%@@5@% %A I!C54H&%#;,0 # ! - ( < ' 5B

>%%);856!=@5>!%?45C".2<5D&B&I=5>!BL;,2[ " ! )) ( ! - " ( * # 5BA

!";=5<"%1?&%;5=&%;569)4, @0 $ B*DA O $\ G: $ &! 5A

51 >"%(HB> 8 #

;% @0 $B*DA

'"1#%A8%%<=5!#(B)A!#(B)2<5!M!AJ%)LB)C<,21# @0 B*DA( @O BD3A 5*A

7%.!"45>%*45C%"!58%("!85C! =5

=&0%4J5=&! C8,; P $ 5**A

<%#%D56%:""%'54 M%5D% ""%2,0 . 8# 9 1O $9 @'# A 5**A

@B!#"%&-2 2# ] . ; GK C] 0 V) 0#

D(!"85%"#5J)%!J5D%.""8,)# ! ! ( : ( .

C4 ! 8( 5D=A

>%*458%("!857%.!"458%-!=5@% %AI!C5>%'5' % !@,P -

( ( @ $BBIA . "'5%I A

;%!<5;%(;5;%&!85=%S;,; 1 8( )!! 5=DA

;%(;5D%"#658%H""=5@""Q'1!#%1;5;%&!C56%*;D5D%8,4 )*# - ! ? . + , 5BA

8%-!=56!("%:858%("!85>%*45C"%))!;58B#4,5 @P A. # 8( 5 D

E'D$4;,SG @0 $B*DA ) U # "5%BA

6%#:J= 5@%??%?< 54"1%1!B; 5 ' # # .

>%#2>'C2> 2 K_ # @0 OAaQ " !

E06252[,) # " , # ' ) 5=DA

52 <9#!<5I&2$53%B2C5!(&B ;,0 . [

! $ 5= A

>!B)%=;5#"J%"";I,S0# - . @ $BIDA @O ($B3A@P ; AU ) % 5%3A

I%9%@5;%))<5@D<5C%1(">65C%%C5C%85< 856%1.BC5>!%<, G M( ( #" 1 =Wc # DW

# ! E . 5= A

I%9%@5< 85@D<56%!"S>5@I;5@8456%1.BC5IBD5>!%<,2M(

# DWc1 =W

. ( 5 *IA

>%'X=I$ ) ( :- (( 1 $ d # ! G D 8 $I$0 G ("80 G)e '(# $\: # ## $4 ! @0 A) "I$C ?? 2

7!Z8 0 '( ) ( ;

' % !@5J%%%<5=!"%D5=%"%<5>%*45@% %AI!C5<!%85;%*D5 ;B %&9K5>%',R # ) X4 $IB @'# $ A ' $8( 53

' % !@5>%*45%',0 ? # . 5IDA

>%*45' % !@5@% %AI!C5 ("=5% !%;=58%("!857%.!"45>B% !85 D%BLB"58%-!= %" , @81 $81 A . # - . 5 B%A

<("!B<5=:1!#!BE56!")!.!B"!BY56%.%#!.!B"!4 ## ##

D! $D5D%#!!58%""<5% !%;=5@% %AI!C5' % !@,5 ! ( # G 5*

8%H""=58%""<5>%*45@% %AI!C5>B%";5C%B"!;5%IC5%1!<5 D% %D5% !%;= %" ,0 #(

5=DA

%"#58&D5;B""%J58&;5D(!"8, # ( - 5*3A

53 ! "# $% &

54 '( ) * +& , - +& ") $% '#

! 56

!" # $%# & ' ()* !,./0 58

(

)

!#$%' II – MISE AU POINT D’UN OUTIL MOLÉCULAIRE POUR LA DÉTECTION DE DIROFILARIA SPP.

Les dirofilarioses sont des helminthoses causées par des nématodes de la famille des Onchocercidae, du genre Dirofilaria, celui-ci comprend deux espèces principales : Dirofilaria immitis et Dirofilaria repens [4]. Le cycle de transmission fait intervenir des moustiques de la famille des culicidés. Les deux espèces affectent les populations canines et félines, provoquant respectivement la dirofilariose cardiopulmonaire et sous-cutanée [3,4]. La dirofilariose cardiopulmonaire à D. immitis est une maladie à répartition mondiale, fréquente et pouvant être mortelle. Cliniquement, cette affection se caractérise par une hypertension pulmonaire compliquée d’une insuffisance cardiaque droite. Par ailleurs, des formes atypiques peuvent exister. La dirofilariose sous-cutanée s’étend à tout l’Ancien Monde : Europe, Asie et Afrique [4]. Chez le chien, l’infection par D. repens est peu pathogène et l’infestation est le plus souvent asymptomatique. Ces deux espèces de filaires ont un potentiel zoonotique, d’où l’importance de les dépister et de les traiter afin d’éviter qu’ils ne servent de réservoirs à d’éventuelles infestations humaines. Un premier travail (Article N° 2) a été réalisé dans l’objectif de développer une PCR duplex en temps réel qui détecte, simultanément, les microfilaires de ces deux espèces et permet de les différencier à partir d’un prélèvement de sang périphérique

61 chez le chien mais aussi à partir de moustiques vecteurs. Une enquête épidémiologique a été menée sur une population canine de 94 chiens et sur une population culicidienne de 797 moustiques collectés en Corse. Ainsi, l'utilisation de la rt-PCR duplex nous a permis de détecter D. immitis chez les chiens avec une prévalence de 21,3%. L’ADN de D. immitis et de D. repens a été rapporté dans les moustiques Ae. albopictus dans des proportions de 5% et 1,5%, respectivement.

Dans la deuxième partie de ce travail (Article N° 3), nous avons mené une enquête sur la dirofilariose du chien au nord de l’Algérie, région où la situation épidémiologique restait inconnue. En utilisant la PCR en temps réel et le séquençage, nous avons détecté pour la première fois, de façon formelle, D. immitis dans 1,4% (3/209) des chiens prélevés à Tizi-Ouzou et à Alger.

Tahir D, Bittar F, ARTICLE Barré-Cardi2 H, Mediannikov O, Raoult D, Davoust B and Parola P. Molecular survey of Dirofilaria immitis and D. repens by Taqman real- time PCR in dogs and mosquitoes (Diptera: Culicidae) in Corsica. Vet. Parasitol. 2017, 235:1–7.152.

Veterinary Parasitology 235 (2017) 1–7

Contents lists available at ScienceDirect

Veterinary Parasitology

journal homepage: www.elsevier.com/locate/vetpar

Research paper Molecular survey of Diroﬁlaria immitis and Diroﬁlaria repens by new real-time TaqMan® PCR assay in dogs and mosquitoes (Diptera: Culicidae) in Corsica (France)

Djamel Tahir a, Fadi Bittar a, Hélène Barré-Cardi b, Doudou Sow a, Mustapha Dahmani a, Oleg Mediannikov a, Didier Raoult a, Bernard Davoust a, Philippe Parola a,∗ a Research Unit of Emerging Infectious and Tropical Diseases (URMITE) UMR CNRS 7278 IRD 198 INSERM U1015 Aix-Marseille University, Marseille, France b OCIC, Ofﬁce de l’Environnement de la Corse, Corte, France article info a b s t r a c t

Article history: Dirofilaria immitis and D. repens are filarioid nematodes of animals and humans, transmitted by the bite of Received 15 September 2016 infected mosquitoes. Domestic and wild canids are a major natural host and reservoir for these parasites. Received in revised form 2 January 2017 In this study, we designed a duplex real-time PCR protocol targeting the mitochondrial cytochrome Accepted 6 January 2017 c oxidase subunit I (COI) gene, detecting both D. immitis and D. repens using two primer pairs and two Dirofilaria-specific hydrolysable probes. The sensitivity and specificity of the primers and probes were tested in both experimental and naturally infected samples. The detection limits of this assay were evaluated using plasmid DNA from D. immitis and D. repens. No cross-reaction was observed when testing this system against DNA from other filarial nematodes. The detection limit of the real-time PCR system was one copy per reaction mixture containing 5 ␮l of template DNA. Field application of the new duplex real-time assay was conducted in Corsica. The prevalence rate of D. immitis was 21.3% (20/94) in dogs. In a locality where most dogs with Dirofilaria spp. infection were found, D. immitis and D. repens were detected in 5% (20/389) and 1.5% (6/389) of the Aedes albopictus population, respectively. These results suggest that this sensitive assay is a powerful tool for monitoring dirofilariosis in endemic or high risk areas. © 2017 Elsevier B.V. All rights reserved.

1. Introduction Canine, feline and human Dirofilaria infections are prevalent in the Mediterranean region (Cancrini et al., 2006). They are endemic Dirofilarioses are mosquito-borne diseases caused by filarioid in the southern European countries of Italy, Greece, the south of nematodes (family Onchocercidae) of the genus Dirofilaria, which France, Spain, and Portugal (Genchi et al., 2005; Genchi et al., includes the two main species, Dirofilaria immitis and Dirofilaria 2009). However, over the last few years, these infections (espe- repens (Dantas-Torres and Otranto, 2013). These two species affect cially D. repens) appear to have spread from the Mediterranean canine and feline populations, causing cardiopulmonary and sub- area to Central Europe in countries such as Germany, Austria, the cutaneous dirofilariosis, respectively (Dantas-Torres and Otranto, Czech Republic, Slovakia, Hungary, Liechtenstein, Poland, Slovenia 2013; Genchi et al., 2005; McCall et al., 2008). In addition, D. immitis and Switzerland (Babal et al., 2008; Fuehrer et al., 2016; Otranto and D. repens are the causative agents of human dirofilariasis, which et al., 2013). In Russia, the Ukraine and southern Romania Dirofilaria can be transmitted to humans by the bite of an infected mosquito, infections appear to be endemic because several autochthonous causing pulmonary, subcutaneous and ocular dirofilariosis (Simon findings of Dirofilaria (especially D. repens) in dogs, humans and et al., 2005; Simon et al., 2009). mosquitoes have been reported (Kartashev et al., 2011; Popescu et al., 2012; Salamatin et al., 2013). D. immitis and D. repens can be transmitted by various mosquito species belonging to different genera, such as Aedes, Anopheles, Culex, Ochlerotatus, Armigeres, Coquillettidia and Mansonia (Dantas- ∗ Corresponding author at: Research Unit of Emerging Infectious and Tropical Torres and Otranto, 2013; Otranto et al., 2013; Pampiglione et al., Diseases (URMITE), Faculté de médecine, 27, Bd Jean Moulin, 13385 Marseille cedex 1995; Simon et al., 2012). However, the vector competence of sev- 05, France. eral mosquito species remains unclear as it cannot be confirmed E-mail address: [email protected] (P. Parola). http://dx.doi.org/10.1016/j.vetpar.2017.01.002 0304-4017/© 2017 Elsevier B.V. All rights reserved.

65 2 D. Tahir et al. / Veterinary Parasitology 235 (2017) 1–7 when entire specimens (including the abdomen) are used for Table 1 molecular analysis (Fuehrer et al., 2016). The Asian tiger mosquito, GenBank accession numbers used for sequence alignment of the filariae (COI) DNA sequences. Ae. albopictus, is a highly invasive mosquito species which contin- ues to spread into European areas where it had not previously been Reference Sequence GenBank Accession Numbers reported (McCall et al., 2008). Dirofilaria immitis AJ537512 The capture and identification of mosquitoes, as well as Dirofilaria repens AM749230 the search for associated pathogenic nematodes, are indispens- Dirofilaria repens AM749231 Dirofilaria repens AB973225 able steps for monitoring dirofilariosis in a region. Traditionally, Brugia pahangi AJ271611 the estimated prevalence of dirofilariosis parasite infections in Brugia malayi AJ271610 mosquito vectors was based on the dissection of individual, freshly Onchocerca volvulus AF015193 killed, female mosquitoes. This procedure is labor-intensive, time- Setaria digitata GU138699 consuming and does not resolve the difficulty of parasite species Setaria tundra KF692106 Loa loa HQ186250 identification (Licitra et al., 2010; Montarsi et al., 2015; Scoles Wuchereria bancrofti JN367461 and Kambhampati, 1995). However, in recent years, polymerase chain reaction (PCR)-based techniques have been developed as a tool for detecting DNA from filarioid parasites in biological and 2.2. Real-time PCR specificity and sensitivity testing environmental samples (Albonico et al., 2014; Latrofa et al., 2012; Licitra et al., 2010). These methods have performed well in terms To assess the specificity of the oligonucleotide hybridization of sensitivity and specificity towards different filarioid species. For based on the fluorescent probes developed in this study, DNA example, when DNA extracted from blood microfilariae was used, extracted from D. immitis, D. repens (adult worms and microfilar- the real-time PCR was able to detect 3.2 × 10–5 microfilariae/4 ␮l iae), Brugia malayi and B. pahangi (L3) were tested using real-time for D. immitis, and 2.4 × 10–6 microfilariae/4 ␮l for D. repens PCR under the experimental conditions described below. Man- (Latrofa et al., 2012) and 4 microfilariae/ml for each single Dirofi- sonella perstans and Loa loa DNA were also used in this assessment. laria species (Albonico et al., 2014). Nonetheless, these procedures DNA extracted from non-infected laboratory-reared mosquitoes are slow and they have a tendency towards contamination because such as Aedes aegypti and Ae. albopictus and from the blood of unin- they involve an additional step such as analysis by agarose gel elec- fected dogs were used as negative controls for the real-time PCR trophoresis (Thanchomnang et al., 2010). In 2012, Latrofa et al. systems. To define the limit of detection (LOD) compared to qPCR, (2012) developed a duplex real-time PCR assay for detecting and a pUC57 plasmid containing target segments from each Dirofilaria differentiating between D. immitis and D. repens in dog blood and species, 444 base pairs long (D. immitis) and 430 pb (D. repens) ® mosquitoes using EvaGreen dye as the source of the fluorescence. (synthesized by Eurogentec, Seraing, Belgium) were used in this However, the SYBR green I dye detects all double-stranded DNA assay. Serial dilutions of these constructed plasmids were prepared, − present in the reaction mixture, including non-specific reaction equivalent to 108–10 10 copies of plasmid per reaction mixture products (Morrison et al., 1998), making it potentially less spe- (5 ␮l of template DNA plasmid). In order to assess intra-assay repro- cific. Indeed, the limited specificity increases false positive results ducibility, two replicates from each serial dilution were submitted caused by the presence of closely-related species in a test sample to the same run. ® (Scoles and Kambhampati, 1995). TaqMan hydrolysis probes are sequence-specific, dual-labelled, fluorogenic DNA probes and one 2.3. Source of samples used to evaluate specificity and sensitivity of the most commonly used chemical probes, offering an alternative approach to the problem of specificity (Mullis, 1990). D. repens adult filarioids were isolated from subcutaneous nod- We therefore aimed to develop a real-time PCR based on ules of a German Shepherd living in Pau, Pyrénées-Atlantiques ® TaqMan technology, using hydrolysis probes for detection and (France), and from a woman who was hospitalized at the Univer- differentiation of D. immitis and D. repens in mosquito vectors sity Hospital (Dermatology Department, North Hospital, Marseille, and blood samples. We applied this tool to a canine dirofilariosis France) for subcutaneous nodules on her left thigh (Benzaquen surveillance process as well as to molecular xenomonitoring in an et al., 2015). For D. immitis, the adult worms were collected from the area where both species are endemic, the French Mediterranean heart of a dog that had died from heartworm disease in Cayenne, island of Corsica. French Guiana. D. immitis, Brugia malayi and B. pahangi-infected and non- infected Ae. aegypti mosquitos were provided by the University of 2. Materials and methods Georgia College of Veterinary Medicine, Athens, (USA). In short, infected mosquitoes were fed with microfilaremic blood using ® 2.1. Real-time PCR design an artificial feeding system (Hemotek feeding system; Discovery Workshops, Lancashire, United Kingdom) (Cosgrove et al., 1994) The gene encoding the cytochrome oxidase subunit I (COI) was loaded with 5 ml of infected blood and then incubated for 15 days chosen as the gene target for the presence of highly-conserved to allow the parasites to develop. The individual mosquitoes were regions with no intra-species variability and for sufficient inter- then placed on a microscope slide, dissected and examined for species variability, allowing discrimination between Filarioidea parasites (L3). Mosquitoes were labelled as infected/uninfected species. The gene sequences were obtained from GenBank and specimens. aligned using version 6.0 of the Molecular Evolutionary Genet- D. immitis and D. repens microfilariae were obtained from ics Analysis (MEGA 6) software (Tamura et al., 2013). Reference peripheral blood samples collected from a Dirofilaria-infected sequences used for DNA alignments are shown in Table 1. Spe- canine. These blood samples (n = 9) came from dogs in France: cific primers and probes for D. immitis and D. repens were designed Pyrénées-Atlantique and Corsica. Dog blood samples were tested from the conserved sequences in the alignment. Once designed, all by direct microscopy, a rapid Immuno Migration (RIMTM) test that ® primers and probes were blasted in silico using the NCBI to deter- detects the presence of female D. immitis antigens (Witness Diro- mine their specificity. In order to distinguish between the signals filaria, Zoetis, Lyon, France) and by conventional PCR using specific obtained from the two species, two different fluorescent dyes, FAM primers for Dirofilaria spp. as described previously (Rishniw et al., and VIC, were used for labeling the probes (Table 2). 2006). PCR products obtained after DNA amplification were then

D. Tahir et al. / Veterinary Parasitology 235 (2017) 1–7 3

Table 2

Sequence of primers and probe sets designed for molecular detection of Diroﬁlaria immitis and D. repens.

′ ′

Name of primer/probe Orientation Diroﬁlaria species Sequence (5 -3 ) Amplicon size (pb)

COI-DIM-F Forward D. immitis TGCTGGTTTGCAAGGTATGC 89

COI-DIM-R Reverse D. immitis TCACCGAACCCAACGAAGAA

COI-DIM-P / D. immitis 6FAM-CGTAAAATTTTAGATTATCCTGATTGT-TAMRA

COI-DRE-F Forward D. repens TCTTTGGATAGTATAATTTTGGGTTT 231

COI-DRE-R Reverse D. repens AAATGCTGATACAACAAAGGA

COI-DRE-P / D. repens 6VIC-TTCTTTGTTGTTTTTGTTATTAGATCG-TAMRA

F: forward, R: reverse, P: probe.

puriﬁed and sequenced to identify the species level (Rishniw et al., In September 2014 and June 2015, 94 dogs over the age

2006). of 12 months, apparently healthy and housed outdoors, were

Mansonella perstans and Loa loa DNA were extracted from blood sampled from 11 localities in Corsica. In the Ventiseri-Solenzara

◦ ′ ′′ ◦ ′ ′′

samples collected from febrile patients in 2010 from rural Sene- locality (41 55 36 N, 9 24 19 E), military working dogs (n = 23)

galese villages in the Kedougou region (Bassene et al., 2015) and were taking continuous chemoprophylaxis with preventive med-

® ®

from blood samples from Gabonese children between 2011 and ication [Vectra 3D (Ceva, Libourne, France) and Milbactor

2014 (Mourembou et al., 2015), respectively. The DNA was then 12.5 mg/125 mg (Ceva, Libourne, France)]. From each animal, 4 ml

◦

− stored in sterile conditions in our laboratory at 20 C. of blood was drawn from the cephalic vein into EDTA-containing

◦

vacutainer tubes and stored at +4 C until laboratory analysis. The

dogs were sampled after obtaining verbal consent from their own-

2.4. DNA extraction ers.

Biogents Sentinel 2 (BGS2) (Biogents AG, Regensburg,

Total DNA was extracted in a ﬁnal volume of 100 ␮l from each

® Germany) traps were used to collect mosquitoes. According to

mosquito, worm or blood sample using the commercial EZ1 DNA

the manufacturer, the BG-Sentinel mosquito trap offers many

Tissue Kit (QIAGEN, Hilden, Germany) according to the manufac-

improved features concerning quality and functionality. The trap

turer’s instructions. Before extraction, samples were digested with

allows for the use of different attractants and can be used with or

◦

25 ␮l of proteinase K at +56 C for 16 h, in line with Dawkins’s

without CO2. This makes it a very versatile tool for both monitoring

recommendations regarding the isolation of nucleic acid from

and research. In our study, the traps were placed approxima-

nematodes (Dawkins and Spencer, 1989). Genomic DNA was stored

tively 1.5 m above ground. They were installed around 17h00 and

◦

−

at 20 C for further real-time PCR analysis. DNA samples extracted

were recovered the following morning around 10 h 00. The female

◦

from reared, uninfected mosquitoes (laboratory colony) and from

−

mosquitoes sampled were frozen at 20 C prior to further analy-

the blood of uninfected dogs were used as negative controls, using

sis. This sampling was performed in June 2015. In September 2015,

the same extraction protocol. DNA-free water was also included

traps were installed around 09 h 00 and then recovered two days

in each reaction to control for possible contamination during the

later, at the same time. After identiﬁcation, the mosquitoes were

preparation of the mix.

stored in silica gel.

2.7. Mosquito identiﬁcation

2.5. Real-time PCR assay

Mosquito identiﬁcation was performed using the Mosquitoes of

The real-time PCR experiment was performed in a total reaction

® Europe identiﬁcation software (Schaffner et al., 2001). Computer-

volume of 20 ␮l containing 10 ␮l master mix Takyon (Eurogen-

aided identiﬁcation incorporates morphological identiﬁcation keys

tec France, Angers, France), 3.5 ␮l distilled water, 1 ␮l (20 ␮M) of

and an ecological approach. All positive mosquitoes were also

each primer, 1 ␮l (5 ␮M) probe, and 5 ␮l DNA template. The ampli-

◦ submitted for molecular identiﬁcation using previously described

ﬁcation program included two initial holds at 50 C for 2 min and

◦ ◦ primers (Kumar et al., 2007), which ampliﬁed DNA sequences

95 C for 15 min, followed by 40 cycles consisting of 95 C for 30 s

◦ of about 600 base-pairs of the COI gene. Finally, the sequences

and 59 C for one minute. All ampliﬁcations in real-time PCR were

obtained were compared with those available in GenBank for

performed on the thermal cycler CFX96 Touch detection system

species identiﬁcation.

(Bio-Rad, Marnes-la-Coquette, France).

Once these two primer and probe systems had been individ-

2.8. DNA sequencing

ually validated, they were incorporated into a duplex real-time

PCR TaqMan assay (Applied Biosystems, Foster City, CA, USA).

Of the positive DNA samples in the real-time PCR, only some of

Each ampliﬁcation was performed using the same conditions as in

them (i.e., 18 for D. immitis and six for D. repens) were subjected to

the TaqMan uniplex reactions, using 0.5 ␮l of each primer (n = 4),

standard PCR using primers of known sequences of the cytochrome

0.5 ␮l of each probe (n = 2), and 5 ␮l DNA (obtained from a mixture ′

oxidase gene subunit (COI) speciﬁc for D. immitis: DI COI-F1 (5 -AGT

of D. immitis and D. repens DNA). The ampliﬁcation program was ′ ′

GTA GAG GGT CAG CCT GAG TTA-3 ) and DI COI-R1 (5 -ACA GGC

the same as used above. ′ ′

ACT GAC AAT ACC AAT-3 ) and D. repens DR COI-F1 (5 -AGT GTT

′ ′

GAT GGT CAA CCT GAA TTA-3 ) and DR COI-R1 (5 -GCC AAA ACA

′

2.6. Field application of the new real-time PCR assay GGA ACA GAT AAA ACT-3 ) (Rishniw et al., 2006). These primers

amplify 203 and 209 base-pair fragments of the COI gene, respec-

Corsica is a French island in the Mediterranean with a total tively. Conventional PCRs were performed using GeneAmp PCR

2 ®

surface area of 8680 km . It is located 90 km west of the Italian System 2720 thermal cyclers (Applied Biosystems , Bedford, MA,

peninsula, 170 km southeast of the French mainland, and 15 km USA). All PCR products obtained after the DNA ampliﬁcation were

north of the Italian island of Sardinia. The area is classified as a purified using the PCR filter plate Millipore NucleoFast 96 PCR kit

hot-summer Mediterranean climate. The study focused on the east following the manufacturer’s recommendations (Macherey Nagel,

coast of Corsica. Düren, Germany). The sequence reaction was carried out using

4 D. Tahir et al. / Veterinary Parasitology 235 (2017) 1–7

Table 3

Speciﬁcity of the real-time PCR assays.

Real-time PCR assays Source of DNA

Diroﬁlaria immitis Diroﬁlaria repens Brugia malayi Brugia pahangi Mansonella perstans Loa loa Negative controls

− − − − − −

COI-DIM +

− − − − − −

COI-DRE +

−

(+) ampliﬁcation, ( ) no ampliﬁcation.

Fig. 1. Standard curves generated from serial dilutions of plasmid DNA from Diroﬁlaria immitis (A) and Diroﬁlaria repens (B).

cross-reactions were observed, with either species of D. immitis and

the BigDye terminator v3.3 cycle sequencing kit DNA accord-

D. repens or with other ﬁlarioid nematodes.

ing to the manufacturer’s instructions (Applied Biosystems, Foster

No ampliﬁcation was observed from genomic DNA from neg-

City, USA). The sequence reaction program contained the follow-

◦

ative controls (uninfected mosquitoes, non-infected dog blood

ing steps: initial denaturation at 96 C for one min, followed by 25

◦ ◦

specimens) or any other parasitic nematodes tested. Our system

cycles of denaturation at 96 C for10 s, annealing at 50 C for 5 s and

◦

showed species-speciﬁc primers and probes (Table 3). When pos-

extension at 60 C for 3 min. Sequencing was performed using an

itive control DNA was used as a template, the DNA from two

ABI Prism 3130xl Genetic Analyzer capillary sequencer (Applied

Diroﬁlaria species was ampliﬁed in the real-time PCR screening

Biosystems ). Finally, all sequences generated were assembled

with the primer pair D. repens and D. immitis. Thus, the combi-

and corrected on ChromasPro 1.7 software (Technelysium Pty Ltd.,

nation of the two systems in duplex real-time PCR is suitable for

Tewantin, Australia) and then compared to sequences available in

detecting D. immitis and D. repens DNA in all tested positive sam-

GenBank using the Basic Local Alignment Search Tool (BLAST) to

ples. The standard curves generated from serial dilutions of DNA conﬁrm species identity.

plasmid showed both a high correlation coefﬁcient (R of 0.99) and

−

very efﬁcient ampliﬁcation rates with slope values of 3.21 and

−

2.9. Ethics statement 3.04 for D. immitis and D. repens respectively (Fig. 1). At the end of

35 cycles, the qPCR system was capable of detecting one copy per

Written informed consent was obtained from the patient (a reaction mixture (5 ␮l of template DNA) (Fig. 2).

woman who was hospitalized in the University Hospital) prior

to inclusion in the study. Samples from Senegal and Gabon

◦ 3.2. Field study results for Diroﬁlaria spp. in mosquitoes and

were obtained under ethics numbers N 0000-91/MSP/DS/CNERS

◦ blood specimens from Corsica

and N 00370/MSP/CABMD, respectively. Written informed consent

from the parents or legal guardians of each child was provided

A total of 797 female mosquitoes were captured, identiﬁed

before inclusion in the study. In terms of the canine samples, blood

and analyzed using duplex real-time PCR for D. immitis and D.

tests do not fall within the ﬁeld covered by the regulations on

repens. Morphological identiﬁcation showed that these mosquitoes

the protection of animals used for scientiﬁc purposes, according

belonged to four genera (Aedes, Culex, Ochlerotatus and Culiseta). Ae.

to Article R.214-88 of the French Rural Code and Maritime Fishing.

albopictus was the most commonly collected, at 70.89%, followed

Moreover, the verbal consent of the dogs’ owners was obtained

by Cx. pipiens complex, Oc. caspius, Ae. vexans and C. annulata at

before the dogs were sampled. Finally, when the mosquito traps

21.45%, 4.39%, 2.63% and 0.62%, respectively (Table 4).

were placed on private or residential areas, verbal informed consent

Positive mosquito samples for D. immitis and D. repens were

was obtained from homeowners.

observed in two areas for a single species of mosquitoes: Ae. albopic-

◦ ′ ′′ ◦ ′ ′′

tus. In Aléria (42 6 53 N, 9 30 48 E), genomic DNA from D. immitis

3. Results was detected in 18.36% (9/49) of Ae. albopictus. Both genomic DNA

of D. immitis and D. repens were detected in 5.14% (20/389) and

3.1. Real-time PCR speciﬁcity and sensitivity 1.54% (6/389) of the Ae. albopictus population, respectively, in the

◦ ′ ′′ ◦ ′ ′′

Solaro (41 54 17 N – 9 19 37 E) locality (Table 4). No mosquitoes

In silico evaluation of the speciﬁcity of primers and probes were found to be co-infected by both species.

showed that the new real-time TaqMan PCR assay performed well. Subsequent sequencing of COI gene amplicons from 16 selected

With 100% query coverage and identiﬁcation for each sequence, no positive PCR samples (six for D. repens and 10 for D. immitis) showed

D. Tahir et al. / Veterinary Parasitology 235 (2017) 1–7 5

Fig. 2. Determination of the limit of detection (copy per reaction mixture with 5 ␮l of template DNA plasmid) using serial dilutions of Diroﬁlaria immitis (A) and Diroﬁlaria repens plasmids (B).

Table 4

List of Culicidae captured in Corsica.

Species of mosquitoes (positive/total tested) Aedes albopictus Aedes vexans Culex pipiens complex Ochlerotatus caspius Culiseta annulata Total

Capture sites

Bastia 0/16 0/3 0/17 0/0 0/0 0/36

Ghisonaccia 0/111 0/2 0/123 0/4 0/0 0/240

Aléria 9/49 0/0 0/19 0/0 0/2 9/70

Solaro 26*/389 0/16 0/12 0/31 0/3 26/451

Total 565 21 171 35 5 35/797

The asterisk (*) indicates the mosquito species/capture sites when DNA of D. immitis and D. repens were simultaneously detected by real-time PCR.

Table 5

Detailed results of selected positive samples sequenced in this study.

Host Sequence products (N) Blast analyses (% of similarity) GenBank accession numbers

Aedes albopictus 6 Diroﬁlaria repens (99.63–100) AM749234, KF410864

mosquitoes 10 Diroﬁlaria immitis (99.89–100) LC107816

Dogs 8 Diroﬁlaria immitis (99.85–100) LC107816

Table 6 Table 7

Results of molecular identiﬁcation of 18 mosquitoes. Location, number and positive dogs (duplex real-time PCR) from Corsica.

Sequence Blast analyses (% GenBank accession Location Number of Duplex real-time PCR Diroﬁlaria

products (N) of similarity) numbers sampled dogs

4 Aedes albopictus (99.71–100) KR068634 Diroﬁlaria immitis Diroﬁlaria repens

2 Aedes albopictus (99.42–99.89) JX679377

Cap Corse 10 0 0

7 Aedes albopictus (99.72–100) KC690955

KC690953 Furiani 1 0 0

Biguglia 1 0 0

5 Aedes albopictus (99.85–100) JQ388786

Borgo 8 1 0

Castellare 2 0 0

Tallone 1 0 0

that the closest sequences available in GenBank were those for Aleria 10 6 0

Ghisonaccia 30 8 0

D. repens (accession No. AM749234 and KF410864) and D. immi-

Ventiseri-Solenzara 23 0 0

tis (accession No. LC107816), which showed 99.63%–100% and

Solaro 7 5 0

99.89%–100% sequence identity, respectively (Table 5). Moreover,

Lecci 1 0 0

a total of 18 positive Ae. albopictus mosquitoes were selected at Total 94 20 0

random and were sequenced to conﬁrm their species identity.

The obtained sequences conﬁrmed that the mosquitoes were Ae.

albopictus, with sequence homology ranging from 99.42% to 100%

4. Discussion

compared to those available in GenBank (Table 6).

In terms of the blood samples collected from dogs, 20 of

In this study, a duplex real-time PCR assay using TaqMan was

94 specimens (21.27%) were positive for D. immitis based on

developed for the simultaneous detection of D. immitis and D.

COI duplex real-time PCR (Table 7). Identiﬁcation of D. immitis

repens in dog blood and mosquito samples. Thanks to the use of

was conﬁrmed by sequencing randomly selected positive samples

hydrolysable probes labelled with two different ﬂuorescent dyes,

(n = 8/19) (Table 5). Obtained sequences showed nucleotide simi-

FAM and VIC, the real-time PCR we developed is able to differen-

larities of 99.85%–100% with the D. immitis sequence from Spain

tiate between D. immitis and D. repens DNA. Although the SYBR

(accession No. LC107816). Finally, no cases due to D. repens were

green I involves relatively inexpensive technology, it does remain,s

detected in the blood samples (Table 7).

however, less speciﬁc than the TaqMan chemistry probes (Mullis,

6 D. Tahir et al. / Veterinary Parasitology 235 (2017) 1–7

1990). For this reason, we chose this technology to develop a spe- of our knowledge, this is the ﬁrst report of the presence of Diro-

ciﬁc real-time PCR system. In the present study, the sensitivity and ﬁlaria spp. DNA in Ae. albopictus mosquitoes in France. Previous

speciﬁcity of primers and probes were conﬁrmed by both in sil- studies in other endemic regions (e.g., Italy, the USA and Taiwan)

ico analyses and experimental laboratory demonstration. The limit have reported that the tiger mosquito was found to be positive for D.

of detection of this assay was evaluated using plasmid DNA of D. immitis and D. repens (Cancrini et al., 2003a; Cancrini et al., 2003b;

immitis and D. repens. Finally, reproducibility was evaluated and Comiskey and Wesson, 1995; Lai et al., 2001; Licitra et al., 2010).

− −

the slope ( 3.21 for D. immitis, and 3.04 for D. repens) of stan- Accordingly, the sequencing of some positive samples con-

dard curves indicated a high PCR efficiency, while the coefficient firmed the results obtained with the real-time PCR assay, thus

of determination (R = 0.99) suggested a good correlation between conﬁrming the speciﬁcity of the system. All sequences showed

threshold cycle values and DNA concentrations. In addition, our nucleotide identitys >99.63% with those of D. immitis or D. repens

real-time detection approach was validated against ﬁeld samples available in the GenBank database.

from dogs and mosquitoes collected in an endemic region (Corsica). In conclusion, a new, speciﬁc and sensitive duplex real-time

Positive cases were identiﬁed in both types of samples, suggesting TaqMan PCR assay targeting the COI gene was developed for

that this assay is suitable for the surveillance of diroﬁlariosis. How- detecting and discriminating between D. immitis and D. repens. This

ever, it should be noted that when the mosquitoes are infected, the new molecular tool provides a powerful approach for the epidemio-

system cannot differentiate between immature and infective-stage logical surveillance of diroﬁlariosis in regions where both parasites

parasites (L3). Scoles et al. (1993) described the infectivity assay are endemic.

technique to screen mosquitoes for the presence of the L3 infective-

stage. Indeed, mosquito dissection is the only available method Conﬂict of interest

for identifying vector-stage Diroﬁlaria (Scoles and Kambhampati,

1995). Another advantage of the present molecular method is the The authors declare no conﬂict of interest.

possibility of using each system in a simplex assay. This is valid for a

laboratory experimental study, when we are interested in knowing Acknowledgements

the rate of infestation of mosquitoes after an infecting blood meal.

In Corsica, several human cases of diroﬁlariosis due to D. repens We would like to express our gratitude to M. Varloud (Ceva Santé

have been reported (Basset et al., 2003; Estran et al., 2007; Marty, Animale, France) for providing a laboratory infected mosquitoes

1997; Nozais et al., 1994; Pampiglione et al., 1999). However, no that used in this study. We thank S. Ferandi, B. Fabrizy, T. Segalen, P.

formally identiﬁed case due to D. immitis has been published until Luret-Guidini and J.L. Marié and the Service de la démoustication et

now. It is important to note that the anatomical localization and his- de la lutte antivectorielle, secteur d’Aléria (Conseil départemental

tological criteria are not sufﬁcient to distinguish between D. immitis de la Haute-Corse), for their assistance during sample collection.

and other ﬁlariae. Pulmonary or intra-abdominal localizations have This study was supported by the AMIDEX project (No. ANR-11-

often been associated with D. immitis, while subcutaneous and ocu- IDEX-0001-02), funded by the ‘Investissements d’Avenir’ French

lar localizations have been attributed to D. repens (Pampiglione Government program, managed by the French National Research

et al., 1995). This is often not the case, because histopathologic Agency (ANR) and the Fondation Méditerranée Infection (www.

diagnosis may be uncertain if worms are immature or subjected to mediterranee-infection.com). The funders had no role in study

necropsy, and D. immitis may be misidentiﬁed as D. repens nema- design, data collection and analysis, decision to publish, or prepa-

todes, or vice versa (Foissac et al., 2013). Recent molecular studies ration of the manuscript.

have reported that human subcutaneous and cutaneo-pulmonary

diroﬁlariosis were due to D. immitis and D. repens, respectively References

(Benzaquen et al., 2015; Foissac et al., 2013). This indicates that

Albonico, F., Loiacono, M., Gioia, G., Genchi, C., Genchi, M., Mortarino, M., 2014.

molecular identiﬁcation can be considered a powerful diagnostic

Rapid differentiation of Diroﬁlaria immitis and Diroﬁlaria repens in canine

method for screening for diroﬁlariosis.

peripheral blood by real-time PCR coupled to high resolution melting analysis.

In terms of dog diroﬁlariosis, despite the known endemicity of Vet. Parasitol. 200, 128–132.

Diroﬁlaria spp. in the south of France, accurate epidemiological data Babal, P., Kobzova, D., Novak, I., Dubinsky, P., Jalili, N., 2008. First case of cutaneous

human diroﬁlariosis in Slovak Republic. Bratisl. Lek. Listy 109, 486–488.

is limited and outdated. For example, in Corsica, although veteri-

Bassene, H., Sambou, M., Fenollar, F., Clarke, S., Djiba, S., ABLY, Mediannikov, O.,

narians have reported numerous cases of dog Diroﬁlaria infections

2015. High prevalence of Mansonella perstans ﬁlariasis in rural Senegal. Am. J.

(B. Davoust, personal communication), there have been no recent Trop. Med. Hyg. 93, 601–606.

Basset, D., Lachaud, L., Marmouset-Ottaviani, C., Dedet, J.P., 2003. A new case of

published data in this area. In their study, Davoust and Ducos de

diroﬁlariasis in Corsica. Presse Med. 32, 702.

Lahitte (1989) reported a high prevalence of canine diroﬁlariosis

Benzaquen, M., Brajon, D., Delord, M., Yin, N., Bittar, F., Toga, I., Berbis, P., Parola, P.,

in Ventiseri-Solenzara (Corsica) with 75% (24/32) and 40% (11/28) 2015. Cutaneous and pulmonary diroﬁlariasis due to Diroﬁlaria repens. Br. J.

Dermatol. 173, 788–791.

in 1983 and 1988, respectively. Our ﬁeld study showed the pres-

Cancrini, G., Frangipane di, R.A., Ricci, I., Tessarin, C., Gabrielli, S., Pietrobelli, M.,

ence of canine heartworm disease with a prevalence of 21.27%

2003a. Aedes albopictus is a natural vector of Diroﬁlaria immitis in Italy. Vet.

(20/94). This result is in accordance with previous reports from Parasitol. 118, 195–202.

Cancrini, G., Romi, R., Gabrielli, S., DIPM, 2003b. First ﬁnding of Diroﬁlaria repens in

other endemic European countries in the Mediterranean region, in

a natural population of Aedes albopictus. Med. Vet. Entomol. 17, 448–451.

which the prevalence ranges from 10% to 34% (Greece), 5% to 45%

Cancrini, G., Magi, M., Gabrielli, S., Arispici, M., Tolari, F., Dell’Omodarme, M., Prati,

(Italy), 8% to 36% (Spain) and 12% to 17% (Portugal) (Genchi et al., M.C., 2006. Natural vectors of diroﬁlariasis in rural and urban areas of the

Tuscan region, central Italy. J. Med. Entomol. 43, 574–579.

2005; Montoya et al., 1998; Papazahariadou et al., 1994; Rossi et al.,

Comiskey, N., Wesson, D.M., 1995. Diroﬁlaria (Filarioidea: Onchocercidae) infection

1996). According to the results obtained in the present investiga-

in Aedes albopictus (Diptera: Culicidae) collected in Louisiana. J. Med. Entomol.

tion, it would appear that dogs in Corsica are more affected by D. 32, 734–737.

immitis than by D. repens (no cases). Although it is geographically Cosgrove, J.B., Wood, R.J., Petric, D., Evans, D.T., Abbot, R.H.R., 1994. A convenient

mosquito membrane feeding system. J. Am. Mosq. Control Assoc. 10, 434–440.

close (<5 km) to a focus of heartworm disease in Solaro, no cases

Dantas-Torres, F., Otranto, D., 2013. Diroﬁlariosis in the Americas: a more virulent

of canine diroﬁlariosis have been reported in Ventiseri-Solenzara.

Diroﬁlaria immitis? Parasite Vectors 6, 288.

This could be explained by the fact that the military dogs are well Davoust, B., Ducos de Lahitte, J., 1989. Evolution of Heartworm in Military Kennels

Southeast of France., pp. 15–19.

maintained on effective chemoprophylaxis.

Dawkins, H.J., Spencer, T.L., 1989. The isolation of nucleic acid from nematodes

Unlike the blood samples from dogs, in mosquito vectors we

requires an understanding of the parasite and its cuticular structure. Parasitol.

detected both D. immitis and D. repens in Ae. albopictus. To the best Today 5, 73–776.

D. Tahir et al. / Veterinary Parasitology 235 (2017) 1–7 7

Estran, C., Marty, P., Blanc, V., Faure, O., Leccia, M.T., Pelloux, H., Diebolt, E., Pampiglione, S., Peraldi, R., Burelli, J.P., 1999. Human diroﬁlariasis in Corsica: a new

Ambrosetti, D., Cardot-Leccia, N., 2007. Human diroﬁlariasis: 3 cases in the local case. Review of reported cases. Bull. Soc. Pathol. Exot. 92, 305–308.

south of France. Presse Med. 36, 799–803. Papazahariadou, M.G., Koutinas, A.F., Rallis, T.S., Haralabidis, S.T., 1994. Prevalence

Foissac, M., Million, M., Mary, C., Dales, J.P., Souraud, J.B., Piarroux, R., Parola, P., of microﬁlaraemia in episodic weakness and clinically normal dogs belonging

2013. Subcutaneous infection with Diroﬁlaria immitis nematode in human, to hunting breeds. J. Helminthol. 68, 243–245.

France. Emerg. Infect. Dis. 19, 171–172. Popescu, I., Tudose, I., Racz, P., Muntau, B., Giurcaneanu, C., Poppert, S., 2012.

Fuehrer, H.P., Auer, H., Leschnik, M., Silbermayr, K., Duscher, G., Joachim, A., 2016. Human Diroﬁlaria repens infection in Romania: a case report. Case Rep. Infect.

