The Metabolic Building Blocks of a Minimal Cell
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
Global Transposon Mutagenesis and a Minimal Mycoplasma Genome
R EPORTS thermore, while immunosubunit precursors- stained positive, whereas no staining of PA28Ϫ/Ϫ purchased from PharMingen (San Diego, CA). 25D1.16 containing 15S proteasome assembly inter- cells was observed. (10) and a PA28a-specific antiserum (2) were kindly 11. S. C. Jameson, F. R. Carbone, M. J. Bevan, J. Exp. Med. provided by A. Porgador and M. Rechsteiner, respective- mediates were detected in wild-type cells, 177, 1541 (1993). ly. Metabolic labeling, immunoprecipitation, immuno- under identical conditions 15S complexes 12. T. Preckel and Y. Yang, unpublished results. blotting, and sodium dodecyl sulfateÐpolyacrylamide were hardly detectable in PA28Ϫ/Ϫ cells (Fig. 13. M. Ho, Cytomegalovirus: Biology and Infection (Ple- gel electrophoresis (SDS-PAGE) were performed as de- 4B). Notably, PA28 was found to be associ- num, New York, ed. 2, 1991). scribed (3). 14. P. Borrow and M. B. A. Oldstone, in Viral Pathogenesis, 19. T. Flad et al., Cancer Res. 58, 5803 (1998). ated with the immunosubunit precursor-con- N. Nathanson, Ed. (Lippincott-Raven, Philadelphia, 20. M. W. Moore, F. R. Carbone, M. J. Bevan, Cell 54, 777 taining 15S complexes, suggesting that PA28 1997), pp. 593Ð627; M. J. Buchmeier and A. J. Zajac, (1988). is required for the incorporation of immuno- in Persistent Virus Infections, R. Ahmed and I. Chen, 21. A. Vitiello et al., Eur. J. Immunol. 27, 671 (1997). Eds. ( Wiley, New York, 1999), pp. 575Ð605. subunits into proteasomes. 22. H. Bluthmann et al., Nature 334, 156 (1988). 15. G. Niedermann et al., J. Exp. Med. 186, 209 (1997); 23. W. Jacoby, P. V. Cammarata, S. -
Essential Genes from Genome-Wide Screenings As a Resource for Neuropsychiatric Disorders Gene Discovery Wei Zhang1, Joao Quevedo 1,2,3,4 and Gabriel R
Zhang et al. Translational Psychiatry (2021) 11:317 https://doi.org/10.1038/s41398-021-01447-y Translational Psychiatry ARTICLE Open Access Essential genes from genome-wide screenings as a resource for neuropsychiatric disorders gene discovery Wei Zhang1, Joao Quevedo 1,2,3,4 and Gabriel R. Fries 1,2,5 Abstract Genome-wide screenings of “essential genes”, i.e., genes required for an organism or cell survival, have been traditionally conducted in vitro in cancer cell lines, limiting the translation of results to other tissues and non-cancerous cells. Recently, an in vivo screening was conducted in adult mouse striatum tissue, providing the first genome-wide dataset of essential genes in neuronal cells. Here, we aim to investigate the role of essential genes in brain development and disease risk with a comprehensive set of bioinformatics tools, including integration with transcriptomic data from developing human brain, publicly available data from genome-wide association studies, de novo mutation datasets for different neuropsychiatric disorders, and case–control transcriptomic data from postmortem brain tissues. For the first time, we found that the expression of neuronal essential genes (NEGs) increases before birth during the early development of human brain and maintains a relatively high expression after birth. On the contrary, common essential genes from cancer cell line screenings (ACEGs) tend to be expressed at high levels during development but quickly drop after birth. Both gene sets were enriched in neurodevelopmental disorders, but only NEGs were robustly associated with neuropsychiatric disorders risk genes. Finally, NEGs were more likely to show differential expression in the brains of neuropsychiatric disorders patients than ACEGs. -
Generated by SRI International Pathway Tools Version 25.0, Authors S
An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. Gcf_000238675-HmpCyc: Bacillus smithii 7_3_47FAA Cellular Overview Connections between pathways are omitted for legibility. -
(12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun. -
Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma Divulgatum
microorganisms Article Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma divulgatum Rafael Bargiela 1 , Karin Lanthaler 1,2, Colin M. Potter 1,2 , Manuel Ferrer 3 , Alexander F. Yakunin 1,2, Bela Paizs 1,2, Peter N. Golyshin 1,2 and Olga V. Golyshina 1,2,* 1 School of Natural Sciences, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK; [email protected] (R.B.); [email protected] (K.L.); [email protected] (C.M.P.); [email protected] (A.F.Y.); [email protected] (B.P.); [email protected] (P.N.G.) 2 Centre for Environmental Biotechnology, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK 3 Systems Biotechnology Group, Department of Applied Biocatalysis, CSIC—Institute of Catalysis, Marie Curie 2, 28049 Madrid, Spain; [email protected] * Correspondence: [email protected]; Tel.: +44-1248-388607; Fax: +44-1248-382569 Received: 27 April 2020; Accepted: 15 May 2020; Published: 19 May 2020 Abstract: The archaeon Cuniculiplasma divulgatum is ubiquitous in acidic environments with low-to-moderate temperatures. However, molecular mechanisms underlying its ability to thrive at lower temperatures remain unexplored. Using mass spectrometry (MS)-based proteomics, we analysed the effect of short-term (3 h) exposure to cold. The C. divulgatum genome encodes 2016 protein-coding genes, from which 819 proteins were identified in the cells grown under optimal conditions. In line with the peptidolytic lifestyle of C. divulgatum, its intracellular proteome revealed the abundance of proteases, ABC transporters and cytochrome C oxidase. From 747 quantifiable polypeptides, the levels of 582 proteins showed no change after the cold shock, whereas 104 proteins were upregulated suggesting that they might be contributing to cold adaptation. