Enzyme Relationships Ina Sorbitol Pathway That Bypasses Glycolysis
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Study of the Partial and Exhaustive Intramolecular Dehydration of D-Sorbitol
Available online at http://journal-of-agroalimentary.ro Journal of Journal of Agroalimentary Processes and Agroalimentary Processes and Technologies 2013, 19(2), 259-270 Technologies Study of the partial and exhaustive intramolecular dehydration of D-sorbitol Ileana Cocan *, Monica Viorica Negrea, Ionel Vasile Jianu ”Dunărea de Jos” University of Galati, Faculty of Food Science and Engineering, Domnească Street, 47, RO-800008, Galati, Romania Received: 07 February 2013; Accepted: 09 March 2013 ______________________________________________________________________________________ Abstract Sweetener, humectants, sequestrant, texturizer, stabilizer, bulking agent, D-sorbitol represents a leading product in the processing of the polysorbate class. The scope of this work is to obtain details on the preparation and accession of D-sorbitol mono- and dianhydride as a method of chemical protection of primary and secondary hydroxyl functional groups (1:4) (3:6) as part of the strategy of controlled processing of polysorbates containing “homogeneous” polyoxyethylenic chains (n = 3, 6, 9, 18). This work is investigating the dependence of yield of internal dehydration (partial and/or exhaustive, direct of D-sorbitol) on temperature (100-160°C and 120-200°C , respectively ) and duration (5–35 minutes and 10–100 minutes , respectively ) for the processing of 1,4-sorbitan and 2,5-isosorbide. The evolution of the hydroxyl number (mg KOH/g D-sorbitol) (mg KOH/g 1,4-sorbitan) related to the theoretical (initial) value was followed and optimal values for the yield and dehydration parameters were established. Also in this work, the mathematical modeling of the dependence curves experimentally registered is realized. Keywords : izosorbide, D-sorbitol, D-glucitol, D-sorbit, 1,4-sorbitan ______________________________________________________________________________________ 1. -
Indications for a Central Role of Hexokinase Activity in Natural Variation of Heat Acclimation in Arabidopsis Thaliana
Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 14 June 2020 doi:10.20944/preprints202006.0169.v1 Article Indications for a central role of hexokinase activity in natural variation of heat acclimation in Arabidopsis thaliana Vasil Atanasov §, Lisa Fürtauer § and Thomas Nägele * LMU Munich, Plant Evolutionary Cell Biology, Großhaderner Str. 2-4, 82152 Planegg, Germany § Authors contributed equally * Correspondence: [email protected] Abstract: Diurnal and seasonal changes of abiotic environmental factors shape plant performance and distribution. Changes of growth temperature and light intensity may vary significantly on a diurnal, but also on a weekly or seasonal scale. Hence, acclimation to a changing temperature and light regime is essential for plant survival and propagation. In the present study, we analyzed photosynthetic CO2 assimilation and metabolic regulation of the central carbohydrate metabolism in two natural accessions of Arabidopsis thaliana originating from Russia and south Italy during exposure to heat and a combination of heat and high light. Our findings indicate that it is hardly possible to predict photosynthetic capacities to fix CO2 under combined stress from single stress experiments. Further, capacities of hexose phosphorylation were found to be significantly lower in the Italian than in the Russian accession which could explain an inverted sucrose-to-hexose ratio. Together with the finding of significantly stronger accumulation of anthocyanins under heat/high light these observations indicate a central role of hexokinase activity in stabilization of photosynthetic capacities within a changing environment. Keywords: photosynthesis; carbohydrate metabolism; hexokinase; heat acclimation; environmental changes; natural variation; high light; combined stress. 1. Introduction Changes of growth temperature and light intensity broadly affect plant molecular, physiological and developmental processes. -