Diroﬁlaria in humans, dogs, and vectors in Austria (1978–2014)-from Dis. 2012, 472976.

Imported pathogens to the endemicity of diroﬁlaria repens. PLoS Negl. Trop. Rishniw, M., Barr, S.C., Simpson, K.W., Frongillo, M.F., Franz, M., Dominguez

Dis. 10, e0004547. Alpizar, J.L., 2006. Discrimination between six species of canine microﬁlariae

Genchi, C., Rinaldi, L., Cascone, C., Mortarino, M., Cringoli, G., 2005. Is heartworm by a single polymerase chain reaction. Vet. Parasitol. 135, 303–314.

disease really spreading in Europe? Vet. Parasitol. 133, 137–148. Rossi, L., Pollono, F., Meneguz, P.G., Gribaudo, L., Balbo, T., 1996. An

Genchi, C., Rinaldi, L., Mortarino, M., Genchi, M., Cringoli, G., 2009. Climate and epidemiological study of canine ﬁlarioses in North-West Italy: what has

Diroﬁlaria infection in Europe. Vet. Parasitol. 163, 286–292. changed in 25 years? Vet. Res. Commun. 20, 308–315.

Kartashev, V., Batashova, I., Kartashov, S., Ermakov, A., Mironova, A., Kuleshova, Y., Salamatin, R.V., Pavlikovska, T.M., Sagach, O.S., Nikolayenko, S.M., Kornyushin, V.V.,

Ilyasov, B., Kolodiy, I., Klyuchnikov, A., Ryabikina, E., Babicheva, M., Levchenko, Kharchenko, V.O., Masny, A., Cielecka, D., Konieczna-Salamatin, J., Conn, D.B.,

Y., Pavlova, R., Pantchev, N., Morchon, R., Simon, F., 2011. Canine and human Golab, E., 2013. Human diroﬁlariasis due to Diroﬁlaria repens in Ukraine, an

diroﬁlariosis in the Rostov region (Southern Russia). Vet. Med. Int. 2011, emergent zoonosis: epidemiological report of 1465 cases. Acta Parasitol. 58,

685713. 592–598.

Kumar, N.P., Rajavel, A.R., Natarajan, R., Jambulingam, P., 2007. DNA barcodes can Schaffner, E., A.G.G.B.H.J.-P.R.A.B.J, 2001. The Mosquitoes of Europe: an

distinguish species of Indian mosquitoes (Diptera: Culicidae). J. Med. Entomol. Identiﬁcation and Training Programme.

44, 1–7. Scoles, G.A., Kambhampati, S., 1995. Polymerase chain reaction-based method for

Lai, C.H., Tung, K.C., Ooi, H.K., Wang, J.S., 2001. Susceptibility of mosquitoes in the detection of canine heartworm (Filarioidea: Onchocercidae) in mosquitoes

central Taiwan to natural infections of Diroﬁlaria immitis. Med. Vet. Entomol. (Diptera: Culicidae) and vertebrate hosts. J. Med. Entomol. 32, 864–869.

15, 64–67. Scoles, G.A., Dickson, S.L., Blackmore, M.S., 1993. Assessment of Aedes sierrensis as a

Latrofa, M.S., Dantas-Torres, F., Annoscia, G., Genchi, M., Traversa, D., Otranto, D., vector of canine heartworm in Utah using a new technique for determining the

2012. A duplex real-time polymerase chain reaction assay for the detection of infectivity rate. J. Am. Mosq. Control Assoc. 9, 88–90.

and differentiation between Diroﬁlaria immitis and Diroﬁlaria repens in dogs Simon, F., Lopez-Belmonte, J., Marcos-Atxutegi, C., Morchon, R., Martin-Pacho, J.R.,

and mosquitoes. Vet. Parasitol. 185, 181–185. 2005. What is happening outside North America regarding human

Licitra, B., Chambers, E.W., Kelly, R., Burkot, T.R., 2010. Detection of Diroﬁlaria diroﬁlariasis? Vet. Parasitol. 133, 181–189.

immitis (Nematoda: Filarioidea) by polymerase chain reaction in Aedes Simon, F., Morchon, R., Gonzalez-Miguel, J., Marcos-Atxutegi, C., Siles-Lucas, M.,

albopictus, Anopheles punctipennis, and Anopheles crucians (Diptera: Culicidae) 2009. What is new about animal and human diroﬁlariosis? Trends Parasitol.

from Georgia, USA. J. Med. Entomol. 47, 634–638. 25, 404–409.

Marty, P., 1997. Human diroﬁlariasis due to Diroﬁlaria repens in France: a review of Simon, F., Siles-Lucas, M., Morchon, R., Gonzalez-Miguel, J., Mellado, I., Carreton, E.,

reported cases. Parassitologia 39, 383–386. Montoya-Alonso, J.A., 2012. Human and animal diroﬁlariasis: the emergence of

McCall, J.W., Genchi, C., Kramer, L.H., Guerrero, J., Venco, L., 2008. Heartworm a zoonotic mosaic. Clin. Microbiol. Rev. 25, 507–544.

disease in animals and humans. Adv. Parasitol. 66, 193–285. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular

Montarsi, F., Ciocchetta, S., Devine, G., Ravagnan, S., Mutinelli, F., Frangipane di, evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729.

R.A., Otranto, D., Capelli, G., 2015. Development of Diroﬁlaria immitis within the Thanchomnang, T., Intapan, P.M., Lulitanond, V., Sangmaneedet, S., Chungpivat, S.,

mosquito Aedes (Finlaya) koreicus, a new invasive species for Europe. Parasite Taweethavonsawat, P., Choochote, W., Maleewong, W., 2010. Rapid detection

Vectors 8, 177. of Diroﬁlaria immitis in mosquito vectors and dogs using a real-time

Montoya, J.A., Morales, M., Ferrer, O., Molina, J.M., Corbera, J.A., 1998. The ﬂuorescence resonance energy transfer PCR and melting curve analysis. Vet.

prevalence of Diroﬁlaria immitis in Gran Canaria, Canary Islands, Spain Parasitol. 168, 255–260.

(1994–1996). Vet. Parasitol. 75, 221–226.

Morrison, T.B., Weis, J.J., Wittwer, C.T., 1998. Quantiﬁcation of low-copy transcripts

Further reading

by continuous SYBR Green I monitoring during ampliﬁcation. Biotechniques

24, 954–958, 960, 962.

Mourembou, G., Fenollar, F., Lekana-Douki, J.B., Ndjoyi, M.A., Maghendji, N.S.,

GenBank, https://www.ncbi.nlm.nih.gov/nucleotide, last

Matsiegui, P.B., Zoleko, M.R., Ehounoud, C.H., Bittar, F., Raoult, D., Mediannikov,

accessed 2 April, 2016.

O., 2015. Mansonella, including a potential new species, as common parasites

in children in Gabon. PLoS Negl. Trop. Dis. 9, e0004155. National Center for Biotechnology Information (NCBI), https://

Mullis, K.B., 1990. The unusual origin of the polymerase chain reaction. Sci. Am.

www.blast.ncbi.nlm.nih.gov/blast.cgi, last accessed 10 August,

262, 55–56. 2016.

Nozais, J.P., Bain, O., Gentilini, M., 1994. A case of subcutaneous Diroﬁlaria

(Nochtiella) repens with microﬁlaremia originating in Corsica. Bull. Soc. Pathol. Eurogentic, http://www.genscript.com/vector/SD1176-pUC57

Exot. 87, 183–185.

plasmid DNA.html, last accessed 15 June, 2016.

Otranto, D., Dantas-Torres, F., Brianti, E., Traversa, D., Petric, D., Genchi, C., Capelli,

G., 2013. Vector-borne helminths of dogs and humans in Europe. Parasit.

Vectors. 6, 16.

Pampiglione, S., Canestri, T.G., Rivasi, F., 1995. Human diroﬁlariasis due to

Diroﬁlaria (Nochtiella) repens: a review of world literature. Parassitologia 37, 149–193.

Tahir D, Damene H,ARTICLE Davoust B and Parola P. First molecular detection of Dirofilaria immitis (Spirurida: Onchocercidae) infection in dogs from Northern Algeria. Comp. Immunol. Microbiol. Infect. Dis. 2017, 51:66-68.

Comparative Immunology, Microbiology and Infectious Diseases 51 (2017) 66–68

Contents lists available at ScienceDirect Comparative Immunology, Microbiology and Infectious Diseases journal homepage: www.elsevier.com/locate/cimid

First molecular detection of Diroﬁlaria immitis (Spirurida: Onchocercidae) infection in dogs from Northern Algeria

Djamel Tahira, Hanane Dameneb, Bernard Davousta, Philippe Parolaa,⁎ a URMITE, Aix Marseille Univ, CNRS, IRD, INSERM, AP-HM, IHU-Méditerranée Infection, Marseille, France b Institute of Veterinary Sciences, University Blida 1, Blida, Algeria

ARTICLE INFO ABSTRACT

Keywords: Dirofilaria immitis and Dirofilaria repens are mosquito-borne filarioid nematodes that affect dogs and other Dirofilaria immitis domestic and wild carnivores, causing heartworm disease and subcutaneous dirofilariosis, respectively. In Dirofilaria repens Algeria, the data about the epidemiology of these infections is largely unknown. The present study was designed Algeria to establish the occurrence of D. immitis and D. repens in dogs in Algeria using molecular tools. Dog In 2014 and 2015, a total of 209 dogs over one year of age of different breed and sex, living in Northern Vector-borne disease Algeria, were examined and blood samples were collected from each dog. The presence of D. immitis and D. Real-time PCR Sequencing repens in these samples was detected by real-time PCR followed by standard PCR and sequencing. Overall, the blood of 209 dogs from two departments was collected and only 3 (1.4%) of the blood samples were found positive for D. immitis DNA. Sequencing of the corresponding amplicon displayed a 99.8% identity to D. immitis, confirming the presence of this mosquito-borne nematode in Algeria. Furthermore, all tested samples were negative for D. repens.

Dirofilarial diseases are vector-borne parasitic infections caused by methods because they are the best diagnostic methods with acceptable the nematodes Dirofilaria immitis and D. repens. Both parasites infect sensitivity and specificity for dirofilariosis diagnosis [5,6]. Therefore, mainly dogs and cats, but also other hosts such as wild carnivores and this study aims at investigating the occurrence of D. immitis and D. humans [1,2]. The adult D. immitis worm occurs in the pulmonary repens in dogs from the northern region of Algeria using molecular tools arteries and right heart chambers, causing both canine and feline such as real-time PCR, standard PCR and sequencing. cardiopulmonary dirofilariasis, whereas D. repens is found mainly in The study was conducted in two provinces of the northern region of subcutaneous tissues, causing subcutaneous dirofilariasis [1]. Algeria such as Tizi-Ouzou (36° 44′ 08″ N, 4° 26′ 27″ E) and Algiers (36° D. immitis is widely distributed throughout the world and is endemic 35′ 40″ N, 2° 59′ 54″ E). In this coastal strip, the climate is typically in temperate, tropical and subtropical regions particularly in the south Mediterranean, with mild, rainy winters and hot summers. The mean east of the United States of America, in many countries of south annual precipitation rate varies between 600 and 800 millimeters, America, in Australia, in Asia and in the south of Europe around the while the average annual temperature is around 18 °C. The climate and Mediterranean sea, whereas D. repens seems exclusive to the Old World socioeconomic life in the region is characterized by a farming activity [3–6]. In regards to the southern shore of the Mediterranean basin, little providing suitable conditions for the development of culicid mosqui- data are available on these filarial nematodes; for example in Tunisia toes, vectors of Dirofilaria spp. the seroprevalence of D. immitis infection in dogs was estimated with In April 2014 and August 2015, we collected samples from a total of ELISA to be of 4.7% [2]. In a recent study, Rjeibi et al. reported an 209 dogs among which 81 animals came from the HURBAL pound overall infection prevalence of Dirofilaria spp. of 17.5% (35/200) [3]. (Hygiène Urbaine d’Alger). For each animal, data on breed, age, gender, Among them, 29 (14.5%) and 6 (3%) were D. immitis and D. repens, health status and place of origin were recorded in a clinical file. Briefly, respectively. In Algeria, a serological study which was conducted on a 135 (64.6%) male, 74 (35.4% female) and only 11 (5.2%) are indoors dog population in the Algiers locality revealed a prevalence of 24.4% dogs. As for age, 123 (58.8%) are less than 4 years old, 69 (33%) are (45/184) [4]. However, further studies were needed to confirm the between 4 and 8 years old and 17 (8.1%) are over 8 years old. From presence of dirofilariosis infection in dogs, which are considered to be each dog, 4 ml of blood were drawn from the cephalic vein in an EDTA- the main domestic reservoir. This may be conducted through molecular containing vacutainer tubes and conserved at +4 °C until laboratory

⁎ Corresponding author at: URMITE, IHU-Méditerranée Infection, 19-21 Boulevard Jean Moulin, 13005 Marseille, France. E-mail address: [email protected] (P. Parola). http://dx.doi.org/10.1016/j.cimid.2017.04.001 Received 27 October 2016; Received in revised form 6 March 2017; Accepted 6 April 2017 0147-9571/ © 2017 Elsevier Ltd. All rights reserved.

75 D. Tahir et al. Comparative Immunology, Microbiology and Infectious Diseases 51 (2017) 66–68 analysis. D. immitis and D. repens. We consider that PCR is the most sensitive and Total DNA was extracted in a final volume of 100 μl from each blood accurate tool to detect and discriminate microfilariae from the different ® sample using the commercial kit EZ1 DNA Tissue Kit (QIAGEN, Hilden, filarial worms [5,11]. The negative results for the detection of D. repens Germany) according to the manufacturer’s instructions. All DNA may not confirm its absence but can be explained, inter alia, by the low samples were individually screened for the presence of D. immitis and prevalence for which the sample size must be sufficient. D. repens by duplex real-time PCR as previously described [7]. D. immitis Molecular tools could be proposed as a powerful approach for the and D. repens DNA obtained from peripheral blood samples collected epidemiological surveillance of dirofilariosis in endemic regions where from a Dirofilaria-infected canine were used as positive controls [7]. other filarial nematodes can coexist., In this study, we confirmed by DNA-free water was also included in each reaction to control possible means of molecular techniques the presence of D. immitis, never contamination during the preparation of the mix. formally reported in Algeria so far, and draws general attention to The positive DNA samples in real-time PCR were subjected to public health risks because human dirofilariasis is considered to be an standard PCR based on the fragment of the mitochondrial cytochrome emerging disease. Therefore, further epidemiological studies are re- c oxidase subunit 1 (cox1) gene which amplified a fragment of 650 bp quired to determine the actual prevalence, geographic distribution and [8]. All amplicons were purified using the PCR filter plate Millipore risk factors of this mosquito-borne disease. Finally, natural vectors NucleoFast 96 PCR kit in agreement with the manufacturer’s recom- should be investigated in an area where the biotope is suitable for the mendations (Macherey Nagel, Düren, Germany). The sequence reaction development of mosquitoes and the continuation of parasitic transmis- ® was carried out using the BigDye terminator v3.3 cycle sequencing kit sion. DNA according to the manufacturer’s instructions (Applied Biosystems, Foster City, USA). The program of sequence reaction contains the Competing interests following steps: initial denaturation at 96 °C for one min, followed by 25 cycles of denaturation at 96 °C for 10 s, annealing at 50 °C for 5 s and The authors declare that they have no competing interests. extension at 60 °C for 3 min. Sequencing was performed with an ABI Prism 3130xl Genetic Analyzer capillary sequencer (Applied Biosys- Authors’ contributions ® tems ). Finally, all sequences generated were assembled and corrected on ChromasPro 1.7 software (Technelysium Pty Ltd., Tewantin, Aus- DT, BD and PP designed the study. DT, HD and BD collected samples tralia) and then compared to sequences available in GenBank using the and clinical data. DT performed the experiments, carried out data Basic Local Alignment Search Tool (BLAST) to confirm species identity. analysis and interpretation and wrote the first draft of the manuscript. The study was carried out in accordance with Algerian legislation BD and PP participated in the critically revised the manuscript. All guidelines. The authorization to conduct the field study was obtained authors read and approved the final manuscript. from the Inspection Vétérinaire de Wilaya operating under the auspices of the Direction des Services Vétérinaires (DSV, Ministry of Agriculture). In Acknowledgments addition, the samples were collected after obtaining a verbal consent from dog owners. This study was supported by the AMIDEX project (No. ANR-11- Three out of the 209 tested blood samples (1.4%) were positive for IDEX-0001-02) funded by the “Investissements d’Avenir,” a French D. immitis DNA. The Dirofilaria-infected dogs (2 German shorthaired Government program managed by the French National Research pointer and 1 crossbreed sheepdog) belonged to the same locality Agency (ANR) and the Foundation Méditerranée Infection (www. (Algiers) and they are aged 4–5 and 7 years respectively. Conventional mediterranee-infection.com). The funders had no role in the study PCR assay applied showed that 2/3 of the samples produced the design, data collection and analysis, decision to publish, or preparation expected bands. It may be due to the low parasitic load (to our of the manuscript. The authors thank Dr. Abdelghani Loudahi and Dr. experience when the cycle threshold > 33) of which the RT-PCR is Kahina Razali for their help in the field study. more sensitive. The comparative analysis of obtained Algerian sequences from the cox1 gene showed 661/662 (99.84% identity) with References D. immitis identified from dog heartworm from Spain (LC107816), China (KT16014), and Australia (AJ537512), respectively. It present [1] F. Simon, M. Siles-Lucas, R. Morchon, J. Gonzalez-Miguel, I. Mellado, E. Carreton, 99.69%, identity with D. immitis detected in mosquitoes from Germany J.A. Montoya-Alonso, Human and animal dirofilariasis: the emergence of a zoonotic – fi mosaic, Clin. Microbiol. Rev. 25 (2012) 507 544. (KF692101). No speci c clinical signs except weight loss and exercise [2] A. Chabchoub, F.C. Landolsi, Serological survey and clinical study of dirofilariosis intolerance were noted in the crossbreed sheepdog. It is noteworthy with Dirofilaria immitis carried out in working dogs in Tunis region (Tunisia), Revue that all positive specimens are hunting dogs and housed outdoors. de médecine vétérinaire 154 (11) (2003). [3] M.R. Rjeibi, M. Rouatbi, M. Mabrouk, I. Tabib, M. Rekik, M. Gharbi, Molecular According to their owners, they are all born in Algeria and they have no study of Dirofilaria immitis and Dirofilaria repens in dogs from Tunisia, Transbound. history of travel, suggesting that these Dirofilaria-infected dogs are Emerg. Dis. (2016), http://dx.doi.org/10.1111/tbed.12541. autochthonous cases. Finally, no D. repens DNA was scored in the blood [4] M. Ben-Mahdi, M. Madani, Prevalence of canine Dirofilaria immitis infection in the samples. city of Algiers, Algeria, Afr. J. Agric. Res. 4 (10) (2009). [5] M.S. Latrofa, F. Dantas-Torres, G. Annoscia, M. Genchi, D. Traversa, D. Otranto, A Here we report for the first time the presence of D. immitis in Algeria duplex real-time polymerase chain reaction assay for the detection of and using molecular tools. A previous study done by Ben-Mahdi et al. in differentiation between Dirofilaria immitis and Dirofilaria repens in dogs and – 2007 reported 24.4% (45/184) and 18.4% (34/184) of positive dogs mosquitoes, Vet. Parasitol. 185 (2012) 181 185. ® [6] M. Foissac, M. Million, C. Mary, J.P. Dales, J.B. Souraud, R. Piarroux, P. Parola, using the commercial ELISA kit (PetChek , IDEXX Laboratories, USA) Subcutaneous infection with Dirofilaria immitis nematode in human France, Emerg. and modified Knott method, respectively [4]. In a previous study, it was Infect. Dis. 19 (2013) 171–172. observed that sera of dogs experimentally infected with Angiostrongylus [7] D. Tahir, F. Bittar, H. Barre-Cardi, D. Sow, M. Dahmani, O. Mediannikov, D. Raoult, B. Davoust, P. Parola, Molecular survey of Dirofilaria immitis and Dirofilaria repens vasorum may cross-react in commercially available test kits for the by new real-time TaqMan(R) PCR assay in dogs and mosquitoes (Diptera: Culicidae) detection of circulating D. immitis antigen [9]. In addition, the in Corsica (France), Vet. Parasitol. 235 (2017) 1–7. observation of microfilariae by microscopy are not reliable to differ- [8] M. Casiraghi, T.J. Anderson, C. Bandi, C. Bazzocchi, C. Genchi, A phylogenetic fi fi analysis of larial nematodes: comparison with the phylogeny of Wolbachia entiate between lariae species because of the high morphological endosymbionts, Parasitology 122 (Pt. 1) (2001) 93–103. criteria similarity between certain fileriae species, especialy when they [9] M. Schnyder, P. Deplazes, Cross-reactions of sera from dogs infected with are present in the same area [10]. A study done by Montaron (1975) Angiostrongylus vasorum in commercially available Dirofilaria immitis test kits, Parasit. Vectors 5 (2012) 258. showed a high prevalence of Dipetaloma dranculoides 22.3% (48/215) in [10] G. Gioia, L. Lecova, M. Genchi, E. Ferri, C. Genchi, M. Mortarino, Highly sensitive dogs from Algiers. So, this species can be confused by microscopy with

67 76 D. Tahir et al. Comparative Immunology, Microbiology and Infectious Diseases 51 (2017) 66–68

multiplex PCR for simultaneous detection and discrimination of Dirofilaria immitis differentiation of Dirofilaria immitis and Dirofilaria repens in canine peripheral blood and Dirofilaria repens in canine peripheral blood, Vet. Parasitol. 172 (2010) by real-time PCR coupled to high resolution melting analysis, Vet. Parasitol. 200 160–163. (2014) 128–132. [11] F. Albonico, M. Loiacono, G. Gioia, C. Genchi, M. Genchi, M. Mortarino, Rapid

68 77

III- APLICATION DU MALDI-TOF MS POUR LA DÉTECTION DES FILAIRES DANS LES MOUSTIQUES

La capture et l'identification des moustiques, ainsi que la détection des agents pathogènes associés, constituent une étape importante pour surveiller les maladies transmises par les moustiques, c’est le cas des dirofilarioses et des filarioses lymphatiques. En effet, pour estimer le taux d’infection des moustiques par une espèce de nématode donnée, la dissection des femelles fraîchement tuées et de façon individuelle, reste la technique de référence [12]. Néanmoins, cette approche exige une expertise entomologique et un temps non négligeable [13,14]. Des méthodes moléculaires, telles que la PCR et le séquençage des gènes, ont été développées, comme un outil pour détecter l'ADN des filaires dans les moustiques. Ces méthodes sont appliquées dans des régions endémiques pour contrôler les filarioses [15]. Cependant, les techniques moléculaires sont relativement coûteuses. Les pays en voie de développement n'ont pas les ressources nécessaires pour créer des laboratoires spécialisés qui peuvent utiliser la biologie moléculaire en tant qu'outil de surveillance de routine des pathogènes transmis par les moustiques. Par conséquent, une technique plus rapide et plus rentable pour l'identification simultanée de l’espèce de moustiques et la détection de leurs agents pathogènes associés pourrait améliorer la surveillance entomologique des moustiques et des agents pathogènes transmis par ces moustiques.

81 La spectrométrie de masse MALDI-TOF MS a été introduite comme méthode de routine dans les laboratoires de microbiologie pour identifier les bactéries, les archées et les champignons isolés à partir d’échantillons cliniques [16,17]. Plus récemment, cette approche protéinique a été utilisée, avec succès, dans l'identification des arthropodes tels que les moustiques, les puces et les tiques [18]. En outre, deux études préliminaires ont démontré la capacité du MALDI-TOF MS à déterminer le statut infectieux des tiques infectées et non infectées par Borrelia crocidurae ou Rickettsia spp. en utilisant les pattes d’arthropodes [6,7]. Dans ce travail (Article N° 6), l'objectif était de déterminer la capacité de la spectrométrie de masse MALDI-TOF dans la détection des changements dans les profils protéiques des moustiques Ae. aegypti infectés expérimentalement par des nématodes filaires, comparativement à ceux qui ne sont pas infectés et ce, en utilisant différents compartiments du moustiques à savoir les pattes, le thorax, la tête et le thorax-tête. Les résultats obtenus montrent qu’effectivement, le MALDI TOF MS permet de discriminer les moustiques infectés parmi les non infectés avec des proportions d’identification correcte qui diffèrent selon le compartiment testé.

Tahir D, Almeras L, VarloudARTICLE M,4 Raoult D, Davoust B and Parola P. Assessment of MALDI TOF mass spectrometry for filariae detection in Aedes aegypti mosquitoes. Accepted for publication in Plos Neglected Tropical Diseases: Vector-borne diseases, November, 2nd, 2017.

Manuscript Click here to download Manuscript PNTD-D-17-01359_clean version.docx

1 Plos Neglected Tropical Diseases: vector-borne diseases

3 Assessment of MALDI-TOF mass spectrometry for filariae detection in Aedes aegypti

4 mosquitoes

5 Djamel Tahir1, Lionel Almeras1,2, Marie Varloud3, Didier Raoult1, Bernard Davoust1 and

6 Philippe Parola1*

8 1Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), Aix-

9 Marseille Université, UM63, CNRS 7278, IRD 198 (Dakar), Inserm 1095, AP-HM Institut

10 Hospitalo-Universitaire Méditerranée Infection, 19-21 Boulevard Jean Moulin 13385

11 Marseille cedex 05.

12 2Unité de Parasitologie et Entomologie, Département des Maladies Infectieuses, Institut de

13 Recherche Biomédicale des Armées, Marseille, France.

14 3Ceva Santé Animale SA, Libourne, France.

16 *Correspondence: Philippe Parola, Institut Hospitalo-Universitaire Méditerranée Infection,

17 19-21 Boulevard Jean Moulin 13385 Marseille cedex 05. Tel: +33491385517; Fax:

18 +33491387772; E-mail:[email protected]

1 85

24 Abstract

25 Background

26 Matrix Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry (MALDI-

27 TOF MS) is an emerging tool for routine identification of bacteria, archaea and fungi. It has

28 also been recently applied as an accurate approach for arthropod identification. Preliminary

29 studies have shown that the MALDI-TOF MS was able to differentiate whether ticks and

30 mosquitoes were infected or not with some bacteria and Plasmodium parasites, respectively.

31 The aim of the present study was to test the efficiency of MALDI-TOF MS tool in

32 distinguishing protein profiles between uninfected mosquitoes from specimens infected by

33 filarioid helminths.

35 Methodology/Principal findings

36 Aedes aegypti mosquitoes were engorged on microfilaremic blood infected with Dirofilaria

37 immitis, Brugia malayi or Brugia pahangi. Fifteen days post-infective blood feeding, a total

38 of 534 mosquitoes were killed by freezing. To assess mass spectra (MS) profile changes

39 following filariae infections, one compartment (legs, thorax, head or thorax and head) per

40 mosquito was submitted for MALDI-TOF MS analysis; the remaining body parts were used

41 to establish filariae infectious status by real-time qPCR.

42 A database of reference MS, based on the mass profiles of at least two individual mosquitoes

43 per compartment, was created. Subsequently, the remaining compartment spectra (N = 350)

44 from Ae. aegypti infected or not infected by filariae were blind tested against the spectral

45 database.

2 86

46 In total, 37 discriminating peak masses ranging from 2062 to 14869 daltons were identified,

47 of which 17, 11, 12 and 7 peak masses were for legs, thorax, thorax-head and head

48 respectively. Two peak masses (4073 and 8847 Da) were specific to spectra from Ae. aegypti

49 infected with filariae, regardless of nematode species or mosquito compartment. The thorax-

50 head part provided better classification with a specificity of 94.1% and sensitivity of 86.6,

51 71.4 and 68.7% of D. immitis, B. malayi and B. pahangi respectively.

53 Conclusion/Significance

54 This study presents the potential of MALDI-TOF MS as a reliable tool for differentiating non-

55 infected and filariae-infected Ae. aegypti mosquitoes. Considering that the results might vary

56 in other mosquito species, further studies are needed to consolidate the obtained preliminary

57 results before applying this tool in entomological surveillance as a fast mass screening method

58 of filariosis vectors in endemic areas.

60 Author Summary

61 Filariosis is a disease group affecting humans and animals, caused by nematode parasites of

62 the family Onchocercidae, superfamily Filarioidea. These parasites can be transmitted,

63 essentially, by mosquitoes during blood meals of infected female specimens. Screening

64 vectors for these filariae currently relies on time- and resource-consuming methods such as

65 dissection and polymerase chain reaction-based methods. Here, we applied matrix-assisted

66 laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) to assess

67 whether this tool can detect changes in the protein profiles of Aedes aegypti infected with

68 filarioid helminths compared to those uninfected by testing different parts of mosquitoes. First

69 a reference mass spectra database from Ae. aegypti infected or not infected by filariae was

3 87

70 created using MS from 47 specimen compartments. Then we tested the remaining mass

71 spectra (350 x 4) in a blind validation test. Regardless of filariae species, the best correct

72 classification rate was obtained from the thorax-head part with a specificity of 94.1% and

73 sensitivity of 86.6, 71.4 and 68.7% for non-infected and D. immitis, B. malayi and B. pahangi

74 infected mosquitoes respectively. The results indicated that MALDI-TOF MS is potentially

75 able to screen Aedes aegypti mosquitoes as being non-infected or filariae-infected.

76 Furthermore, complementary works using other mosquito species infected with different

77 filarioids are needed to reinforce these preliminary results prior to apply this tool on field

78 samples.

80 Keywords

81 MALDI-TOF mass spectrometry, Aedes aegypti, Dirofilaria immitis, Brugia malayi, Brugia

82 pahangi, Real-time PCR, Entomological surveillance.

4 88

89 Introduction

90 Mosquitoes are blood-sucking arthropods with a global distribution. They represent a huge

91 threat to humans and animals as vectors of pathogens [1,2]. In passing from host to host, some

92 mosquito species may transmit parasitic diseases (i.e. malaria, lymphatic filariosis and

93 dirofilariosis), arboviroses (i.e. dengue, west nile, zika, eastern equine encephalitis disease

94 and others) [3,4], and possibly bacterial diseases (i.e. Rickettsia felis infection) [5].

95 Dirofilarioses due to Dirofilaria immitis and Dirofilaria repens are mosquito-borne parasitic

96 infections of dogs and other wild carnivores, which function as reservoirs. Humans and cats

97 are less suitable hosts [6,7]. D. immitis has a worldwide distribution and it is endemic in

98 tropical and temperate regions throughout the world, whereas D. repens is exclusive to the

99 Old World [8]. Lymphatic filariosis (commonly known as elephantiasis) is a neglected human

100 borne-disease caused by infection with three different filarioid worms. Most of the infections

101 worldwide are caused by Wunchereria bancrofti [9]. However, in Asia the disease can also be

102 caused by Brugia malayi and Brugia timorii [10]. Brugia pahangi, another zoonotic lymphatic

103 filarioid nematode that is naturally found in cats but also found in other types of hosts, can

104 cause clinical infection in humans, with clinical presentations that are consistent with

105 lymphatic filariosis [11]. All these filariae parasites have biphasic life cycles involving the

106 definitive mammalian host and various genera of mosquito vectors, including Aedes,

107 Anopheles, Culex, Mansonia, and Ochlerotatus [7,12].

108 The capture and identification of mosquitoes, as well as the detection of associated pathogens,

109 are important steps for monitoring mosquito-borne diseases like dirofilariosis and lymphatic

110 filariosis. Mosquito identification is performed using mainly morphological keys and/or

111 molecular methods [13]. However, screening the mosquitoes according to their filarioid

112 infection rate is based on dissecting freshly killed, individual female mosquitoes. In fact,

5 89

113 mosquito dissection is considered the gold standard for measuring infection rates and

114 densities in the vector [14]. However, this is a labor-intensive and time-consuming procedure

115 requiring entomological expertise [15,16]. Molecular methods such as PCR and gene

116 sequencing have been developed as a tool for detecting filarioid parasite DNA in mosquitoes.

117 These methods have been applied as molecular xenomonitoring of filariosis [17]. However,

118 molecular techniques are relatively expensive. But, sometimes, for economic reasons, it is not

119 possible to routinely use molecular biology as a monitoring tool for mosquito vectors.

120 Therefore, a faster and more cost-effective technique for the simultaneous identification of

121 mosquito vector species and detection of their associated pathogens could improve

122 entomological surveillance of mosquitoes and mosquito-borne diseases.

123 MALDI-TOF MS has been introduced as a routine method in diagnostic microbiology

124 laboratories for identifying bacteria, archaea and fungi isolated from different samples

125 [18,19]. More recently, this proteomic approach has been used with success in the

126 identification of arthropods such as mosquitoes, fleas and ticks [13]. In addition, two

127 preliminary studies showed the ability of MALDI-TOF MS to differentiate ticks infected or

128 not infected with Borrelia crocidurae or Rickettsia spp. using specimen legs [20,21]. Finally,

129 MALDI-TOF MS showed a good performances of specificity (100%) and sensitivity (92%)

130 when this tool was applied to screen mosquitoes infected or not infected with Plasmodium

131 berghei protozoan parasites [22]

132 The aim of this study was to determine MALDI-TOF MS’s effectiveness in detecting changes

133 in the protein profiles of Ae. aegypti mosquitoes infected with filarioid helminths compared to

134 uninfected ones.

135

136 Materials and methods

6 90

137 Ethics statement

138 Aedes aegypti (Black-eyed Liverpool strain) were artificially infected by feeding them on a

139 membrane feeder which contained blood with microfilariae, as previously described [23].

140 This experiment was conducted at TRS Labs, Inc. in Athens, Georgia (USA) under AUP 15–

141 07 (2). The protocol was approved by the laboratory's Institutional Animal Care and Use

142 Committee (IACUC) prior to the study beginning.

143

144 Experimental model

145 D. immitis, B. malayi and B. pahangi infected and non-infected Ae. aegypti were provided by

146 TRS Labs, Inc. in Athens, Georgia (USA). For each nematode species two experimental

147 groups of four- to six-day-old female mosquitoes were constructed: one infected group in

148 which mosquitoes were fed with microfilaremic blood and one control non-infected group in

149 which mosquitoes were feed with non-microfilaremic blood. All mosquitoes were starved for

150 24 hours prior to blood feeding. In brief, D. immitis microfilaremic blood were collected from

151 naturally infected dog into syringes containing 3.8% sodium citrate. Mosquitoes were fed for

152 at least 1 hour using an artificial feeding system (Hemotek® feeding system; Discovery

153 Workshops, Lancashire, United Kingdom) [24] loaded with 3 mL of infected (5,000 mf/ml) or

154 amicrofilaremic blood containing sodium citrate anticoagulant (control). While, for B. malayi

155 and B. pahangi infected or uninfected mosquitoes, female Ae. aegypti were allowed to feed

156 for 40 mins on anaesthetized, infected or uninfected (control) jirds, Meriones unguiculatus

157 with microfilaremiae of B. malayi or B. pahangi ranging from 192-1,008 mf/20 mL blood.

158 After the blood meal, all mosquitoes were fed on 10% sucrose solution and kept under

159 standard laboratory-rearing conditions for 15 days, the timeframe necessary for the mosquito

7 91

160 parasite cycle. Subsequently, mosquitoes were killed by putting them in dry ice and stored at

161 – 20°C for subsequent analysis.

162

163 Mosquito analysis

164 Mosquito screening for filarioid helminths using real-time PCR

165 Each mosquito was successively washed in 70% ethanol and sterile water for 10 mins, before

166 being dried on sterile filter paper. Molecular analysis was done to establish the infectious

167 status of mosquitoes engorged on filariae infective blood (Table 1). Mosquito body parts

168 (legs, heads, thoraces or heads and thoraces) selected for MS analysis were classified in

169 groups one to four, respectively. For each group, the remaining body parts were used to

170 determine their filariae infection status by qPCR.

171 For each mosquito, the carcass not used for MS analysis was transferred to a 1.5 mL micro-

172 centrifuge tube and crushed in 180 μL buffer G2 (Qiagen, Hilden, Germany) used for

173 molecular filariae detection. Then 20 μL of proteinase K (20 mg/mL; Qiagen, Hilden,

174 Germany) was added to the ground mosquito body and the mixture incubated overnight at 56

175 °C to ensure complete lysis of the tissue. Whole genomic DNA was extracted in 50 μL of Tris

176 EDTA (TE) buffer using the EZ1 DNA Tissue kit (Qiagen, Hilden, Germany) according to

177 the manufacturer's instructions. The DNA was stored at –20°C until the sample was used for

178 qPCR.

179 For each group, all DNA samples were individually screened for the presence of D. immitis,

180 B. malayi or B. pahangi by qPCR as previously described [25,26]. In brief, the real-time PCR

181 experiment was performed in a total reaction volume of 20 μL, containing 10 μL master mix

182 Takyon® (Eurogentec France, Angers, France), 3.5 μL distilled water, 0.5 μL (20 μM) of

183 each primer, 0.5 μL probe (5 μM), and 5 μL DNA template. All amplifications in real-time

8 92

184 PCR were performed on the thermal cycler CFX96 Touch detection system (Bio-Rad,

185 Marnes-la-Coquette, France). For each reaction, DNA-free water and DNA from uninfected

186 mosquitoes were used as negative controls. D. immitis, B. malayi and B. pahangi DNA were

187 used as positive controls.

188

189 Sample preparation for MALDI-TOF MS analysis

190 The volumes of supplying buffers for sample homogenization were adjusted according to the

191 body part used: 15 μL of 70% (v/v) formic acid (Sigma) plus 15 μL of 50% (v/v) acetonitrile

192 (Fluka, Buchs, Switzerland) for mosquito legs (Nebbak et al, 2016) and 30 μL of 70% formic

193 acid plus 30 μL of 50% acetonitrile for heads, thoraces and heads plus thoraces. A pinch of

194 glass powder (Sigma) was added to each sample and FastPrep-24 (MP Biomedicals Santa Ana,

195 California, USA) automated grinding methods were used for sample destruction. The FastPrep-

196 24 parameters were 4 cycles at 5 m/s for 40 secs for legs and 6 cycles at 5 m/s for 40 secs for

197 the three others body parts. The homogenate was then centrifuged at 6,700 x g for 30 seconds

198 and one microliter of the supernatant of each sample was spotted in quadruplicate onto the

199 polished-steel MSP 96 target plate (Bruker Daltonics®, Bremen, Germany). The spots were

200 dried at room temperature for a few minutes before being covered with 1 μL of matrix solution

201 containing saturated α-Cyano-4-hydroxy-cinnamic acid (CHCA) (Sigma), 50% acetonitrile

202 (Sigma), 10% trifluoroacetic acid (Sigma) and HPLC water. The target plate was introduced

203 into the MALDI-TOF MS instrument for analysis. To control for differences in sample loading,

204 matrix quality and MALDI-TOF apparatus performance, the matrix solution was loaded in

205 duplicate onto each MALDI-TOF plate with and without a bacterial test standard (Bruker

206 Bacterial Test Standard, ref: #8255343).

207

9 93

208 Spectra analysis and reference database creation

209 A Microflex MALDI-TOF Mass Spectrometer (Bruker Daltonics, Germany) was used to

210 generate MS ranging from 2 to 20 kDa. Spectra were acquired in positive linear mode at a

211 laser frequency of 50 Hz. The acceleration voltage was 20 kV, and the extraction delay time

212 was 200 ns. Each spectrum corresponded to ions obtained from 240 laser shots performed in

213 six regions of the same spot and automatically acquired using the AutoXecute method of the

214 flexControl v2.4 software (Bruker Daltonics). The reproducibility of MALDI-TOF MS

215 spectra from all compartments of mosquitoes infected or not infected with filariae was

216 evaluated by comparing the average spectra obtained from the four spectra of each sample

217 tested using Flex analysis and ClinProTools 2.2 software (Bruker Daltonics). The specificity

218 of MALDI-TOF MS spectra according to the filariae species with which the mosquitoes were

219 infected was also analyzed using the Flex analysis and ClinProTools 2.2 software (Bruker

220 Daltonics). To create a MS database, reference spectra (MSP, Main Spectrum Profile) were

221 created by combining the results of the spectra from at least two individual mosquitoes per

222 compartment using the automated function on the MALDI-Biotyper software v3.0. (Bruker

223 Daltonics). Thus, the MS of a total of 47 specimens was used to build the database. These

224 reference spectra were added to the homemade database containing 915 MS from eight

225 arthropod families, including MS profiles from 30 adult mosquito species [27].

226

227 Blind tests, sensitivity and specificity estimation

228 To test the performance of MALDI-TOF MS in screening mosquitoes infected or not infected

229 with microfilariae, a blind test was carried out using 1,400 MS spectra obtained from 350

230 mosquitoes infected or not infected with filariae (Fig. 1). All spectra considered poor quality

231 (i.e. low intensity), as well as spectra that were introduced in the reference database, were

10 94

232 excluded from the test. Blind tests were performed using the MALDI-Biotyper software v3.0.

233 tool (Bruker Daltonics). The level of significance was determined using the LSV, which

234 ranged from 0 to 3. The log score value given by the MALDI-Biotyper software v.3.3.

235 corresponds to a match between the query’s MS and reference spectra’s signal intensities. A

236 sample was considered correctly and significantly identified when the queried spectrum

237 obtained an LSV ≥ 1.8 [21].

238 Sensitivity (Se) and specificity (Sp) were calculated using formulae reported in the literature

239 (Altman et Bland, 1994) [28]:

240 ୘୔ ሺΨሻ ൌ ͳͲͲ ୘୔ା୊୒ 241 ୘୒ ሺΨሻ ൌ ͳͲͲ ୘୒ା୊୔ 242 TP: true positives, FN: false negatives, TN: true negatives, FP: false positives

243

244 Results

245 Infection rates using qPCR

246 Infection rates for each group of Ae. aegypti tested by qPCR were as follows: in Group 1 (legs

247 to be tested by MALDI-TOF MS), D. immitis, B. malayi and B. pahangi DNA were

248 respectively detected in 77.3% (58/75), 90% (54/60) and 83.5% (66/79) of mosquitoes (Table

249 1). Infection rates for Group 2 (Thorax to be tested by MALDI-TOF MS), the infection rates

250 were 73.9% (17/23), 95.4% (42/44) and 80% (12/15) for D. immitis, B. malayi and B.

251 pahangi, respectively. As for Group 3 (thorax-head to be tested by MALDI-TOF MS), were

252 28.6% (18/63), 62.5% (10/16) and 79.16% (19/24) for D. immitis, B. malayi and B. pahangi,

253 respectively. Lastly, the infection rates for Group 4 (head to be tested by MALDI-TOF MS),

11 95

254 were 95.6% (22/23) and 85.7% (12/14) B. malayi and B. pahangi, respectively (D. immitis

255 was not tested by qPCR for this group because of a lack of samples) (Table 1).