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Analyzing the Heterogeneous Structure of the Genes Interaction Network Through the Random Matrix Theory
Analyzing the heterogeneous structure of the genes interaction network through the random matrix theory Nastaran Allahyari1, Ali Hosseiny1, Nima Abedpour2, and G. Reza Jafari1* 1Department of Physics, Shahid Beheshti University, G.C., Evin, Tehran 19839, Iran 2Department of Translational Genomics, University of Cologne, Weyertal 115b, 50931 Cologne, Germany * g [email protected] ABSTRACT There have been massive efforts devoted to understanding the collective behavior of genes. In this regard, a wide range of studies has focused on pairwise interactions. Understanding collective performance beyond pairwise interactions is a great goal in this field of research. In this work, we aim to analyze the structure of the genes interaction network through the random matrix theory. We focus on the Pearson Correlation Coefficient network of about 6000 genes of the yeast Saccharomyces cerevisiae. By comparing the spectrum of the eigenvalues of the interaction networks itself with the spectrum of the shuffled ones, we observe clear evidence that unveils the existence of the structure beyond pairwise interactions in the network of genes. In the global network, we identify 140 eigenvectors that have unnormal large eigenvalues.It is interesting to observe that when the essential genes as the influential and hubs of the network are excluded, still the special spectrum of the eigenvalues is preserved which is quite different from the random networks. In another analysis we derive the spectrum of genes based on the node participation ratio (NPR) index. We again observe noticeable deviation from a random structure. We indicate about 500 genes that have high values of NPR. Comparing with the records of the shuffled network, we present clear pieces of evidence that these high values of NPR are a consequence of the structures of the network. -
Pantothenate Kinase-Associated Neurodegeneration
Pantothenate kinase-associated neurodegeneration Description Pantothenate kinase-associated neurodegeneration (formerly called Hallervorden-Spatz syndrome) is a disorder of the nervous system. This condition is characterized by progressive difficulty with movement, typically beginning in childhood. Movement abnormalities include involuntary muscle spasms, rigidity, and trouble with walking that worsens over time. Many people with this condition also develop problems with speech ( dysarthria), and some develop vision loss. Additionally, affected individuals may experience a loss of intellectual function (dementia) and psychiatric symptoms such as behavioral problems, personality changes, and depression. Pantothenate kinase-associated neurodegeneration is characterized by an abnormal buildup of iron in certain areas of the brain. A particular change called the eye-of-the- tiger sign, which indicates an accumulation of iron, is typically seen on magnetic resonance imaging (MRI) scans of the brain in people with this disorder. Researchers have described classic and atypical forms of pantothenate kinase- associated neurodegeneration. The classic form usually appears in early childhood, causing severe problems with movement that worsen rapidly. Features of the atypical form appear later in childhood or adolescence and progress more slowly. Signs and symptoms vary, but the atypical form is more likely than the classic form to involve speech defects and psychiatric problems. A condition called HARP (hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration) syndrome, which was historically described as a separate syndrome, is now considered part of pantothenate kinase-associated neurodegeneration. Frequency The precise incidence of this condition is unknown. It is estimated to affect 1 to 3 per million people worldwide. Causes Mutations in the PANK2 gene cause pantothenate kinase-associated neurodegeneration. -
A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration
IJMCM Case Report Autumn 2016, Vol 5, No 4 A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration Soudeh Ghafouri-Fard 1, Vahid Reza Yassaee 2, Alireza Rezayi 3, Feyzollah Hashemi-Gorji 2, Nasrin Alipour 2, ∗ Mohammad Miryounesi 2 1. Department of Medical Genetics, Shahid Beheshti University of Medical sciences, Tehran, Iran. 2. Genomic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 3. Pediatric Neurology Department, Loghman Hospital, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Submmited 29 June 2016; Accepted 14 August 2016; Published 23 October 2016 Pantothenate kinase- associated neurodegeneration (PKAN) syndrome is a rare autosomal recessive disorder characterized by progressive extrapyramidal dysfunction and iron accumulation in the brain and axonal spheroids in the central nervous system. It has been shown that the disorder is caused by mutations in PANK2 gene which codes for a mitochondrial enzyme participating in coenzyme A biosynthesis. Here we report two cases of classic PKAN syndrome with early onset of neurodegenerative disorder. Mutational analysis has revealed that both are homozygous for a novel nonsense mutation in PANK2 gene (c.T936A (p.C312X)). The high prevalence of consanguineous marriages in Iran raises the likelihood of occurrence of autosomal recessive disorders such as PKAN and necessitates proper premarital genetic counseling. Further research is needed to provide the data on the prevalence of PKAN and identification of common PANK2 mutations in Iranian population. Key words : PANK2 , pantothenate kinase-associated neurodegeneration, mutation antothenate kinase-associated neurodegen- weighted which is due to iron deposition in the Peration (PKAN) syndrome is a rare autosomal periphery (hypointensity) and necrosis on its central recessive disorder characterized by progressive part (hyperintensity) (2). -
Genetic Network Complexity Shapes
TIGS 1479 No. of Pages 9 Opinion Genetic Network Complexity Shapes Background-Dependent Phenotypic Expression 1, 1 1, 1, Jing Hou, * Jolanda van Leeuwen, Brenda J. Andrews, * and Charles Boone * The phenotypic consequences of a given mutation can vary across individuals. Highlights This so-called background effect is widely observed, from mutant fitness of The same mutation often does not lead loss-of-function variants in model organisms to variable disease penetrance to the same phenotype in different indi- and expressivity in humans; however, the underlying genetic basis often viduals due to other genetic variants that are specific to each individual remains unclear. Taking insights gained from recent large-scale surveys of genome. genetic interaction and suppression analyses in yeast, we propose that the Background modifiers can arise genetic network context for a given mutation may shape its propensity of through gain- or loss-of-function exhibiting background-dependent phenotypes. We argue that further efforts mutations in genes involved in related in systematically mapping the genetic interaction networks beyond yeast will cellular functions. provide not only key insights into the functional properties of genes, but also a Our ability to predict phenotypes relies better understanding of the background effects and the (un)predictability of on expanding our knowledge of the traits in a broader context. complex networks of genetic interac- tions underlying traits; however, the structure and complexity of the net- Genetic Background and the (Un)predictability of Traits work itself may be variable across A particular mutation in a given gene often leads to different phenotypes in different individuals. -
Upper and Lower Case Letters to Be Used
Thiamine Concentrations in Extruded Dog and Cat Food & Determination of Thiamine Status in Healthy Dogs and Cats and Comparison with Hospitalized Inappetent Animals by Georgia Kritikos A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Master of Science in Clinical Studies Guelph, Ontario, Canada © Georgia Kritikos, August, 2017 ABSTRACT THIAMINE CONCENTRATIONS IN EXTRUDED DOG AND CAT FOOD & DETERMINATION OF THIAMINE STATUS IN HEALTHY DOGS AND CATS AND COMPARISON WITH HOSPITALIZED INAPPETENT ANIMALS Georgia Kritikos Advisor: University of Guelph, 2017 Dr. Adronie Verbrugghe Thiamine is a water-soluble vitamin and a dietary requirement for dogs and cats. It has a critical role in energy metabolism. As pet owners may freeze excess pet food in an attempt to maintain freshness, this thesis investigates the effect of freezing on thiamine in extruded dog and cat foods. Storage temperature did not affect thiamine concentrations of extruded diets, but thiamine significantly increased over time. Additionally, this thesis examines thiamine status of healthy dogs and cats in comparison to inappetent patients presenting to a tertiary referral hospital, and determines the effect of supplementation on resultant thiamine status in inappetent dogs. We found that thiamine diphosphate (TDP) and unphosphorylated thiamine status of healthy dogs declined with age. This relationship was not present in cats. TDP status was higher in inappetent dogs compared to healthy dogs. Supplementation led to higher TDP status in inappetent dogs compared to baseline TDP status. ACKNOWLEDGEMENTS First, I’d like to thank my advisor, Dr. Adronie Verbrugghe. I came into my degree with a love for nutrition and an idea that I wanted to pursue nutrition as a career.