Labeled in Thecourse of Glycolysis, Since Phosphoglycerate Kinase
THE STATE OF MAGNESIUM IN CELLS AS ESTIMATED FROM THE ADENYLATE KINASE EQUILIBRIUM* BY TRWIN A. RoSE THE INSTITUTE FOR CANCER RESEARCH, PHILADELPHIA Communicated by Thomas F. Anderson, August 30, 1968 Magnesium functions in many enzymatic reactions as a cofactor and in com- plex with nucleotides acting as substrates. Numerous examples of a possible regulatory role of Mg can be cited from studies with isolated enzymes,'- and it is known that Mg affects the structural integrity of macromolecules such as trans- fer RNA" and functional elements such as ribosomes.'0 The major problem in translating this information on isolated preparations to the functioning cell is the difficulty in determining the distribution of Mg and the nucleotides among the free and complexed forms that function in the region of the cell for which this information is desired. Nanningall based an attempt to calculate the free Mg2+ and Ca2+ ion concentrations of frog muscle on the total content of these metals and of the principal known ligands (adenosine 5'-triphosphate (ATP), creatine-P, and myosin) and the dissociation constants of the complexes. However, this method suffers from the necessity of evaluating the contribution of all ligands as well as from the assumption that all the known ligands are contributing their full complexing capacity. During studies concerned with the control of glycolysis in red cells and the control of the phosphoglycerate kinase step in particular, it became important to determine the fractions of the cell's ATP and adenosine 5'-diphosphate (ADP) that were present as Mg complexes. Just as the problem of determining the distribution of protonated and dissociated forms of an acid can be solved from a knowledge of pH and pKa of the acid, so it would be possible to determine the liganded and free forms of all rapidly established Mg complexes from a knowledge of Mg2+ ion concentration and the appropriate dissociation constants. -
Sorbitol Malabsorption 1/2
Internal Medicine and Gastroenterology Clinic Dres. Mares,M.Hanig,Mares, Hanig, Rambow, S.Blau, Blau, M.Seip, Hanig, Seip, A.Borchers,Blau,Kirchner, Hochstr. Hochstr. Hochstr. 43, 60313 43, 43, 60313 60313 Frankfurt/Main, Frankfurt/M., Frankfurt/M., www.gastroenterologie-ffm.de www.gastroenterologie-ffm.de www.gastroenterologie-ffm.de Nutrition hints for sorbitol malabsorption 1/2 Sorbitol intolerance Sorbitol incompatibility 1. What does this mean for nutrition? Avoid sorbitol as a sweetener and foods high in sorbitol. Small amount of sorbitol can often be tolerated (at most 10-10 g per day, sometimes less). In order to prevent general upper GI problems, easily digestible foods that do not cause gas are recommended. 2. Key points about foods – Avoid sorbitol and foods containing sorbitol – easily digestible food that does not cause gas 3. vegetables and fruits low in fibre (see 5) 4. Choice of foods The following foods are high in sorbitol and not suitable: – Sorbitol as sweetener: e.g. Sionon, Flarom, diabetic sweetener – Dietetic foods produced with sorbitol: for example, diabetic marmalades, diabetic sweets, diabetic baked goods – Types of fruit which have a naturally high sorbitol content: Apples, pears, cherries, prunes, plums, dates fruits with seeds, such as mirabelles, apricots, nectarines, and all fruit syrups made from these types of fruits – Types of fruit which have a naturally low sorbitol content: Berry fruits such as strawberries, raspberries, blackberries, blueberries, currants, gooseberries, citrus fruits, bananas, pineapples, kiwis – Sorbitol as a coating for: sultanas, raisins, and dried fruit or candied fruit – Sorbitol in sweets: chewing gum, jelly babies, jelly fruits, candies, chocolate bars, filled wafers, chocolate, etc. -
Copyrighted Material