256

257 Spectral analysis

258 A total of 428 body parts of Ae. aegypti mosquitoes were submitted for MALDI-TOF MS

259 analysis. First, the MS spectra were assessed visually by comparing the average spectra (MSP

260 Main Spectrum Profile) obtained from the four spectra of each sample tested using the

261 flexAnalysis v3.3 and ClinProTools v2.2 software (Bruker Daltonics). Inadequate spectra (i.e.

262 MS with low quality) were excluded from the study. For example, all samples providing MS

263 of which the most intense peaks were less than 2000 a.u. or with no detected spectra were

264 systematically excluded. Based on these criteria, a total of 31 MS were excluded from the

265 study. Next, spectra with a good reproducibility of at least two specimens per compartment

266 (control uninfected and filariae infected mosquitoes) were randomly selected and loaded in

267 MALDI-Biotyper 3.0 software to create a reference database. Thus, a total of 47 mosquito

268 body parts were used to create this reference database. They are allocated as follows: 21 legs

269 (5 control, 5 infected with D. immitis, 5 infected with B. malayi and 6 infected with B.

270 pahangi), 9 thorax (2 control, 2 infected with D. immitis, 3 infected with B. malayi and 2

271 infected with B. pahangi), 10 thorax-head (3 control, 2 infected with D. immitis, 2 infected

272 with B. malayi and 3 infected with B. pahangi) and 7 head (3 control, 2 infected with B.

273 malayi and 2 infected with B. pahangi).

274 The remaining MS (350 mosquito parts) were blind tested against the database. Visual

275 inspection of spectral profiles obtained from different compartments showed consistent and

276 reproducible spectra between specimens according to the compartments, namely legs (Fig. 2),

277 thorax (Fig. 3), thorax-head (Fig. 4) and head (Fig. 5), and the infectious status. Spectra

12 96

278 alignment using Flex analysis software confirmed reproducibility but also revealed changes in

279 the MS pattern according to the infectious status, with mass peaks present or absent between

280 infected and uninfected mosquitoes.

281

282 Peak masses distinguishing non-infected and infected mosquitoes

283 In total, 37 discriminating peak masses ranging from 2062 to 14869 Da were identified (Table

284 2), of which 17, 11, 12 and 7 peak masses were for legs, thorax, thorax-head and head spectra

285 respectively. For Group 1 (legs), regardless of the filariae species with which mosquitoes

286 were infected, spectral profile analysis showed that there were at least two protein peaks

287 (3509 and 14869 Da) only present in spectra obtained from control mosquitoes compared to

288 the infected ones (Fig. 2), while three peak masses (2062 and 4073 and 8847 Da) were

289 exclusively present in infected mosquitoes (Table 2). For Group 2 (thorax), three protein

290 peaks (4073, 8847 and 1071 Da) were present in the infected mosquitoes compared to the

291 non-infected ones (Fig. 3). As for Group 3 (thorax-head), six protein peaks (4073, 5637 and

292 8847 Da) and (2759, 4179 and 6498 Da) were only found in infected and control uninfected

293 mosquitoes, respectively (Fig. 4 and Table 2). Finally, for Group 4 (head), two protein peaks

294 (4073 and 8847 Da) were found only in infected specimens compared to uninfected ones. It is

295 important to note that of the 37 peak masses, two (4073 and 8847 Da) were observed in all

296 groups of filariae infected mosquitoes (regardless of species) compared with uninfected ones

297 (Table 2).

298 Discriminating peak masses can be present in all filarioid-infected specimens but

299 overexpressed for one species more than others. For example, the 5290, 6126, 6781, 7827 Da

300 peaks are intensely expressed in mosquitoes’ legs (Group 1) infected with B. malayi and B.

301 pahangi compared to the D. immitis infected specimens (Table 2). Concerning Group 2, the

13 97

302 2329 Da peak was intensely expressed in the mosquitoes infected with B. malayi and B.

303 pahangi compared to those infected with D. immitis. As for Group 3, the 3001 Da peak was

304 more noticeable in the mosquitoes infected with D. immitis and B. pahangi compared to those

305 infected with B. malayi. Finally, for Group 4, one peak (2828 Da) was more expressed in

306 mosquitoes infected with B. malayi compared to those infected with B. pahangi.

307

308 Blind tests

309 The specificity, estimated using control uninfected mosquitoes, varied slightly depending on

310 tested compartment. It was 85.1% for leg, 76.9% for thorax, 94.1% for thorax-head and 80%

311 for head analysis. In addition, the blind test showed correct identification rates for infected

312 specimens varying according to the compartment tested. The sensitivity was 82.9% for legs,

313 60% for thorax and 86.6% for thorax-heads infected with D. immitis (Table 3). It was 61.6 %

314 for legs, 65.7 % for thorax, 71.4 % for thorax-head and 84.2% for heads infected with B.

315 malayi. It was 75.4% for legs, 70% for thorax, 68.7% for thorax-heads and 70% for heads

316 infected with B. pahangi.

317

318 Discussion

319

320 This is the first study conducted on using MALDI-TOF MS to detect filariae in mosquitoes.

321 Here, the ability of the MALDI-TOF MS to detect filariae in mosquitoes was evaluated using

322 qPCR as a “gold standard”/reference. The reliability of nucleic acid amplification techniques

323 for filariae detection in vectors has been addressed in a number of studies [25,26,29]. These

324 studies showed that these PCR assays had high sensitivity and specificity toward the detection

325 of the filariae in mosquitoes.

14 98

326 In a recent study [22] it was reported that MALDI-TOF MS can correctly screen (100% of

327 specificity and 92% and sensitivity) mosquitoes infected or not infected with Plasmodium

328 berghei parasites using head and thorax as the target part. Here, we investigated whether the

329 MALDI-TOF MS tool could detect changes in the protein profiles of non-infected and

330 filariae-infected Ae. aegypti mosquitoes, in other words generate a profile reflecting the

331 infectious status. We were also interested in assessing which mosquito compartment was

332 appropriate for determining infectious status using MALDI-TOF MS.

333 It is worth noting that after ingestion by the mosquito, Dirofilaria spp. microfilariae remain in

334 the midgut for approximately 24 h. Subsequently, they migrate into the large cells of the

335 malpighian tubules [6]. After two molts (L2, L3) the filariae perforate the distal ends of the

336 tubules and migrate via the haemocoel to the head of the mosquito on the 15th to 17th day

337 [30,31]. For Brugia spp. development in mosquito, after ingestion, the microfilariae lose their

338 sheaths and perforate the wall of the proventriculus and cardiac portion of the midgut to reach

339 the thoracic muscles [32]. At this level, the microfilariae develop into first-stage larvae (L1)

340 and subsequently into third-stage larvae (L3) within 8 to 10 days after the infecting blood

341 meal [32,33]. Subsequently, the L3 larvae migrate through the hemocoel to the mosquito's

342 prosbocis on the within 14 to 20 days. A small minority of larvae may stay in the haemocoele

343 or enter some other thoracic structure in which they stay without signs of development [33].

344 Previous studies showed that changes occur in the mosquitoes' hemolymph as a result of

345 infection by microorganisms [34,34–36] and this can provide a useful approach for examining

346 changes in hemolymph proteins after infection by parasites [36]. It is acknowledged that these

347 proteins may play important roles in the relationship between mosquitoes and the viral,

348 protozoal and nematode pathogens they transmit [36]. In their study, Paskewitz et al. (2005)

349 focused on evaluating changes in the protein profiles in the hemolymph of Anopheles

15 99

350 gambiae following bacterial (Escherichia coli) inoculation, identifying 26 hemolymph

351 proteins that belong to families linked to immunity, lipid transport, and iron regulation in

352 insects [36]. Shi et al. (2004) reported two bacterial infection-related proteins in An. gambiae

353 hemolymph using 2D SDS PAGE analysis. These two mosquito proteins are involved in

354 immunity because they appear early in the hemolymph following mosquito exposure to

355 bacterial infection, but not to other treatments that cause damage to the mosquito's body wall

356 [37]. In their study, Brenda et al. (1990) showed that there is an increase in biosynthesis of the

357 84-kDa polypeptide in the hemolymph of Ae. aegypti mosquitoes inoculated with D. immitis

358 microfilariae compared with those from saline-inoculated and uninoculated controls [38].

359 According to these authors, greater synthetization of this protein in D. immitis-inoculated

360 mosquitoes may reflect the production of melanotic material necessary for the encapsulation

361 reactions against microfilariae parasites [38]. All these changes occurring at the hemolymph

362 level represent one of the reasons why we tested different parts of mosquitoes, including legs.

363 Here, the infectious status of each mosquito was validated by means of a high sensitivity

364 molecular tool. It has been demonstrated by dissecting mosquitoes that filariae, especially L3

365 stage larvae, are found in the abdominal hemocoel 15 days after infection [39]. This validates

366 our analysis approach, in which we have tested the abdomen by qPCR in each group to detect

367 filariae DNA, especially for the group in which head and thorax were tested by MALDI-TOF

368 MS as a whole part. Nevertheless, for this group (Group 3), a low infection rate (28.5%) for

369 D. immitis was obtained, compared to Group 1 and Group 2 in which the infection rates were

370 77.3% and 73.9% respectively. This result can be explained by the low density (or absence) of

371 the filariae present in the abdomen of the mosquito after migration of the L3 larvae to the

372 head two weeks after the infecting blood meal.

16 100

373 A comparison of spectra profiles for control and infected mosquitoes using ClinProTools

374 showed a set of 37 biomarker masses that distinguish mosquitoes according to their infectious

375 status as well as the filariae species with which the mosquito was infected. Of these peak

376 masses, some are present only in infected specimens. It may be inferred that these proteins

377 correspond to filariae proteins circulation or to the immune-induced proteins of the

378 mosquitoes following infection as previously reported in mosquitoes and Drosophila fruit

379 flies challenged with bacteria [36] [40]. Furthermore, we have noted that some discriminating

380 peaks are detected in the uninfected control mosquitoes and are down-regulated or squarely

381 suppressed in the infected specimens. This agrees with published literature in which it has

382 been reported that certain genes coding for proteins involved in innate immunity are down-

383 regulated after bacterial or malaria challenges of Anopheles gambiae mosquitoes [41].The

384 performance of MALDI-TOF MS for filariae detection in different Ae. aegypti mosquitoes’

385 compartments was based on the blind test following the database’s creation. The obtained

386 results generally presented specificity and sensitivity rates ranging from 76.9 % to 94.1%, and

387 from 60% to 86.6% respectively, according to the target compartment. For legs (Group 1), the

388 specificity is 85.1% while the sensitivity is 82.9%, 61.3% and 75.4% for specimens infected

389 with D. immits, B. malayi and B. pahangi respectively. These values were closer than those

390 reported in a previous study (93.7% of specificity and 88.9% of sensitivity) in which another

391 pathogen (Borrelia crocidurae) was detected in the legs of Ornithodoros sonrai ticks using

392 MALDI-TOF MS [20]. For thorax (Group 2), the specificity is 76.9% while the sensitivity is

393 60%, 65.7% and 70% for specimens infected with D. immitis, B. malayi and B. pahangi

394 respectively. The best specificity and sensitivity results were obtained from the thorax-head

395 compartment (Group 3) with values of 94.1% and 86.6%, 71.4% and 68.7% for control

396 uninfected mosquitoes and specimens infected with D. immitis, B. malayi and B. pahangi

397 respectively. In their study, Laroche et al. (2017) had better results (100% of specificity and

17 101

398 92.8% of sensitivity) testing the thorax-head by MALDI-TOF MS to screen Anopheles

399 stephensi mosquitoes infected or not infected with Plasmodium berghei parasites [22]. Lastly,

400 the head (Group 4) generated a specificity of 80% and a sensitivity of 84.2% and 70% for

401 control uninfected mosquitoes and specimens infected with B. malayi and B. pahangi

402 respectively. All these values of specificity and sensitivity can be considered good taking into

403 account some limitations of the MALDI-TOF MS such as the relative low resolution and

404 limited sensitivity for larger masses (MS superior to 20 kDa) [13]. This limitation may make

405 this tool unable to detect all proteins that can differentiate the filariae species for which

406 mosquitoes are tested. However, another promising technique can be used in combination

407 with MALDI-TOF MS. This method, known as peptide mass fingerprinting or shotgun mass

408 mapping, involves the proteolytic hydrolysis of the sample prior to MALDI-TOF MS

409 reference database creation or interrogation [13,42]. It is based on the comparison of peptide

410 MS spectra. The advantages of shotgun mass mapping are greater resolution in the lower mass

411 range (i.e. from 500 to 4000 Da) and the ability to obtain peptide sequence information by

412 analyzing the more stringent peptides with tandem mass spectrometry [13]. It is worth noting

413 that the application of this technique in medical entomology has been successfully initiated by

414 Uhlmann et al. (2014), by determining the identity of 28 peptide peaks of Culicoides in which

415 the mass ranged from 1.1 to 3.1 kDa [42].

416 This study demonstrated the potential of MALDI-TOF MS as a promising tool for screening

417 Aedes aegypti mosquitoes as being non-infected or filariae-infected. For large scale studies,

418 this technique can be applied to screen mosquitoes (infected/not infected) and then other tools

419 can be used, such as PCR for pathogen species identification. Moreover, it is recognized that

420 the MALDI-TOF MS-based approaches provides cheaper and faster method for routine

421 microbial species identification than conventional phenotypic and 16S molecular sequencing

422 identification methods, with equal or better accuracy [18,43–45]. In a study conducted by

18 102

423 Dhiman N et al. (2011) [46] the authors reported a reagent cost of $0.50 and an average

424 hands-on-time of 5.1 min per isolate for yeast identification. In their study, Cherkaoui et al.

425 (2010) [47] reported that of a total of 720 isolates belonging to different bacterial species, the

426 average cost of conventional and MALDI-TOF MS identifications was approximately $10

427 and $0.50 per isolate respectively. In addition, the estimated timeliness of conventional and

428 MALDI-TOF MS methods was 24 h and 5 min per isolate, respectively. In a cost-benefit

429 study published in 2015, showed that out of 21,930 isolates composed of commonly isolated

430 organisms (e.g., bacteria and yeast) the total costs with traditional methods, including reagent,

431 technologist time, and maintenance agreement contracts, were determined to be $6.50 per

432 isolate reported, compared to $3.14 for with MALDI-TOF MS [44]. It is noteworthy that for

433 16S molecular sequencing, reagent costs are 5-10 times higher than of MALDI-TOF MS [44].

434 In addition, the cost of the instrument and software ($150,000) is comparable to that for

435 DNA-sequencing platforms [46]. This suggests that, once the MALDI Biotyper machine is

436 purchased, the analyzing cost per sample remains much lower by MALDI-TOF MS than by

437 molecular biology. This implies that in the coming years, MALDI-TOF MS will be a routine

438 tool in monitoring and managing human and animal vector-borne diseases (e.g. filariosis).

439 Furthermore, we recommend that other studies be conducted using other species of

440 mosquitoes challenged with different filarioid species to create a large database and

441 consolidate the results obtained in this scope of research. Additionally, the characterization of

442 the proteins (i.e. amino acid composition and sequence) from discriminating peaks will

443 precise the protein candidates involved in MS profile changes following nematode infection.

444

445 Acknowledgements

19 103

446 We would like to express our gratitude to John McCall (College of Veterinary Medicine

447 University of Georgia, USA) for providing laboratory filariae infected/uninfected Ae. aegypti

448 mosquitoes used in this study.

449

450 Figure legends

451 Fig. 1. Schematic representation of the molecular and MS analysis performed in this

452 study.

453 Fig. 2. Comparison of MALDI-TOF MS spectra from legs of Aedes aegypti infected or

454 not by filariae. Spectra of control Ae. aegypti not exposed to filariae (A, B) or infected with

455 D. immitis (C, D) or B. malayi (E, F) or B. pahangi (G, H). The filariae infectious status for

456 each specimen was controlled by qPCR. Some distinct protein masses detected with

457 ClinProTools software are represented (I, J, K, and L). a.u., arbitrary units; m/z, mass-to-

458 charge ratio.

459 Fig. 3. Comparison of MALDI-TOF MS spectra from thorax of Aedes aegypti infected or

460 not by filariae. Spectra of control uninfected Ae. aegypti (A, B); infected with D. immitis (C,

461 D) or B. malayi (E, F) or B. pahangi (G, H). Some distinct protein masses generated with

462 ClinProTools are represented (I, J, K, and L). a.u., arbitrary units; m/z, mass-to-charge ratio.

463 Fig. 4. Comparison of MALDI-TOF MS spectra from thorax-head of Aedes aegypti

464 infected or not by filariae. Spectra of control uninfected Ae. aegypti (A, B); infected with D.

465 immitis (C, D) or B. malayi (E, F) or B. pahangi (G, H). Somme distinct protein masses

466 generated with ClinProTools are represented (I, J, K, and L). a.u., arbitrary units; m/z, mass-

467 to-charge ratio.

20 104

468 Fig. 5. Comparison of MALDI-TOF MS spectra from heads of Aedes aegypti infected or

469 not by filariae. Spectra of control uninfected Ae. aegypti (A, B); infected with B. malayi (C,

470 D) or B. pahangi (E, F). Some distinct protein masses generated with ClinProTools are

471 represented (I, J and K). a.u., arbitrary units; m/z, mass-to-charge ratio.

472

473 Tables

474 Table 1. Classification of samples submitted to MALDI-TOF MS and real-time PCR results. Number of specimens qPCR+ Compartment submitted to MS (%)* legs 40 / Aedes aegypti fed on microfilaremic- thorax 15 / free blood (control group, n=98) thorax-head 22 / head 21 / legs 75 58 (77.3) Aedes aegypti fed on D. immitis thorax 23 17 (73.9) microfilaremic blood (n=161) thorax-head 63 18 (28.5) head / / legs 60 54 (90) Aedes aegypti fed on Brugia malayi thorax 44 42 (95.4) microfilaremic blood (n=143) thorax-head 16 10 (62.5) head 23 22 (95.6) legs 79 66 (83.5) Aedes aegypti fed on Brugia pahangi thorax 15 12 (80) microfilaremic blood (n=132) thorax-head 24 19 (79.1) head 14 12 (85.7) Total 534 330 475 *qPCR were done on the remaining body part from MS analysis, for each specimen to establish filariae 476 infectious status.

477

478 Table 2. Peak masses distinguishing uninfected and filariae-infected Aedes aegypti

479 mosquitoes according the compartment, based on the Genetic Algorithm model analysis of

480 ClinProTools.

21 105

Peak masses (Da) Group 1: legs Group 2: thorax Group 3: thorax-head Group 4: head

Ctrl D. I B. M B. P Ctrl D. I B. M B. P Ctrl D. I B. M B. P Ctrl D. I B. M B. P

2062 - +++ + ++

2142 ++ + + +

2329 + + +++ +++

2759 +++ - - -

2828 +++ / ++ +

3001 + + + +++ ++ ++ + ++

3028 + ++ ++ ++

3253 +++ + + +

3398 + + ++ ++

3509 +++ - - -

3514 + + + +++

3527 + + - +

3640 +++ +++ + +++

3755 ++ ++ - ++

4025 + + + ++

4073 - +++ +++ +++ - +++ +++ +++ - ++ ++ +++ - / +++ +++

4179 +++ - - -

4530 - - +++ +++

4953 + / ++ ++

5056 +++ + - -

5135 +++ + + +

5284 + ++ ++ ++ + ++ ++ ++ + / +++ +++

5290 + + +++ +++

5637 - ++ ++ ++

5639 + + ++ ++

5750 + +++ +++ +++

6126 + + +++ +++

6498 +++ - - -

6781 + + +++ +++

7826 + + +++ +++

8433 + + ++ +

8847 - ++ ++ ++ - +++ +++ +++ - +++ +++ +++ - / +++ +++

9799 ++ / - -

1071 + ++ ++ ++ - ++ ++ ++

22 106

11955 - / +++ +++

12253 + + ++ ++

14869 +++ - - -

Total discriminating 17 11 12 7 peak

481 Ctrl: Control (non-infected), D. I: Dirofilaria immitis, B. M: Brugia malayi, B. P: Brugia pahangi.

482

483 Table 3. Result of the blind tests against the MALDI-TOF MS reference database according 484 the compartment and infectious status of mosquitoes.

Number of Number of Specimens Specimens High LSVs obtained from blind Correct specimens specimens integrated in used for the test against Database classification (%) excluded the database blind test (N) from (N) Correct Incorrect (Specificity and analysis classification classification sensitivity)

Legs Control mosquitoes 40 8 5 27 23 4 (2 DI, 1 BM) 85.18 Mosquitoes infected 58 6 5 47 39 8 (3 DI, 4 BP, 1 82.97 with D. immitis Neg) 97.87*

Mosquitoes infected 54 5 5 44 27 17 (12 BP, 3 DI, 61.63 95.45* with B. malayi 2 Neg)

Mosquitoes infected 66 3 6 57 43 14 (BM) 75.43 100* with B. pahangi

Total 218 22 21 175 132 43 /

Thorax Control mosquitoes 15 0 2 13 10 3 (2 Thx-Hd DI, 76.92 1 Thx BP)

Mosquitoes infected 17 0 2 15 9 6 (3 Thx-Hd DI, 60 with D. immitis 3 Thx-BM) 100*

Mosquitoes infected 42 1 3 38 25 13 (4 Thx-Hd 65.78 97.36* with B. malayi DI, 7 Thx-Hd BM, 1 Thx DI, 1 Neg)) Mosquitoes infected 12 0 2 10 7 3 (1 Thx-Hd DI, 70 100* with B. pahangi 2 Thx-Hd BM)

Total 86 1 9 76 51 25 /

Thorax Control mosquitoes 22 2 3 17 16 1 (Thx-Hd DI) 94.11 -head Mosquitoes infected 18 1 2 15 13 2 (Thx-Hd BM) 86.66 100* with D. immitis

Mosquitoes infected 10 1 2 7 5 2 (1 Thx-Hd DI, 71.42 100* with B. malayi 1 Hd-BP)

Mosquitoes infected 19 0 3 16 11 5 (1 Thx-Cl, 2 68.75 100* with B. pahangi Thx-Hd-DI, 2 Thx-Hd-BM ) Total 69 4 10 55 45 10 /

Head Control mosquitoes 21 3 3 15 12 3 (Thx-Hd DI) 80

Mosquitoes infected 22 1 2 19 16 3 (1 Thx-Hd DI, 84.21 100* with B. malayi 2 Thx-Hd BM)

23 107

Mosquitoes infected 12 0 2 10 7 2 (Hd BM, 1 70 90* with B. pahangi Neg)

Total 55 4 7 44 35 9 /

Total 428 31 47 350 263 87 / 485 486 DI: Dirofilaria immitis, BM: Brugia malayi, BP: Brugia pahangi, Thx: thorax, Cl: control, Hd: head, Neg: 487 negative. 488 The asterisk (*) indicates the sensitivity of the MALDI-TOF MS without taking into account the filariae species 489 of which mosquitoes were infected.

490

491

24 108

492 References

493

494 1. Benelli G, Jeffries CL, Walker T (2016) Biological Control of Mosquito Vectors: Past, Present, 495 and Future. Insects 7. insects7040052 [pii];10.3390/insects7040052 [doi].

496 2. Pavela R, Benelli G (2016) Ethnobotanical knowledge on botanical repellents employed in the 497 African region against mosquito vectors - A review. Exp Parasitol 167: 103-108. 498 S0014-4894(16)30111-4 [pii];10.1016/j.exppara.2016.05.010 [doi].

499 3. Becker N (2008) Influence of climate change on mosquito development and mosquito-borne 500 diseases in Europe. Parasitol Res 103 Suppl 1: S19-S28. 10.1007/s00436-008-1210-2 501 [doi].

502 4. Benelli G, Mehlhorn H (2016) Declining malaria, rising of dengue and Zika virus: insights for 503 mosquito vector control. Parasitol Res 115: 1747-1754. 10.1007/s00436-016-4971-z 504 [doi];10.1007/s00436-016-4971-z [pii].

505 5. Dieme C, Bechah Y, Socolovschi C, Audoly G, Berenger JM, Faye O, Raoult D, Parola P (2015) 506 Transmission potential of Rickettsia felis infection by Anopheles gambiae 507 mosquitoes. Proc Natl Acad Sci U S A 112: 8088-8093. 1413835112 508 [pii];10.1073/pnas.1413835112 [doi].

509 6. McCall JW, Genchi C, Kramer LH, Guerrero J, Venco L (2008) Heartworm disease in animals 510 and humans. Adv Parasitol 66: 193-285. S0065-308X(08)00204-2 511 [pii];10.1016/S0065-308X(08)00204-2 [doi].

512 7. Dantas-Torres F, Otranto D (2013) Dirofilariosis in the Americas: a more virulent Dirofilaria 513 immitis? Parasit Vectors 6: 288. 1756-3305-6-288 [pii];10.1186/1756-3305-6-288 514 [doi].

515 8. Simon F, Siles-Lucas M, Morchon R, Gonzalez-Miguel J, Mellado I, Carreton E, Montoya- 516 Alonso JA (2012) Human and animal dirofilariasis: the emergence of a zoonotic 517 mosaic. Clin Microbiol Rev 25: 507-544. 25/3/507 [pii];10.1128/CMR.00012-12 [doi].

518 9. Simonsen PE, Mwakitalu ME (2013) Urban lymphatic filariasis. Parasitol Res 112: 35-44. 519 10.1007/s00436-012-3226-x [doi].

520 10. WHO (2016) .

521 11. Tan LH, Fong MY, Mahmud R, Muslim A, Lau YL, Kamarulzaman A (2011) Zoonotic Brugia 522 pahangi filariasis in a suburbia of Kuala Lumpur City, Malaysia. Parasitol Int 60: 111- 523 113. S1383-5769(10)00155-8 [pii];10.1016/j.parint.2010.09.010 [doi].

524 12. Bockarie MJ, Pedersen EM, White GB, Michael E (2009) Role of vector control in the global 525 program to eliminate lymphatic filariasis. Annu Rev Entomol 54: 469-487. 526 10.1146/annurev.ento.54.110807.090626 [doi].

527 13. Yssouf A, Almeras L, Raoult D, Parola P (2016) Emerging tools for identification of arthropod 528 vectors. Future Microbiol 11: 549-566. 10.2217/fmb.16.5 [doi].

25 109

529 14. Plichart C, Sechan Y, Davies N, Legrand AM (2006) PCR and dissection as tools to monitor 530 filarial infection of Aedes polynesiensis mosquitoes in French Polynesia. Filaria J 5: 2. 531 1475-2883-5-2 [pii];10.1186/1475-2883-5-2 [doi].

532 15. Licitra B, Chambers EW, Kelly R, Burkot TR (2010) Detection of Dirofilaria immitis (Nematoda: 533 Filarioidea) by polymerase chain reaction in Aedes albopictus, Anopheles 534 punctipennis, and Anopheles crucians (Diptera: Culicidae) from Georgia, USA. J Med 535 Entomol 47: 634-638.

536 16. Moustafa MA, Salamah MM, Thabet HS, Tawfik RA, Mehrez MM, Hamdy DM (2017) 537 Molecular xenomonitoring (MX) and transmission assessment survey (TAS) of 538 lymphatic filariasis elimination in two villages, Menoufyia Governorate, Egypt. Eur J 539 Clin Microbiol Infect Dis . 10.1007/s10096-017-2901-3 [doi];10.1007/s10096-017- 540 2901-3 [pii].

541 17. Lau CL, Won KY, Lammie PJ, Graves PM (2016) Lymphatic Filariasis Elimination in American 542 Samoa: Evaluation of Molecular Xenomonitoring as a Surveillance Tool in the 543 Endgame. PLoS Negl Trop Dis 10: e0005108. 10.1371/journal.pntd.0005108 544 [doi];PNTD-D-16-01230 [pii].

545 18. Seng P, Drancourt M, Gouriet F, La SB, Fournier PE, Rolain JM, Raoult D (2009) Ongoing 546 revolution in bacteriology: routine identification of bacteria by matrix-assisted laser 547 desorption ionization time-of-flight mass spectrometry. Clin Infect Dis 49: 543-551. 548 10.1086/600885 [doi].

549 19. Chalupova J, Raus M, Sedlarova M, Sebela M (2014) Identification of fungal microorganisms 550 by MALDI-TOF mass spectrometry. Biotechnol Adv 32: 230-241. S0734- 551 9750(13)00194-8 [pii];10.1016/j.biotechadv.2013.11.002 [doi].

552 20. Fotso FA, Mediannikov O, Diatta G, Almeras L, Flaudrops C, Parola P, Drancourt M (2014) 553 MALDI-TOF mass spectrometry detection of pathogens in vectors: the Borrelia 554 crocidurae/Ornithodoros sonrai paradigm. PLoS Negl Trop Dis 8: e2984. 555 10.1371/journal.pntd.0002984 [doi];PNTD-D-14-00185 [pii].

556 21. Yssouf A, Almeras L, Terras J, Socolovschi C, Raoult D, Parola P (2015) Detection of Rickettsia 557 spp in ticks by MALDI-TOF MS. PLoS Negl Trop Dis 9: e0003473. 558 10.1371/journal.pntd.0003473 [doi];PNTD-D-14-01242 [pii].

559 22. Laroche M, Almeras L, Pecchi E, Bechah Y, Raoult D, Viola A, Parola P (2017) MALDI-TOF MS 560 as an innovative tool for detection of Plasmodium parasites in Anopheles 561 mosquitoes. Malar J 16: 5. 10.1186/s12936-016-1657-z [doi];10.1186/s12936-016- 562 1657-z [pii].

563 23. Chandrashekar R, Beall MJ, Saucier J, O'Connor T, McCall JW, McCall SD (2014) Experimental 564 Dirofilaria immitis infection in dogs: effects of doxycycline and Advantage Multi(R) 565 administration on immature adult parasites. Vet Parasitol 206: 93-98. S0304- 566 4017(14)00464-6 [pii];10.1016/j.vetpar.2014.08.011 [doi].

567 24. Cosgrove JB, Wood RJ, Petric D, Evans DT, Abbott RH (1994) A convenient mosquito 568 membrane feeding system. J Am Mosq Control Assoc 10: 434-436.

569 25. Tahir D, Bittar F, Barre-Cardi H, Sow D, Dahmani M, Mediannikov O, Raoult D, Davoust B, 570 Parola P (2017) Molecular survey of Dirofilaria immitis and Dirofilaria repens by new

26 110

571 real-time TaqMan(R) PCR assay in dogs and mosquitoes (Diptera: Culicidae) in 572 Corsica (France). Vet Parasitol 235: 1-7. S0304-4017(17)30002-X 573 [pii];10.1016/j.vetpar.2017.01.002 [doi].

574 26. Rao RU, Weil GJ, Fischer K, Supali T, Fischer P (2006) Detection of Brugia parasite DNA in 575 human blood by real-time PCR. J Clin Microbiol 44: 3887-3893. JCM.00969-06 576 [pii];10.1128/JCM.00969-06 [doi].

577 27. Nebbak A, Willcox AC, Bitam I, Raoult D, Parola P, Almeras L (2016) Standardization of sample 578 homogenization for mosquito identification using an innovative proteomic tool 579 based on protein profiling. Proteomics 16: 3148-3160. 10.1002/pmic.201600287 580 [doi].

581 28. Altman DG, Bland JM (1994) Diagnostic tests. 1: Sensitivity and specificity. BMJ 308: 1552.

582 29. Albonico F, Loiacono M, Gioia G, Genchi C, Genchi M, Mortarino M (2014) Rapid 583 differentiation of Dirofilaria immitis and Dirofilaria repens in canine peripheral blood 584 by real-time PCR coupled to high resolution melting analysis. Vet Parasitol 200: 128- 585 132. S0304-4017(13)00649-3 [pii];10.1016/j.vetpar.2013.11.027 [doi].

586 30. TAYLOR AE (1960) The development of Dirofilaria immitis in the mosquito Aedes aegypti. J 587 Helminthol 34: 27-38.

588 31. Serrao ML, Labarthe N, Lourenco-de-Oliveira R (2001) Vectorial competence of Aedes aegypti 589 (Linnaeus 1762) Rio de Janeiro strain, to Dirofilaria immitis (Leidy 1856). Mem Inst 590 Oswaldo Cruz 96: 593-598. S0074-02762001000500001 [pii].

591 32. Laurence BR, Simpson MG (1971) The microfilaria of Brugia: a first stage nematode larva. J 592 Helminthol 45: 23-40.

593 33. Beckett EB, Macdonald WW (1970) The distribution of larvae of Brugia malayi and Brugia 594 pahangi in the flight muscle fibres of Aedes aegypti and Mansonia uniformis. 595 Parasitology 61: 211-218.

596 34. Mack SR, Samuels S, Vanderberg JP (1979) Hemolymph of Anopheles stephensi from 597 uninfected and Plasmodium berghei-infected mosquitoes. 2. Free amino acids. J 598 Parasitol 65: 130-136.

599 35. Mack SR, Samuels S, Vanderberg JP (1979) Hemolymph of Anopheles stephensi from 600 noninfected and Plasmodium berghei-infected mosquitoes. 3. Carbohydrates. J 601 Parasitol 65: 217-221.

602 36. Paskewitz SM, Shi L (2005) The hemolymph proteome of Anopheles gambiae. Insect Biochem 603 Mol Biol 35: 815-824. S0965-1748(05)00087-1 [pii];10.1016/j.ibmb.2005.03.002 604 [doi].

605 37. Shi L, Paskewitz SM (2004) Identification and molecular characterization of two immune- 606 responsive chitinase-like proteins from Anopheles gambiae. Insect Mol Biol 13: 387- 607 398. 10.1111/j.0962-1075.2004.00496.x [doi];IMB496 [pii].

608 38. Beerntsen BT, Christensen BM (1990) Dirofilaria immitis: effect on hemolymph polypeptide 609 synthesis in Aedes aegypti during melanotic encapsulation reactions against 610 microfilariae. Exp Parasitol 71: 406-414.

27 111

611 39. Nayar JK, Knight JW (1999) Aedes albopictus (Diptera: Culicidae): an experimental and natural 612 host of Dirofilaria immitis (Filarioidea: Onchocercidae) in Florida, U.S.A. J Med 613 Entomol 36: 441-448.

614 40. Vierstraete E, Cerstiaens A, Baggerman G, Van den Bergh G, De LA, Schoofs L (2003) 615 Proteomics in Drosophila melanogaster: first 2D database of larval hemolymph 616 proteins. Biochem Biophys Res Commun 304: 831-838. S0006291X03006831 [pii].

617 41. Dimopoulos G, Christophides GK, Meister S, Schultz J, White KP, Barillas-Mury C, Kafatos FC 618 (2002) Genome expression analysis of Anopheles gambiae: responses to injury, 619 bacterial challenge, and malaria infection. Proc Natl Acad Sci U S A 99: 8814-8819. 620 10.1073/pnas.092274999 [doi];092274999 [pii].

621 42. Uhlmann KR, Gibb S, Kalkhof S, Arroyo-Abad U, Schulz C, Hoffmann B, Stubbins F, Carpenter 622 S, Beer M, von BM, Feltens R (2014) Species determination of Culicoides biting 623 midges via peptide profiling using matrix-assisted laser desorption ionization mass 624 spectrometry. Parasit Vectors 7: 392. 1756-3305-7-392 [pii];10.1186/1756-3305-7- 625 392 [doi].

626 43. Tan KE, Ellis BC, Lee R, Stamper PD, Zhang SX, Carroll KC (2012) Prospective evaluation of a 627 matrix-assisted laser desorption ionization-time of flight mass spectrometry system 628 in a hospital clinical microbiology laboratory for identification of bacteria and yeasts: 629 a bench-by-bench study for assessing the impact on time to identification and cost- 630 effectiveness. J Clin Microbiol 50: 3301-3308. JCM.01405-12 631 [pii];10.1128/JCM.01405-12 [doi].

632 44. Tran A, Alby K, Kerr A, Jones M, Gilligan PH (2015) Cost Savings Realized by Implementation 633 of Routine Microbiological Identification by Matrix-Assisted Laser Desorption 634 Ionization-Time of Flight Mass Spectrometry. J Clin Microbiol 53: 2473-2479. 635 JCM.00833-15 [pii];10.1128/JCM.00833-15 [doi].

636 45. Lagace-Wiens PR, Adam HJ, Karlowsky JA, Nichol KA, Pang PF, Guenther J, Webb AA, Miller C, 637 Alfa MJ (2012) Identification of blood culture isolates directly from positive blood 638 cultures by use of matrix-assisted laser desorption ionization-time of flight mass 639 spectrometry and a commercial extraction system: analysis of performance, cost, 640 and turnaround time. J Clin Microbiol 50: 3324-3328. JCM.01479-12 641 [pii];10.1128/JCM.01479-12 [doi].

642 46. Dhiman N, Hall L, Wohlfiel SL, Buckwalter SP, Wengenack NL (2011) Performance and cost 643 analysis of matrix-assisted laser desorption ionization-time of flight mass 644 spectrometry for routine identification of yeast. J Clin Microbiol 49: 1614-1616. 645 JCM.02381-10 [pii];10.1128/JCM.02381-10 [doi].

646 47. Cherkaoui A, Hibbs J, Emonet S, Tangomo M, Girard M, Francois P, Schrenzel J (2010) 647 Comparison of two matrix-assisted laser desorption ionization-time of flight mass 648 spectrometry methods with conventional phenotypic identification for routine 649 identification of bacteria to the species level. J Clin Microbiol 48: 1169-1175. 650 JCM.01881-09 [pii];10.1128/JCM.01881-09 [doi]. 651 652

653

28 112 Figure 1 Click here to download Figure Fig 1..pptx

Aedes aegypti mosquitoes potentialy Control uninfected mosquitoes infected with microfilariae (N = 436) (N = 98)

qPCR 113

Negative Positive MALDI-TOF MS (N = 106) (N = 330) analysis (N = 428)

Eliminated Spectra used Spectra spectra to create the used in the (N = 31) database blind test (N = 47) (N = 350)

Fig 1. Schematic representation of the molecular and MS analysis performed in this study. Figure 2 Click here to download Figure Fig 2..pptx 4000 2000 A 0 4000 2000 B 0 2000 1000 C 30000 2000 D 1000 0 3000 2000 E 1000 0 4000 Intensity [a.u.] 2000 F

114 0 2000 G 1000 0 4000 2000 H 0 2000 4000 6000 8000 10000 12000 14000 16000 18000 m/z

I JK L 3509 4073 5750 14869 Intensity [a.u.]

m/z Fig 2. Comparison of MALDI-TOF MS spectra from legs of Aedes aegypti infected or not by filariae. Spectra of control Ae. aegypti not exposed to filariae (A, B) or infected with D. immitis (C, D) or B. malayi (E, F) or B. pahangi (G, H). The filariae infectious status for each specimen was controlled by qPCR. Some distinct protein masses detected with ClinProTools software are represented (I, J, K,

115 and L). a.u., arbitrary units; m/z, mass-to-charge ratio. Figure 3 Click here to download Figure Fig 3..pptx

10000 5000 A 0 10000 5000 B 0 10000 C 5000 0 8000 6000 4000 D 2000 0 10000 E 5000 0

Intensity [a.u.] 10000 F

116 5000

10000 5000 G 0 6000 4000 2000 H 0 2000 4000 6000 8000 10000 12000 14000 16000 18000 m/z

4073 I 4530 K 1071 J 8847 L Intensity [a.u.] m/z Fig 3. Comparison of MALDI-TOF MS spectra from thorax of Aedes aegypti infected or not by filariae. Spectra of control uninfected Ae. aegypti (A, B); infected with D. immitis (C, D) or B. malayi (E, F) or B. pahangi (G, H). Some distinct protein masses generated with ClinProTools are represented (I, J, K, and L). a.u., arbitrary units; m/z, mass-to-charge ratio. 117 Figure 4 Click here to download Figure Fig 4..pptx 8000 6000 4000 A 2000 0 8000 6000 B 4000 2000 0 8000 6000 C 4000 2000 0 8000 6000 D 4000 2000 0 8000 6000 E 4000 2000

Intensity [a.u.] 0 8000 6000 4000 F

118 2000 0 4000 G 2000 0 8000 6000 4000 H 2000 0 2000 4000 6000 8000 10000 12000 14000 16000 18000 m/z 5637 I J 4179 K L 8847 4073 Intensity [a.u.] m/z Fig 4. Comparison of MALDI-TOF MS spectra from thorax-head of Aedes aegypti infected or not by filariae. Spectra of control uninfected Ae. aegypti (A, B); infected with D. immitis (C, D) or B. malayi (E, F) or B. pahangi (G, H). Somme distinct protein masses generated with ClinProTools are represented (I, J, K, and L). a.u., arbitrary units; m/z, mass-to-charge ratio. 119 Figure 5 Click here to download Figure Fig 5..pptx 2000

1000 A 0 2000 B 1000 0 6000 4000 C 2000 0 4000 Intensity [a.u.] D 2000

0 120 10000 E 5000 0 15000 10000. F 5000 0 2000 4000 6000 8000 10000 12000 14000 16000 18000 m/z I J K 4073 4953 8847 Intensity [a.u.]

m/z Fig 5. Comparison of MALDI-TOF MS spectra from heads of Aedes aegypti infected or not by filariae. Spectra of control uninfected Ae. aegypti (A, B); infected with B. malayi (C, D) or B. pahangi (E, F). Some distinct protein masses generated with ClinProTools are represented (I, J and K) . a.u., arbitrary units; m/z, mass-to-charge ratio. 121

IV- ÉVALUATION DES INSECTICIDES CONTRE LES VECTEURS

123

Le moustique tigre Ae. albopictus est considéré comme l’une des principales espèces de moustiques envahissantes qui sont incriminées dans la transmission de Dirofilaria immitis et Dirofilaria repens [19,20]. Ainsi, la protection des chiens contre les piqûres de moustiques est essentielle pour prévenir la transmission des agents pathogènes transmis par les moustiques dont les dirofilaires. Cette lutte réduit également le risque de transmission d'agents pathogènes d'importance zoonotique. Compte tenu du manque de vaccins contre de nombreuses maladies à transmission vectorielle, le meilleur moyen de réduire le risque infectieux est d'éviter le contact entre l'hôte et le vecteur. Les stratégies adoptées pour atteindre cet objectif reposent sur l'utilisation de la protection individuelle impliquant l'application régulière d'insecticides et la réduction des densités de moustiques par leur contrôle en utilisant des produits adulticides et larvicides. Chez les chiens, les produits insecticides aux propriétés répulsives offrent généralement une protection contre les moustiques, les mouches, les puces et les tiques, et leurs effets peuvent durer plus d'un mois après l'administration. La plupart des activités de contact et de répulsion sont évaluées par l'efficacité anti-gorgement. Il est également important de mesurer la survie des moustiques après l'exposition afin d'évaluer le potentiel de réduction de la propagation des parasites.

125 Récemment, une formulation combinant trois principes actifs : le dinotéfurane, la pyriproxyfène et la perméthrine (DPP) (Vectra® 3D) a été commercialisée comme ectoparasiticide pour chiens afin de traiter et prévenir les infestations par les puces et les tiques et pour repousser les mouches, les moustiques et les phlébotomes (European Medicines Agencys, 2013) [21] . La formulation produit une activité insecticide et répulsive persistante pendant un mois contre certaines espèces de moustiques (Aedes aegypti) et de phlébotomes (Phlebotomus perniciosus). Cependant, l'efficacité protectrice (effets répulsifs et insecticides) du DPP contre Ae. albopictus chez les animaux n'avait pas été testée. C’est pourquoi, l'objectif de cette partie (Article N° 5) est d'explorer les effets anti-gorgements et insecticides d'une administration topique du DPP chez les souris contre les moustiques Ae. albopictus. Le modèle murin est proposé dans cette étude car, techniquement, il est plus facile et moins coûteux que le modèle canin. Les résultats obtenus ont montré une efficacité anti-gorgement de 99,2 - 100 - 98,0 - 89,3 et 87,4% à, respectivement, 1, 7, 14, 21 et 28 jours post- traitement. L’efficacité insecticide évaluée à 24 h post- exposition est de 68,4 - 45,0 - 43,3 – 37,9 et 19,9%, à, respectivement, 1, 7, 14, 21 et 28 jours post-traitement.

126 Dans un autre travail (Article N° 6), nous avons testé cette même formulation contre un autre arthropode hématophage, Triatoma infestans, vecteur de Trypanosoma cruzi, l’agent de la maladie de Chagas, redoutable parasitose humaine. En Amérique Latine, le chien est considéré comme étant le principal réservoir domestique de T. cruzi [22]. Pour cette étude, nous avons utilisé le rat comme modèle animal. L'efficacité anti-gorgement est de 96,7 - 84,7 - 80,5 – 81,5 et 42,6%, respectivement, aux jours 1, 7, 14, 21 et 28 post-traitement. L'efficacité insecticide est de 100 - 100 - 100 - 96,0 et 49,9%, 24 h après l'exposition, respectivement, aux jours 1, 7, 14, 21 et 28 après le traitement. Cette étude démontre qu'une administration unique de DPP chez les rats a un effet puissant contre T. infestans et que cet effet dure au moins trois semaines.

127

Tahir D, Davoust ARTICLE B, Almeras L, Berenger JM, Varloud M and Parola P. Anti-feeding and insecticidal efficacy of a topical administration of dinotefuran- pyriproxyfen-permethrin spot-on (Vectra® 3D) on mice against Stegomyia albopicta (= Aedes albopictus). Med. Vet. Entomol. 2017, 31(4): 351- 357.

129

Medical and Veterinary Entomology (2017) 31, 351–357 doi: 10.1111/mve.12243

Anti-feeding and insecticidal efﬁcacy of a topical administration of dinotefuran–pyriproxyfen–permethrin spot-on (Vectra® 3D) on mice against Stegomyia albopicta (= Aedes albopictus)

D. TAHIR1, B. DAVOUST1, L. ALMERAS1,2, J. M. BERENGER1, M. VARLOUD3 andP.PAROLA1 1Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), Aix-Marseille Université, UM63, Centre National de la Recherche Scientiique (CNRS) 7278, Institut de Recherche pour le Développement (IRD) 198 (Dakar), Institut National de la Santé et de la Recherche Médicale (INSERM) 1095, Assistance-Publique Hôpitaux de Marseille (AP-HM) Institut Hospitalo-Universitaire Méditerranée Infection, Marseille, France, 2Unité de Parasitologie et Entomologie, Département des Maladies Infectieuses, Institut de Recherche Biomédicale des Armées, Marseille, France and 3Ceva Santé Animale SA, Libourne, France

Abstract. An ectoparasiticide combining three active ingredients [dinotefuran, permethrin and pyriproxyfen (DPP)] was used in mice in an experiment designed to evaluate its anti-feeding and insecticidal eficacy against Stegomyia albopicta (= Aedes albopictus) (Diptera: Culicidae) mosquitoes. Twenty-two adult mice were randomly allocated into two groups consisting of an untreated control group and a DPP-treated group. Mice were exposed individually for 1 h to a mean ± standard deviation of 27 ± 2 starved female mosquitoes on days 1, 7, 14, 21 and 28 post-treatment. At the end of the exposure (1 h), mosquitoes were assessed for immediate survival and engorgement status. Additionally, live mosquitoes in both groups were incubated separately and observed for mortality at 24 h after the end of the exposure. The anti-feeding eficacy of DPP after the 1-h exposure period was 99.2, 100, 98.0, 89.3 and 87.4% at 1, 7, 14, 21 and 28 days, respectively. Levels of insecticidal eficacy evaluated at 1 h and 24 h after exposure on days 1, 7, 14, 21 and 28 were 36.7, 28.9, 30.8, 23.1 and 11.9%, and 68.4, 45.0, 43.3, 37.9 and 19.9%, respectively. Based on the mouse model, the present study demonstrates that the DPP combination has signiicant anti-feeding and insecticidal eficacy against S. albopicta for at least 4 weeks. Key words. Stegomyia albopicta (= Aedes albopictus), ectoparasiticide, eficacy, mosquito-borne diseases, mouse model.

Introduction species in the world. Stegomyia albopicta is implicated as a competent vector of many emerging and re-emerging human The global range of the Asian tiger mosquito, Stegomyia arboviruses such as Chikungunya, Zika, dengue and yellow albopicta (= Aedes albopictus) (Skuse), has undergone a dra- fever (Gratz, 2004; Delatte et al., 2008; Lambrechts et al., 2010). matic expansion over the past 25 years into numerous countries Stegomyia albopicta is also involved in the transmission of Diro- outside Asia, particularly in the American, Paciic, European, ilaria immitis and Diroilaria repens, parasitic nematodes that Mediterranean and African regions (Gubler, 2003; Faraji et al., cause, respectively, heartworm disease and subcutaneous diro- 2014). It is now considered one of the most invasive mosquito ilariosis in dogs and cats (Cancrini et al. 2003a, 2003b; Gratz,

Correspondence: Philippe Parola, Institut Hospitalo-Universitaire Méditerranée Infection, 19–21 Boulevard Jean Moulin 13385, Marseille Cedex 05, France. Tel.: + 33 4 91 38 55 17; Fax: + 33 4 91 38 77 72; E-mail: [email protected] The copyright line for this article was changed on 19 July 2017 after original online publication. © 2017 The Authors. Medical and Veterinary Entomology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society. 351 This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

131 352 D. Tahir et al.

2004; Licitra et al., 2010). Both parasites can also be transmit- Materials and methods ted to humans through the bite of an infected mosquito and will cause pulmonary and/or subcutaneous or ocular diroilar- Mice and ethics statement iosis (Foissac et al., 2013; Benzaquen et al., 2015). The diroi- larioses represent major veterinary and public health concerns Twenty-two healthy, adult (6-week-old), female Swiss CD1 and continue to be diagnosed in several regions of the world, mice (Charles River Laboratories, Écully, France) were used which qualiies them as emerging zoonoses (Simon et al., 2012; in this investigation. The mice were housed in groups of three Dantas-Torres & Otranto, 2013). to ive individuals per cage (50 × 20 × 20 cm) at a tempera- ∘ Female S. albopicta are characterized by a wide range of host ture of 22 C under an LD 12 : 12 h cycle. They were supplied feeding preferences. They feed predominantly on mammalian with food pellets and water ad libitum. After administration hosts (83%), including humans (24%), cats (21%) and dogs of the test agent (DPP), mice were observed once per day for (14%). These mosquitoes are also opportunistic feeders and abnormal clinical signs. The experimental protocol and proce- can take a signiicant proportion of bloodmeals from avian and dures were reviewed and approved by the Ethics Committee for amphibian hosts (Richards et al., 2006; Kamgang et al., 2012). Animal Experimentation at Aix-Marseille University (approval Therefore, the feeding plasticity of S. albopicta may increase no. 2015040912442281). The mice were handled according to the risk for transmission of zoonotic pathogens from wildlife or French legislation for the protection of animals used for scien- domestic animals to humans (Gubler, 2003; Delatte et al., 2010). tiic purposes (decree no. 2013–118; 1 February 2013, Paris) Protecting dogs from mosquito bites is essential to prevent (Legifrance, 2013). mosquito-borne pathogen transmission. It also reduces the risk for transmission of pathogens of zoonotic importance. Given the lack of vaccines against numerous vector-borne diseases, Treatment the best means of reducing mosquito–pathogen transmission is Vectra® 3D contains three active ingredients, comprising to avoid host–vector contact. Strategies adopted to achieve this dinotefuran [(2-methyl-1-nitro-3-(tetrahydrofuran-3-ylmethyl) objective rely on the use of individual protection involving the guanidine)], pyriproxyfen [(4-phenoxyphenyl (RS)-2- regular application of insecticides and the reduction of mosquito (2-pyridiloxy) propyl ether)] and permethrin [(3-phenoxybenzyl densities by the control of mosquito fauna using adulticidal (1RS)-cis, trans-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopro- and larvicidal products. In dogs, insecticidal products with panecarboxylate)] at 54.00 mg, 4.84 mg and 397.00 mg per mL, repellent properties usually offer protection against mosquitoes, respectively. The formulation is an ectoparasiticide designed sandlies, leas and ticks, and their effects are expected to last for use in dogs. The minimum recommended dose used to treat over 1 month after administration. Most act by contact and dogs [i.e. 6.4 mg/kg bodyweight (bwt) of dinotefuran, 0.6 mg/kg repellency is assessed through anti-feeding eficacy. It is also bwt of pyriproxyfen and 46.6 mg/kg bwt of permethrin] served important to assess the survival of mosquitoes after exposure to determine the dose to be administered to mice weighing a in order to evaluate the potential for reducing the spread of mean ± standard deviation (SD) of 20.16 ± 0.4 g. As DPP is a parasites. topically applied non-systemic drug, it was decided that doses Recently, a formulation combining three active substances, expressed in mg/kg bwt for dogs should be converted to equiv- ® dinotefuran, pyriproxyfen and permethrin (DPP) (Vectra 3D; alent surface area doses in mice expressed as mg/m2 (Table 1), Ceva Santé Animale SA, Libourne, France), was launched as an as previously described by Freireich et al. (1966). The body ectoparasiticide for dogs to treat and prevent lea and tick infes- surface area of an adult Swiss mouse was considered equal to tations and to repel sandlies, mosquitoes and stable lies (Euro- 0.0066 m2. The dose of DPP was estimated at 0.014 mL/mouse. pean Medicines Agencys, 2013). The formulation also provides The mouse’s bristles were separated and the formulation was persistent insecticidal and repellent activity for 1 month against applied directly to the skin as a line-on treatment along the mosquitoes [Stegomyia aegypti (= Aedes aegypti)], stable lies length of the spine using a micropipette. To ensure a uniform [Stomoxys calcitrans (Diptera: Muscidae)] and bugs [Triatoma impregnation of the active ingredient across the entire body infestans (Hemiptera: Reduviidae)]. This ectoparasiticide com- of the mouse, the treatment was applied 18 h before the irst bination had already been tested on dogs against S. aegypti exposure to mosquitoes. mosquitoes and had exhibited high levels of anti-feeding and insecticidal eficacy (Franc et al., 2012). However, no data on the effectiveness of DPP against S. albopicta were available. Source of S. albopicta The current experiment evaluated both the repellent and insecticidal effects of a dinotefuran–pyriproxyfen–permethrin Stegomyia albopicta mosquitoes (Marseille strain) used in this spot-on formulation against S. albopicta mosquitoes on mice study were laboratory-reared from 2012 at the present group’s up to 4 weeks after the administration of treatment. The mouse laboratory’s insectarium (Aix-Marseille University, Marseille, model may be easier to set and is less expensive than the France). Mosquitoes were kept in a climate-controlled cham- canine model. It is noteworthy that other animal species, such ber (Sanyo incubator MIR-254-PE; Sanyo Electric Co. Ltd, as chickens, pigeons, dogs and goats, have been used as models Tokyo, Japan) at a temperature of 28 ∘C and relative humid- to evaluate the insecticidal and repellent eficacy of ipronil and ity (RH) of 70–90%. Adults were fed on a 10% sugar water imidacloprid against T. infestans (Gentile et al., 2004; Carvajal solution. For reproduction purposes, the mosquitoes were et al., 2014). fed with deibrinated human blood (according to agreement

132 Eficacy of Vectra® 3D in mice 353

Table 1. Dose estimation of Vectra® 3D administered in mice.

MRD in dog, Conversion Dose in mouse, Dose in mouse, Dose per mg/kg bwt factor mg/kg bwt km factor mg/m2 BSA mouse, mg∗ Dinotefuran 6.4 6 38.4 3 115.2 0.76 Pyriproxyfen 0.6 6 3.6 3 10.8 0.071 Permethrin 46.6 6 279.6 3 838.8 5.53

∗In Swiss mice: body weight = 0.02 kg; BSA = 0.0066 m2. Conversion factor and kilometre (km) factor are constants reported by Freireich et al. (1966). BSA, body surface area; MRD, minimal recommended dose. with the Etablissement Français du Sang) using a haemotek 60 membrane feeding system (Discovery Workshops, Accrington, U.K.). Female S. albopicta aged 3–4 days were used in the 50 present study. All mosquitoes were starved for 24 h before the experiment. 40

30 Mouse exposure to S. albopicta 20 After an acclimation period of 10 days, the mice (n = 22) were randomly allocated into two equal groups consisting of Engorged % mosquitoes, 10 an untreated control group and a DPP-treated group. The two groups were maintained in isolation, under similar conditions, 0 1 7 14 21 28 for the duration of the study. Female mosquitoes were allo- Time, days cated to 22 cages at a mean ± SD of 27 ± 2 mosquitoes per cage. Control group Treated group Mosquitoes were observed for approximately 2 h before testing to ensure that damaged specimens were not included. All Fig. 1. Engorgement rates of Stegomyia albopicta in the control group mice were exposed for 1 h to mosquito infestation on days 1, (untreated mice) and treated group (mice treated with a combination of 7, 14, 21 and 28 post-treatment. Before exposure, each mouse dinotefuran, pyriproxyfen and permethrin). [Colour igure can be viewed was anaesthetized with an intraperitoneal injection of a com- at wileyonlinelibrary.com]. bination of 90 mg/kg bwt ketamine (Imalgene® 500; Merial SA, Lyon, France) and 10 mg/kg bwt xylazine (Rompun® where MC represents the mean (GM or AM) number of 2%; Bayer Santé Animale SA, Lyon, France), and was then engorged mosquitoes in the control group, and MT represents introduced into a mosquito cage (17 × 17 × 17 cm). Mice were the mean (GM or AM) number of engorged mosquitoes in the observed regularly during and after treatment and infestation to treated group. record adverse reactions and clinical side-effects. After the 1-h Statistical analyses were performed using statistia Version exposure period, the mosquitoes were categorized and counted 6.1 (StatSoft Inc., Tulsa, OK, U.S.A.). At each time-point, differ- as engorged/non-engorged and dead/live. All live mosquitoes ences between treated and untreated mice were compared using were placed in separate incubators and fed on sugar water. Student’s t-test and the chi-squared test. P-values of ≤ 0.05 were Dead mosquitoes were counted after 24 h of observation. Mori- considered to indicate differences of statistical signiicance. bund specimens and those that had lost legs were considered as dead. Results

Statistical analysis No adverse effects of treatment were observed in any of the treated mice. Female mosquitoes landed on the mouse, pref- The geometric mean numbers of engorged mosquitoes and erentially on hairless parts such as the muzzle, ears, paws and live mosquitoes were calculated at each time-point. Levels tail. In cages containing treated mice, mosquitoes were unable to of anti-feeding and insecticidal eficacy were calculated using take bloodmeals, with the exception of a few specimens (< 1%), Abbott’s formula (Abbott, 1987) as: on days 0, 7 and 14. After day 14, blood-feeding behaviour MC − MT insecticidal eficacy (%) = 100 × increased and > 5% of mosquitoes fed on days 21 and 28. In the MC untreated control mice, mosquitoes showed conspicuous signs where MC represents the mean [geometric mean (GM) or of engorgement at 4–6 min after contact with the mouse. arithmetic mean (AM)] number of live mosquitoes in the control group, and MT represents the mean (GM or AM) number of live Anti-feeding eficacy mosquitoes in the treated group, and MC − MT Throughout the study, the rate of engorgement in female anti-feeding eficacy (%) = 100 × MC mosquitoes ranged from 42.9 to 50.4% and from 0 to 7.3% in

133 354 D. Tahir et al.

Table 2. Percentage repellency of Vectra® 3D against Stegomyia In veterinary medicine, target species such as dogs are albopicta in mice. often involved in parasiticide testing without preliminary eficacy assessments in animal models (Tiawsirisup et al., 2007; Number of fed mosquitoes, Machida et al., 2008; Bonneau et al., 2010; Franc et al., 2012; geometric mean ± SD Repellency Molina et al., 2012; Dumont et al., 2015a, 2015b; Varloud & Exposure day Untreated group Treated group eficacy, % Hodgkins, 2015). However, these models can provide preliminary and complementary information that may be useful in 1 11.81 ± 2.83 0.09 ± 0.30 99.23%∗ further testing on the targeted animal. In the present study, 7 11.09 ± 1.70 0 100%∗ the mouse model was selected to explore the repellent and 14 13.90 ± 2.60 0.27 ± 0.64 98.03%∗ 21 15.36 ± 3.50 1.63 ± 1.02 89.34%∗ insecticidal eficacy of DPP prior to demonstration in the tar- 28 14.18 ± 3.66 2.00 ± 1.00 87.35%∗ get species (dogs) because this model is fast and easy to perform. Reifenrath & Rutledge (1983) described a dose–response ∗Signiicant difference between the treated and untreated groups method for testing S. aegypti repellents on mice. In a subsequent (P < 0.0001). study conducted by Rutledge et al. (1994), the objective was SD, standard deviation. the evaluation of the repellent effectiveness of eight commercial products against S. aegypti using a laboratory mouse model the control group and treated group, respectively (Fig. 1). The and volunteers. Findings showed that the results obtained with GM number of fed mosquitoes in the untreated group ranged mice were representative of those obtained with human volun- from 11.81 to 14.18. Levels of anti-feeding eficacy of DPP were teers. Although representativeness can always be questioned, 99.2, 100, 98.0, 89.3 and 87.4% at days 1, 7, 14, 21 and 28, the information collected from the models is deinitely useful respectively (Table 2). in terms of optimizing experimental design in investigations in the target animal. Insecticidal eficacy In the current study, the feeding rate of S. albopicta on control mice ranged between 41.4 and 52.8% and was slightly higher The GM numbers of live mosquitoes in the treated and control than that reported in a previous dog study (24.4–50.6%) using groups were calculated at 1 h and 24 h post-exposure on each the same mosquito species (Fankhauser et al., 2015). The high day of the experiment (Table 3). The number of live mosquitoes feeding rate showed that the population of S. albopicta in the remained higher (P < 0.0001) in the control group than in experiment was robust (the mosquito population did not suffer the treated group throughout the study. Levels of insecticidal any abnormality as a result of taking a bloodmeal from mice), eficacy in the treated group compared with the control group which allowed the effect of the anti-feeding product to be on days 1, 7, 14, 21 and 28, respectively, were 36.7, 28.9, 30.8, validated. The host-seeking behaviour of female S. albopicta 23.1 and 11.9% at 1 h, and 68.4, 45.0, 43.3, 37.9 and 19.9% at had been evaluated previously with reference to mice in a study 24 h (Table 3). that found the host-seeking activity of 6-day-old S. albopicta mosquitoes gradually increased to a maximum of 35.7% when they were given up to 30 min of exposure once per day for 6 days Discussion post-emergence (Fukumitsu et al., 2012). In the present study, the survival rate of mosquitoes in the The present study allowed for the quantiication of blood- control group was also satisfactory, with > 99.0 and > 93.2% of feeding rates of S. albopicta on Swiss mice, as well as the mosquitoes surviving until 1 h and 24 h, respectively, after the determination of the anti-feeding and insecticidal repellency end of the exposure period. These data concord with the World effects of a topical treatment using a mouse model. As this model Health Organization recommendation that mortality in the has not been reported previously in the literature, the irst aim of control group should not exceed 20% to validate the experiment the study was to conirm that S. albopicta mosquitoes blood feed (World Health Organization, 2006). Although the treatment on mice in order to indicate the validity of this approach. was applied at the lowest recommended dose, the repellency of

Table 3. Insecticidal eficacy of Vectra® 3D against Stegomyia albopicta in mice at 1 h and 24 h post-exposure.

Number of live mosquitoes, geometric mean ± SD 1 h 24 h Insecticidal eficacy, % Exposure day Untreated group Treated group Untreated group Treated group 1 h 24 h

1 27.44 ± 0.8 17.44 ± 3.8 26.52 ± 1.1 8.37 ± 1.2 36.65%∗ 68.41%∗ 7 26.72 ± 0.4 19.01 ± 1.8 25.53 ± 2.0 14.04 ± 5.1 28.85%∗ 44.96%∗ 14 27.99 ± 0.7 19.35 ± 3.0 26.33 ± 1.3 14.92 ± 2.8 30.84%∗ 43.30%∗ 21 28.19 ± 0.4 22.30 ± 2.6 27.19 ± 0.8 16.89 ± 3.8 23.07%∗ 37.89%∗ 28 28.08 ± 0.5 24.75 ± 2.8 26.60 ± 1.2 21.31 ± 2.6 11.85%∗ 19.90%∗

∗Signiicant difference between the treated and untreated groups (P < 0.0001). SD, standard deviation.

134 Eficacy of Vectra® 3D in mice 355

DPP against S. albopicta was higher than that reported by Franc day 1 of administration that lasts for at least 3 weeks (Tahir et al. (2012) using the same formulation against S. aegypti et al., 2017). Hence, the monthly use of DPP on dogs can be in dogs. However, repellency was close to that reported for considered as a safe and effective measure against ectoparasites other commercial products containing permethrin tested against and associated vector-borne diseases. S. albopicta in dogs (Fankhauser et al., 2015). Permethrin is both an insecticide and a repellent. It acts against insects through contact (Brown & Hebert, 1997; Beugnet & Franc, 2012). The Conclusions repellency of a single-active ingredient 65% permethrin spot-on formulation against S. aegypti remained at < 89.9% during the The present study, based on the mouse model, demonstrates that irst 3 weeks following administration and then decreased to the dinotefuran–pyriproxyfen–permethrin combination has reli- 61.9% at 28 days after treatment (Meyer et al., 2003). Indeed, able repellency and insecticidal eficacy against S. albopicta. In additive effects were observed in numerous studies in which mice, this eficacy persisted for at least 1 month after treatment. permethrin was administered in combination with other insecti- As the tested dose was designed to be representative of the min- cides. In the same species of mosquito, a formulation containing imal recommended dose in dogs, these results can be extrap- 10% imidacloprid and 50% permethrin provided repellency olated to dogs. Previous studies have reported that the results that ranged from 84.9 to 94.1% until day 21 and then declined obtained in mouse models and in human volunteers were similar to 50.4% at 28 days after treatment (Tiawsirisup et al., 2007). in terms of the repellent effectiveness of eight products against In a recent combination, 6.7% ipronil and 50.4% permethrin S. aegypti. (Rutledge et al., 1994). Therefore, the present ind- continued to have high repellency against S. aegypti (96.1%) ings strongly suggest that DPP will show good eficacy against and Culex pipiens (Diptera: Culicidae) (90.4%) for 28 days S. albopicta in dogs. post-treatment. For S. albopicta, repellency in dogs ranged from 93.4 to 96.6% until day 21 and then decreased slightly to 86.9% on day 28 (Fankhauser et al., 2015). The DPP formulation tested Acknowledgements in the current study provided a good anti-feeding effect in mice, ranging from 89.3 to 100% to day 21 and remaining at 87.4% The authors thank Y. Bechah, C. Nappez and E. Lopez on day 28. (URMITE, UMR CNRS 7278, IRD 198, INSERM U1015, In this study, DPP exhibited a moderate mortality effect Aix-Marseille University) for helpful suggestions and advice against S. albopicta. At 1 h after exposure, insecticidal eficacy on experimentation protocol, and F. Chandre [IRD-MIVEGEC ranged from 23.1 to 36.7% for 21 days and declined to 11.9% (UM-CNRS 5290-IRD 224, Montpellier, France)] for his at day 28 post-treatment. Nevertheless, the GM number of live help in interpreting the results. This study was supported by mosquitoes calculated at 1 h post-exposure remained signii- the AMIDEX project (no. ANR-11-IDEX-0001-02), funded cantly higher in the control group than in the treated group by the Investissements d’Avenir programme of the French throughout the study. This conirms the insecticidal potential of Government, managed by the French National Research DPP against S. albopicta. However, it should be noted that all Agency (ANR), the Fondation Méditerranée Infection (www the mosquitoes that fed on treated mice died within hours fol- .mediterranee-infection.com), and by Ceva Santé Animale SA, lowing the experiment, proving the insecticidal effect of DPP Libourne, France. The funders had no role in study design, data by contact. Additionally, insecticidal eficacy calculated 24 h collection and analysis, decision to publish, or preparation of after exposure ranged between 68.4 and 37.9% until day 21, and the manuscript. decreased to 19.9% on day 28. These levels are lower than those reported by Fankhauser et al. (2015), who tested ipronil and permethrin against S. albopicta. Their results show eficacy above References 97.1% at 24 h post-exposure for at least 1 month after application of the product (Fankhauser et al., 2015). This difference in Abbott, W.S. (1987) A method of computing the effectiveness of an insecticidal eficacy can be explained by the length of contact insecticide. Journal of the American Mosquito Control Association, 3, 302–303. time between the mosquito and the treated animal. Both dinote- Benzaquen, M., Brajon, D., Delord, M. et al. (2015) Cutaneous and furan and ipronil act through contact on arthropods, and cause pulmonary diroilariasis due to Diroilaria repens. British Journal of hyperexcitation (rapid, brief and inconsistent movements) that Dermatology, 173, 788–791. leads to death (Corbel et al., 2004; Beugnet & Franc, 2012). Beugnet, F. & Franc, M. (2012) Insecticide and acaricide molecules In this study, repellent and insecticidal eficacy against and/or combinations to prevent pet infestation by ectoparasites. S. albopicta was demonstrated using a mouse model. In addition, Trends in Parasitology, 28, 267–279. the test agent has been proven to be effective against S. aegypti, Bonneau, S., Gupta, S. & Cadiergues, M.C. (2010) Comparative eficacy Phlebotomus perniciosus (Diptera: Psychodidae), ticks [Rhipi- of two ipronil spot-on formulations against experimental tick infesta- cephalus spp., Ixodes spp., Dermacentor spp., Amblyomma tions (Ixodes ricinus) in dogs. Parasitology Research, 107, 735–739. spp. (all: Ixodida: Ixodidae)] and leas [Ctenocephalides felis, Brown, M. & Hebert, A.A. (1997) Insect repellents: an overview. Ctenocephalides canis (Siphonaptera: Pulicidae)] in dogs Journal of the American Academy of Dermatology, 36, 243–249. (Coyne, 2009; Franc et al., 2012; Lienard et al., 2013; Varloud Cancrini, G., Frangipane di Regalbono, A., Ricci, I., Tessarin, C., & Fourie, 2015; Varloud & Hodgkins, 2015). A recent study, Gabrielli, S. & Pietrobelli, M. (2003a) Aedes albopictus is a natural in which DPP was tested against T. infestans using a rat model, vector of Diroilaria immitis in Italy. Veterinary Parasitology, 118, showed that DPP has a powerful effect against T. infestans from 195–202.

135 356 D. Tahir et al.

Cancrini, G., Romi, R., Gabrielli, S., Toma, L., Di Paolo, M. & Triatoma infestans in an area resistant to deltamethrin. Cadernos de Scaramozzino, P. (2003b) First inding of Diroilaria repens in a Saúde Pública, 20, 1240–1248. natural population of Aedes albopictus. Medical and Veterinary Gratz, N.G. (2004) Critical review of the vector status of Aedes Entomology, 17, 448–451. albopictus. Medical and Veterinary Entomology, 18, 215–227. Carvajal, G., Picollo, M.I. & Toloza, A.C. (2014) Is imidacloprid Gubler, D.J. (2003) Aedes albopictus in Africa. Lancet Infectious an effective alternative for controlling pyrethroid-resistant popula- Diseases, 3, 751–752. tions of Triatoma infestans (Hemiptera: Reduviidae) in the Gran Kamgang, B., Nchoutpouen, E., Simard, F. & Paupy, C. (2012) Notes on Chaco ecoregion? Memórias do Instituto Oswaldo Cruz, 109, the blood-feeding behavior of Aedes albopictus (Diptera: Culicidae) 761–766. in Cameroon. Parasites & Vectors, 5, 57. Corbel, V., Duchon, S., Zaim, M. & Hougard, J.M. (2004) Dinotefuran: Lambrechts, L., Scott, T.W. & Gubler, D.J. (2010) Consequences of the a potential neonicotinoid insecticide against resistant mosquitoes. expanding global distribution of Aedes albopictus for dengue virus Journal of Medical Entomology, 41, 712–717. transmission. PLoS Neglected Tropical Diseases, 4, e646. Coyne, M.J. (2009) Eficacy of a topical ectoparasiticide containing Legifrance (2013) Decree No. 2013–118 of February 1, 2013 concern- dinotefuran, pyriproxyfen, and permethrin against Amblyomma amer- ing the protection of animals used for scientiic purposes. https:// icanum (Lone Star tick) and Amblyomma maculatum (Gulf Coast tick) www.legifrance.gouv.fr/eli/decret/2013/2/1/AGRG1231951D/jo/ on dogs. Veterinary Therapeutics, 10, 17–23. texte [accessed on August 2015]. Dantas-Torres, F. & Otranto, D. (2013) Diroilariosis in the Americas: a Licitra, B., Chambers, E.W., Kelly, R. & Burkot, T.R. (2010) Detection more virulent Diroilaria immitis? Parasites & Vectors, 6, 288. of Diroilaria immitis (Nematoda: Filarioidea) by polymerase chain Delatte, H., Paupy, C., Dehecq, J.S., Thiria, J., Failloux, A.B. & reaction in Aedes albopictus, Anopheles punctipennis,andAnopheles Fontenille, D. (2008) Aedes albopictus, vector of chikungunya and crucians (Diptera: Culicidae) from Georgia, U.S.A. Journal of Med- dengue viruses in Reunion Island: biology and control. Parasite, 15, ical Entomology, 47, 634–638. 3–13. Lienard, E., Bouhsira, E., Jacquiet, P., Warin, S., Kaltsatos, V. & Franc, Delatte, H., Desvars, A., Bouetard, A. et al. (2010) Blood-feeding M. (2013) Eficacy of dinotefuran, permethrin and pyriproxyfen behavior of Aedes albopictus, a vector of Chikungunya on La combination spot-on on dogs against Phlebotomus perniciosus and Reunion. Vector Borne and Zoonotic Diseases, 10, 249–258. Ctenocephalides canis. Parasitology Research, 112, 3799–3805. Dumont, P., Fankhauser, B., Bouhsira, E. et al. (2015a) Repellent Machida, H., Kondo, T., Kanehira, K., Hagimori, I. & Kamio, T. and insecticidal eficacy of a new combination of ipronil and (2008) The inhibitory effect of a combination of imidacloprid and permethrin against the main vector of canine leishmaniasis in Europe permethrin on blood feeding by mosquitoes in dogs raised under (Phlebotomus perniciosus). Parasites & Vectors, 8, 49. outdoor conditions. Veterinary Parasitology, 154, 318–324. Dumont, P., Liebenberg, J., Beugnet, F. & Fankhauser, B. (2015b) Meyer, J.A., Disch, D., Cruthers, L.R., Slone, R.L. & Endris, R.G. Repellency and acaricidal eficacy of a new combination of ipronil (2003) Repellency and eficacy of a 65% permethrin spot-on formula- and permethrin against Ixodes ricinus and Rhipicephalus sanguineus tion for dogs against Aedes aegypti (Diptera: Culicidae) mosquitoes. ticks on dogs. Parasites & Vectors, 8, 531. Veterinary Therapeutics, 4, 135–144. European Medicines Agencys (2013) Vectra3D Product information Molina, R., Espinosa-Gongora, C., Galvez, R. et al. (2012) Eficacy of EPAR.http://www.ema.europa.eu/docs/en_GB/document_library/ 65% permethrin applied to dogs as a spot-on against Phlebotomus Summary_of_opinion_-_Initial_authorisation/veterinary/002555/ perniciosus. Veterinary Parasitology, 187, 529–533. WC500151982.pdf [accessed on 21 August 2015]. Reifenrath, W.G. & Rutledge, L.C. (1983) Evaluation of mosquito Fankhauser, B., Dumont, P., Hunter, J.S. III et al. (2015) Repellent and repellent formulations. Journal of Pharmaceutical Sciences, 72, insecticidal eficacy of a new combination of ipronil and permethrin 169–173. against three mosquito species (Aedes albopictus, Aedes aegypti and Richards, S.L., Ponnusamy, L., Unnasch, T.R., Hassan, H.K. & Apper- Culex pipiens) on dogs. Parasites & Vectors, 8, 64. son, C.S. (2006) Host-feeding patterns of Aedes albopictus (Diptera: Faraji, A., Egizi, A., Fonseca, D.M. et al. (2014) Comparative host Culicidae) in relation to availability of human and domestic animals feeding patterns of the Asian tiger mosquito, Aedes albopictus,in in suburban landscapes of central North Carolina. Journal of Medical urban and suburban northeastern U.S.A. and implications for disease Entomology, 43, 543–551. transmission. PLoS Neglected Tropical Diseases, 8, e3037. Rutledge, L.C., Gupta, R.K., Wirtz, R.A. & Buescher, M.D. (1994) Foissac, M., Million, M., Mary, C. et al. (2013) Subcutaneous infection Evaluation of the laboratory mouse model for screening topical with Diroilaria immitis nematode in human, France. Emerging mosquito repellents. Journal of the American Mosquito Control Infectious Diseases, 19, 171–172. Association, 10, 565–571. Franc, M., Genchi, C., Bouhsira, E. et al. (2012) Eficacy of dinote- Simon, F., Siles-Lucas, M., Morchon, R. et al. (2012) Human and furan, permethrin and pyriproxyfen combination spot-on against animal diroilariasis: the emergence of a zoonotic mosaic. Clinical Aedes aegypti mosquitoes on dogs. Veterinary Parasitology, 189, Microbiology Reviews, 25, 507–544. 333–337. Tahir, D., Davoust, B., Varloud, M. et al. (2017) Assessment of the Freireich, E.J., Gehan, E.A., Rall, D.P., Schmidt, L.H. & Skipper, H.E. anti-feeding and insecticidal effects of the combination of dinotefu- (1966) Quantitative comparison of toxicity of anticancer agents in ran, permethrin and pyriproxyfen (Vectra(R) 3D) against Triatoma mouse, rat, hamster, dog, monkey, and man. Cancer Chemotherapy infestans on rats. Medical and Veterinary Entomology, 31, 132–139. Reports, 50, 219–244. Tiawsirisup, S., Nithiuthai, S. & Kaewthamasorn, M. (2007) Repellent Fukumitsu, Y., Irie, K., Satho, T. et al. (2012) Elevation of dopamine and adulticide eficacy of a combination containing 10% imidacloprid level reduces host-seeking activity in the adult female mosquito Aedes and 50% permethrin against Aedes aegypti mosquitoes on dogs. albopictus. Parasites & Vectors, 5, 92. Parasitology Research, 101, 527–531. Gentile, A.G., Sartini, J.L., Campo, M.C. & Sanchez, J.F. (2004) Varloud, M. & Fourie, J.J. (2015) One-month comparative eficacy Eficacy of ipronil in the control of the peridomiciliary cycle of of three topical ectoparasiticides against adult brown dog ticks

136 Eficacy of Vectra® 3D in mice 357

(Rhipicephalus sanguineus sensu lato) on mixed-bred dogs in con- World Health Organization (2006) Guidelines for Testing Mosquito trolled environment. Parasitology Research, 114, 1711–1719. Adulticides for Indoor Residual Spraying and Treatment of Mosquito Varloud, M. & Hodgkins, E. (2015) Five-month comparative eficacy Nets. http://apps.who.int/iris/bitstream/10665/69296/1/WHO_CDS_ evaluation of three ectoparasiticides against adult cat leas (Cteno- NTD_WHOPES_GCDPP_2006.3_eng.pdf. cephalides felis), lea egg hatch and emergence, and adult brown dog ticks (Rhipicephalus sanguineus sensu lato) on dogs housed outdoors. Accepted 24 March 2017 Parasitology Research, 114, 965–973. First published online 17 July 2017

137

Tahir D, Davoust B,ARTICLE M. Varloud M, Berenger JM, Raoult D, Almeras L, Parola P. Assessment of the anti- feeding and insecticidal effects of the combination of dinotefuran, permethrin and pyriproxyfen (Vectra® 3D) against Triatoma infestans on rats. Med. Vet. Entomol. 2017, 31(2):132-139.

139

Medical and Veterinary Entomology (2017) 31, 132–139 doi: 10.1111/mve.12206

Assessment of the anti-feeding and insecticidal effects of the combination of dinotefuran, permethrin and pyriproxyfen (Vectra® 3D) against Triatoma infestans on rats

D. TAHIR1, B. DAVOUST1, M. VARLOUD2, J.-M. BERENGER1, D. RAOULT1, L. ALMERAS1 andP.PAROLA1 1Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63, Centre National de la Recherche Scientiique (CNRS) 7278, Institut de Recherche pour le Développement (IRD) 198 (Dakar), Institut National de la Santé et de la Recherche Médicale (INSERM) 1095, Aix-Marseille University, Marseille, France and 2Ceva Santé Animale SA, Libourne, France

Abstract. This study, based on the rat model, was designed to explore the anti-feeding and insecticidal eficacy of a topical ectoparasiticide, dinotefuran– permethrin–pyriproxyfen (DPP), against Triatoma infestans (Hemiptera: Reduviidae), a vector of Trypanosoma cruzi (Trypanosomatida: Trypanosomatidae), for which dogs are domestic reservoir hosts. Twenty rats were divided into two equal groups: untreated and treated. Each rat was exposed under sedation to 16 T. infestans of mixed life stages for 1 h on days 1, 7, 14, 21 and 28 post-treatment. The anti-feeding and insecticidal effects of DPP were estimated after 1 h of exposure. Insecticidal eficacy was also assessed after incubation of the insects for 24 h post-exposure. Anti-feeding eficacy was 96.7, 84.7, 80.5, 81.5 and 42.6% on days 1, 7, 14, 21 and 28, respectively. Insecticidal eficacy evaluated at 1 and 24 h after exposure on days 1, 7, 14, 21 and 28 was 100, 91.2, 82.5, 80.0 and 29.1, and 100, 100, 100, 96.0 and 49.9%, respectively. This study demonstrates that a single administration of DPP spot-on treatment at a dose equivalent to the minimal recommended dose in rats has a powerful effect against T. infestans starting from day 1 that lasts for at least 3 weeks. Key words. Triatoma infestans, Trypanosoma cruzi, ectoparasiticide, eficacy, rat model.