Index Abbreviations receptor sites 202, 211 weak 122 amino acids, Table 500–1 muscarinic 413 weak, pH calculation 147–8 nucleic acids 551 nicotinic 413 Acid–base nucleotides, Table 551 as quaternary ammonium salt 202 catalysis, enzymes 516 peptides and proteins 504 Acetylcholinesterase equilibria 121 phosphates and diphosphates 277 enzyme mechanism 519–21 interactions, predicting 155–7 structural, Table 14 hydrolysis of acetylcholine 279 Acidic reagents, Table 157 ACE (angiotensin-converting enzyme) inhibitors 279 Acidity enzyme action 532 Acetyl-CoA carboxylase, in fatty acid acidity constant 122 inhibitors 532 biosynthesis 595 bond energy effects 125 Acetal Acetyl-CoA (acetyl coenzyme A) definition 121 in etoposide 233 as acylating agent 262 electronegativity effects 125 formation 229 carboxylation to malonyl-CoA 595, hybridization effects 128 polysaccharides as polyacetals 232 609 inductive effects 125–7 as protecting group 230 Claisen reaction 381 influence of electronic and structural Acetal and ketal enolate anions 373 features 125–34 cyclic, as protecting groups 481 in Krebs cycle 585 and leaving groups, Table 189 groups in sucrose 231 from β-oxidation of fatty acids 388 pKa values 122–5 Acetaldehyde, basicity 139 as thioester 262, 373 resonance / delocalization effects 129–34 Acetamide, basicity 139 Acetylene, bonding molecular orbitals 31 Acidity (compounds) Acetaminophen, see paracetamol Acetylenes, acidity 128 acetone 130 Acetoacetyl-CoA, biosynthesis from N-Acetylgalactosamine, in blood group acetonitrile 365 acetyl-CoA 392 -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Polyols Have a Variety of Functional Properties That Make Them Useful Alternatives to Sugars in Applications Including Baked Goods
Polyols have a variety of functional properties that make them useful alternatives to sugars in applications including baked goods. Photo © iStockphoto.com/Synergee pg 22 09.12 • www.ift.org BY LYN NABORS and THERESA HEDRICK SUGAR REDUCTION WITH Polyols Polyols are in a unique position to assist with reduced-sugar or sugar-free reformulations since they can reduce calories and complement sugar’s functionality. ugar reduction will be an important goal over the of the product’s original characteristics may still be main- next few years as consumers, government, and in- tained with the replacement of those sugars by polyols. Sdustry alike have expressed interest in lower-calorie In addition, excellent, good-tasting sugar-free products and lower-sugar foods. The 2010 Dietary Guidelines for can be developed by using polyols. Polyols are in a unique Americans put a strong emphasis on consuming fewer position to assist with reduced-sugar or sugar-free refor- calories and reducing intake of added sugars. The In- mulations; since they are only partially digested and ab- stitute of Medicine (IOM) held a public workshop in sorbed, they can reduce calories and complement sugar’s November 2010 to discuss ways the food industry can functionality. Polyols provide the same bulk as sugars and use contemporary and innovative food processing tech- other carbohydrates. Additionally, polyols have a clean, nologies to reduce calorie intake in an effort to reduce sweet taste, which is important since consumers are not and prevent obesity, and in October 2011 recommended likely to sacrifice taste for perceived health benefits. Poly- front-of-package labeling that includes rating the product ols have a host of other functional properties that make based on added sugars content. -
Phosphine Stabilizers for Oxidoreductase Enzymes