Introduction Reduviidae), are considered to be the most relevant vectors of T. cruzi because of their anthropophily, high density in perido- Chagas’ disease, also known as American trypanosomiasis, mestic areas, good adaptation to human dwellings and T. cruzi is a tropical parasitic disease caused by the protozoan Try- vectorial capacity (Noireau et al., 2009), as well as for their wide panosoma cruzi. An estimated 6 million people infected with geographic distribution, principally in Latin America (Noireau, T. cruzi currently reside in the endemic regions of Latin America 2009). It is important to stress that the vector elimination pro- [World Health Organization (WHO), 2015]. The protozoan par- gramme started in 1991 that aimed to eradicate Chagas’ dis- asite T. cruzi is mainly transmitted through the faeces or urine ease in Southern Cone countries such as Argentina, Bolivia, of infected blood-sucking insects of the family Reduviidae, Brazil, Chile, Paraguay and Uruguay produced good results in subfamily Triatominae (WHO, 2016). Triatomine bugs, espe- terms of the elimination of T. infestans in some South Ameri- cially Triatoma infestans and Rhodnius prolixus (Hemiptera: can countries. For example, the greatest successes were obtained

Correspondence: Philippe Parola, Faculté de Médecine, Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes (URMITE), 27 Boulevard Jean Moulin, 13385 Marseille Cedex 5, France. Tel.: + 33 4 91 38 55 17; Fax: + 33 4 91 38 77 72; E-mail: [email protected] The copyright line for this article was changed on 24 January 2017 after original online publication. 132 © 2016 The Authors. Medical and Veterinary Entomology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

141 Eficacy of DPP against bugs 133 by Uruguay in 1997, Chile in 1999 and Brazil in 2006, all Dinotefuran, pyriproxyfen and permethrin (DPP; Vectra® 3D; of which were certiied by the Pan American Health Orga- Ceva Santé Animale SA, Libourne, France) can be combined nization (PAHO)/WHO as free from T. infestans (Dias, 2009; in a topical ectoparasiticide for dogs. This has been reported Abad-Franch et al., 2013). However, it is important that these to be an eficient repellent and adulticide against ticks, leas, countries remain vigilant if they are to avoid the reintroduction mosquitoes, stable lies and sandlies for up to 1 month (Coyne, of T. infestans, which still exists in Argentina, Bolivia, Paraguay 2009; Franc et al., 2012; Varloud & Hodgkins, 2015; Varloud and Peru, and of other species that have not been eliminated et al., 2015a) and for up to 2 months against immature stages (Abad-Franch et al., 2013). of leas (Bouhsira et al., 2012). However, the protective effec- Triatoma infestans prefers to feed on humans and domestic tiveness of DPP against T. infestans in animals has not yet been animals in homes. It derives its bloodmeals from four main tested. The aim of the present study was thus to explore the sources: humans, chickens, dogs and cats (Gürtler et al., 2014; anti-feeding and insecticidal effects of a DPP topical adminis- Provecho et al., 2014; Coura, 2015; Cecere et al., 2016). Tri- tration in rats against T. infestans bugs for up to 4 weeks after atoma infestans nests in thatched or straw roofs, in the crevices administration. of mud walls, and in cement and brick. Other than vector control with insecticides, there is no way to control Chagas’ disease, no vaccine and no effective treatment for chronic forms Materials and methods (WHO, 2006). Because triatomines can live in homes, prevention includes cleaning, the use of mosquito nets and insecticidal Animals and ethical approval treatment of the premises. This prophylaxis gives results, but resistance to mono-insecticides has been detected (Gomez et al., Twenty adult (aged 6 weeks) male Sprague–Dawley rats 2015; Mougabure-Cueto & Picollo, 2015) and some insecti- (Charles River Laboratories, Saint-Germain-Nuelles, France), cides, such as spinosad and indoxacarb, are not effective against with a mean ± standard deviation (SD) weight of 160.7 ± 3.6 g, triatomine bugs (Carvajal et al., 2012). In the last decade, ield were housed in groups of two individuals per cage and laboratory studies have reported high levels of resistance (58 × 36 × 20 cm3) at a temperature of 22 ∘C under an LD to deltamethrin in T. infestans in Argentina and Bolivia (Picollo 12 : 12 h cycle. Rats were fed an appropriate maintenance ration et al., 2005; Toloza et al., 2008). Indeed, pyrethroids are the of commercial food pellets. Water was available ad libitum.The insecticides most commonly used for the chemical control of rats were handled according to French rules on the protection the vector (WHO, 2006). of animals used for scientiic purposes (decree no. 2013-118; 1 Dogs have been shown to be often involved in outbreaks February 2013, Paris) (Legifrance, 2015). The protocol for this of Chagas’ disease (Castillo-Neyra et al., 2015; Gürtler & study was reviewed and approved by the Ethics Committee for Cardinal, 2015). The role of the dog in the parasitic cycle is Animal Experimentation at Aix-Marseille University (approval now better understood as a result of molecular biology studies no. 2015090110122337). General health observations were per- on the blood of dogs (Enriquez et al., 2014; Gürtler & Cardinal, formed at least twice per day from the start of the acclimation 2015). Mathematical modelling predicts that the elimination of period to the end of the study. infected dogs from a household with infected people could be suficient to limit the transmission of T. cruzi (Cohen & Gürtler, 2001). This suggests that preventive treatment of dogs using Source of T. infestans an ectoparasiticide may minimize the risk for transmission of T. cruzi to humans. Fipronil-(S)-methoprene spot-on treatment Adult T. infestans (CEPEIN susceptible strain) were taken is not recommended in dogs for this purpose because of its from a laboratory colony initiated in 2009 using adult speci- limited and transient effect on triatomine bugs (Gürtler et al., mens sourced from Argentina. Since then, this colony has been 2009) and because of high inter-individual variability (Amelotti reared at the laboratory without exposure to any insecticides. All et al., 2012). Although the use in dogs of a deltamethrin-based bugs were reared in the laboratory’s insectarium at 26 ± 1 ∘Cand application on collars reduced the survival and fecundity of 70 ± 1% relative humidity (RH). The bugs were fed with deibri- triatomine bug populations, no difference in insect feeding was nated human blood (under an agreement with the Etablissement noticed between untreated and deltamethrin-treated specimens Français du Sang) using a Hemotek membrane feeding system (Reithinger et al., 2006). Collectively, these data emphasize that (Discovery Workshops, Accrington, U.K.). Nymph instars and currently there are no drug treatments (ectoparasiticides) that adults of both sexes were used in the present study. Each rat was effectively prevent triatomine bugs from blood feeding on pets. exposed to a total of 16 triatomine bugs, including 12 nymph From the point of view of veterinary medicine, the prevention instars (three specimens of each of stages 2, 3, 4 and 5) and four of triatomine bug bites is essential to the prevention of Chagas’ adult triatomines. All bugs were starved for 15 days before they disease in dogs. Infection is more common in puppies than in were given access to the rats. adult dogs and often presents in the acute form. Symptoms are similar to those in humans and include myocarditis (most commonly), hepatomegaly, splenomegaly, lymphadenopathy, Treatment anorexia, weight loss, diarrhoea, hypothermia and dehydration (Snider et al., 1980; Barr et al., 1995; Kjos et al., 2008; Barr, The minimum recommended dose in dogs [i.e. 6.4 mg/kg body 2009). weight (BW) of dinotefuran, 0.6 mg/kg BW of pyriproxyfen

142 134 D. Tahir et al. and 46.6 mg/kg BW of permethrin] was used to determine the each time-point, differences between treated and untreated rats dose to be administered to rats with a mean ± SD weight of were compared using Student’s t-test. Statistical signiicance 160.7 ± 3.6 g. As the dose per kilogram BW for one species was declared at a two-sided P-value of 0.05. cannot be transposed to another species, it was decided that doses expressed in mg/kg BW for dogs should be converted to equivalent doses based on body surface area in rats and Results expressed as mg/m2 as previously described by Freireich et al. (1966). The minimal recommended dose of DPP was therefore No adverse effects of treatment were observed in any of the estimated to be 0.07 mL per rat. All doses were administered on treated rats. The proportions of fed bugs in the untreated groups day 0 and were applied directly to the skin as a line-on treatment ranged from 94.3 to 99.3%, with an average of 97.2 ± 1.9%, along the spine using a micropipette to ensure accurate and throughout the study (Table 1). In both groups, T. infestans complete dosing. Treated rats were observed several times per bugs introduced into the plastic containers holding the rats day for 15 min after treatment for general health status and any immediately attacked the rats. Bugs showed conspicuous signs adverse events that might be associated with the administration of feeding after 10–20 min of exposure to untreated control rats. of the agent. Generally, adult bugs fed longer than instar nymphs. It was noted that the bugs always defecated on the rats while feeding. In the treated rats, bugs expressed signs of intoxication such as Exposure of rats to T. infestans inconsistent movements, unfolding of the rostrum, swelling of the abdomen and shiny cuticle. It is important to note that no Before exposure, all rats were anaesthetized with an intraperi- blood was observed when a needle was pressed into the swollen toneal injection of a combination of 90 mg/kg ketamine abdomen in such bugs. In treated rats, the proportions of fed bugs ® (Imalgene 500; Merial, Lyon, France) and 10 mg/kg xylazine were 3.1, 15.0, 19.3, 18.1 and 55.0% on days 1, 7, 14, 21 and 28, ® (Rompun 2%; Bayer Santé Animale, Lyon, France). Each rat respectively (Table 1). 3 was placed in a transparent plastic container (50 × 20 × 20 cm ) Fed bug counts were signiicantly lower for DPP-treated rats in which it was then exposed for 1 h to starved nymph instars than for untreated control rats (P < 0.0001) at all time-points. (n = 12) and male and female adults (n = 4) on days 1, 7, 14, 21 The anti-feeding eficacy of DPP was high at 96.7, 84.7, 80.5 and 28 post-treatment. The whole experiment was conducted and 81.5% on days 1, 7, 14 and 21, respectively, and decreased in a slightly darkened room at a mean ± SD temperature of ∘ to 42.6% on day 28 (Table 2). At 1 and 24 h post-exposure, the 22 ± 1 C. After the 1-h exposure period, the bugs were catego- AMs of live bugs were signiicantly lower for DPP-treated rats rized and counted as fed or unfed and dead or live. Live bugs than for untreated control rats (P < 0.0001) throughout the study from each group were maintained in separate incubators and (Table 2). Insecticidal eficacy evaluated at 1 h after exposure survival rates at 24 h after the end of the exposure were recorded ranged between 80.0 and 100% up to day 21 and declined to (Fig. 1). 29.1% at 28 days after treatment, whereas insecticidal eficacy assessed 24 h after exposure remained above 96.0% until day 21 and declined to 49.9% at 28 days after treatment (Table 3). No Statistical analysis difference in treatment sensitivity was observed between adults and instar nymphs. In the present study, each rat represented the experimental unit. The primary endpoints were the fed and live bug counts. The arithmetic mean numbers of engorged bugs and live bugs were calculated at each time-point. Anti-feeding and insecticidal Discussion eficacies were calculated using Abbott’s formula (Abbott, Animal models can provide preliminary and complementary 1987) as: information that is useful in further testing on targeted animals. MCe − MTe In the present study, a rat model was selected to explore the Anti-feeding eficacy (%) = 100 × MCe anti-feeding and insecticidal eficacy of DPP against T. infestans. Previous studies have demonstrated the possibility of extrapolat- where MCe represents the mean [geometric mean (GM) or ing the results obtained in mice treated with a mosquito repellent arithmetic mean (AM)] number of fed bugs in the control to humans (Reifenrath & Rutledge, 1983; Rutledge et al., 1994). (untreated) group, and MTe represents the mean (GM or AM) Although representativeness can be questioned, the information number of fed bugs in the treated group and: collected from the models is deinitely useful in terms of optimizing the designs of experiments in the target animals. MCi − MTi Insecticidal eficacy (%) = 100 × In the present study, the feeding rate of T. infestans on control MCi rats exceeded 94.0% at all ive time-points tested (Table 1). This where MCi represents the mean (GM or AM) number of live strong feeding rate showed that the population of T. infestans bugs in the control (untreated) group, and MTi represents the used in the experiment was robust and the challenge was reliable. mean (GM or AM) number of live bugs in the treated group. This is consistent with previous observations in experiments Statistical analyses were performed using statistia Version conducted in Triatoma rubrofasciata fed on Swiss mice (Braga 6.1 (StatSoft, Inc., Tulsa, OK, U.S.A.; www.statsoft.com). At & Lima, 1999) and T. infestans fed on Sprague–Dawley rats,

143 Eficacy of DPP against bugs 135

DPP-treated group Control (untreated) group

10 rats 10 rats

12 starved nymph instars and four adults of Triatoma infestans per rat Treatment with DPP

0 1 7 14 21 28 Days

Triatoma infestans counts (Fed/ unfed and live/dead) at 1 h and 24 h post-exposure

Fig. 1. Schematic representation of the experimental design. DPP, dinotefuran, permethrin and pyriproxyfen. [Colour igure can be viewed at wileyonlinelibrary.com].

Table 1. Feeding and mortality rates in Triatoma infestans (12 nymph instars and four adults per rat) on rats untreated (control group; n = 10) and treated (n = 10) with a combination of dinotefuran, permethrin and pyriproxyfen.

Mortality rate, % (n) Feeding rate, % (n)1h 24h Exposure day Untreated group Treated group Untreated group Treated group Untreated group Treated group 1 96.2% (154) 3.1% (5) 0 100% (160) 1.8% (3) 100% (160) 7 98.1% (157) 15.0% (24) 0 91.2% (146) 3.1% (5) 100% (160) 14 99.3% (159) 19.3% (31) 0 82.5% (132) 5.6% (9) 100% (160) 21 98.1% (157) 18.1% (29) 0 79.3% (127) 4.3% (7) 96.2% (154) 28 94.3% (151) 55.0% (88) 0 28.1% (45) 3.1% (5) 50.6% (81)

Table 2. Anti-feeding eficacy against Triatoma infestans (12 nymph at the appropriate dose, DPP could be safely reapplied at instars and four adults per rat) on rats untreated (control group; n = 10) 3-week intervals (Coussanes et al., 2015). This anti-feeding and treated (n = 10) with a combination of dinotefuran, permethrin and performance were not observed in previous studies assessing pyriproxyfen. the effects of deltamethrin-based collars (Reithinger et al., 2005, 2009) or ipronil-(S)-methoprene spot-on treatment (Gürtler T. infestans feeding, AM ± SD Exposure Repellency et al., 2009) on dogs or with imidacloprid spot-on applied to day Untreated group Treated group eficacy, % pigeons (Carvajal et al., 2014). This high level of anti-feeding eficacy of DPP can be explained by the synergistic action of 1 15.4 ± 0.8 0.5 ± 0.7 96.7%* dinotefuran and permethrin against insects at the tested ratio 7 15.6 ± 0.6 2.4 ± 0.9 84.7%* 14 15.8 ± 0.3 3.1 ± 1.2 80.5%* (Varloud et al., 2015a, 2015b). The administration of DPP will 21 15.7 ± 0.4 2.9 ± 1.6 81.5%* prevent bugs from taking bloodmeals from treated animals 28 15.1 ± 1.1 8.8 ± 1.5 42.6%* (dogs) and is expected to reduce the transmission of T. cruzi to and from dogs, which are considered to represent the pathogen’s *Signiicant difference between the treated and untreated (control) main domestic reservoir (Reithinger et al., 2005, 2006; Amelotti groups (P < 0.0001). et al., 2012). AM, arithmetic mean; SD, standard deviation. The feeding rates of T. infestans on DPP-treated rats at days 1, 7, 14, 21 and 28 were 3.1, 15.0, 19.3, 18.1 and 55.0%, in which more than 86% of bugs were seen to bite the host respectively. These were lower than that reported in a pre- (Canals et al., 1999). The single topical treatment of DPP had vious dog study in which another insecticide (deltamethrin) an immediate effect after administration, as demonstrated by of the second-generation pyrethroids was tested on dogs the high anti-feeding eficacy (> 80%) that started at day 1 against T. infestans bugs using deltamethrin-impregnated dog and lasted until day 21 after treatment. The anti-feeding effect collars (Reithinger et al., 2005). The earlier results showed decreased to 42.6% at 28 days after treatment (Table 2). If feeding rates of 97, 93, 91, 93 and 85% in dogs wearing such a decrease in eficacy were to be conirmed in dogs deltamethrin-impregnated collars, and 99, 100, 97, 91 and 90%

144 136 D. Tahir et al.

Table 3. Insecticidal eficacy against Triatoma infestans (12 nymph instars and four adults per rat) on rats untreated (control group; n = 10) and treated (n = 10) with a combination of dinotefuran, permethrin and pyriproxyfen at 1 and 24 h post-exposure.

Live T. infestans,AM± SD Insecticidal eficacy, % 1h 24h Exposure day Untreated group Treated group Untreated group Treated group 1 h 24 h

1 16 0 15.7 ± 0.6 0 100%* 100%* 716 1.4± 1.2 15.5 ± 0.8 0 91.2%* 100%* 14 16 2.8 ± 1 15.1 ± 1.1 0 82.5%* 100%* 21 15.8 ± 0.4 3.3 ± 0.5 15.3 ± 0.9 0.6 ± 0.8 80.0%* 96.0%* 28 16 11.5 ± 2 15.5 ± 0.8 7.9 ± 1.6 29.1%* 49.9%*

*Signiicant differences between the treated and untreated (control) groups (P < 0.0001). AM, arithmetic mean; SD, standard deviation. in control dogs on days 0, 15, 30, 60 and 90, respectively. How- (Gentile et al., 2004). Even when applied as a spot-on in ever, over the 90-day period, the average engorgement rate on pigeons at a massive dose (158 mg/kg pigeon), imidacloprid collared dogs remained signiicantly lower at 30.8% compared did not provide insecticidal eficacy that lasted over 7 days with 55.2% on control dogs (Reithinger et al., 2005). Similar after administration, although the exposure of bugs to the results were reported in another study in which the proportion of active ingredient (imidacloprid) was maximized by exposing feeding bugs was signiicantly lower (92.2%) on collared dogs the insects to the pigeons at the site of administration of the than on control dogs (95.1%) over the entire 126-day obser- product (Carvajal et al., 2014). Data for the performance of DPP vation period (Reithinger et al., 2006). It is important to stress obtained in rats cannot be directly compared with data recorded that the collars (i.e. impregnated with 40 mg/g deltamethrin) are for ipronil-(S)-methoprene or deltamethrin-based products effective for up to 6 months (Reithinger et al., 2006). used in dogs or with data for imidacloprid applied to pigeons. Survival rates of T. infestans on the untreated control rats were Such differences can be explained by both methodological also satisfactory, with over 98 and 93% surviving until 1 and and product effects. To the present authors’ knowledge, this is 24 h, respectively, after the end of the exposure period (Table 1). the irst time that a dinotefuran-based combination has been These data validate the level of challenge in the present study. tested against triatomine bugs. Dinotefuran is a furanicotinyl Although the treatment was applied at the lowest recommended belonging to the third generation of neonicotinoids and is dose, DPP exhibited high insecticidal eficacy against the bugs. known as a fast-acting insecticide (Wakita et al., 2005). When it Eficacy exceeded 80.0 and 96.0% at 1 and 24 h post-exposure is combined with permethrin, the effect of dinotefuran against from day 1 and over the 21-day period, respectively. It declined insects is enhanced at the ganglionic synaptic level, resulting in to 29.1 and 49.9% at 1 and 24 h post-exposure on day 28, increases in depolarization and desensitization (Varloud et al., although mortality remained signiicant. 2015b). When cis-permethrin or deltamethrin were used alone The combination of dinotefuran with permethrin at the against T. infestans nymphs, parasite recovery was observed ratio used in the DPP combination led to a synergistic effect, (Alzogaray & Zerba, 1997). In the present experiments, the bugs inducing a faster onset and residual killing activity against did not recover. This lethal effect of DPP is assumed to be linked insects (Varloud et al., 2015b). The percentages of bugs that to the synergistic combination of dinotefuran and permethrin. died at 24 h post-exposure on days 1, 7, 14, 21 and 28 after Despite the success in eliminating T. infestans from Uruguay, treatment in the treated group were 100, 100, 100, 96.2 and Chile and Brazil, triatomine bugs remain widespread and con- 50.6%, respectively. These were higher than the rate reported tinue to pose serious problems in other countries of the Southern by Reithinger et al. (2006), who tested deltamethrin-based Cone of South America, such as Bolivia, Argentina, Paraguay collars on dogs against T. infestans. Their results showed and Peru. The species is almost exclusively domestic in all of that 23.9% of bugs died over the entire 126-day observa- these countries. In outbreaks, particularly in Argentina, where tion period. The insecticidal effect of DPP was also higher Chagas’ disease is transmitted by T. infestans, dogs and cats than that reported for ipronil-(S)-methoprene spot-on for represent domestic reservoirs of T. cruzi infection (Cardinal dogs tested against T. infestans (Gürtler et al., 2009). These et al., 2007). Levels of canine seroprevalence to T. cruzi are authors’ results showed that cumulative mean bug mortal- high in 15 countries and vary from 8 to 50% across various ity after exposure differed signiicantly only at 1 week after surveys, which are often conducted using different techniques treatment, when mortality was 18.7% in bugs infesting dogs (Barbabosa-Pliego et al., 2011; Berrizbeitia et al., 2013; Chik- treated with ipronil-(S)-methoprene and 4.4% in bugs infesting weto et al., 2014; Tenney et al., 2014; Alroy et al., 2015; Gürtler control dogs. Another study conducted in both laboratory and & Cardinal, 2015; Saldaña et al., 2015). Dogs should be pre- ield conditions tested the eficacy of liquid ipronil (1.0%) vented from becoming infected by restraining their access to against T. infestans nymphs on dogs, chickens and goats. Its ecosystems that feature vector bugs. The protection of dogs results showed nymphal mortality of 100% after 7 days and using a residual insecticide applied as a spot-on treatment 88.8% after 30 days in the laboratory assessments, and a 65.4% should be strongly recommended in high-risk areas. Studies in decrease in triatomine density after 30 days in ield experiments Argentina have helped to highlight the correlation between the

145 Eficacy of DPP against bugs 137 number of infected dogs in homes and the number of human native vectors: cui bono? Memórias do Instituto Oswaldo Cruz, 108, cases (Gürtler et al., 2005). Similarly, in Brazil, infection (both 251–254. acute and chronic) of children is linked to that of dogs (Mott Abbott, W.S. (1987) A method of computing the effectiveness of et al., 1978). This is why the prevention of blood feeding on an insecticide. 1925. Journal of the American Mosquito Control dog hosts is a primary target in the ight against Chagas’ disease Association, 3, 302–303. transmission to humans. Alroy, K.A., Huang, C., Gilman, R.H. et al. (2015) Prevalence and transmission of Trypanosoma cruzi in people of rural communities of the high jungle of Northern Peru. PLoS Neglected Tropical Diseases, 9, e0003779. Conclusions Alzogaray, R.A. & Zerba, E.N. (1997) Incoordination, paralysis and recovery after pyrethroid treatment on nymphs III of Triatoma The present study demonstrates that at the dosages tested, infestans (Hemiptera: Reduviidae). Memórias do Instituto Oswaldo DPP has reliable anti-feeding and insecticidal effects against Cruz, 92, 431–435. T. infestans. Indeed, the anti-feeding effect of DPP against bugs Amelotti, I., Catalá, S.S. & Gorla, D.E. (2012) Effects of ipronil may increase the risk to humans of contracting the parasite on dogs over Triatoma infestans, the main vector of Trypanosoma because if T. infestans is unable to feed on treated dogs, it will cruzi, causative agent of Chagas disease. Parasitology Research, 111, bite another host, such as a human. However, the powerful 1457–1462. insecticidal eficacy of the product offsets this effect because Barbabosa-Pliego, A., Gil, P.C., Hernández, D.O. et al. (2011) Preva- it will reduce the population of bugs in homes, thus reducing lence of Trypanosoma cruzi in dogs (Canis familiaris) and triatomines insect bites to humans. On rats, these two eficacy parameters during 2008 in a sanitary region of the State of Mexico, Mexico. Vec- persisted at > 80% for at least 3 weeks after treatment and both tor Borne and Zoonotic Diseases, 11, 151–156. actions were detected at signiicant levels for at least 1 month. Barr, S.C. (2009) Canine Chagas’ disease (American trypanosomiasis) Although such results require further investigation in the target in North America. Veterinary Clinics of North America: Small Animal species, the tested dose was designed to be representative of the Practice, 39, 1055–1064. minimal recommended dose in dogs. Consequently, these results Barr, S.C., van Beek, O., Carlisle-Nowak, M.S. et al. (1995) Try- are expected to represent a reliable estimate of the anticipated panosoma cruzi infection in Walker hounds from Virginia. American performance of DPP on dogs against triatomine bugs. The Journal of Veterinary Research, 56, 1037–1044. preventive treatment of non-infected dogs with DPP may protect Berrizbeitia, M., Concepción, J.L., Carzola, V., Rodríguez, J., Cárceres, them from contact with triatomines and reduce the risk for A. & Quiñones, W. (2013) Seroprevalence of T. cruzi infection in transmission of certain zoonotic agents to humans. Canis familiaris, state of Sucre, Venezuela. Biomédica, 33, 214–225. Bouhsira, E., Lienard, E., Jacquiet, P. et al. (2012) Eficacy of permethrin, dinotefuran and pyriproxyfen on adult leas, lea eggs collection, and lea egg development following transplantation of mature female Acknowledgements leas (Ctenocephalides felis felis) from cats to dogs. Veterinary Para- sitology, 190, 541–546. This study was funded by Ceva Santé Animale (Libourne, Braga, M.V. & Lima, M.M. (1999) Feeding and defecation patterns France) and received additional support from the AMIDEX of nymphs of Triatoma rubrofasciata (De Geer, 1773) (Hemiptera: project (no. ANR-11-IDEX-0001-02), funded by the French Reduviidae), and its potential role as vector for Trypanosoma cruzi. Government programme Investissements d’Avenir, managed Memórias do Instituto Oswaldo Cruz, 94, 127–129. by the French National Research Agency (ANR) and the Foun- Canals, M., Solis, R., Tapia, C., Ehrenfeld, M. & Cattan, P.E. (1999) dation Méditerranée Infection (www.mediterranee-infection Comparison of some behavioral and physiological feeding parameters .com). The funders had no role in the study design, data col- of Triatoma infestans Klug, 1834 and Mepraia spinolai Porter, 1934, lection and analysis, decision to publish or preparation of the vectors of Chagas disease in Chile. Memórias do Instituto Oswaldo manuscript. Cruz, 94, 687–692. DT conceived the study design, performed the experiments, Cardinal, M.V., Lauricella, M.A., Marcet, P.L., Orozco, M.M., Kitron, carried out data analysis and interpretation and wrote the irst U. & Gürtler, R.E. (2007) Impact of community-based vector control draft of the manuscript. BD participed in the study design, the on house infestation and Trypanosoma cruzi infection in Triatoma experiments and in the writing of the manuscript. JMB produced infestans, dogs and cats in the Argentine Chaco. Acta Tropica, 103, triatomines and participed in the revision of the manuscript. 201–211. MV was involved in studying designing, interpreting data and Carvajal, G., Mougabure-Cueto, G. & Toloza, A.C. (2012) Toxicity of revising the manuscript. LA participed in data analysis and non-pyrethroid insecticides against Triatoma infestans (Hemiptera: revision of the manuscript. DR facilited the implementation of Reduviidae). Memórias do Instituto Oswaldo Cruz, 107, 675–679. the work. PP participed in the study design, in data analysis Carvajal, G., Picollo, M.I. & Toloza, A.C. (2014) Is imidacloprid an effective alternative for controlling pyrethroid-resistant populations and critically revised the manuscript. All authors have read and of Triatoma infestans (Hemiptera: Reduviidae) in the Gran Chaco approved the inal version of the manuscript. ecoregion? Memórias do Instituto Oswaldo Cruz, 109, 761–766. Castillo-Neyra, R., Chou Chu, L., Quispe-Machaca, V. et al. (2015) References The potential of canine sentinels for reemerging Trypanosoma cruzi transmission. Preventive Veterinary Medicine, 120, 349–356. Abad-Franch, F., Diotaiuti, L., Gurgel-Gonçalves, R. & Gürtler, R.E. Cecere, M.C., Leporace, M., Fernàndez, M.P. et al. (2016) Host-feeding (2013) Certifying the interruption of Chagas disease transmission by sources and infection with Trypanosoma cruzi of Triatoma infestans

146 138 D. Tahir et al.

and Triatoma eratyrusiformis (Hemiptera: Reduviidae) from the Legifrance (2015) Decree No. 2013-118 of February 1, 2013 concerning calchaqui valleys in northwestern argentina. Journal of Medical the protection of animals used for scientiic purposes. https://www Entomology, 53, 666–673. .legifrance.gouv.fr/eli/decret/2013/2/1/AGRG1231951D/jo/texte Chikweto, A., Kumthekar, S., Chawla, P. et al. (2014) Seroprevalence [accessed on 10 September 2015]. of Trypanosoma cruzi in stray and pet dogs in Grenada, West Indies. Mott, K.E., Muniz, T.M., Lehman, J.S. et al. (1978) House construction, Tropical Biomedicine, 31, 347–350. triatomine distribution, and household distribution of seroreactivity Cohen, J.E. & Gürtler, R.E. (2001) Modeling household transmission of to Trypanosoma cruzi in a rural community in northeast Brazil. American trypanosomiasis. Science, 293, 694–698. American Journal of Tropical Medicine and Hygiene, 27, 1116–1122. Coura, J.R. (2015) The main sceneries of Chagas disease transmission. Mougabure-Cueto, G. & Picollo, M.I. (2015) Insecticide resistance in The vectors, blood and oral transmissions – a comprehensive review. vector Chagas disease: evolution, mechanisms and management. Acta Memórias do Instituto Oswaldo Cruz, 10, 277–282. Tropica, 149, 70–85. Coussanes, E., Varloud, M., Ameller, T. & Kaltsatos, V. (2015) Eval- Noireau, F. (2009) Wild Triatoma infestans, a potential threat that needs uation of the tolerance of a permethrin -dinotefuran -pyriproxyfen to be monitored. Memórias do Instituto Oswaldo Cruz, 104, 60–64. combination (Vectra® 3D) after topically repeated overdosed admin- Noireau, F., Diosque, P. & Jansen, A.M. (2009) Trypanosoma istration in young puppies. Journal of Veterinary Pharmacology and cruzi: adaptation to its vectors and its hosts. Veterinary Research, Therapeutics, 38 (Suppl. 1), 141–142. 40, 26. Coyne, M.J. (2009) Eficacy of a topical ectoparasiticide containing Picollo, M., Vassena, C., Santo Orihuela, P., Barrios, S., Zaidemberg, dinotefuran, pyriproxyfen, and permethrin against Amblyomma amer- M. & Zerba, E. (2005) High resistance to pyrethroid insecticides icanum (lone star tick) and Amblyomma maculatum (Gulf Coast tick) associated with ineffective ield treatments in Triatoma infestans on dogs. Veterinary Therapeutics, 10, 17–23. (Hemiptera: Reduviidae) from northern Argentina. Journal of Med- Dias, J.C.P.(2009) Elimination of Chagas disease transmission: perspec- ical Entomology, 42, 637–642. tives. Memórias do Instituto Oswaldo Cruz, 104, 41–45. Provecho, Y.M., Gaspe, M.S., del Pilar Fernández, M., Enriquez, G.F., Enriquez, G.F., Bua, J., Orozco, M.M. et al. (2014) High levels of Try- Weinberg, D. & Gürtler, R.E. (2014) The peri-urban interface and panosoma cruzi DNA determined by qPCR and infectiousness to house infestation with Triatoma infestans in the Argentine Chaco: an Triatoma infestans support dogs and cats are major sources of par- underreported process? Memórias do Instituto Oswaldo Cruz, 109, asites for domestic transmission. Infection, Genetics and Evolution, 923–934. 25, 36–43. Reifenrath, W.G. & Rutledge, L.C. (1983) Evaluation of mosquito Franc, M., Genchi, C., Bouhsira, E. et al. (2012) Eficacy of dinotefuran, repellent formulations. Journal of Pharmaceutical Sciences, 72, permethrin and pyriproxyfen combination spot-on against Aedes 169–173. aegypti mosquitoes on dogs. Veterinary Parasitology, 189, 333–337. Reithinger, R., Ceballos, L., Stariolo, R., Davies, C.R. & Gürtler, R.E. Freireich, E.J., Gehan, E.A., Rall, D.P., Schmidt, L.H. & Skipper, H.E. (2005) Chagas disease control: deltamethrin-treated collars reduce (1966) Quantitative comparison of toxicity of anticancer agents in Triatoma infestans feeding success on dogs. Transactions of the Royal mouse, rat, hamster, dog, monkey, and man. Cancer Chemotherapy Society of Tropical Medicine and Hygiene, 99, 502–508. Reports, 50, 219–244. Reithinger, R., Ceballos, L. & Stariolo, R. (2006) Extinction of experi- Gentile, A.G., Sartini, J.L., Campo, M.C. & Sanchez, J.F. (2004) mental Triatoma infestans populations following continuous exposure Eficacy of ipronil in the control of the peridomiciliary cycle of to dogs wearing deltamethrin-treated collars. American Journal of Triatoma infestans in an area resistant to deltamethrin. Cadernos de Tropical Medicine and Hygiene, 74, 766–771. Saúde Pública, 20, 1240–1248. Reithinger, R., Tarleton, R.L., Urbina, J.A., Kitron, U. & Gürtler, R.E. Gomez, M.B., Pessoa, G.D., Rosa, A.C., Echeverria, J.E. & Diotaiuti, (2009) Eliminating Chagas disease: challenges and a roadmap. British L.G. (2015) Inheritance and heritability of deltamethrin resistance Medical Journal, 338, b1283. under laboratory conditions of Triatoma infestans from Bolivia. Rutledge, L.C., Gupta, R.K., Wirtz, R.A. & Buescher, M.D. (1994) Parasites & Vectors, 16, 595. Evaluation of the laboratory mouse model for screening topical Gürtler, R.E. & Cardinal, M.V. (2015) Reservoir host competence and mosquito repellents. Journal of the American Mosquito Control the role of domestic and commensal hosts in the transmission of Association, 10, 565–571. Trypanosoma cruzi. Acta Tropica, 151, 32–50. Saldaña, A., Calzada, J.E., Pineda, V. et al. (2015) Risk factors associ- Gürtler, R.E., Cecere, M.C., Lauricella, M.A. et al. (2005) Incidence ated with Trypanosoma cruzi exposure in domestic dogs from a rural of Trypanosoma cruzi infection among children following domes- community in Panama. Memórias do Instituto Oswaldo Cruz, 110, tic reinfestation after insecticide spraying in rural northwestern 936–944. Argentina. American Journal of Tropical Medicine and Hygiene, 73, Snider, T.G., Yaeger, R.G. & Dellucky, J. (1980) Myocarditis caused by 95–103. Trypanosoma cruzi in a native Louisiana dog. Journal of the American Gürtler, R.E., Ceballos, L.A., Stariolo, R., Kitron, U. & Reithinger, Veterinary Medical Association, 177, 247–249. R. (2009) Effects of topical application of ipronil spot-on on dogs Tenney, T.D., Curtis-Robles, R., Snowden, K.F. & Hamer, S.A. (2014) against the Chagas disease vector Triatoma infestans. Transactions of Shelter dogs as sentinels for Trypanosoma cruzi transmission across the Royal Society of Tropical Medicine and Hygiene, 103, 298–304. Texas. Emerging Infectious Diseases, 20, 1323–1329. Gürtler, R.E., Cecere, M.C., Vázquez-Prokopec, G.M. et al. (2014) Toloza, A.C., Germano, M., Cueto, G.M., Vassena, C., Zerba, E. & Domestic animal hosts strongly inluence human-feeding rates of Picollo, M.I. (2008) Differential patterns of insecticide resistance in the Chagas disease vector Triatoma infestans in Argentina. PLoS eggs and irst instars of Triatoma infestans (Hemiptera: Reduviidae) Neglected Tropical Diseases, 8, e2894. from Argentina and Bolivia. Journal of Medical Entomology, 45, Kjos, S.A., Snowden, K.F., Craig, T.M. Lewis, B., Ronald, N. & 421–427. Olson, J.K. (2008) Distribution and characterization of canine Chagas Varloud, M. & Hodgkins, E. (2015) Five-month comparative efi- disease in Texas. Veterinary Parasitology, 152, 249–256. cacy evaluation of three ectoparasiticides against adult cat leas

147 Eficacy of DPP against bugs 139

(Ctenocephalides felis), lea egg hatch and emergence, and adult Wakita, T., Yasui, N., Yamada, E. & Kishi, D. (2005) Development brown dog ticks (Rhipicephalus sanguineus sensu lato) on dogs of a novel insecticide, dinotefuran. Journal of Pesticide Science, 30, housed outdoors. Parasitology Research, 114, 965–973. 122–123. Varloud, M., Fourie, J.J., Blagburn, B.L. & Delandre, A. (2015a) Expel- World Health Organization (2006) Pesticides and their Application for lency, anti-feeding and speed of kill of a dinotefuran–permethrin– the Control of Vectors and Pests of Public Health Importance, 6th edn. pyriproxyfen spot-on (Vectra®3D) in dogs weekly challenged WHO, Geneva. with adult leas (Ctenocephalides felis) for 1 month-comparison World Health Organization (2015) Chagas disease in Latin America: an to a spinosad tablet (Comfortis®). Parasitology Research, 114, epidemiological update based on 2010 estimates. Weekly Epidemio- 2649–2657. logical Record, 90, 33–43. Varloud, M., Karembe, H. & Thany, S. (2015b) Synergic effect between World Health Organization (2016) Chagas disease (American try- permethrin and dinotefuran on ganglionic synaptic transmission in panosomiasis). http://www.who.int/mediacentre/factsheets/fs340/en/ an insect model (Periplana americana) assessed by mannitol-gap [accessed on 28 April 2016]. recording. 25th International Conference of the World Association for the Advancement of Veterinary Parasitology, 16–20 August 2015, Accepted 24 July 2016 Liverpool. First published online 9 November 2016

148 IV- CONCLUSION GENERALE & PERSPECTIVES

149

A travers cette thèse, nous avons pu répondre à certaines questions concernant les dirofilarioses dans la région méditerranéenne. Ainsi, nous avons mis en place un outil moléculaire en temps réel qui permet de différencier D. immitis de D. repens, les deux principales espèces dirofilariennes affectant les carnivores et l’homme dans le Bassin méditerranéen. Cet outil moléculaire a démontré son utilité sur le terrain, notamment, pour le dépistage des moustiques dans des régions où les deux espèces coexistent. Ainsi, nous avons mis en évidence la présence d’ADN de ces deux espèces de filaires dans les moustiques Ae. albopictus, ce constat représente une nouvelle alerte au regard de la capacité vectorielle de ce moustique qui ne cesse d’envahir la région méditerranéenne. Nous avons aussi confirmé la présence de la maladie des vers du cœur chez le chien dans le nord de l’Algérie. Ceci devrait retenir l’attention des autorités sanitaires sur le risque d’émergence de cas humains. Ainsi, les moustiques vecteurs devraient être mieux étudiés dans l’environnement des cas canins. Nous avons mis en place un outil protéomique pour dépister des moustiques infectés expérimentalement par trois espèces de filaires. Dans l’attente de sa validation sur des échantillons de terrain, cette approche protéomique semble être prometteuse dans la surveillance entomologique des maladies à transmission vectorielle.

151 Durant notre doctorat, nous avons aussi établi des modèles animaux basés sur des rongeurs de petite taille (souris et rats) pour tester l’efficacité d’ectoparasiticides utilisés en médecine vétérinaire. Ainsi, leur efficacité anti-gorgement et insecticide ont été testés contre Ae. albopictus avec une nouvelle combinaison de trois composants antiparasitaires. Ces modèles, qualifiés d’économiques et pratiques, devraient, sans doute, intéresser les laboratoires pharmaceutiques vétérinaires car, souvent, ce genre d’expérimentation est réalisé sur l’espèce cible (chiens ou chats). Le produit que nous avons testé (Vectra® 3D) a montré de bonnes performances répulsives et insecticides contre le moustique tigre pendant au moins quatre semaines. Ceci suggère, qu’un traitement mensuel des chiens par ce produit les protégera contre les piqûres de moustiques (mais aussi d’autres arthropodes), par conséquent, cela va empêcher la transmission des agents pathogènes qui sont associés à ces arthropodes.

152 RÉFÉRENCES

153

1. Mehlhorn H (2008) Encyclopedia of Parasitology. 3rd Edit. Springer, Heidelberg, Germany, 1573p.

2. Day MJ (2016) Arthropod-borne infectious diseases of the dog and cat. 2nd Edit. CRC Press, Boca Raton, USA, 220p.

3. McCall JW, Genchi C, Kramer LH, Guerrero J, Venco L (2008) Heartworm disease in animals and humans. Adv Parasitol 66: 193-285.

4. Dantas-Torres F, Otranto D (2013) Dirofilariosis in the Americas: a more virulent Dirofilaria immitis? Parasit Vectors 6: 288.

5. Harizanov RN, Jordanova DP, Bikov IS (2014) Some aspects of the epidemiology, clinical manifestations, and diagnosis of human dirofilariasis caused by Dirofilaria repens. Parasitol Res 113: 1571-1579.

6. Yssouf A, Almeras L, Terras J, Socolovschi C, Raoult D, Parola P (2015) Detection of Rickettsia spp. in ticks by MALDI-TOF MS. PLoS Negl Trop Dis 9: e0003473.

7. Fotso FA, Mediannikov O, Diatta G, Almeras L, Flaudrops C, Parola P, Drancourt M (2014) MALDI-TOF mass spectrometry detection of pathogens in vectors: the Borrelia crocidurae/Ornithodoros sonrai paradigm. PLoS Negl Trop Dis 8: e2984.

8. Laroche M, Almeras L, Pecchi E, Bechah Y, Raoult D, Viola A, Parola P (2017) MALDI-TOF MS as an innovative tool for detection of Plasmodium parasites in Anopheles mosquitoes. Malar J 16: 5. 10.

155 9. Bonizzoni M, Gasperi G, Chen X, James AA (2013) The invasive mosquito species Aedes albopictus: current knowledge and future perspectives. Trends Parasitol 29: 460-468.

10. Organisation Mondiale de la Santé (OMS) (2016) .

11. Mills JN, Gage KL, Khan AS (2010) Potential influence of climate change on vector-borne and zoonotic diseases: a review and proposed research plan. Environ Health Perspect 118: 1507- 1514.

12. Plichart C, Sechan Y, Davies N, Legrand AM (2006) PCR and dissection as tools to monitor filarial infection of Aedes polynesiensis mosquitoes in French Polynesia. Filaria J 5: 2.

13. Licitra B, Chambers EW, Kelly R, Burkot TR (2010) Detection of Dirofilaria immitis (Nematoda: Filarioidea) by polymerase chain reaction in Aedes albopictus, Anopheles punctipennis, and Anopheles crucians (Diptera: Culicidae) from Georgia, USA. J Med Entomol 47: 634-638.

14. Moustafa MA, Salamah MMI, Thabet HS, Tawfik RA, Mehrez MM, Hamdy DM (2017) Molecular xenomonitoring (MX) and transmission assessment survey (TAS) of lymphatic filariasis elimination in two villages, Menoufyia Governorate, Egypt. Eur J Clin Microbiol Infect Dis 36: 1143-1150.

15. Lau CL, Won KY, Lammie PJ, Graves PM (2016) Lymphatic filariasis elimination in American Samoa: evaluation of molecular xenomonitoring as a surveillance tool in the endgame. PLoS Negl Trop Dis 10: e0005108.

156 16. Seng P, Drancourt M, Gouriet F, La SB, Fournier PE, Rolain JM, Raoult D (2009) Ongoing revolution in bacteriology: routine identification of bacteria by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Clin Infect Dis 49: 543-551.

17. Chalupova J, Raus M, Sedlarova M, Sebela M (2014) Identification of fungal microorganisms by MALDI-TOF mass spectrometry. Biotechnol Adv 32: 230-241.

18. Yssouf A, Almeras L, Raoult D, Parola P (2016) Emerging tools for identification of arthropod vectors. Future Microbiol 11: 549-566.

19. Cancrini G, Frangipane di RA, Ricci I, Tessarin C, Gabrielli S, Pietrobelli M (2003) Aedes albopictus is a natural vector of Dirofilaria immitis in Italy. Vet Parasitol 118: 195-202.

20. Cancrini G, Scaramozzino P, Gabrielli S, Di PM, Toma L, Romi R (2007) Aedes albopictus and Culex pipiens implicated as natural vectors of Dirofilaria repens in central Italy. J Med Entomol 44: 1064-1066.

21. European Medicines Agencys (2013).

22. Reithinger R, Ceballos L, Stariolo R, Davies CR, Gurtler RE (2005) Chagas disease control: deltamethrin-treated collars reduce Triatoma infestans feeding success on dogs. Trans R Soc Trop Med Hyg 99: 502-508.

157

ANNEXES

159

Au cours de mes trois années de doctorat, j’ai participé à des études concernant aussi les maladies vectorielles, mais différentes de celles relevant directement de l’objet de mon travail de thèse. Concernant l’Article N° 7, il s’agit d’une étude séro-épidémiologique relative à une phlébovirose (l’infection à Toscana virus) chez le chien en Kabylie, Algérie. Cette phlébovirose est largement répandue dans le Bassin méditerranéen. Dans un autre travail (Article N° 8), nous avons détecté de potentielles bactéries pathogènes Rickettsia spp. portées par des tiques molles collectées sur des chauves-souris, en Guyane. Dans l’Article N° 9, nous avons participé à la détection de bactéries Anaplasmataceae chez des animaux domestiques ainsi que dans les tiques collectées en Corse. En fin, dans l’Article N° 10, nous avons mené une étude sérologique et moléculaire sur la trypanosomose à Trypanosoma cruzi dans une population de chiens en Guyane.

161

Tahir D, Alwassouf ARTICLES, Loudahi7 A, Davoust B and Charrel RN. Seroprevalence of Toscana virus in dogs from Kabylia (Algeria). Clin. Microbiol. Infect. 2016, 22/e16-e17.

163

LETTER TO THE EDITOR VIROLOGY

Seroprevalence of Toscana virus in dogs 96-well microtitre plates using Vero cells. Brieﬂy, twofold from Kabylia (Algeria) serial dilutions from 1:10 to 1:80 of 50 μLofserumwere mixed with an equal volume of virus culture titred at 1000

TCID50 (tissue culture 50% infective dose) into 96-well plates, providing twofold final dilutions from 1:20 to 1:160. D. Tahir1,3, S. Alwassouf2,3, A. Loudahi1,3, B. Davoust1,3 and Out of a total of 93 dogs, four were seropositive (4.3%) and R. N. Charrel2,3 were from three localities: Ouaguenoun, Azazga and Tifra 1) Research Unit of Emerging Infectious and Tropical Diseases (URMITE) (Table 1). UMR CNRS 7278 IRD 198 INSERM U1095 Aix-Marseille Neutralization is the most discriminative serologic assay University, 2) UMR 190 ‘Emergence des Pathologies Virales’, IRD, INSERM- that is well adapted to differentiate the affinity of antibodies EHESP, Aix-Marseille University, Marseille and 3) IHU Méditerranée against different viruses as a result of the lack of cross re- Infection, APHM Public Hospitals of Marseille, France actions. Two TOSV neutralization-based seroprevalence studies in dogs showed comparable results to Tunisia and Original Submission: 12 October 2015; Accepted: higher results than in Turkey. In Kairouan, Tunisia, 5.6% (11/ 29 October 2015 147) of dogs were infected in an area where sandflies are Editor: D. Raoult present at high density and where leishmaniasis is endemic [2]. Article published online: 10 November 2015 In contrast, in Bizerte, where leishmaniasis cases are un- common, none of the 118 tested dogs was TOSV positive [2]. Corresponding author: D. Tahir, Research Unit of Emerging In southern Anatolia, Turkey, 40.4% (21/52) of dogs were Infectious and Tropical Diseases (URMITE) UMR CNRS 7278 IRD TOSV MN seropositive and 15.5% (24/155) were TOSV 198 INSERM U1095 Aix-Marseille University, Marseille, France viremic; of the latter, two dogs were coinfected with Leish- E-mail: [email protected] mania infantum [6]. Moreover, in Granada (Spain), 48.3% (138/ 286) of dogs were positive for TOSV using the indirect fl Toscana virus (TOSV) is an arbovirus belonging to Bunyaviridae, uorescent antibody test [7]. The latter should be considered fl a family of negative-stranded, enveloped RNA viruses. The vi- with caution because it is well known that the indirect uo- rus can be transmitted to humans by the bite of an infected rescent antibody test is prone to cross-reactivity with phle- sandfly of the genus Phlebotomus. The infection is usually boviruses other that TOSV within the Sandfly fever Naples asymptomatic, but it can cause aseptic meningitis and menin- virus species, such as Granada virus, Massilia virus, Naples goencephalitis between May and October in northern Medi- virus or Tehran virus. terranean countries (Italy, Croatia, France, Greece, Portugal, So far it is not known if the dog is an important reservoir of Spain) as well as several of the eastern Mediterranean countries TOSV, but several studies, including our own, show that it is a fl (Cyprus, Turkey) [1]. Recently TOSV circulation has been re- good sentinel of exposure to TOSV transmission by sand ies in ported in North Africa (Morocco, Tunisia) [2]. In Kabylia, the Mediterranean region. Accordingly, geographic areas where Algeria, one strain of TOSV was isolated from sandflies. In this dogs possess TOSV-neutralizing antibodies are good candidates area, the human seroprevalence was 50%—a rate much higher to implement TOSV direct and indirect diagnosis in patients than that observed in Southern Europe [3]. In Kabylia, dogs are presenting with febrile illness and central nervous system in- exposed to the bites of sandflies, as evidenced by the impor- fections such as meningitis and encephalitis. tance of the incidence of canine leishmaniasis [4]. The aim of our study was to evaluate the TOSV seroprevalence in dogs of TABLE 1. Localization of Toscana virus–seropositive dogs in Kabylia. Kabylia (Algeria) In January and February 2014, we collected sera from 93 watchdogs living in 11 localities in the wilaya of Tizi Ouzou Age of Wilaya Locality Site dog (years) Titre (Makouda, Boudjima, Tigzirt, Iflissen,Timizart, Ouaguenoun, Tizi Ouaguenoun 36° 460 1200 N, 4° 100 2900 E 2 1:80 Azazga, Aghrib, Fréha) and in the wilaya of Béjaïa (Tifra, Ouzou 2 1:20 Azazga 36° 440 4300 N, 4° 220 1600 4 1:20 Kherata). The virus microneutralization-based (MN) sero- 0 00 0 00 Béjaïa Tifra 36° 39 59 N, 4° 22 16 E 1.5 1:40 prevalence study assay we used was adapted from a previously described protocol [5]. The MN assay was performed in

Clin Microbiol Infect 2016; 22: e16–e17 Clinical Microbiology and Infection © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved http://dx.doi.org/10.1016/j.cmi.2015.10.029 165 CMI Letter to the Editor e17

Transparency Declaration [3] Alkan C, Allal-Ikhlef AB, Alwassouf S, Baklouti A, Piorkowski G, de Lamballerie X, et al. Virus isolation, genetic characterization, and seroprevalence of Toscana virus in Algeria. Clin Microbiol Infect 2015;21:1040.e1–9. All authors report no conflicts of interest relevant to this [4] Berdjane-Brouk Z, Charrel RN, Hamrioui B, Izri A. First detection of article. Leishmania infantum DNA in Phlebotomus longicuspis Nitzulescu, 1930 from visceral leishmaniasis endemic focus in Algeria. Parasitol Res 2012;111:419–22. References [5] Alkan C, Alwassouf S, Piorkowski G, Bichaud L, Tezcan S, Dincer E, et al. Isolation, genetic characterization and seroprevalence of Adana virus, a novel phlebovirus belonging to the Salehabad virus complex in Turkey. J Virol 2015;89:4080–91. [1] Charrel RN, Bichaud L, de Lamballerie X. Emergence of Toscana virus [6] Dincer E, Gargari S, Ozkul A, Ergunay K. Potential animal reservoirs of in the Mediterranean area. World J Virol 2012;1:135–41. Toscana virus and coinfections with Leishmania infantum in Turkey. Am J [2] Sakhria S, Alwassouf S, Fares W, Bichaud L, Dachraoui K, Alkan C, et al. Trop Med Hyg 2015;92:690–7. Presence of sandfly-borne phleboviruses of two antigenic complexes [7] Navarro-Marí JM, Palop-Borrás B, Pérez-Ruiz M, Sanbonmatsu- (Sandfly fever Naples virus and Sandfly fever Sicilian virus) in two different Gámez S. Serosurvey study of Toscana virus in domestic animals, bio-geographical regions of Tunisia demonstrated by a Granada, Spain. Vector Borne Zoonotic Dis 2011;11:583–7. microneutralisation-based seroprevalence study in dogs. Parasit Vectors 2014;7:476.

166 8

Tahir D, SocolovschiARTICLE C, Marié JL, Ganay G, Berenger JM, Bompar JM, Blanchet D, Cheuret M, Mediannikov O, Davoust B and Parola P. New Rickettsia species in soft ticks collected from bats in French Guiana. Ticks Tick Borne Dis. 2016, 7(6):1089-1096.

167

Ticks and Tick-borne Diseases 7 (2016) 1089–1096

Contents lists available at ScienceDirect

Ticks and Tick-borne Diseases

journal homepage: www.elsevier.com/locate/ttbdis

Original article New Rickettsia species in soft ticks Ornithodoros hasei collected from bats in French Guiana

Djamel Tahir a, Cristina Socolovschi a,e, Jean-Lou Marié a,b, Gautier Ganay a, Jean-Michel Berenger a, Jean-Michel Bompar c, Denis Blanchet d, Marie Cheuret d, Oleg Mediannikov a, Didier Raoult a, Bernard Davoust a,b,∗, Philippe Parola a a Research Unit of Emerging Infectious and Tropical Diseases (URMITE) UMR CNRS 7278 IRD 198 INSERM U1095, Aix-Marseille University, Marseille, France b Animal Epidemiology Working Group of the Military Health Service, Toulon, France c Chiroptérologue, Solliès-Pont, France d Laboratoire Hospitalier Universitaire de Parasitologie et Mycologie, Centre Hospitalier A. Rosemon, Cayenne, France e Service de pneumologie, Hôpital Saint Joseph, Marseille, France article info a b s t r a c t

Article history: In French Guiana, located on the northeastern coast of South America, bats of different species are very Received 7 June 2016 numerous. The infection of bats and their ticks with zoonotic bacteria, especially Rickettsia species, is Received in revised form 31 August 2016 so far unknown. In order to improve knowledge of these zoonotic pathogens in this French overseas Accepted 10 September 2016 department, the presence and diversity of tick-borne bacteria was investigated with molecular tools in Available online 11 September 2016 bat ticks. In the beginning of 2013, 32 bats were caught in Saint-Jean-du-Maroni, an area close to the coast of Keywords: French Guiana, and the ticks of these animals were collected. A total of 354 larvae of Argasidae soft ticks Rickettsia spp. Bat (Ornithodoros hasei) from 12 bats (Noctilio albiventris) were collected and 107 of them were analysed. French Guiana DNA was extracted from the samples and quantitative real-time PCR was carried out to detect Rickettsia Tick spp., Bartonella spp., Borrelia spp. and Coxiella burnetii. All tested samples were negative for Bartonella Ornithodoros hasei spp., Borrelia spp. and Coxiella burnetii. Rickettsia DNA was detected in 31 (28.9%) ticks. An almost entire Candidatus Rickettsia wissemanii (1118 base pairs long) sequence of the gltA gene was obtained after the ampliﬁcation of some positive samples on conventional PCR and sequencing. A Bayesian tree was constructed using concatenated rrs, gltA, ompA, ompB, and gene D sequences. The study of characteristic sequences shows that this Rickettsia species is very close (98.3–99.8%) genetically to R. peacockii. Nevertheless, the comparative analysis of sequences obtained from gltA, ompA, ompB, rrs and gene D fragments demonstrated that this Rickettsia is different from the other members of the spotted fever group. The sequences of this new species were deposited in GenBank as Candidatus Rickettsia wissemanii. This is the ﬁrst report showing the presence of nucleic acid of Rickettsia in Ornithodoros hasei ticks from South American bats. © 2016 Elsevier GmbH. All rights reserved.

1. Introduction Haemaphysalis, Hyalomma and Ixodes) which are recognized as competent vectors (Parola and Raoult, 2001). Concerning soft ticks Rickettsiae are obligate intracellular gram-negative bacteria (Argasidae), R. bellii is found in both Argas and Ornithodoros genera, transmitted by blood-feeding arthropods, primarily ticks, which and it is the most common Rickettsia found in ticks in United States may act as vectors, reservoirs, and/or ampliﬁers in the life cycles of of America (Raoult and Roux, 1997; Ogata et al., 2006). Recently the bacteria (Raoult and Roux, 1997). Ixodid ticks, also called hard described, the spotted fever group Rickettsia hoogstraalii is regu- ticks, are the main vectors of Rickettsiae (Parola et al., 2013). There larly identiﬁed in Ornithodoros spp. and Haemaphysalis spp. ticks are at least six genera (Rhipicephalus, Dermacentor, Amblyomma, (Duh et al., 2010; Dietrich et al., 2014). In humans, rickettsiae are the causative agents of the tick-borne rickettsioses, characterized by clinical features including fever, headache, rash, and occasional ∗ eschar formation at the site of the tick bite (Parola et al., 2013). Corresponding author at: Research Unit of Emerging Infectious and Tropical Diseases (URMITE), Faculté de medicine, 27 Bd Jean Moulin, 13385 Marseille cedex French Guiana is an overseas territory situated between Brazil 2 05, France. and Suriname, and its size (84,000 km ) is equivalent to about one E-mail address: [email protected] (B. Davoust). http://dx.doi.org/10.1016/j.ttbdis.2016.09.004 1877-959X/© 2016 Elsevier GmbH. All rights reserved.

169 1090 D. Tahir et al. / Ticks and Tick-borne Diseases 7 (2016) 1089–1096

fifth of the territory of mainland France; it is a sparsely popu- further analysis. Simultaneously, DNA was extracted according to lated department. Its climate is equatorial (hot and humid) and the same protocol from our laboratory colonies of uninfected ticks, the Amazon rainforest covers 90% of its territory. Its ecosystem to be used as a negative control. is characterized by a rich fauna and flora (5500 species of plants, 700 species of birds, and 177 species of mammals) and a dense 2.4. Real time PCR detection of bacteria in ticks river network. To our knowledge, in French Guiana only one Rick- ettsia, Candidatus R. amblyommii, has been detected in Amblyomma All DNA samples were individually screened for the presence of coelebs ticks (Parola et al., 2007). This rickettsia, with unknown Rickettsia spp. by quantitative real-time PCR for the entire spotted pathogenic potential, is very common in North and Central America fever group according to the Rickettsiae-specific gltA gene-based (Parola et al., 2013). RKND03 system previously described (Socolovschi et al., 2010). In French Guiana, bats of different species are very numerous. It Positive results were confirmed by another real-time PCR based is estimated that there are approximately 110 species. The infection on the RC0338 membrane phosphatase gene (Socolovschi et al., of bats and their ticks with bacterial pathogens such as Rickettsia 2010). In addition, all DNA samples were tested by qPCR for other spp., Bartonella spp., Borrelia spp. and Coxiella burnetii is so far tick-borne bacteria such as Bartonella spp. by targeting an inter- unknown. In order to improve the knowledge of these zoonotic nally transcribed spacer (Angelakis et al., 2010); Coxiella burnetii pathogens in this country, the presence and diversity of these tick- using IS30A spacers (Mediannikov et al., 2010), and Borrelia spp. by transmitted pathogens were investigated with molecular tools in targeting a fragment of the 16S rRNA gene (Parola et al., 2011). bat ticks. Briefly, the real-time PCR experiment was performed in a total reaction volume of 20 ␮L, containing 10 ␮L master mix Takyon® 2. Materials and methods (Eurogentec France, Angers, France), 3.5 ␮L distilled water, 0.5 ␮L (20 ␮M) of each primer, 0.5 ␮L probe (5 ␮M), and 5 ␮L DNA tem- 2.1. Study site and bat samples plate. All amplifications in real-time PCR were performed on the thermal cycler CFX96 Touch detection system (Bio-Rad, Marnes- In January 2013, 32 bats (Chiroptera) were caught in Saint- la-Coquette, France). For each reaction, DNA-free water and DNA ◦ ′ ′′ ◦ ′ ′′ Jean-du-Maroni (05 23 95 N–54 04 72 W), an area close to the from uninfected ticks were used as negative controls; Rickettsia coast of French Guiana, and the ticks (N = 354) of these ani- montanensis, Bartonella elizabethae, Coxiella burnetii, and Borrelia mals were collected. Bats were caught with mist nets. Catches burgdorferi DNAs were used as positive controls. The samples were occurred in unoccupied buildings. The identification of bats was considered positive when the threshold cycles (Ct) were inferior to performed using previously described conventional morphological 35. keys (Brosset and Charles-Dominique, 1990).

2.5. Sequencing and phylogenetic analysis 2.2. Collection and identiﬁcation of ticks

Positive results were confirmed by standard PCR using the fol- A total of 32 apparently healthy bats were captured; species lowing gene primers: gltA (Roux et al., 1997), rOmpA (Fournier and sex were identified. The entire body of each bat was thor- et al., 1998), rOmpB (Roux and Raoult, 2000), sca4 (“gene D”) oughly examined for ticks by visual inspection. All visible ticks (Sekeyova et al., 2001) and 16S rRNA (Roux and Raoult, 1995), were removed from the body using tweezers. Ticks of each bat which amplify sequences of 1177 bp, 611 bp, 4346 bp, 3026 bp and were then transferred to 5 mL vials containing 70% ethanol. All ticks 1466 bp, respectively. Subsequently, all PCR products obtained after were sent to our laboratory at the Reference Center for Rickettsial the DNA amplification were purified using the PCR filter plate Diseases and Other Arthropod-Borne Bacterial Diseases (Marseille, Millipore NucleoFast 96 PCR kit following the manufacturer’s rec- France). Tick larvae were identified at the genus level using previ- ommendations (Macherey-Nagel, Düren, Germany). The sequence ously described morphological identification keys (Barros-Battesti reactions were carried out using the BigDye® terminator v3.3 cycle et al., 2013). Molecular identification of 16 randomly selected ticks sequencing kit DNA according to the manufacturer’s instructions was carried out using standard PCR assays by targeting the 16S (Applied Biosystems, Foster City, USA). The sequence reaction pro- and 12S rRNA mitochondrial genes, which amplify a fragment of gram contains the following steps: initial denaturation at 96 ◦C for 460 bp and 420 bp respectively (Norris et al., 1996). Subsequently, one min, followed by 25 cycles of denaturation at 96 ◦C for10 s, PCR products were subjected to sequencing as described in a previ- annealing at 50 ◦C for 5 s and extension at 60 ◦C for 3 min. Sequenc- ous study (Norris et al., 1996). Finally, the sequences obtained were ing was performed with an ABI Prism 3130xl Genetic Analyzer compared with those available in GenBank for species identifica- capillary sequencer (Applied Biosystems®). Finally, all obtained tion. sequences were assembled and corrected on ChromasPro 1.7 software (Technelysium Pty Ltd., Tewantin, Australia) and then were 2.3. DNA extraction from ticks compared to sequences available in GenBank using the Basic Local Alignment Search Tool (BLAST) (www.ncbi.nlm.nih.gov/blast/Blast. Prior to DNA extraction, all ticks were examined individually by cgi). Phylogenetic trees were constructed using the neighbor- optical microscope observation (ZEISS Axio Observer, Germany). joining method tree algorithm in the MEGA6 program (http:// Specimen images were taken for each tick for possible subsequent megasoftware.net/) based on the protein-coding genes gltA, ompA, morphological identification. Then each tick was rinsed in sterile ompB, gene D and on the 16S rRNA-coding gene rrs sequences. Sup- water for 10 min, then dried on sterile filter paper. Each tick was port for the tree nodes was calculated with 100 bootstrap replicates. cut longitudinally into two parts using a scalpel. One-half of each tick was crushed in a buffered solution (G2) with proteinase K (Qia- gen Hilden, Germany) and incubated at 56 ◦C overnight. The total 2.6. Accession numbers genomic DNA was extracted in 50 ␮L of Tris EDTA (TE) buffer using the EZ1 DNA Tissue kit (Qiagen, Hilden, Germany) according to the The rrs, gltA, ompA, ompB, and gene D sequences determined manufacturer’s instructions. The DNA was stored at −20 ◦C under in this study were submitted to the Genbank database under sterile conditions to preclude contamination until the sample was the following accession numbers: LT558851, LT558852, LT558853, used for PCR. The remaining half of each tick was kept at −20 ◦C for LT558854 and LT558855, respectively.

170 D. Tahir et al. / Ticks and Tick-borne Diseases 7 (2016) 1089–1096 1091

Fig. 1. Bat (Noctilio albiventris) and ticks (Ornithodoros hasei).

Table 1 Results of PCR screening for Rickettsia (RKND03) in ticks (Ornithodoros hasei) of bats (Noctilio albiventris) from Saint-Jean-du-Maroni (French Guiana).

Bat identiﬁer Sex Number of tick larvae collected Number of tick larvae analysed qPCR Rickettsia spp. RKND03

POS NEG

49 M 10 10 0 10 52 F 8 8 0 8 53 M 57 10 7 3 56 M 39 10 8 2 58 F 4 4 1 3 60 F 5 5 0 5 61 M 42 10 2 8 64 M 43 10 3 7 66 M 42 10 1 9 68 M 23 10 1 9 69 M 67 10 4 6 80 F 14 10 4 6 Total 12 (8 M/4 F) 354 107 31 76

2.7. Ethical statement these, 16 ticks were randomly selected and identiﬁed with molecular tools as Ornithodoros hasei. The 16S rRNA sequences obtained All captures and sample collections of bat specimens were were identical to each other and showed 99.76% and 98.78% iden- directed by a mammalian specialist approved by the French tity with Ornithodoros hasei from Brazilian Pantanal (KT894588) authorities. The protocol (No. 1688) was approved by the Ethics and Argentina (DQ295779), respectively. In addition, all sequences Committee for Animal Experimentation of Aix-Marseille Univer- obtained from the 12S rRNA gene showed 82.84%, 81.41% and sity (C2EA-14). Collection of ticks from animals was not harmful 80.78% identity with Carios capensis from Japan (AB075953), Car- and not contrary to the welfare of the animals. ios fonsecai from Australia (KC769597) and Ornithodoros tholozani from Israel (KC431875), respectively. It should be noted that for 3. Results Ornithodoros hasei, no sequence of 12S rRNA gene was available on GenBank, which explains these low (<83%) sequence identities. 3.1. Tick identiﬁcation 3.2. Detection of tick-borne bacteria In the location of Saint Jean du Maroni, a total of 32 bats belonging to Noctilio albiventris (Fig. 1) were captured and examined; 12 We tested 107 tick larvae by qPCR for the presence of Bar- (37.5%) of them (8 males and 4 females) were found to be infested tonella spp., Borrelia spp. and C. burnetii. Results were negative with soft tick larvae. The bats’ infestation varied between 4 and 67 for these bacteria. In the evaluation of Rickettsia spp., using qPCR ticks per specimen, with an average infestation of 29.5 ± 21. Dur- (RKND03), we detected Rickettsia DNA in 28.9% (31/107) of the ing this study, a total of 354 tick larvae were collected (Table 1). Of ticks (Table 1). Among the 12 infested bats, eight (66.66%) of them

171 1092 D. Tahir et al. / Ticks and Tick-borne Diseases 7 (2016) 1089–1096

43 R. africae [U43790] Rickettsia sp. str. S [U43805] 58 R. parkeri str. Maculatum 20 [U43802] R. sibirica str. 246 [U43807] 25 42 R. sibirica mongolotimonae str. HA-91 [U43796] R. conorii caspiensis [U43791] R. conorii israelensis [U43797] 35 65 57 R. conorii str. Seven [U43806] 94 R. conorii indica [U43794] R. honei [U43809] 61 28 R. slovaca [U43808] R. peacockii str. Skalkaho [AH013412]

97 R. rickettsii [U43804]

49 R. philipii [CP003308] Candidatus Rickettsia wissemanii 1329462 59 42 Candidatus Rickettsia wissemanii 1329467 Candidatus Rickettsia wissemanii 1329521

100 Candidatus Rickettsia wissemanii 1329526 Candidatus Rickettsia wissemanii 1329529 Candidatus Rickettsia wissemanii 1329597 R. japonica [U83442] 99 R. heilongjiangensis [AF179362]

59 R. australis [AF149108] R. montanensis [U43801]

61 R. aeschlimannii [U43800]

98 R. massiliae [U43799] 88 R. rhipicephali [U43803]

0.01

Fig. 2. Phylogenetic tree drawn using the neighbor-joining method from an alignment of the 611 bp ompA gene of Candidatus Rickettsia wissemanii. Bootstrap values are indicated at the nodes. Scale bar indicates the degree of divergence represented by a given length of branch. Boldface indicates the taxonomic position of a new Rickettsia.

(male and female) were carrying ticks infected with Rickettsia spp. (2974/3028; GenBank accession No. CP003308) and R. slovaca Subsequent sequencing of gltA gene amplicons from two positive (2986/3043; GenBank accession No. CP003375) respectively. PCR samples (sample Nos. 1329524 and 1329471) showed that the Phylogenetic trees were built using the neighbor-joining closest sequences available in GenBank were those for R. peacockii method from an alignment of the 611 bp ompA (Fig. 2), 4346 bp (accession No. CP001227), R. sibirica (accession No. KM288711), ompB (Fig. 3), 3026 bp gene D(Fig. 4), 1466 bp 16s RNA (Fig. 5) and and R. slovaca (accession No. CP003375), which showed 1170 of 1777 bp gltA (Fig. 6) of this novel Rickettsia. Candidatus Rickettsia 1173 (99.74% identity), 1169 of 1173 (99.65% identity) and 1168 wissemanii was proposed to name this microorganism. We would of 1173 (99.57% identity) base positions in common respectively. like to honor Charles Wisseman of the University of Maryland (Bal- In addition, the comparative analysis of sequences obtained from timore, USA), who worked in the ﬁeld of rickettsial diseases from the 16S rrs gene was 99.59% identical with R. philipii (accession 1954 to 1985. No. NR 074470), 99.58% identical with R. rickettsii (accession No. CP 003311) and 99.52% identical with R. peacockii (accession No. NR 074488). The closest sequences available in GenBank for the 4. Discussion ompA gene fragments were those for R. slovaca (accession No. CP003375), R. philipii (accession No. CP003308), and R. rickettsii In French Guiana, bats are very numerous, with a great diversity (accession No. CP006010), which showed 96.65% (607/628 bp), of species. The order Chiroptera comprises more than 100 species. 96.65% (607/628 bp), and 96.17% (604/628 bp) sequence identity, Bats represent 54% of the total number of wild animal species respectively. The sequences of the ompB were 98.28%, 97.84%, (Charles-Dominique et al., 2001). The lesser bulldog bat (Noctilio 97.70% and 67.66% similar to R. peacockii (4286/4361; GenBank albiventris) is an insectivorous and occasionally carnivorous bat of accession No. CP001227), R. slovaca (4264/4358; GenBank acces- the Neotropic ecozone. Its distribution range extends from south- sion No. CP003375), R. rickettsii (4258/4358; GenBank accession ern Mexico to eastern Brazil, then south into northern Argentina No. CP003311) and R. philipii (4257/4358; GenBank accession No. and Peru (Wilson and Reeder, 1993). 003308), respectively. Finally, the gene D sequences obtained Bats can be infested by a wide range of arthropod ectopara- showed 98.48%, 98.34%, 98.21% and 98.12% identity with R. sites belonging to the Acari (ticks and mites), Dermaptera, Diptera, peacockii (2982/3028; GenBank accession No. CP001227), R. rick- Hemiptera, and Siphonaptera orders (Bertola et al., 2005). Ticks ettsii (2978/3028; GenBank accession No. CP003311), R. philipii identiﬁed on bats belonged to the families Argasidae (Ornithodoros

172 D. Tahir et al. / Ticks and Tick-borne Diseases 7 (2016) 1089–1096 1093

100 R. sibirica str. 246 [AF123722] 100 R. sibirica mongolotimonae str. BJ90 [AY331393] 43 R. sibirica mongolotimonae str. Marseille 1 [AF123715]

99 R. africae [AF123706] 49 R. parkeri [AF123717]

99 Rickettsia sp. str. S [AF123720] 100 R. conorii caspiensis str. A-167 [AF123708] R. conorii israelensis [AF123712]

90 96 R. conorii indica [AF123726]

100 R. conorii str. Seven [AF123721] 100 100 R. conorii str. Malish 7 [AE006914] R. slovaca [CP003375] R. honei [AF123724] R. peacockii str. Rustic [CP001227] 88 100 Candidatus Rickettsia wissemanii 1379526 99 42 R. rickettsii [X16353] 100 R. philipii [CP003308]

100 R. japonica [AF123713]

100 R. heilongjiangensis str. 054 [CP002912] 80 R. hulinensis [AY260452] R. montanensis [AF123716] R. aeschlimannii [AF123705] 89

98 R. rhipicephali [AF123719] 100 R. massiliae str. Bar29 [AF123710] 100 R. massiliae str. Mtu1 [AF123714] R. felis [CP000053]

100 R. akari [AF123707] 99 R. australis [AF123709] 88 R. typhi [L04661] 100 R. prowazekii [AF211820]

0.02

Fig. 3. Phylogenetic tree drawn using the neighbor-joining method from an alignment of the 4346 bp ompB gene of Candidatus Rickettsia wissemanii. Bootstrap values are indicated at the nodes. Scale bar indicates the degree of divergence represented by a given length of branch. sp., Carios sp.) and Ixodidae (Ixodes sp., Amblyomma sp.) (Franck In this area, the majority of data on infection in bats originates et al., 2013). from virological or parasitological studies (Fagrouch et al., 2012; In this study, we identified only the larval stages of O. hasei Lavergne et al., 2016). However, several bacteria were also isolated ticks in bats. These ticks were identified both morphologically and from healthy and ill bats: enteropathogenic bacteria, Bartonella molecularly, targeting two mitochondrial genes: 16S rRNA and spp., Borrelia spp., Leptospira spp., and Pasteurella spp. (Mühldorfer, 12S rRNA. Indeed, the adult and nymphal stages of some argasid 2013). species are morphologically very similar, especially within the The impact of Rickettsia spp. in bats is so far unknown. In Brazil, genus Ornithodoros, which makes their morphological identifica- a study of seroprevalence by indirect immunofluorescence assay of tion problematic (Barros-Battesti et al., 2013). rickettsial diseases was conducted on a population of 20 species of Our study is the first report showing the presence of DNA of Rick- bats caught in Sao Paulo (d’Auria et al., 2010). Overall, 8.6% (39/451), ettsia spp. in Ornithodoros hasei ticks from South American bats. O. 9.5% (34/358), 7.8% (28/358), 1.1% (4/358), and 0% (0/358) serum hasei is considered a neotropical species, and its geographical dis- samples were reactive to R. rickettsii, R. parkeri, R. amblyommii, R. tribution ranges from southern Mexico to Argentina. Kohls et al. rhipicephali, and R. bellii, respectively. Another bat-associated soft (1965) recorded O. hasei from bats (Noctilio leporinus) in North tick collected in France, Carios vespertilionis, which is absent in Manzanilla (Trinidad). Today, the distribution of this species is as South America, apparently harbor a new spotted fever group, Rick- follows: Barbuda, Brazil, Guyana, Colombia, Costa Rica, Dominica, ettsia sp. AvBat (Socolovschi et al., 2012). Ixodes ricinus, which is not Guadeloupe, Guatemala, Martinique, Mexico, Nicaragua, Panama, a bat-associated tick, but which was collected, however, from bats Peru, Uruguay, St. Croix (de la Cruz, 2001), Venezuela, Bolivia (Kohls (Rhinolophus hipposideros and Myotis myotis) in Poland, harbored et al., 1965), Argentina (Nava et al., 2007a), Paraguay (Nava et al., Rickettsia helvetica (Piksa et al., 2016). 2007b) and Jamaica (Guglielmone et al., 2003). Recently, it has been Analysis of 5 different genes (rrs, gltA, ompA, ompB, and sca4) shown that O. hasei is the most common tick species that infest showed the absence of close identity for any recognized rickettsial bats in the Brazilian Pantanal (Munoz-Leal˜ et al., 2016). In fact, is species. The presence of the ompA gene means that the novel rick- not known if O. hasei is able to bite humans. ettsia belongs to the spotted fever group of Rickettsiae (Fournier

173 1094 D. Tahir et al. / Ticks and Tick-borne Diseases 7 (2016) 1089–1096

100 R. sibirica sibirica [AF155057] 97 R. sibirica str. Bj 90 [AY331393] 56 R. sibirica mongolotimonae [AF151725]

81 R. africae [AF123706] 84 Rickettsia sp. str. S [AF123720] R. parkeri str. Maculatum 20 [AF123717] 75 99 R. conorii israelensis [AF123712] R. conorii caspiensis [AF123708]

88 80 R. conorii str. Seven [AF123721] R. conorii indica [AF123726] 100 R. conorii str. Malish7 [AE006914] 80 R. slovaca [CP003375]

100 R. rickettsii [X16353]

99 R. philipii [CP003308] 99 Candidatus Rickettsia wissemanii 1329462 54 91 R. peacockii [CP001227] R. honei [AF123724] 93 R. montanensis [AF123716] R. japonica [AF123713]

100 R. hulinensis str. HL-93 [AY260452] 100 R. heilongjiangensis str. 054 [CP002912] R. aeschlimannii [AF123705]

90 R. massiliae str. Mtu1 [AF123714] 100 R. rhipicephali [AF123719] 55 R. massiliae str. bar29 [AF123710]

0.002

Fig. 4. Phylogenetic tree drawn using the neighbor-joining method from an alignment of the 3026 bp gene D of Candidatus Rickettsia wissemanii. Bootstrap values are indicated at the nodes. Scale bar indicates the degree of divergence represented by a given length of branch. Boldface indicates the taxonomic position of a new Rickettsia.

50 R. aeschlimannii [AF123705] R. rhipicephali [AF123719] 52 R. helvetica [KU310591] R. massiliae [AF123714] 7 R. japonica [AF123713]

12 R. montanensis [AF123716]

45 R. philipii [CP003308] 44 40 R. rickettsii [X16353]

Candidatus Rickettsia wissemanii

35 1329757 33 R. peacockii str. Rustic [CP001227] R. honei [AF123724] R. slovaca [CP003375]

50 R. africae [AF123706] 37 64 R. sibirica str. 246 [AF123722] R. sibirica mongolotimonae [AF123715] 20 36 R. parkeri str. Maculatum 20 [AF123717] Rickettsia sp. str. S [AF123720]

25 84 R. conorii str. Seven [AF123721] R. conorii israelensis [AF123712] R. conorii str. Malish 7 [NR074480] 46 R. conorii indica [AF123726] 54 R. conorii str. Malish 7 [AE006914] R. conorii caspiensis [AF123708] R. bellii [U11014] R. felis str.URRWXCal2 [CP000053]

0.0005

Fig. 5. Phylogenetic tree drawn using the neighbor-joining method from an alignment of the 1466 bp 16S gene of Candidatus Rickettsia wissemanii. Bootstrap values are indicated at the nodes. Scale bar indicates the degree of divergence represented by a given length of branch. Boldface indicates the taxonomic position of a new Rickettsia.

174 D. Tahir et al. / Ticks and Tick-borne Diseases 7 (2016) 1089–1096 1095

99 R. japonica [U59724] R. heilongjiangensis [AY285776]

63 Candidatus Rickettsia wissemanii 1329524

60 Candidatus Rickettsia wissemanii 1329471 Rickettsia sp. str. DaE100R [AF201330] 54 66 R. peacockii str. Rustic [CP001227] R. philipii [CP003308] 50 87 90 R. rickettsii [U59729] R. conorii indica [U59730] 95 R. conorii str. Seven [U59730] 29 48 R. conorii israelensis [U59727] 19 R. caspiensis [U59728] R. honei [U59726]

27 24 R. africae [U59733]

52 R. sibirica str. 246 [U59734] 23 Candidatus Rickettsia sp. [JN038177] 63 R. parkeri [U59732] Rickettsia sp. str. HA-91 [U59731] 73 R. slovaca [U59725] R. aeschlimannii [U59722]

71 R. rhipicephali [U59721] 96 R. massiliae [U59719] R. raoultii [DQ365804] R. montanensis [U74756]

0.001

Fig. 6. Phylogenetic tree drawn using the neighbor-joining method from an alignment of the 1177 bp gltA gene of Candidatus Rickettsia wissemanii. Bootstrap values are indicated at the nodes. Scale bar indicates the degree of divergence represented by a given length of branch. Boldface indicates the taxonomic position of a new Rickettsia. et al., 2003). Using the gene sequence-based guidelines for the Acknowledgments identification of new Rickettsia isolates described by Fournier et al. (2003), in which the isolate should not exhibit more than one of the This study was supported by the AMIDEX project (No. ANR- following degrees of nucleotide similarity with the most homolo- 11-IDEX-0001-02) funded by the “Investissements d’Avenir,” a gous validated species: ≥99.8 and ≥99.9% for the rrs and gltA genes, French Government program managed by the French National respectively, and, when amplifiable, ≥98.8, ≥99.2, and ≥99.3% for Research Agency (ANR) and Foundation Méditerranée Infection the ompA and ompB genes and gene D, respectively, the Rickettsia (www.mediterranee-infection.com). The funders had no role in identified in this study may belong to a new species. In fact, the study design, data collection and analysis, decision to publish, or degrees of pairwise nucleotide sequences similarity obtained in this preparation of the manuscript. This work was also supported by study were: ≤98.28%, ≤99.74%, ≤99.59%, ≤96.65% and ≤98.48% for the medical service of the French armed forces. We thank Annick the ompB, gltA, rrs, ompA genes and gene D, respectively. As this Abeille and Marcello Labruna for their assistance. rickettsia is yet incompletely characterized, we propose to name it Candidatus Rickettsia wissemanii. This new species is phyloge- netically close to R. peacockii and to R. rickettsii. R. peacockii is a References non-pathogenic endosymbiont found in Dermacentor andersoni ticks (Rocky Mountain wood ticks) in the western USA and Canada Angelakis, E., Pulcini, C., Waton, J., Imbert, P., Socolovschi, C., Edouard, S., (Niebylski et al., 1997; Dergousoff et al., 2009). The loss of their vir- Dellamonica, P., Raoult, D., 2010. Scalp eschar and neck lymphadenopathy ulence is probably associated with the deleted or mutated genes in caused by Bartonella henselae after tick bite. Clin. Infect. Dis. 50, 549–551. Barros-Battesti, D.M., Ramirez, D.G., Landulfo, G.A., Faccini, J.L., Dantas-Torres, F., the genome of R. peacockii (Felsheim et al., 2009). In Brazil, human Labruna, M.B., Venzal, J.M., Onofrio, V.C., 2013. Immature argasid ticks: cases of spotted fever are attributed to R. rickettsii, but also to a diagnosis and keys for Neotropical region. Rev. Bras. Parasitol. Vet. 22, strain of R. parkeri-like rickettsia (Rickettsia spp. Atlantic rainfor- 443–456. Bertola, P.B., Aires, C.C., Favorito, S.E., Gracioll, G., Amaku, M., Pinto-da-Rocha, R., est genotype) infecting Amblyomma ovale ticks (Szabó et al., 2013). 2005. Bat flies (Diptera: Streblidae, Nycteribiidae) parasitic on bats (Mammalia: These ticks are parasites of dogs and wild rodents in the forest areas. Chiroptera) at Parque Estadual da Cantareira, São Paulo, Brazil: parasitism According to our results, bats may play a role in the natural cycle rates and host-parasite associations. Mem. Inst. Oswaldo Cruz 100, 25–32. Brosset, A., Charles-Dominique, P., 1990. The bats of French Guiana: a taxonomic, of a novel Rickettsia spp. Additional studies are required to investi- faunistic and ecological approach. Mammalia 54, 509–559. gate the role of bats and their ticks in the epidemiology of Rickettsia Charles-Dominique, P., Brosset, A., Jouard, S., 2001. Atlas des chauves-souris de spp. infections. Guyane. Muséum national d’histoire naturelle, Paris, France, pp. 172. d’Auria, S.R.N., Camargo, M.C.G.O., Pacheco, R.C., San Martin Mouriz Savani, E., Galvao Dias, M.A., da Rosa, A.R., de Almeida, M.F., Labruna, M.B., 2010. Conflict of interest statement Serologic survey for rickettsiosis in bats from Sao Paulo City, Brazil. Vector-Borne Zoonotic Dis. 10, 459–463. de la Cruz, J.O., 2001. Patterns in the biogeography of West Indian ticks. In: Woods, All the authors declare no conflicts of interest related to this C.A., Sergile, F.E. (Eds.), Biogeography of West Indies: Patterns and article. Perspectives. , second edition. CRC Press, pp. 85–106.

175 1096 D. Tahir et al. / Ticks and Tick-borne Diseases 7 (2016) 1089–1096

Dergousoff, S.J., Gajadhar, A.J.A., Chilton, N.B., 2009. Prevalence of Rickettsia species Nava, S., Lareschi, M., Rebollo, C., Benitez Usher, C., Beati, L., Robbins, R.G., Durden, in Canadian populations of Dermacentor andersoni and D. variabilis. Appl. L.A., Mangold, A.J., Guglielmone, A.A., 2007b. The ticks (Acari: Ixodida: Environ. Microbiol. 75, 1786–1789. Argasidae, Ixodidae) of Paraguay. Ann. Trop. Med. Parasitol. 101, 255–270. Dietrich, M., Lebarbenchon, C., Jaeger, A., Le, R.C., Bastien, M., Lagadec, E., McCoy, Niebylski, M.L., Schrumpf, M.E., Burgdorfer, W., Fischer, E.R., Gage, K.L., Schwan, K.D., Pascalis, H., Le, C.M., Dellagi, K., Tortosa, P., 2014. Rickettsia spp. in seabird T.G., 1997. Rickettsia peacockii sp. nov. a new species infecting wood ticks, ticks from western Indian Ocean islands, 2011–2012. Emerg. Infect. Dis. 20, Dermacentor andersoni, in western Montana. Int. J. Syst. Bacteriol. 47, 446–452. 838–842. Norris, D.E., Klompen, J.S., Keirans, J.E., Black, W.C., 1996. Population genetics of Duh, D., Punda-Polic, V., Avsic-Zupanc, T., Bouyer, D., Walker, D.H., Popov, V.L., Ixodes scapularis (Acari: Ixodidae) based on mitochondrial 16S and 12S genes. J. Jelovsek, M., Gracner, M., Trilar, T., Bradaric, N., Kurtti, T.J., Strus, J., 2010. Med. Entomol. 33, 78–89. Rickettsia hoogstraalii sp. nov., isolated from hard- and soft-bodied ticks. Int. J. Ogata, H., La Scola, B., Audic, S., Renesto, P., Blanc, G., Robert, C., Fournier, P.E., Syst. Evol. Microbiol. 60, 977–984. Claverie, J.M., Raoult, D., 2006. Genome sequence of Rickettsia bellii illuminates Fagrouch, Z., Sarwari, R., Lavergne, A., Delaval, M., de Thoisy, B., Lacoste, V., the role of amoebae in gene exchanges between intracellular pathogens. PLoS Verschoor, E.J., 2012. Novel polyomaviruses in South American bats and their Genet. 2, e76. relationship to other members of the family Polyomaviridae. J. Gen. Virol. 93, Parola, P., Raoult, D., 2001. Ticks and tickborne bacterial diseases in humans: an 2652–2657. emerging infectious threat. Clin. Infect. Dis. 32, 897–928. Felsheim, R.F., Kurtti, T.J., Munderloh, U.G., 2009. Genome sequence of the Parola, P., Matsumoto, K., Socolovschi, C., Parzy, D., Raoult, D., 2007. A tick-borne endosymbiont Rickettsia peacockii and comparison with virulent Rickettsia rickettsia of the spotted-fever group, similar to Rickettsia amblyommii, in rickettsii: identification of virulence factors. PLoS One 4, pe8361. French Guyana. Ann. Trop. Med. Parasitol. 101, 185–188. Fournier, P.E., Roux, V., Raoult, D., 1998. Phylogenetic analysis of spotted fever Parola, P., Diatta, G., Socolovschi, C., Mediannikov, O., Tall, A., Bassene, H., Trape, group rickettsiae by study of the outer surface protein rOmpA. Int. J. Syst. J.F., Raoult, D., 2011. Tick-borne relapsing fever borreliosis in rural Senegal. Bacteriol. 48, 839–849. Emerg. Infect. Dis. 17, 883–885. Fournier, P.E., Dumler, J.S., Greub, G., Zhang, J., Wu, Y., Raoult, D., 2003. Gene Parola, P., Paddock, C.D., Socolovschi, C., Labruna, M.B., Mediannikov, O., Kernif, T., sequence-based criteria for identification of new rickettsia isolates and Yazid Abdad, M., Stenos, J., Bitam, I., Fournier, P.E., Raoult, D., 2013. Update on description of Rickettsia heilongjiangensis sp. nov. J. Clin. Microbiol. 41, tick-borne rickettsioses around the world: a geographic approach. Clin. 5456–5465. Microbiol. Rev. 26, 657–702. Franck, F., Münster, J., Schulze, J., Liston, A., Klimpel, S., 2013. Macroparasites of Piksa, K., Stanczak, J., Biernat, B., Gorz, A., Nowak-Chmura, M., Siuda, K., 2016. Microchiroptera: bat ectoparasites of Central and South America. In: Klimpel, Detection of Borrelia burgadorferi sensu lato and spotted fever group S., Mehlhorn, H. (Eds.), Bats (Chiroptera) as Vectors of Diseases and Parasites. Rickettsiae in hard ticks (Acari, Ixodidae) parasitizing bats in Poland. Parasitol. Facts and Myths, pp. 87–130. Res. 115, 1727–1731. Guglielmone, A.A., Estrada-Pena, A., Keirans, J.E., Robbins, R.G., 2003. Ticks (Acari. Raoult, D., Roux, V., 1997. Rickettsioses as paradigms of new or emerging Ixodida) of the Neotropical Zoogeographic Region—Special Publication of the infectious diseases. Clin. Microbiol. Rev. 10, 694–719. International Consortium on Ticks and Tick-borne Diseases, Atlanta, Houten, Roux, V., Raoult, D., 1995. Phylogenetic analysis of the genus Rickettsia by 16S The Netherlands, p. 174 (ISBN987-43-6828-4). rDNA sequencing. Res. Microbiol. 146, 385–396. Kohls, G.M., Sonenshine, D.E., Clifford, C.M., 1965. The systemics of the subfamily Roux, V., Raoult, D., 2000. Phylogenetic analysis of members of the genus Rickettsia Ornithodorinae (Acarina: Argasidae). II. Identification of the larvae of the using the gene encoding the outer-membrane protein rOmpB (ompB). Int. J. Western Hemisphere and descriptions of three new species. Ann. Entomol. Syst. Evol. Microbiol. 50 (Pt. 4), 1449–1455. Soc. Am. 58, 331–364. Sekeyova, Z., Roux, V., Raoult, D., 2001. Phylogeny of Rickettsia spp. inferred by Lavergne, A., Darcissac, E., Bourhy, H., Tirera, S., de Thoisy, B., Lacoste, V., 2016. comparing sequences of ‘gene D’, which encodes an intracytoplasmic protein. Complete genome sequence of a vampire bat rabies virus from French Guiana. Int. J. Syst. Evol. Microbiol. 51, 1353–1360. Genome Announc. 4 (pii: e00188-16). Socolovschi, C., Mediannikov, O., Sokhna, C., Tall, A., Diatta, G., Bassene, H., Trape, Mühldorfer, K., 2013. Bats and bacterial pathogens: a review. Zoonoses Public J.F., Raoult, D., 2010. Rickettsia felis-associated uneruptive fever, Senegal. Health 60, 93–103. Emerg. Infect. Dis. 16, 1140–1142. Mediannikov, O., Fenollar, F., Socolovschi, C., Diatta, G., Sokhna, C., Bassene, H., Socolovschi, C., Kernif, T., Raoult, D., Parola, P., 2012. Borrelia, Rickettsia, and Molez, J.F., Trape, J.F., Raoult, D., 2010. Coxiella burnetii in humans and ticks in Ehrlichia species in bat ticks, France, 2010. Emerg. Infect. Dis. 18, 1966–1975. rural Senegal. PLoS Negl. Trop. Dis. 4, pe654. Szabó, M.P.J., Pinter, A., Labruna, M.B., 2013. Ecology, biology and distribution of Munoz-Leal,˜ S., Eriksson, A., Santos, C.F., Fischer, E., de Almeida, J.C., Luz, H.R., spotted-fever tick vectors in Brazil. Front. Cell. Infect. Microbiol. 3, 27. Labruna, M.B., 2016. Ticks infesting bats (Mammalia: Chiroptera) in the Wilson, D., Reeder, D., 1993. Mammal Species of the World, second edition. Brazilian Pantanal. Exp. Appl. Acarol. 69, 73–85. Smithsonian Institution Press, Washington, D.C. Nava, S., Venzal, J.M., Diaz, M.M., Mangold, A.J., Guglielmone, A.A., 2007a. The Ornithodoros hasei (Schulze, 1935) (Acari: Argasidae) species group in Argentina. Syst. Appl. Acarol. 12, 27–30.

176

Dahmani M, DavoustARTICLE B, Tahir9 D, Fenollar F and Mediannikov O. Molecular investigation and phylogeny of Anaplasmataceae species infecting domestic animals and ticks in Corsica, France. Parasit. Vectors. 2017, 10(1):302.

177

Dahmani et al. Parasites & Vectors (2017) 10:302 DOI 10.1186/s13071-017-2233-2

RESEARCH Open Access Molecular investigation and phylogeny of Anaplasmataceae species infecting domestic animals and ticks in Corsica, France Mustapha Dahmani, Bernard Davoust, Djamel Tahir, Didier Raoult, Florence Fenollar and Oleg Mediannikov*

Abstract Backgrounds: Corsica is a French island situated in the Mediterranean Sea. The island provides suitable natural conditions to study disease ecology, especially tick-borne diseases and emerging diseases in animals and ticks. The family Anaplasmataceae is a member of the order Rickettsiales; it includes the genera Anaplasma, Ehrlichia, Neorickettsia and Wolbachia. Anaplasmosis and ehrlichiosis traditionally refer to diseases caused by obligate intracellular bacteria of the genera Anaplasma and Ehrlichia. The aim of this study was to identify and estimate the prevalence of Anaplasmataceae species infecting domestic animals and ticks in Corsica. Methods: In this study, 458 blood samples from sheep, cattle, horses, goats, dogs, and 123 ticks removed from cattle, were collected in Corsica. Quantitative real-time PCR screening and genetic characterisation of Anaplasmataceae bacteria were based on the 23S rRNA, rpoB and groEl genes. Results: Two tick species were collected in the present study: Rhipicephalus bursa (118) and Hyalomma marginatum marginatum (5). Molecular investigation showed that 32.1% (147/458) of blood samples were positive for Anaplasmataceae infection. Anaplasma ovis was identified in 42.3% (93/220) of sheep. Anaplasma marginale was amplified from 100% (12/12) of cattle and two R. bursa (2/123). Several potentially new species were also identified: Anaplasma cf. ovis, “Candidatus Anaplasma corsicanum”, “Candidatus Anaplasma mediterraneum” were amplified from 17.3% (38/220) of sheep, and Anaplasma sp. marginale-like was amplified from 80% (4/5) of goats. Finally, one R. bursa tick was found to harbour the DNA of E. canis. All samples from horses and dogs were negative for Anaplasmataceae infection. Conclusions: To our knowledge, this study is the first epidemiological survey on Anaplasmataceae species infecting animals and ticks in Corsica and contributes toward the identification of current Anaplasmataceae species circulating in Corsica. Keywords: Corsica Island, Animals, Ticks, Anaplasma ovis, Anaplasma marginale, Anaplasma sp., Ehrlichia canis

* Correspondence: [email protected] Aix Marseille Univ, CNRS, IRD, INSERM, AP-HM, URMITE, IHU - Méditerranée Infection, Marseille, France

© The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

179 Dahmani et al. Parasites & Vectors (2017) 10:302 Page 2 of 12

Background endemic flora and fauna and endemic pathologies are Bacteria from the genera Anaplasma and Ehrlichia are characteristic in Corsica [22]. Recently, we reported the obligate intracellular bacteria transmitted by arthropods, emergence of Toscana virus in dogs in this region [23] mainly ticks, from one vertebrate host to another. and West Nile virus in domestic animals [24]. Our main Transmission usually occurs transstadially [1, 2], although objective was to continue the epidemiologic investigation transovarial transmission has been reported [3]. In the of neglected infectious diseases in animals. To date, the vertebrate host, the bacteria infect hematopoietic cells occurrence of Anaplasmataceae bacteria in Corsica in do- [4, 5]. Anaplasma and Ehrlichia can cause a per- mestic animals has never been reported. The aim of this sistent infection in vertebrate hosts, which allows study was to screen for the presence and the prevalence of these hosts to be reservoirs [1, 5]. Probable cases of Anaplasmataceae species infecting and currently circulat- Anaplasmataceae infection in domestic animals were ing in domestic animals and their ticks in this region. known as early as the beginning of the twentieth century. However, wide interest in studying these Methods bacteria arose when discovering species pathogenic Sampling for humans [1]. Anaplasma phagocytophilum was From 2014 to 2015, EDTA blood samples were obtained known to cause disease in domestic ruminants in from domestic animals on different farms from 14 different Europe and the USA decades before its identification areas situated on the east coast of Corsica, France (Fig. 1). in humans [6]. The first European case of human an- Sheep and goats were sampled on the Aléria plain. Cattle aplasmosis was reported in 1995 in Slovenia; after and ticks were sampled from one farm in Centu Mezzini, that, human cases have been reported in many coun- Balagne (42°34′58.242″N, 8°58′38.015″E), whereas dogs tries of Europe [7–11]. Bovine anaplasmosis due to A. and horses were sampled in different localities along the marginale results in the development of mild to severe an- east coast of Corsica island, including Cap Corse (42°56′ aemia and occurs in tropical and subtropical regions, in- 44″N, 9°26′28″E), Furiani (42°3932″N, 9°24′54″E), cluding South and Central America, the United States, Biguglia (42°37′41″N, 9°25′14″E), Lucciana (42°32′48″N, southern Europe, Africa, Asia and Australia [12]. In India, 9°25′5″E), Vescovato (42°29′41″N, 9°26′26″E), Castellare mortality due to bovine anaplasmosis is estimated at be- (42°28′7″N, 9°28′27″E), Tallone (42°13′55″N, 9°24′53″E), tween 5 and 40% but may reach up to 70% during a severe Ghisonaccia (42°1′3″N, 9°24′20″E), Solenzara (41°55′36″N, outbreak [13]. The economic loss due to infections caused 9°24′19″E), Lecci (41°40′48″N, 9°19′5″E), Borgo (42°33′ by Babesia and Anaplasma infections in India was esti- 17″N, 9°25′41″E), and Ventiseri-Solenzara (41°55′36″N, mated to be $57 million [14]. In Europe, A. marginale has 9°24′19″E) (Table 1). Sheep blood samples (230) were col- spread up to the northern latitudes of Switzerland, Austria lected from three farms. In two farms, the sheep appeared and Hungary [15]. Anaplasma centrale, a less pathogenic healthy; however, the farmers declared that their sheep organism but closely related to A. marginale, was reported experienced many health problems during the winter of in cattle in Sicily, Italy [16], and from roe deer in Spain 2014, including respiratory disorders and a drop in milk [17]. Anaplasma ovis is an intraerythrocytic pathogen of production. At the third sheep farm, the farmer declared sheep, goats and wild ruminants [18]. It is thought to cause that the sheep at his farm were currently unhealthy, with a only mild clinical symptoms, thus being of minor economic variety of symptoms, including recurrent fever, abortion, importance [19]. Ovine anaplasmosis appears to be wide- and some sheep died. A cattle herd in Balagne consisted spread and found in different regions of the world. The ex- of 16 cows. The cows in this herd had pronounced an- tent of the infection and the loss of livestock productivity aemia with icterus, and some of them died in 2015. Goats remain poorly understood [19]. The historical record of (n = 5) were all sampled on one farm; they had anaemia this bacterium in Europe was established in Russia in 1929 and a drop in milk production. In addition, blood samples and 1930 by Yakimoff et al. [19], and in France by Cuille et were collected from horses at a different ranch. Dogs sam- al. in 1935 and 1936 [19]. In 2007, A. ovis human infection pled in the present study included hunting dogs, sheep was reported in a 27-year-old woman in Cyprus [20]. dogs, military working dogs and some pet dogs. Animals The management of vector-borne diseases requires were examined with the assistance of their owners. Blood increased communication between physicians and veteri- samples were collected by a veterinarian. After transport narians, particularly when physicians are dealing with to the laboratory in Marseille, all samples were stored patients with unexplained febrile illnesses in an endemic at -80 °C. area were pathogen like Anaplasmataceae largely interconnected in an epidemiological network involving Tick collection and identification animals, vectors and humans [21]. Corsica is a French From the cattle farm, ticks were collected manually from island in the Mediterranean Sea close to the south-east adult cattle and stored in 70% ethanol until identifica- French coast, Sardinia, and the west Italian coast. Highly tion. Morphological identification was performed with a

180 Dahmani et al. Parasites & Vectors (2017) 10:302 Page 3 of 12

Fig. 1 Map of Corsica, France, showing the study areas where the animals were sampled binocular microscope. Ticks were classified by family, DNA extraction genus and species using available taxonomic keys and DNA extraction was performed on the BioRobot EZ1 morphometric tables [25, 26]. In addition, to confirm the (Qiagen, Courtaboeuf, France) using a commercial EZ1 morphological identification, three morphologically identi- DNA Tissue Kit (Qiagen) according to the manufac- fied specimens of each species and all ticks that were not turer’s instructions. DNA was extracted from 200 μlof identified, or identified only to the genus level (engorged blood from all animal samples. Ticks were recovered females and damaged ticks) were subjected to molecular from ethanol, rinsed with distilled water and dried on identification using primers targeting the mitochondrial sterile filter paper in a laminar-flow hood. Each tick was 12S rRNA gene, as previously described [27]. cut in half lengthways (the blades were discarded after each tick was cut). DNA was individually extracted from one half, and the remaining halves of the ticks were Table 1 Origin of animal and tick samples collected and frozen at -80 °C for subsequent studies, as previously investigated in this study described [28]. Species Number Origin Tick infestation No. of ticks 2014 PCR amplification Sheep 201 Aléria Plain not found – For the molecular identification of the species of Horse 98 East coast not found – selected ticks, the DNA samples were subjected to standard PCR to amplify a 360-base-pair (bp) fragment Dog 73 East coast not found – of the mitochondrial 12S rRNA gene (Table 2). To inves- 2015 – tigate the presence of Anaplasmataceae in Corsican Sheep 19 Aléria Plain not found – ticks and domestic animals, DNA from ticks and blood Cattle 12 Balagne R. bursa 118 were initially screened by a qPCR targeting the 23S Hy. m. marginatum 5 rRNA gene. This qPCR has been reported to amplify Goat 5 Aléria Plain not found – most bacteria belonging to the family Anaplasmataceae [29]. Then, all positive samples were subjected to conven- Dog 50 not found – tional PCR using the primers that amplify a 485 bp frag- Totals 458 123 ment of the 23S rRNA gene, as previously described [29].

181 Dahmani et al. Parasites & Vectors (2017) 10:302 Page 4 of 12

Table 2 Primers and probes used in this study Targeted microorganisms Targeted gene Primers and probea Sequences 5′-3′ Annealing temperature (°C) References qPCR Anaplasmataceae 23S rRNA TtAna-F TGACAGCGTACCTTTTGCAT 60 [28, 29] TtAna-R GTAACAGGTTCGGTCCTCCA TtAna-Sa FAM-CTTGGTTTCGGGTCTAATCC-TAMRA Conventional PCR Anaplasmataceae 23S rRNA Ana23S-212f ATAAGCTGCGGGGAGTTGTC 55 [28, 29] Ana23S-753r TGCAAAAGGTACGCTGTCAC Anaplasma spp. rpoB Ana-rpoBF GCTGTTCCTAGGCTYTCTTACGCGA 55 [27] Ana-rpoBR AATCRAGCCAVGAGCCCCTRTAWGG Ehrlichia spp. groEL Ehr-groEL-F GTTGAAAARACTGATGGTATGCA 50 [27] Ehr-groEL-R ACACGRTCTTTACGYTCYTTAAC Ticks 12S rRNA T1B AAACTAGGATTAGATACCCT 51 [26] T2A AATGAGAGCGACGGGCGATGT aProbe

In order to mine deeper into the identification of Anaplas- Terminator Kit (Perkin-Elmer) according to the man- mataceae species in domestic animals or ticks, positive ufacturer’s instructions. The obtained sequences were as- samples were tested by PCR using Anaplasma genus- sembled using ChromasPro 1.7 software (Technelysium specific primers targeting the 525 bp fragment of the RNA Pty Ltd., Tewantin, Australia) and the sequences of polymerase subunit beta (rpoB) gene, and Ehrlichia primers were removed. Sequences obtained in this study genus-specific primers targeting the 590 bp fragment of were aligned with other ticks or Anaplasmataceae species the heat shock protein (groEl)gene[28](Table2). sequences available on GenBank using CLUSTALW im- PCR amplifications were performed as described previ- plemented on BioEdit v3 [31]. The sequence of 12S rDNA ously [29, 30]. Briefly, quantitative real-time PCR assays from ticks and the sequences of bacterial 23S rRNA, rpoB, were performed on the CFX96 Touch detection system and groEl genes were first aligned individually, gaps and (Bio-Rad, Marnes-la-Coquette, France) using the Takyon missing data were eliminated, and then, for the sequences Master Mix according to the manufacturer’s instruc- of Anaplasmataceae species, the alignment of the 23S tions. The conventional PCRs were performed in auto- rRNA with rpoB genes and 23S rRNA with groEl gene mated DNA Thermal cyclers (GeneAmp PCR Systems sequences were concatenated for phylogenetic tree Applied Biosystems, Courtaboeuf, France). The amplifi- construction for the Anaplasma and Ehrlichia species, cation reactions were performed under the following respectively. Phylogenetic and molecular evolutionary ana- conditions: an initial denaturation step at 95 °C for lysis were inferred using the maximum likelihood method 15 min, followed by 40 cycles consisting of 1 min de- implemented on MEGA7 [32], with the complete deletion naturation at 95 °C, 1 min annealing at a corresponding option, based on the Hasegawa-Kishino-Yano (HYK) temperature (Table 2) and a 1 min extension at 72 °C. A model for nucleotide sequences. A discrete gamma distri- final extension cycle at 72 °C for 7 min was performed bution was used to model evolutionary rate differences and the reactions were cooled at 15 °C. Distilled water among sites. Initial trees for the heuristic search were ob- was used as negative control. Positive control used was tained automatically by applying the neighbor-joining and the DNA of A. phagocytophilum extracted from the BIONJ algorithms to a matrix of pairwise distances esti- supernatant of the continuous culture of this species in mated using the maximum composite likelihood (MCL) our laboratory, and E. canis DNA obtained from infected approach. Statistical support for internal branches of the dogs sampled in Algeria [30]. After electrophoresis, the trees was evaluated by bootstrapping with 1000 iterations. amplification products were visualised on 1.5% agarose gels stained with ethidium bromide and examined by UV Results transillumination. A DNA molecular weight marker Tick identification and Anaplasmataceae screening (marker VI, Boehringer Mannheim, Mannheim, Germany) In total, 123 ticks were collected. Eighty-five removed was used to estimate the size of the products. ticks were identified as Rhipicephalus bursa, and 3 as Hyalomma marginatum. Thirty-five damaged ticks, Sequencing and phylogenetic analyses including 32 engorged ticks, were only morphologically Sequencing analyses were performed on the Applied identified to the genus level as follows: 29 ticks Rhipice- Biosystems 3130xl Genetic Analyzer (Thermo Fisher phalus sp., 2 Hyalomma sp., and 4 ticks were not identi- Scientific, France) using the DNA sequencing BigDye fied. Two or three specimens from each tick identified at

182 Dahmani et al. Parasites & Vectors (2017) 10:302 Page 5 of 12

a species level were selected randomly, and all 35 96% identity with the A. ovis strain KMND Niayes-14. damaged/engorged ticks were subjected to molecular Due to the absence of additional data on this Anaplasma identification. After 12S rDNA amplification and blast and genetic relatedness to A. ovis, we refer to this analysis, the six morphologically identified specimens genotype here as Anaplasma cf. ovis. There were 3/131 were confirmed to be R. bursa and Hy. marginatum mar- (2.3%) sheep infected by another genotype of Anaplasma. ginatum. From the 35 damaged ticks, 32 ticks were identi- These three sequences had 96–98% identity to each other fied as R. bursa, and 3 were identified as Hy. m. and showed 91–94% identity with the A. phagocytophilum marginatum. All 12S rDNA sequences of the R. bursa strain Norway Variant 2, reported from sheep in Norway were identical to each other and showed 100% identity (CP015376). We are provisionally calling this incom- with R. bursa from Italy (KU51295, KC243833, pletely characterised bacterium “Candidatus Anaplasma AM410572), and 99% identity with R. bursa ticks reported corsicanum”. Finally, a third genotype was found infecting from Spain (KC243834) (Fig. 1). All five sequences of Hy. 22/131 (16.8%) sheep, sampled only in 2015. All sequences m. marginatum were also identical to each other and of this genotype were identical to each other and showed showed 100% identity with Hy. m. marginatum from Italy 95% identity with the A. centrale strain Israel (CP001759) (KC817304), Israel (KT391046), Morocco (AF150034) and reported from Israel (Fig. 3). We are provisionally calling Yemen (HE819515) (Fig. 2). Overall, the ticks collected in this bacterium “Candidatus Anaplasma mediterraneum”. this study were as follows: 118 (95.9%) were identified as R. All 12 cattle tested were positive in qPCR and con- bursa; 75 were female, including 30 engorged females, and ventional PCR (100%) for Anaplasmataceae bacteria. 43 were male. Five (4.1%) were identified as Hy. m. margin- Sequencing analyses showed that all cattle were infected atum; two were engorged females, and three were male. by A. marginale. The sequences were identical to each Anaplasmataceae DNA was detected in three R. bursa other, and also to the sequences of A. marginale of the 123 ticks examined (2.4%). After the 23S rRNA identified in the R. bursa ticks removed from the gene sequencing of the Anaplasmataceae DNA present same animals. in the three ticks, A. marginale was identified in two Finally, 4 of 5 goats were found to be infected by a ticks. The two sequences of A. marginale were identical potentially new species of Anaplasma similar to A. mar- to each other and showed 100% homology with the A. ginale. All sequences were identical to each other and marginale strain Dawn (CP006847) and Gypsy Plains showed 99% homology with the A. marginale strain Dawn (CP006846) reported from Australia, and 99% with the (CP006847), A. centrale strain Israel (CP001759) and 99% A. marginale strain Florida (CP001079) and St. Maries with A. ovis strain KMND Niayas-14 (KM021411) (Fig. 3). (CP000030) reported from the USA (Fig. 3). Finally, Additional characterisation of detected Anaplasmata- based on the 23S rRNA analysis, E. canis was identified ceae bacteria was performed by amplification/sequencing from the third positive tick. These sequences presented of a portion of the rpoB gene (for Anaplasma-positive 99% homology with the E. canis strain Jack (CP000107) samples) or groEL gene (for Ehrlichia-positive samples). reported from the USA (Fig. 4). RpoB sequences from A. ovis-positive samples were also identical to each other and showed 100% identity with A. Anaplasmataceae species screening from animal blood ovis strain KMND Nayes-14. rpoB sequences from two A. The results are summarised in the (Table 3). Of the total marginale-positive R. bursa ticks and the four other se- of 458 blood samples analysed (Table 1), 32.1% (147) quences obtained from cattle blood samples were identical were positive for the initial 23S rRNA qPCR screening. to each other and showed 100% identity with A. marginale The prevalence of Anaplasmataceae infections was as strain Dawn (CP006847) and Gypsy Plains (CP006846) follows: sheep 59.5% (131/220), cattle 100% (12/12) and and 99% with A. marginale strain Florida (CP001079) and goats 80% (4/5), whereas all blood samples from horses St. Maries (CP000030). For the E. canis identified in one and dogs were negative. Identification of bacterial spe- R. bursa tick, the DNA sample was amplified using groEl cies was achieved by amplification followed by sequen- Ehrlichia genus-specific primers and sequenced. The cing of the portion of the 23S rRNA gene. Seventy-one sequence showed 99% homology with the E. canis strain percent (93/131) of Anaplasmataceae-positive sheep Jack (CP000107) (Fig. 4). samples were infected by A. ovis. The 23S sequences ob- Analysis of rpoB sequences of all three novel geno- tained were identical to each other and showed 100% types of Anaplasma produced results similar to the 23S identity with A. ovis strain KMND Niayes-14 reported in gene analysis. RpoB sequences from A. cf. ovis showed sheep from Senegal [33]. All the other 38 qPCR-positive 98% identity with A. ovis strain KMND Nayes-14. The sheep (29%) were found to be infected by several as yet three rpoB sequences from “Ca. Anaplasma corsicanum” uncharacterised and potentially new species of Ana- had 99% identity to each other, and only 80% with A. plasma. In 13/131 (9.9%) of infected sheep, the obtained phagocytophilum strains Norway Variant 2 (CP015376), sequences were identical to each other and showed only Dog2 (CP006618), JM (CP006617) and HZ (CP000235).

183 Dahmani et al. Parasites & Vectors (2017) 10:302 Page 6 of 12

Fig. 2 Phylogenetic tree showing the position of Rhipicephalus bursa and Hyalomma marginatum marginatum compared to other tick species. The evolutionary history was inferred by using the maximum likelihood method based on the Hasegawa-Kishino-Yano model. A discrete Gamma distribution was used to model evolutionary rate differences among sites [4 categories (+G, parameter = 0.2936)]. The analysis involved 39 nucleotide sequences. All positions containing gaps and missing data were eliminated. There was a total of 267 positions in the final dataset. The scale-bar represents a 5% nucleotide sequence divergence

RpoB sequences of “Ca. Anaplasma mediterraneum” Dawn (CP006847) and Gypsy Plains (CP006846), and presented 84% identity with A. centrale strain Israel 87% with A. centrale strain Israel (CP001759) (Fig. 3). (CP001759). Finally, Anaplasma cf. marginale from four goats had rpoB sequences that shared 98% identity with Phylogenetic analyses of the potentially new species A. ovis strain KMND Niayes-14 (KX155494) and strain The phylogenetic tree inferred from the Anaplasmataceae RhburBas11 (KX155495), 93% with A. marginale strain concatenated 23S rRNA, and the rpoB genes provide evi- Florida (CP001079), St. Maries (CP000030), 89% strain dence that “Ca. Anaplasma corsicanum”, Anaplasma cf.

184 Dahmani et al. Parasites & Vectors (2017) 10:302 Page 7 of 12

Fig. 3 Phylogenetic tree showing the position of A. marginale amplified from R. bursa and cattle, A. ovis, “Ca. Anaplasma corsicanum”, Anaplasma sp. ovis-like, “Ca. Anaplasma mediterraneum” amplified from sheep and Anaplasma sp. marginale-like amplified from goats, compared to other species. The evolutionary history was inferred by using the maximum likelihood method based on the Hasegawa-Kishino-Yano model. A discrete Gamma distribution was used to model evolutionary rate differences among sites [2 categories (+G, parameter = 0.3880)]. The analysis involved 43 nucleotide sequences. All positions containing gaps and missing data were eliminated. There was a total of 861 positions in the final dataset. The scale-bar represents a 10% nucleotide sequence divergence ovis, “Ca. Anaplasma mediterraneum” from sheep and The sequence of Anaplasma cf. ovis from sheep and the Anaplasma cf. marginale from goats could potentially be sequence of Anaplasma cf. marginale from goats clus- new species. “ Ca. Anaplasma corsicanum” clustered sep- tered together with the sequence of A. ovis strain KMND arately from the recognised species A. phagocytophilum, Niayes-14 from Senegal and A. ovis from sheep identified A. platys, A. ovis, A. marginale and A. centrale (Fig. 2). in this study with high bootstrap values and separately

185 Dahmani et al. Parasites & Vectors (2017) 10:302 Page 8 of 12

Fig. 4 Phylogenetic tree showing the position of E. canis amplified from R. bursa compared to other Anaplasmataceae species. Evolutionary analyses were conducted using MEGA7 [32]. The concatenated 23S rRNA and the groEl genes of the Ehrlichia canis amplified in this study together with other sequences of Anaplasmataceae species available on GenBank. The evolutionary history was. A discrete Gamma distribution was used to model evolutionary rate differences among sites [4 categories (+G, parameter = 0.6567)]. The analysis involved 15 nucleotide sequences. All positions containing gaps and missing data were eliminated. There was a total of 1039 positions in the final dataset. The scale-bar represents a 5% nucleotide sequence divergence from the cluster of A. marginale species. Finally, the BvCF13 (KY498332), A. marginale Rh.burCF08 (KY498334), sequence of “Ca. Anaplasma mediterraneum” obtained A. marginale Rh.burCF10 (KY498335), Ehrlichia canis from sheep form well-defined branches with high boot- Rh.burCF07 (KY498333); (ii) for the rpoB gene: Ana- strap values (93–95%) (Fig. 3). plasma ovis OVCF02 (KY498325), Anaplasma cf. ovis All sequences obtained in the present study were submit- OVCF115 (KY498336), “Ca. Anaplasma corsicanum” ted to GenBank under the following accession numbers: (i) OVCF72 (KY498338), “Ca. Anaplasma corsicanum” for the 23S rRNA gene: Anaplasma ovis OVCF02 OVCF81 (KY498339), “Ca. Anaplasma corsicanum” (KY498325), Anaplasma cf. ovis OVCF115 (KY498326), OVCF65 (KY498340), “Ca. Anaplasma mediterraneum” “Ca. Anaplasma corsicanum” OVCF72 (KY498327), “Ca. OVCFO215 (KY498341), Anaplasma cf. marginale Anaplasma corsicanum” OVCF81 (KY498328), “Ca.Ana- CpCF01 (KY498342), Anaplasma marginale BvCF13 plasma corsicanum” OVCF65 (KY498329), “Ca.Anaplasma (KY498343), A. marginale Rh.burCF08 (KY498344), A. mediterraneum” OVCFO215 (KY498330), Anaplasma cf. marginale Rh.burCF10 (KY498345); (iii) For the groEl marginale CpCF01 (KY498331), Anaplasma marginale gene: Ehrlichia canis Rh.burCF07 (KY498324). For tick

Table 3 Overall results and Anaplasmataceae species reported in the present study Species Sheep Cattle Goats Equine Dogs R. bursa Hy. m. marginatum A. ovis 93/220 (71%) 0 0 0 0 0 0 A. marginale 0 0 0 0 0 2/118 (1.7%) 0 Anaplasma cf. marginale 0 12/12 (100%) 4/5 (80%) 0 0 0 0 Anaplasma cf. ovis 13/220 (9.9%) 0 0 0 0 0 0 “Canditatus Anaplasma corsicanum” 3/220 (2.3%) 0 0 0 0 0 0 “Candidatus Anaplasma mediterraneum” 22/220 (16.8%) 0 0 0 0 0 0 E. canis 0 0 0 0 0 1/118 (0.8%) 0 Totals 131/220 (59.5%) 12/12 (100%) 4/5 (80%) 0 0 3/118 (2.5%) 0 Data presented as No. of infected/No. of examined (Prevalence %)

186 Dahmani et al. Parasites & Vectors (2017) 10:302 Page 9 of 12

species, the 12S rRNA sequences were submitted under engorged female ticks removed from cattle infected by A. the following accession number: Hy. m. marginatum marginale. Previous studies have reported A. marginale (KY595783) and R. bursa (KY595784). from R. bursa removed from cattle in Portugal [34], and from Iberian red deer and European wild boar in Spain Discussion [37]. It is likely that the presence of A. marginale DNA in Livestock farming in Corsica is an important economic these two ticks was due to the presence of this activity involving approximately 150,000 sheep, 48,000 pathogen in the blood meal. However, the percentage goats, 40,000 pigs and 70,000 cattle [22]. The signifi- of R. bursa-engorged females in our study was 42.9% cance of anaplasmosis in animals in Corsica is not yet (30/70 female); only two engorged ticks were found known. Anaplasma infection may likely be neglected to harbour A. marginale. because of its unknown economic importance in small Ehrlichia canis was amplified from one non-engorged ruminants. To our knowledge, the present study is the R. bursa female. In Europe, E. canis is associated with first report of the incidence of Anaplasmataceae species the presence of the brown dog tick R. sanguineus [38]. in ticks and animals in Corsica. Furthermore, the pres- However, in the Mediterranean area, E. canis has also ence and molecular traits of six species belonging to the been reported from R. bursa collected from goats in genus Anaplasma from ruminants and ticks infecting Sardinia, Italy [39] and Cediopsylla inaequalis collected cattle, and one Ehrlichia, are shown. The typical from red foxes in Sicily, Italy [40]. In other European Mediterranean environment of Corsica with hot sum- countries, there are reports of E. canis from D. marginatus mers, along with the geographical location, favours the collected from dogs, Ixodes canisuga collected from red spread of seasonal tick infestations. Two tick species foxes, and I. ricinus collected from vegetation in Hungary were collected and confirmed by the morphological and [41, 42]. Domestic animals are now recognised as the molecular investigation as R. bursa and Hy. m. margina- primary hosts of R. bursa [36];however,theroleof tum (Fig. 1). Neither the tick fauna of Corsica nor the R. bursa and the other arthropod species in the trans- transmitted pathogens have been fully investigated. Here, mission of E. canis remains unknown. ticks were only collected from cattle; infestation of other None of the five Hy. m. marginatum ticks were positive animals, including sheep, goats, horses and dogs, was for Anaplasmataceae infection. However, in Spain, Hy. m. not observed. A previous study demonstrated the pres- marginatum has been identified as a potential biological ence of three species of the genus Hyalomma in Corsica: vector for A. marginale [43]. These ticks are also the vec- Hy. marginatum, Hy. aegyptium and Hy. rufipes [22]. tors of Babesia caballi, causing babesiosis in horses and While Hy. marginatum is found on many hosts, Hy. Theileria annulata infection under laboratory conditions aegyptium was identified once in Corsica on a Testudo [26]. Other studies are needed to clarify and list the patho- hermanni tortoise, while Hy. rufipes has been collected gens associated with these ticks in Corsica. from migrating birds [22]. Recently, Hy. scupense was The prevalence of Anaplasma spp. in our study was also identified and collected from Corsican cattle by surprisingly high in ruminants. Based on the 23S rRNA Grech-Angelini et al. [22]. Rhipicephalus bursa was the gene molecular investigations, the individual prevalence most common tick infesting cattle in our study. This observed was 59.5% in sheep, 100% in cattle, and 80% in two-host species occurs in the entire Mediterranean, goats. However, none of the canine or equine blood sam- Adriatic and Aegean basins, including their islands, and ples was positive. Genetic characterisation using 23S North Africa [25, 34]. Rhipicephalus bursa prefers grassy rRNA and the rpoB genes identified A. ovis, A. marginale, slopes and low to medium altitude mountain slopes, as and several potentially new species, all belonging to the well as certain modified steppe and semi-desert environ- genus Anaplasma. These data confirm the relevance of ments [35]. However, this tick species is recorded in cold ruminants as important hosts and reservoirs of different regions, including the Atlantic region of Europe, the Anaplasma species in the Mediterranean ecosystem. The French Basque country, Spanish Basque country, and prevalence of Anaplasma spp. in ruminants examined by north-west Portugal [28, 35]. Corsica is a typical Mediter- us was lower than the prevalence data reported from Sar- ranean ecosystem, which favours the spread of these ticks. dinia [44]. The prevalence of A. marginale infection in cat- Rhipicephalus bursa mature and adults infest many hosts, tle was higher than that observed in cattle in Sicily [45]; including cattle, sheep, goats and other domestic animals, however, in that study, the number of samples analysed whereas wild ungulates are the original host [36]. This was greater than in our study. In sheep, the prevalence species is a recognised vector of many pathogens, includ- reported in our study was lower than that reported in ing Babesia ovis, Theileria spp., A. marginale and A. ovis Sicily [46]. [36]. DNA of Coxiella burnetii and A. phagocytophilum Sheep, goats, and cattle sampled in this study mani- have also been amplified from these ticks [28, 35]. Here, fested poor health. In sheep, most clinical manifestations the DNA of A. marginale was amplified from two observed were relapsing fever, drop in milk production

187 Dahmani et al. Parasites & Vectors (2017) 10:302 Page 10 of 12

and mortality. Molecular and phylogenetic analysis of marginale, grouped with the sequences of A. ovis (Fig. 3). sequences amplified from sheep blood samples were Interestingly, despite this grouping, Anaplasma cf. mar- identified A. ovis, and three potentially new species, “Ca. ginale is closer to A. marginale than to A. ovis, based on Anaplasma corsicanum”, “Ca. Anaplasma mediterraneum”, the 23S rRNA comparison. The rpoB encodes the RNA and Anaplasma cf. ovis. In the Mediterranean area, A. ovis polymerase subunit beta and gives a better statistical score is reported to be endemic to Sicily [47, 48]. This pathogen for differentiating between the closest species of has also been reported from Greece and Cyprus [21, 49]. Anaplasma spp., with more sequence variations [28]. The In Europe, A. ovis has also been reported from Portugal, observed prevalence of the potentially new Anaplasma Hungary [19] and Slovakia [47]. Anaplasma ovis infection species in sheep was low (17.3%, 38/220) compared to the in the mouflon and the European roe deer has been re- prevalence of A. ovis; however, 80% (4/5) of the goats ported from Cyprus and southern Spain, respectively [50, sampled in this study were infected by Anaplasma cf. 51]. The main vector of A. ovis in Europe is R. bursa [28]. marginale. The importance of this amplified Anaplasma However, A. ovis DNA was amplified from I. ricinus re- species remains to be understood. moved from cattle in Hungary [15], Haemaphysalis sulcata Mortalities in animals were reported by the farmers in removed from mouflons in Cyprus [50], and the sheep ked the sheep and cattle herds. Unfortunately, we did not have (Melophagus ovinus) and deer ked (Lipoptena cervi)in access to body tissue of fluid from the dead animals to Hungary [48]. In addition, in provinces of Palermo and perform a post-mortem diagnosis. The different reported Ragusa (Italy), A. ovis was amplified from foxes, and a symptoms and the results found in the present study with flea, Xenopsylla cheopis, removed from these foxes [40]. the high prevalence of A. marginale in cattle and A. ovis The role of these arthropods and insects in the trans- and the others amplified Anaplasma spp. in sheep and mission of A. ovis remains unclear. Anaplasmosis in goats suggest that the mortalities can be linked to these sheep is usually subclinical. This bacterium can lead to Anaplasma species. However, other tick- or vector-borne severe infection with severe illness in sheep; severe diseases can also lead to mortalities like Piroplasmosis illness can occur in some extreme conditions, such as [54, 55]. In addition, co-infection by two or more patho- the association with more than one parasitic disease or gens can lead to increase the pathogenicity and clinical other stress factors [49, 52]. manifestations in animals and resultant varying outcomes All cattle sampled in this study were infected with A. on host health and survival [56]. The involvement or not marginale. In this farm, the farmer reported mortality in involvement of the Anaplasmataceae species amplified in his livestock. Anaemia and icterus were most observed the present study should be considered with caution do to in other cattle (Table 1). Bovine anaplasmosis due to A. the possible implication of other pathogens. marginale causes mild to severe anaemia, icterus, fever, In our study, we did not find A. phagocytophilum in weight loss, abortion and lethargy [53]. In Europe, A. mar- animal or tick samples. Anaplasma platys and E. canis ginale is mainly present in the Mediterranean region, al- were also not found in dogs, although E. canis was found pine, and eastern areas [16]. In the Mediterranean region, in Rh. bursa collected from a cow. the DNA of this bacterium has been amplified from D. reticulatus, D. marginatus, R. turanicus, Haemaphysalis punctata, Hy. m. marginatum and R. bursa [34, 37, 43]. Conclusion Interestingly, A. marginale has been amplified from The present study demonstrates that ruminants in Xenopsylla cheopis removed from red foxes in Italy [40]. Corsica are a reservoir for multiple Anaplasma species, Outside of the Mediterranean region, A. marginale has whereas R. bursa seems to be a vector of A. marginale been amplified from I. ricinus and Tabanus bovis in in cattle. The prevalence of Anaplasma spp. infection Hungary [15, 43]. The role of I. ricinus, Tabanus bovis and was high. The use of quantitative real-time PCR comple- Xenopsylla cheopis in the transmission of A. marginale mented with sequencing and genetic characterisation remains unclear. using two genes, rpoB and groEl, revealed an interesting The potentially new species “Ca. Anaplasma corsica- diversity of Anaplasma spp. infection in small ruminants num” and “Ca. Anaplasma mediterraneum” have genetic and R. bursa, including potentially new species and E. features which are different from other species of the canis in one R. bursa tick. Nevertheless, characterisation genus Anaplasma (Fig. 3). Phylogenetic analysis based studies are needed to ascertain the pathogenesis and/or on the concatenated 23S rRNA and rpoB genes showed the zoonotic potential of the strains and their signifi- that “Ca. Anaplasma corsicanum” is related to A. phago- cance for animals and public health. cytophilum, but clustered separately from recognised species. “Ca. Anaplasma mediterraneum” is related to A. Abbreviations centrale and forms a distinct subcluster. Two other iden- GroEl gene: Heat shock protein gene; qPCR: Quantitative real-time polymer- tified genotypes, Anaplasma cf. ovis and Anaplasma cf. ase chain reaction; RpoB gene: RNA polymerase subunit beta gene

188 Dahmani et al. Parasites & Vectors (2017) 10:302 Page 11 of 12

Acknowledgments 11. Chochlakis D, Psaroulaki A, Kokkini S, Kostanatis S, Arkalati E, Karagrannaki E, We are grateful to Emilie Fauconnier, Bernard Fabrizy, and Sandrine Ferrandi et al. First evidence of Anaplasma infection in Crete, Greece. Report of six for their valuable help with the field work. human cases. Clin Microbiol Infect. 2008;15:8–9. 12. Aubry P, Geale DW. A review of bovine anaplasmosis. Transbound Emerg Funding Dis. 2011;58:1–30. This study was supported by the AMIDEX project (No. ANR-11-IDEX-0001-02) 13. Ashraf QUA, Ullah A, Mehmood R, Ali M, Sadiq R, Ali M, et al. A report on funded by the “Investissements d’Avenir” French Government program, the high prevalence of Anaplasma sp. in buffaloes from two provinces in managed by the French National Research Agency (ANR) and Foundation Pakistan. Ticks Tick Borne Dis. 2013;4:395–8. Méditerranée Infection (www.mediterranee-infection.com). The funders had 14. Nair AS, Ravindran R, Lakshmanan B, Sreekumar C, Kumar SS, Raju R, et al. no role in study design, data collection and analysis, decision to publish, or Bovine carriers of Anaplasma marginale and Anaplasma bovis in South India. preparation of the manuscript. Trop Biomed. 2013;30:105–12. 15. Hornok S, Micsutka A, Fernández de Mera IG, Meli ML, Gönczi E, Tánczos B, Availability of data and materials et al. Fatal bovine anaplasmosis in a herd with new genotypes of The data supporting the conclusions of this article are included within Anaplasma marginale, Anaplasma ovis and concurrent haemoplasmosis. Res – the article. Vet Sci. 2012;92:30 5. 16. Ceci L, Iarussi F, Greco B, Lacinio R, Fornelli S, Carelli G. Retrospective study of hemoparasites in cattle in Southern Italy by reverse line blot ’ Authors contributions hybridization. J Vet Med Sci. 2014;76:869–75. MD, DT, BD, FF, OM and DR designed the study. MD, BD, FF, OM designed 17. García-Pérez A, Oporto B, Espí A, del Cerro A, Barral M, Povedano I, et al. and MD carried out the data analysis. MD and OM drafted the manuscript. Anaplasmataceae in wild ungulates and carnivores in northern Spain. Ticks All authors read and approved the final manuscript. Tick Borne Dis. 2015;7:264–9. 18. de la Fuente J, Atkinson MW, Naranjo V, Fernández de Mera IG, Mangold AJ, Competing interests Keating KA, et al. Sequence analysis of the Msp4 gene of Anaplasma ovis The authors declare that they have no competing interests. strains. Vet Microbiol. 2007;119:375–81. 19. Renneker S, Abdo J, Salih DE, Karagenç T, Bilgiç H, Torina, et al. Can Consent for publication Anaplasma ovis in small ruminants be neglected any longer? Transbound Not applicable. Emerg Dis. 2013;60(Suppl 2):105–12. 20. Dimosthenis C, Ioannis I, Tselentis Y, Psaroulaki A. Human anaplasmosis and – Ethics approval and consent to participate Anaplasma ovis Variant. Emerg Infect Dis. 2010;16:1031 2. All animals sampled in this study were examined with the assistance of their 21. Dantas-Torres F, Chomel BB, Otranto D. Ticks and tick-borne diseases: a One owners. Blood samples were collected by a veterinarian. Health perspective. Trends Parasitol Elsevier Ltd. 2012;28:437–46. 22. Grech-Angelini S, Stachurski F, Lancelot R, Boissier J, Allienne JF, Gharbi M, et al. First report of the tick Hyalomma scupense (natural vector of bovine Publisher’sNote tropical theileriosis) on the French Mediterranean island of Corsica. Vet Springer Nature remains neutral with regard to jurisdictional claims in Parasitol. 2016;216:33–7. published maps and institutional affiliations. 23. Dahmani M, Alwassouf S, Grech-angelini S, Marié J, Davoust B, Charrel RN. Seroprevalence of Toscana virus in dogs from Corsica, France. Parasit Received: 13 April 2017 Accepted: 6 June 2017 Vectors. 2016;9:381. 24. Maquart M, Dahmani M, Marié J-L, Gravier P, Leparc-Goffart I, Davoust B. First serological evidence of West Nile virus in horses and dogs from References Corsica Island, France. Int J Infect Dis. 2016;53:58. 1. Rar V, Golovljova I. Anaplasma, Ehrlichia, and “ Candidatus Neoehrlichia” 25. Guglielmone AA, Robbins RG, Apanaskevich DA, Petney TN, Estrada-Peña A, bacteria: Pathogenicity, biodiversity, and molecular genetic characteristics, a Horak IG. The hard ticks of the World (Acari: Ixodidae: Ixodidae). Dordrecht: review. Infect Genet Evol. 2011;11:1842–61. Springer; 2014. 2. de la Fuente J, Kocan KM, Blouin EF, Zivkovic Z, Naranjo V, Almazán C, et al. 26. Estrada-Peña A, Bouattour A, Camicas JL, Walker AR. Ticks of domestic Functional genomics and evolution of tick-Anaplasma interactions and animals in the Mediterranean region. Zaragoza: University of Zaragoza; 2004. vaccine development. Vet Parasitol. 2010;167:175–86. 27. Beati L, Keirans JE. Analysis of the systematic relationships among ticks of 3. Baldridge GD, Scoles GA, Burkhardt NY, Kurtti TJ, Munderloh UG, Baldridge GD, the genera Rhipicephalus and Boophilus (Acari: Ixodidae) based on et al. Transovarial transmission of Francisella-like endosymbionts and Anaplasma mitochondrial 12S ribosomal DNA gene sequences and morphological phagocytophilum variants in Dermacentor albipictus (Acari: Ixodidae ). J Med characters. J Parasitol. 2001;87:32–48. Entomol. 2009;46:625–32. 28. Dahmani M, Davoust B, Rousseau F, Raoult D, Fenollar F, Mediannikov O. 4. Moniuszko A, Rückert C, Alberdi MP, Barry G, Stevenson B, Fazakerley JK, et al. Natural Anaplasmataceae infection in Rhipicephalus bursa ticks collected from Coinfection of tick cell lines has variable effects on replication of intracellular sheep in the French Basque Country. Ticks Tick Borne Dis. 2017;8:18–24. bacterial and viral pathogens. Ticks Tick Borne Dis. 2014;5:415–22. 29. Dahmani M, Bernard D, Seghir BM, Fenollara F, Raoulta D, Mediannikov O. 5. Rikihisa Y. Anaplasma phagocytophilum and Ehrlichia chaffeensis: subversive Development of a new PCR-based assay to detect Anaplasmataceae and manipulators of host cells. Nat Rev Microbiol. 2010;8:328–39. the first report of Anaplasma phagocytophilum and Anaplasma platys in 6. Stuen S, Granquist EG, Silaghi C. Anaplasma phagocytophilum a widespread cattle from Algeria. Comp Immunol Microbiol Infect Dis. 2015;4:39–45. multi-host pathogen with highly adaptive strategies. Front Cell Infect 30. Dahmani M, Loudahi A, Mediannikov O, Fenollar F, Raoult D, Davoust B. Microbiol. 2013;3:31. Molecular detection of Anaplasma platys and Ehrlichia canis in dogs from 7. Katargina O, Geller J, Alekseev A, Dubinina H, Efremova G, Mishaeva N, et al. Kabylie, Algeria. Ticks Tick Borne Dis. 2015;6:198–203. Identification of Anaplasma phagocytophilum in tick populations in Estonia, 31. Hall TA. BioEdit: a user-frindly biological sequence alignment editor and the European part of Russia and Belarus. Clin Microbiol Infect. 2011;18:7–9. analysis program for Windows 95/98/NT. Nucl Acids Symp Ser. 1999;41:95–8. 8. Cochez C, Ducoffre G, Vandenvelde C, Luyasu V, Heyman P. Human 32. Kumar S, Stecher G, Tamura K. MEGA7: Molecular evolutionary genetics anaplasmosis in Belgium: a 10-year seroepidemiological study. Ticks Tick analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:msw054. Borne Dis. 2011;2:156–9. 33. Djiba ML, Mediannikov O, Mbengue M, Thiongane Y, Molez J-F, Seck MT, et 9. Väisänen E, Kuisma I, Phan TG, Delwart E, Lappalainen M, Tarkka E, et al. al. Survey of Anaplasmataceae bacteria in sheep from Senegal. Trop Anim Granulocytic anaplasmosis acquired in Scotland. Emerg Infect Dis. Health Prod. 2013;45:1557–61. 2014;20:7–9. 34. Ferrolho J, Antunes S, Santos AS, Velez R, Padre L, Cabezas-Cruz A, et al. 10. Jin H, Wei F, Liu Q, Qian J. Epidemiology and control of human Detection and phylogenetic characterization of Theileria spp. and granulocytic anaplasmosis: a systematic review. Vector Borne Zoonotic Anaplasma marginale in Rhipicephalus bursa in Portugal. Ticks Tick Borne Dis. 2012;12:269–74. Dis. 2016;7:443–8.

189 Dahmani et al. Parasites & Vectors (2017) 10:302 Page 12 of 12

35. Raele DA, Galante D, Pugliese N, De Simone E, Cafiero MA. Coxiella-like endosymbiont associated to the “Anatolian brown tick” Rhipicephalus bursa in Southern Italy. Microbes Infect. 2015;17:799–805. 36. Walker JB, Keirans JE, Horak IG. The genus Rhipicephalus (Acari, Ixodidae): a guide to the brown ticks of the world. Cambridge: Cambridge University Press; 2005. 37. De La Fuente J, Naranjo V, Ruiz-Fons F, Vicente J, Estrada-Peña A, Almazán C, et al. Prevalence of tick-borne pathogens in ixodid ticks (Acari: Ixodidae) collected from European wild boar (Sus scrofa) and Iberian red deer (Cervus elaphus hispanicus) in central Spain. Eur J Wildl Res. 2004;50:187–96. 38. René-martellet M, Lebert I, Chêne J, Massot R, Leon M, Leal A, et al. Diagnosis and incidence risk of clinical canine monocytic ehrlichiosis under field conditions in Southern Europe. Parasit Vectors. 2015;8:3. 39. Masala G, Chisu V, Foxi C, Socolovschi C, Raoult D, Parola P. First detection of Ehrlichia canis in Rhipicephalus bursa ticks in Sardinia, Italy. Ticks Tick Borne Dis. 2012;3:396–7. 40. Torina A, Blanda V, Antoci F, Scimeca S, Agostino RD, Scariano E, et al. A molecular survey of Anaplasma spp., Rickettsia spp., Ehrlichia canis and Babesia microti in foxes and fleas from Sicily. Transbound Emerg Dis. 2013;60:125–30. 41. Real C, Sciences H, Animal S, Madrid D. Molecular evidence of Ehrlichia canis and Rickettsia massiliae in ixodid ticks. Acta Vet Hung. 2013;61:42–50. 42. Hornok S, Meli ML, Perreten A, Farkas R, Willi B, Beugnet F, et al. Molecular investigation of hard ticks (Acari: Ixodidae) and fleas (Siphonaptera: Pulicidae) as potential vectors of rickettsial and mycoplasmal agents. Vet Microbiol. 2010;140:98–104. 43. Bonnet S, de la Fuente J, Nicollet P, Liu X, Madani N, Blanchard B, et al. Prevalence of tick-borne pathogens in adult Dermacentor spp. ticks from nine collection sites in France. Vector Borne Zoonotic Dis. 2013;13:226–36. 44. Zobba R, Anfossi AG, Pinna Parpaglia ML, Dore GM, Chessa B, Spezzigu A, et al. Molecular investigation and phylogeny of Anaplasma spp. in Mediterranean ruminants reveal the presence of neutrophil-tropic strains closely related to A. platys. Appl Environ Microbiol. 2014;80:271–80. 45. de la Fuente J, Torina A, Caracappa S, Tumino G, Furlá R, Almazán C, et al. Serologic and molecular characterization of Anaplasma species infection in farm animals and ticks from Sicily. Vet Parasitol. 2005;133:357–62. 46. Torina A, Galindo RC, Vicente J, Di MV, Russo M, Aronica V, et al. Characterization of Anaplasma phagocytophilum and A. ovis infection in a naturally infected sheep flock with poor health condition. Trop Anim Health Prod. 2010;42:1327–31. 47. Víchová B, Majláthová V, Nováková M, Stanko M, Hvišcová I, Pangrácová L, et al. Anaplasma infections in ticks and reservoir host from Slovakia. Infect Genet Evol. 2014;22:265–72. 48. Hornok S, de la Fuente J, Biró N, Fernández de Mera IG, Meli ML, Elek V, et al. First molecular evidence of Anaplasma ovis and Rickettsia spp. in keds (Diptera: Hippoboscidae) of sheep and wild ruminants. Vector Borne Zoonotic Dis. 2011;11:1319–21. 49. Torina A, Caracappa S. Tick-borne diseases in sheep and goats: clinical and diagnostic aspects. Small Rumin Res. 2012;106:S6–S11. 50. Ioannou I, Sandalakis V, Kassinis N, Chochlakis D, Papadopoulos B, Loukaides F, et al. Tick-borne bacteria in mouflons and their ectoparasites in Cyprus. J Wildl Dis. 2011;47:300–6. 51. de la Fuente J, Ruiz-Fons F, Naranjo V, Torina A, Rodríguez O, Gortázar C. Evidence of Anaplasma infections in European roe deer (Capreolus capreolus) from southern Spain. Res Vet Sci. 2008;84:382–6. 52. Stuen S. Tick-borne infections in small ruminants in northern Europe. Small Rumin Res. 2013;110:142–4. 53. Kocan KM, de la Fuente J, Blouin EF, Coetzee JF, Ewing S. The natural Submit your next manuscript to BioMed Central history of Anaplasma marginale. Vet Parasitol. 2010;167:95–107. 54. Hornok S, Mester A, Takács N, Fernández de Mera IG, de la Fuente J, Farkas R. and we will help you at every step: Re-emergence of bovine piroplasmosis in Hungary: has the etiological role of • We accept pre-submission inquiries Babesia divergens been taken over by B. major and Theileria buffeli?Parasit Vectors. 2014;7:434. • Our selector tool helps you to ﬁnd the most relevant journal 55. Decaro N, Larocca V, Parisi A, Losurdo M, Lia RP, Greco MF, et al. Clinical • We provide round the clock customer support bovine piroplasmosis caused by Babesia occultans in Italy. J Clin Microbiol. • Convenient online submission 2013;51:2432–4. 56. Thumbi SM, Bronsvoort BMDC, Poole EJ, Kiara H, Toye PG, Mbole-Kariuki MN, • Thorough peer review et al. Parasite co-infections and their impact on survival of indigenous cattle. • Inclusion in PubMed and all major indexing services PLoS One. 2014;9:e76324. • Maximum visibility for your research

Submit your manuscript at www.biomedcentral.com/submit

190

Tahir D, Davoust ARTICLEB, Heu K, 10Lamour T, Marié JL and Blanchet D. Molecular and serological investigation of Trypanosoma cruzi infection in dogs in French Guiana. Vet. Parasitol. Reg. Stud. Rep. 2017.

191

9HWHULQDU\3DUDVLWRORJ\5HJLRQDO6WXGLHVDQG5HSRUWV[[[ [[[[ [[[²[[[

Contents lists available at ScienceDirect

Veterinary Parasitology: Regional Studies and Reports

journal homepage: www.elsevier.com/locate/vprsr

Short communications Molecular and serological investigation of Trypanosoma cruzi infection in dogs in French Guiana

Djamel Tahira, Bernard Davousta,b, Katy Heuc, Thierry Lamourb, Magali Demarc, Jean-Lou Mariéa,b, Denis Blanchetc,⁎ a Research Unit of Emerging Infectious and Tropical Diseases (URMITE) – IHU Méditerranée Infection. Aix Marseille Univ, CNRS, IRD, INSERM, AP-HM, Marseille, France b Animal Epidemiology Working Group of the Military Health Service, DRSSA Toulon, France c University Medical Parasitology and Mycology Laboratory, Centre Hospitalier A. Rosemon, Cayenne, France

ARTICLE INFO ABSTRACT

Keywords: Clinical cases of Chagas disease, an infection caused by the parasite Trypanosoma cruzi, have been recently Trypanosoma cruzi described in humans and dogs in French Guiana, a French overseas department located in South America. Dog Elsewhere in endemic countries for this disease, cases of asymptomatic infections have been described. We French Guiana performed a prevalence survey of the infection in dogs in Cayenne and Kourou, the main cities of French Guiana. In 2014 and 2016, blood samples were taken from 153 dogs from Cayenne and Kourou. All dogs were apparently healthy at the time of sampling. Sex and age of the dogs were recorded as well as the location where they lived. Serum samples from dogs were screened using a rapid immunochromatographic test (Chagas Stat-Pak®Assay, Chembio, USA) detecting anti-T. cruzi antibodies. Simultaneously, a real-time PCR targeting T. cruzi kDNA was performed on the blood samples of the dog. Six dogs (3.9%) were positive only in serology and one (0.6%) only in qPCR. Two dogs were positive for both tests. The prevalence of infection (positivity for one of the two tests) was 5.8% (9/153). There was no signiﬁcant diﬀerence (χ2 test) between Cayenne (5/100) and Kourou (4/53), between males (3/60) and females (6/93), or between 2014 (2/55) and 2016 (7/98). Canine surveillance is a useful tool for the public health risk assessment of Chagas disease. Positive dogs, even when asymptomatic, should be treated as they can serve as a reservoir for T. cruzi.

1. Introduction significant immigration from Brazil, and deforestation led to relatively large disruptions in the environment. At the same time, during previous Initially described in Brazil in a human by Carlos Chagas in 1909, years, the number of human and canine cases increased significantly Chagas disease, or American trypanosomiasis, is a major public health and Chagas disease is now considered emerging in French Guiana. problem in Latin America (Stanaway and Roth, 2015). It is a zoonotic Thus, between January 1990 and March 2005, 15 cases of Chagas infection caused by the protozoon Trypanosoma cruzi and is most often disease were identified, including 6 acute cases, and in 2005, 36 con- transmitted by Triatominae insect vectors, but also through blood firmed cases, including 21 acute cases (among these were 8 grouped transfusion, organ transplant, and congenitally. This vector-borne cases, following ingestion of contaminated food) were reported parasitic disease in the New World is characterized by a high pre- (Jeannel et al., 2005; Blanchet et al., 2014). valence in endemic areas (from the southern United States to southern In French Guiana, among the fourteen triatomines species potential Argentina) (Stanaway and Roth, 2015). This tropical parasitic zoonosis vectors of T. cruzi, three species (Panstrongylus geniculatus, Rhodnius concerns 5 to 18 million people, 2 to 3 million of whom develop serious robustus, and Rhodnius pictipes) are likely to come into contact with complications (digestive and/or heart disease, and/or neurological humans, being attracted by the lights in homes (Chippaux et al., 1985; manifestation) and some 10,000 succumb annually (Stanaway and Bérenger et al., 2009; Peneau et al., 2014). Their rate of infection by T. Roth, 2015). cruzi oscillates between 46 and 66%, with an even higher value for In French Guiana, 13 human cases diagnosed between 1939 and insects in the Cayenne region (Pagès F., personal communication). One 1996 were considered sporadic following forest exposition (Floch and of these three species (P. geniculatus) is described as having a high Tasqué, 1941; Jeannel et al., 2005). Rapid population growth, potential for domiciliation, as already observed in Venezuela

⁎ Corresponding author. E-mail address: [email protected] (D. Blanchet). http://dx.doi.org/10.1016/j.vprsr.2017.06.004 Received 2 December 2016; Received in revised form 16 May 2017; Accepted 3 June 2017

3XEOLVKHGE\(OVHYLHU%9

3OHDVHFLWHWKLVDUWLFOHDV7DKLU'9HWHULQDU\3DUDVLWRORJ\5HJLRQDO6WXGLHVDQG5HSRUWV KWWSG[GRLRUJMYSUVU 193 D. Tahir et al. 9HWHULQDU\3DUDVLWRORJ\5HJLRQDO6WXGLHVDQG5HSRUWV[[[ [[[[ [[[²[[[

(Feliciangeli et al., 2004). Table 1 All mammals are potential hosts for T. cruzi, but dogs and cats are Prevalence of canine infection with Trypanosoma cruzi in two localities in French Guiana. reservoirs of the parasites in proximity to humans (Barr, 2009; Esch and Year Number of Only Chembio® Stat- Only PCR For both tests Petersen, 2013; Gürtler and Cardinal, 2015) or can act as sentinels of dogs Pak positives T.cruzi positives positives infection (Saldaña et al., 2015). Chagas disease is also clinically observed in dogs in French Guiana. A ﬁve-month-old puppy found at the 2014 55 2 0 0 border with Suriname presented hyperthermia, generalized edema, and 2016 98 4 1 2 Total 153 6 (3.9%) 1 (0.6%) 2 (1.3%) polyanedomegalia. The microscopic blood test showed the presence of Trypanosoma spp. Serology and PCR were positive for T. cruzi (Baud'huin and Le Pelletier, 2007). From 2003 to 2005, among 60 respectively. suspected dogs examined in veterinary clinics of French Guiana (especially in Cayenne), 23 were PCR positive and 17 died of the disease 2.4. Statistical analysis (unpublished data). The dogs probably became infected by swallowing triatomines (Barr, 2009). Elsewhere in countries endemic for this dis- To obtain information on potential associations between the results ease, cases of asymptomatic infections have been described. In this and the sex or geographical location of the dogs, Pearson's chi-squared study we carried out a prevalence survey of the infection in dogs from test (χ2) was applied. The value of P < 0.05 was considered sig- the cities of Cayenne and Kourou which are situated along the Atlantic niﬁcant. coast.

2. Material and methods 3. Results

2.1. Animals Six dogs (3.9%) were positive only in serology, and one (0.6%) only in qPCR (Table 1). Two dog (1.3%) were positive for both tests. The rate This study was conducted in January 2014 and January 2016. One of infection (positivity for either of the two tests) is 5.8% (9/153). Of hundred dogs were studied in Cayenne (4° 56′ 4.6″ N, 52° 19′ 49.19″ the seven pet dogs' cohort, tested twice, two years apart, one dog had a W), the capital of Guiana with 55,000 residents. Some 60 km northwest negative qPCR in 2014, which turned positive in 2016 (Ct 18), while of Cayenne, we collected samples from 53 dogs in Kourou (5° 9′ 34.92″ the serology was negative both in 2014 and 2016. This apparently ff N, 52° 39′ 1.08″ W). Blood collection was made by cephalic veni- healthy Italian Masti is a 10-year-old female, living primarily out- puncture using EDTA tubes; all samples were stored at +4 °C for doors, on the edge of a forest near Cayenne, where opossums (Didelphis transport to our laboratory. Ethical aspects relating to dog sampling marsupialis) are common. Seven out of the eight dogs which were sero- was made in accordance with the French law. The dogs came from dog positive, tested negative in qPCR, while two dogs were giving positive shelters from both cities and from some private dog owners in Cayenne, results in qPCR but were negative in serology. Two of the three dogs who gave their consent. Overall, blood samples were taken from 153 were found positives for both tests. Furthermore, the qPCR of T. evansi adult dogs, all apparently healthy, including 93 females and 60 males, and T. vivax were negative for all 153 dogs. fi ff of which 55 were sampled in 2014, and 98 in 2016. A cohort of seven There was no statistical signi cant di erence in the prevalence of T. pet dogs was collected in 2014 and 2016. cruzi infection between Cayenne (5/100) and Kourou (4/53), between males (3/60) and females (6/93), or between 2014 (2/55) and 2016 (7/ 2.2. DNA extraction and molecular detection of protozoa in blood 98).

Total DNA was extracted in a final volume of 100 μL from each dog 4. Discussion blood sample using the commercial kit EZ1® DNA Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions. Before French Guiana has long been considered a low-risk area for the extraction, samples were digested with 25 μL of proteinase K at +56 °C emergence of Chagas' disease, with vectors and the parasite certainly for 16 h. The genomic DNA was stored at −20 °C until its use as a present in the Guianese forest, but with the cycle of T. cruzi considered template in PCR assays. The qPCR was performed using a set of primers exclusively sylvatic. In the sylvatic cycle, the parasite circulates be- and probes from T. cruzi kDNA, as previously described (Blanchet et al., tween Triatominae and many species of arboreal and terrestrial mam- 2014). The assay was carried out in duplicate in a final volume of 25 μL mals, which are considered reservoirs (Lewicka et al., 1995). Thirty containing Taqman® Gene expression Master mix (Applied Biosys- species of mammals, including marsupials, toothless, bats, rodents, tems™, Foster City, USA), 900 nM of each primer, 250 nM of probe and carnivores, and primates have been identified as reservoirs in the Bra- 5 μL of template DNA. Reactions were processed and analyzed in an zilian Amazon (Coura et al., 2002). Most of these animals do not Applied Biosystems® 7500 Real-Time PCR System (Applied Biosys- manifest clinical forms of the disease. In the domestic cycle, dogs are tems™, Foster City, USA). Sterile water was used as a negative control; the main reservoir, but cats and synanthropic animals such as opossums T. cruzi DNA was used as a positive control. The samples were con- and rodents also play a role (Dedet et al., 1985). During an epidemio- sidered positive for T. cruzi when the threshold cycle (Ct) for the T. cruzi logical survey in French Guiana, three species of Marsupiala were found target was < 45. A qPCR specific for T. evansi and T. vivax have been infected by T. cruzi, with high infection rates including 30.8% of 68 implemented according to the same type of protocol, with control Didelphis marsupialis (Dedet et al., 1985). samples on slides, where the parasites were visualized. Direct detection of the parasite in the blood by microscopy, hae- moculture, xenodiagnosis or nucleic acid detection is highly specific. 2.3. Serological examination for the presence of anti-T. cruzi antibodies Serological assays for detecting antibodies directed at T. cruzi are generally used for screening surveys. In the present study, we reported Each serum was examined for the presence of a unique combination for the first time, in this area, the presence of healthy dogs carrying of a specific antibody binding protein which is conjugated to dye par- antibodies anti-T. cruzi. The Chembio® CHAGAS Stat Pak test (im- ticles and antigens which are in turn bound to the membrane (solid munochromatography) is specific (95.3%) and sensitive (93%) phase) using the commercial Chembio® CHAGAS Stat Pak (Chembio, (Luquetti et al., 2003; World Health Organization, 2010). In humans, New York, USA) immunochromatographic test. According to the man- according to the nature of the antigen used in the assay, there may be ufacturer, the sensitivity and specificity of the kits are 99.6 and 99.9%, cross reactions with Leishmania spp. That cross-reaction has also been

194

186 D. Tahir et al. 9HWHULQDU\3DUDVLWRORJ\5HJLRQDO6WXGLHVDQG5HSRUWV[[[ [[[[ [[[²[[[

reported in dogs (Calzada et al., 2015). In dogs, it can produce false- Biomedical Research Involving Animals. positive results during infection with T. evansi, which can be found in hunting dogs (unpublished data). In our study, there were few hunting Conflict of interest statement dogs and/or dogs living near cattle or horses (main reservoirs of T. evansi), which explains the absence of infection by this parasite. It has The authors declare that there have no actual or potential conflicts already been demonstrated that the immunochromatographic test is of interest including any financial, personal or other relationships with highly powerful in terms of sensitivity and specificity, compared to other people or organizations within three years of beginning the standard methods such as the immunofluorescence assay test (IFAT) submitted work that could be perceived to influence, their work. (Nieto et al., 2009). Our seroprevalence result (5.2%) is close to that observed in Texas: 8.8% (Tenney et al., 2014). In Mexico, in a survey of Acknowledgment 262 dogs, seroprevalence was 7.6% (Balan et al., 2011). The negative results in the qPCR detection of T. evansi in dog blood samples cannot This study was also supported by the AMIDEX project (No. ANR-11- be explained by its absence in Guianan dog population. It has been IDEX-0001-02), funded by the ‘Investissements d'Avenir’ French reported that, in endemic area, dogs living in a rural area were most Government program, managed by the French National Research frequently affected with T. evansi (Bono Battistoni et al., 2016). The Agency (ANR) and the Fondation Méditerranée Infection (www.medi- results reveal discordances between qPCR and serology. One dog po- terranee-infection.com). The funders had no role in study design, data sitive for qPCR and seronegative could be in the acute phase of the collection and analysis, decision to publish, or preparation of the infection, before antibodies can be detected. For five dogs, the positive manuscript. results obtained in immunological tests were not confirmed by qPCR; suggesting a contact with the parasite. References The follow-up of the seven-dog cohort showed that one dog became infected between 2014 and 2016, illustrating an active transmission of Aznar, C., La Ruche, G., Laventure, S., Carme, B., Liégeard, P., Hontebeyrie, M., 2004. the disease in Cayenne. This pet dog remained on the property of the Seroprevalence of Trypanosoma cruzi infection in French Guiana. Mem. Inst. Oswaldo Cruz 99 (8), 805–808. owner, near the forest, during the whole period; thus the contamination Balan, L.U., Yerbes, I.M., Piña, M.A., Balmes, J., Pascual, A., Hernández, O., Lopez, R., occurred in Cayenne (autochthonous case). Monteón, V., 2011. Higher seroprevalence of Trypanosoma cruzi infection in dogs Our study is a preliminary one which needs to be extended con- than in humans in an urban area of Campeche, Mexico. Vector Borne Zoonotic Dis. 11 ff ff (7), 843–844. sidering di erent dog populations exposed to di erent environmental Barr, S.C., 2009. Canine Chagas' disease (American Trypanosomiasis) in North America. factors (including vegetation) and followed during several years (cohort Vet. Clin. North Am. Small Anim. Pract. 39 (6), 1055–1064. follow-up) (Saldaña et al., 2015; Fung et al., 2014). Baud'huin, B., Le Pelletier, C., 2007. Cas clinique: maladie de Chagas chez un chien. In: Le – In humans, the global seroprevalence of anti-T. cruzi extrapolated to Point Vétérinaire. Vol. 272. pp. 62 66. Bérenger, J.M., Pluot-Sigwalt, D., Pagès, F., Blanchet, D., Aznar, C., 2009. The triatominae the entire population of French Guiana was 5% (Aznar et al., 2004). The species of French Guiana (Heteroptera: Reduviidae). Mem. Inst. Oswaldo Cruz 104, discordant results (positive serology and PCR negative) could be ex- 1111–1116. plained by a chronic infection with a parasitaemia too low to be de- Blanchet, D., Brenière, S.F., Schijman, A.G., Bisio, M., Simon, S., Véron, V., Mayence, C., Demar-Pierre, M., Djossou, F., Aznar, C., 2014. First report of a family outbreak of tected by molecular biology. Both positive PCR and negative serology Chagas disease in French Guiana and posttreatment follow-up. Infect. Genet. Evol. can be explained by the immune system's failure in these dogs. In hu- 28, 245–250. mans, the molecular methods show poor performance when used in the Bono Battistoni, M.F., Orcellet, V., Peralta, J.L., Marengo, R., Plaza, D., Brunini, A., Ruiz, M., Widenhorn, N., Sanchez, A., Monje, L., Cignetti, L., 2016. First report of diagnosis of patients with chronic Chagas disease, whereas PCR can be Trypanosoma evansi in a canine in Argentina. Vet. Parasitol. 6, 1–3. successfully used to diagnose acute and congenital cases (Qvarnstrom Calzada, J.E., Saldaña, A., González, K., Rigg, C., Pineda, V., Santamaría, A.M., et al., 2012; Duarte et al., 2014). Furthermore, the qPCR method may Rodriguez, I., Gottdenker, N., Laurenti, M.D., Chaves, L.F., 2015. Cutaneous fi Leishmaniasis in dogs: is high seroprevalence indicative of a reservoir role? lack speci city and produce false-positive results with T. rangeli but not Parasitology 142, 1202–1214. with T. evansi (unpublished data). Chippaux, J.P., Pajot, F.X., Geoffroy, B., Tavakilian, G., 1985. Etude préliminaire sur l'écologie et la systématique des triatomes (Hemiptera, Reduviidae) en Guyane fra- nçaise. Cahier ORSTOM, série Entomologie Médicale et Vétérinaire 23, 75–85. 5. Conclusion Coura, J.R., Junqueira, A.C., Fernandes, O., Valente, S.A., Miles, M.A., 2002. Emerging Chagas disease in Amazonian Brazil. Trends Parasitol. 18 (4), 171–176. The dog, and to a lesser extent the cat, are considered the main Dedet, J.P., Chippaux, J.P., Goyot, P., Pajot, F.X., Tibayrenc, M., Geoffroy, B., Gosselin, domestic reservoirs of T. cruzi in the human environment in many re- H., Jacquet-Vialet, P., 1985. Natural hosts of Trypanosoma cruzi in French Guiana. High endemicity of zymodeme 1 in wild marsupials. [Article in French] Ann. gions where Chagas disease is endemic. This has been well studied in Parasitol. Hum. Comp. 60 (2), 111–117. Argentina, where the intervention program based on domestic spraying Duarte, L.F., Flórez, O., Rincón, G., González, C.I., 2014. Comparison of seven diagnostic with pyrethroid insecticides showed a decrease in canine infections tests to detect Trypanosoma cruzi infection in patients in chronic phase of Chagas disease. Colomb. Med. (Cali). 45 (2), 61–66. (Gürtler and Cardinal, 2015). In the Amazonian region, where the do- Esch, K.J., Petersen, C.A., 2013. Transmission and epidemiology of zoonotic protozoal mestic cycle of T. cruzi still does not exist, canine surveillance is a useful diseases of companion animals. Clin. Microbiol. Rev. 26 (1), 58–85. tool as an indicator of triatomine intrusion into the human environ- Feliciangeli, M.D., Carrasco, H., Patterson, J.S., Suarez, B., Martinez, C., Medina, M., 2004. Mixed domestic infestation by Rhodnius prolixus Stal, 1859 and Panstrongylus ment. In such an epidemiological context, dogs or another domestic geniculatus Latreille, 1811, vector incrimination, and seroprevalence for Trypanosoma animal may not have a significant role as reservoir. However, even if cruzi among inhabitants in El Guamito, Lara State, Venezuela. Am. J. Trop. Med. Hyg. the potential risk relating to dogs is very low, it is necessary to take 71, 501–505. Floch, H., Tasqué, P., 1941. Un cas de maladie de Chagas en Guyane française. Bull. Soc. measures and to remain vigilant. Seriously ill dogs, during the acute Pathol. Exot. 34, 137–139. phase, must be euthanized or treated with benznidazole. Eventually, Fung, H.L., Calzada, J., Saldaña, A., Santamaria, A.M., Pineda, V., Gonzalez, K., Chaves, the interest of preventive dog treatments, using spot-on insecticides L.F., Garner, B., Gottdenker, N., 2014. Domestic dog health worsens with socioeconomic deprivation of their home communities. Acta Trop. 135, 67–74. active against triatomines, has been assessed. Such treatments con- Gürtler, R.E., Cardinal, M.V., 2015. Reservoir host competence and the role of domestic tribute to decrease the populations of bugs in the environment of the and commensal hosts in the transmission of Trypanosoma cruzi. Acta Trop. 151, treated animals (Tahir et al., 2016). 32–50. Jeannel, D., Noireau, F., Chaud, P., 2005. Émergence de la maladie de Chagas en Guyane française, évaluation en 2005 et perspectives. In: Rapport de l'Institut de veille sa- Ethical statement nitaire, (85p). Lewicka, K., Breniere-Campana, S.F., Barnabé, C., Dedet, J.P., Tibayrenc, M., 1995. An Ethical aspects related with dog sampling followed regulations by isoenzyme survey of Trypanosoma cruzi genetic variability in sylvatic cycles from French Guiana. Exp. Parasitol. 81, 20–28. French law and meet the International Guiding Principles for

195

187 D. Tahir et al. 9HWHULQDU\3DUDVLWRORJ\5HJLRQDO6WXGLHVDQG5HSRUWV[[[ [[[[ [[[²[[[

Luquetti, A.O., Ponce, C., Ponce, E., Esfandiari, J., Schijman, A., Revollo, S., Añez, N., Saldaña, A., Calzada, J.E., Pineda, V., Perea, M., Rigg, C., González, K., Santamaria, A.M., Zingales, B., Ramgel-Aldao, R., Gonzalez, A., Levin, M.J., Umezawa, E.S., Franco da Gottdenker, N.L., Chaves, L.F., 2015. Risk factors associated with Trypanosoma cruzi Silveira, J., 2003. Chagas'disease diagnosis: A multicentric evaluation of Chagas Stat- exposure in domestic dogs from a rural community in Panama. Mem. Inst. Oswaldo Pak, a rapid immunochromatographic assay with recombinant proteins of Cruz 110, 936–944. Trypanosoma cruzi. Microbiol. Infect. Dis. 46, 265–271. Stanaway, J.D., Roth, G., 2015. The burden of Chagas disease: estimates and challenges. Nieto, P.D., Boughton, R., Dorn, P.L., Streurer, F., Raychaudhuri, S., Esfandiari, J., Glob. Heart 10 (3), 139–144. Gonçalves, E., Diaz, J., Malone, J.B., 2009. Comparaison of two immunochromato- Tahir, D., Davoust, B., Varloud, M., Berenger, J.-M., Raoult, D., Almeras, L., Parola, P., graphic assays and the indirect immunofluorescence antibody test for diagnosis of 2016. Assessment of the anti-feeding and insecticidal effects of the combination of Trypanosoma cruzi infection in dogs in south central Louisiana. Vet. Parasitol. 165, dinotefuran, permethrin and pyriproxyfen (Vectra® 3D) against Triatoma infestans on 241–247. rats. Med. Vet. Entomol. http://dx.doi.org/10.1111/mve.12206. Peneau, J., Blanchet, D., de Thoisy, B., Aznar, C., 2014. Genetic diversity of Trypanosoma Tenney, T.D., Curtis-Robles, R., Snowden, K.F., Hamer, S.A., 2014. Shelter dogs as sen- cruzi circulating in mammals and triatomines collected in urban areas, in French tinels for Trypanosoma cruzi transmission across Texas, USA. Emerg. Infect. Dis. 20, Guiana. Acad. J. Suriname. 5, 456–460. 1323–1326. Qvarnstrom, Y., Schijman, A.G., Veron, V., Aznar, C., Steurer, F., da Silva, A.J., 2012. World Health Organization, 2010. Anti-Trypanosoma cruzi Assays: Operational Sensitive and specific detection of Trypanosoma cruzi DNA in clinical specimens using Characteristics, Report 1. Geneva, Switzerland. (pp 38). a multi-target real-time PCR approach. PLoS Negl. Trop. Dis. 6, e1689.

196

RESUME

Les moustiques et les tiques sont les principaux vecteurs incriminés dans la transmission d’agents pathogènes aux carnivores et à l’homme. Les dirofilarioses sont des infections parasitaires transmises par différentes espèces de moustiques. Ces maladies parasitaires sont imputables à deux espèces de filaires : Dirofilaria immitis et Dirofilaria repens adaptées aux hôtes canins, félins et humains. Dans ce travail, nous nous sommes intéressés à l’étude des dirofilarioses chez le réservoir canin « le chien » ainsi que chez les vecteurs « moustiques », en particulier, en ce qui concerne la détection, la surveillance et la prophylaxie. Le premier objectif était de développer une PCR duplex en temps réel ciblant le gène COI capable de détecter et de différencier simultanément D. immitis et D. repens à partir d'échantillons de moustiques ou de sang périphérique chez les carnivores. Par la suite, nous avons appliqué cet outil pour la surveillance de la dirofilariose canine dans différentes zones enzootiques du bassin méditerranéen (Corse et Algérie). Ainsi, nous avons détecté par cet outil moléculaire, pour la première fois en France, D. immitis et D. repens chez des moustiques tigre « Aedes albopictus (ou Stegomyia albopicta) » collectés en Corse. Nous avons, de plus, confirmé la présence de l’infection à D. immitis chez les chiens du nord de l'Algérie. Le deuxième objectif était d'évaluer l’intérêt de la spectrométrie de masse, MALDI-TOF MS, pour la détection de changements dans les profils protéiques d'Aedes aegypti infectés expérimentalement avec des nématodes filaires (D. immitis, Brugia malayi et B. pahangi) par rapport à ceux qui ne sont pas infectés, et ce, en testant différentes parties des moustiques. Les résultats obtenus montrent la capacité du MALDI-TOF MS à différencier des moustiques infectés et non infectés par les filaires. Ainsi, les meilleurs taux de classification correcte ont été obtenus à partir de la partie « tête-thorax » du moustique avec 94,1%, 86,6%, 71,4% et 68,7% pour les non infectés versus ceux infectés, respectivement, par D. immitis, B. malayi et B. pahangi. Le troisième objectif de ce travail était l’évaluation de l'efficacité anti-gorgement et insecticide d'un ectoparasiticide (Vectra® 3D) contenant trois principes actifs : le dinotéfurane, le pyriproxyfène et la perméthrine (DPP) contre Ae. albopictus, l'une des principales espèces vectrices de Dirofilaria spp. ceci en utilisant un modèle murin. Les résultats ont démontré que le DPP a une efficacité anti-gorgement et insecticide significative contre Ae. albopictus pendant au moins un mois, suggérant que cette combinaison (DPP) aurait une bonne efficacité contre un des vecteurs de la dirofilariose canine.

Mots-clés : Moustiques, Dirofilaria spp., PCR en temps réel, MALDI-TOF MS, ectoparasiticide et surveillance. ABSTRACT

Mosquitoes and ticks are the main vectors of pathogen transmission to carnivores and humans. Dirofilarial diseases are mosquito-borne parasitic infections caused by two main filarial species (Dirofilaria immitis and Dirofilaria repens) which have adapted to canine, feline, and human hosts. In this work, we are interested in studying dirofilarial infections in dogs and vectors “Mosquitoes” especially detection, monitoring and prophylaxis. The first objective is to develop a real-time duplex PCR targeting the COI gene capable of simultaneously detecting and differentiating D. immitis and D. repens from a sample of mosquitos or of a peripheral blood sample in carnivores. Subsequently, we applied this tool to a canine dirofilariosis surveillance process in different endemic areas of Mediterranean basin (Corsica and Algeria). We have thus detected by this molecular tool for the first time in France, D. immitis and D. repens in Aedes albopictus mosquitoes collected in Corsica Island. We reported, also, the presence of D. immitis in dogs from northern Algeria. The second aim was to assess whether the matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) can detect changes in the protein profiles of Aedes aegypti infected experimentaly with filarial nematodes (D. immitis, Brugia malayi and B. pahangi) compared to those uninfected by testing different parts of mosquitoes. Obtained results showed the potential of MALDI-TOF MS as a reliable tool for differentiating non-infected and filariae-infected Ae. aegypti mosquitoes with a best correct classification rate obtained from the thorax-head part with 94.1% and 86.6%, 71.4% and 68.7% for non-infected and D. immitis, B. malayi and B. pahangi infected mosquitoes respectively. The third aim of this work has focused on the evaluation of the anti-feeding and insecticidal efficacy of an ectoparasiticide (Vectra® 3D) containing three active ingredients: dinotefurane, pyriproxyfen and permethrin (DPP) against Ae. albopictus, one of the main vector species of Dirofilaria spp. and this by using a murine model. Results demonstrated that the DPP combination has significant anti-feeding and insecticidal efficacy against Ae. albopictus for at least 4 weeks, suggesting that DPP will show good efficacy against this mosquito species in dog. Key words: Mosquitoes, Dirofilaria spp., real-time PCR, MALDI-TOF MS, ectoparasiticide and monitoring.