Europäisches Patentamt *EP001181356B1* (19) European Patent Office Office européen des brevets (11) EP 1 181 356 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.7: C12N 9/02, C12P 7/00, of the grant of the patent: C12P 13/02, C12P 1/00 07.12.2005 Bulletin 2005/49 (86) International application number: (21) Application number: 00917839.3 PCT/US2000/006300 (22) Date of filing: 10.03.2000 (87) International publication number: WO 2000/053731 (14.09.2000 Gazette 2000/37) (54) Phosphine stabilizers for oxidoreductase enzymes Phosphine Stabilisatoren für oxidoreduktase Enzymen Phosphines stabilisateurs des enzymes ayant une activité comme oxidoreducase (84) Designated Contracting States: (56) References cited: DE FR GB NL US-A- 5 777 008 (30) Priority: 11.03.1999 US 123833 P • ABRIL O ET AL.: "Hybrid organometallic/enzymatic catalyst systems: (43) Date of publication of application: Regeneration of NADH using dihydrogen" 27.02.2002 Bulletin 2002/09 JOURNAL OF THE AMERICAN CHEMICAL SOCIETY., vol. 104, no. 6, 1982, pages 1552-1554, (60) Divisional application: XP002148357 DC US cited in the application 05021016.0 • BHADURI S ET AL: "Coupling of catalysis by carbonyl clusters and dehydrigenases: (73) Proprietor: EASTMAN CHEMICAL COMPANY Redution of pyruvate to L-lactate by dihydrogen" Kingsport, TN 37660 (US) JOURNAL OF THE AMERICAN CHEMICAL SOCIETY., vol. 120, no. 49, 11 October 1998 (72) Inventors: (1998-10-11), pages 12127-12128, XP002148358 • HEMBRE, Robert, T. DC US cited in the application Johnson City, TN 37601 (US) • OTSUKA K: "Regeneration of NADH and ketone • WAGENKNECHT, Paul, S. hydrogenation by hydrogen with the San Jose, CA 95129 (US) combination of hydrogenase and alcohol • PENNEY, Jonathan, M. -
Vitamin K1 Prevents Diabetic Cataract by Inhibiting Lens Aldose Reductase 2 (ALR2) Activity Received: 21 May 2019 R
www.nature.com/scientificreports OPEN Vitamin K1 prevents diabetic cataract by inhibiting lens aldose reductase 2 (ALR2) activity Received: 21 May 2019 R. Thiagarajan1,5, M. K. N. Sai Varsha2, V. Srinivasan3, R. Ravichandran4 & K. Saraboji1 Accepted: 24 September 2019 This study investigated the potential of vitamin K1 as a novel lens aldose reductase inhibitor in a Published: xx xx xxxx streptozotocin-induced diabetic cataract model. A single, intraperitoneal injection of streptozotocin (STZ) (35 mg/kg) resulted in hyperglycemia, activation of lens aldose reductase 2 (ALR2) and accumulation of sorbitol in eye lens which could have contributed to diabetic cataract formation. However, when diabetic rats were treated with vitamin K1 (5 mg/kg, sc, twice a week) it resulted in lowering of blood glucose and inhibition of lens aldose reductase activity because of which there was a corresponding decrease in lens sorbitol accumulation. These results suggest that vitamin K1 is a potent inhibitor of lens aldose reductase enzyme and we made an attempt to understand the nature of this inhibition using crude lens homogenate as well as recombinant human aldose reductase enzyme. Our results from protein docking and spectrofuorimetric analyses clearly show that vitamin K1 is a potent inhibitor of ALR2 and this inhibition is primarily mediated by the blockage of DL-glyceraldehyde binding to ALR2. At the same time docking also suggests that vitamin K1 overlaps at the NADPH binding site of ALR2, which probably shows that vitamin K1 could possibly bind both these sites in the enzyme. Another deduction that we can derive from the experiments performed with pure protein is that ALR2 has three levels of afnity, frst for NADPH, second for vitamin K1 and third for the substrate DL-glyceraldehyde. -
Clostridium Difficile Exploits a Host Metabolite Produced During Toxin-Mediated Infection
bioRxiv preprint doi: https://doi.org/10.1101/2021.01.14.426744; this version posted January 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Clostridium difficile exploits a host metabolite produced during toxin-mediated infection 2 3 Kali M. Pruss and Justin L. Sonnenburg* 4 5 Department of Microbiology & Immunology, Stanford University School of Medicine, Stanford 6 CA, USA 94305 7 *Corresponding author address: [email protected] 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 bioRxiv preprint doi: https://doi.org/10.1101/2021.01.14.426744; this version posted January 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 23 Several enteric pathogens can gain specific metabolic advantages over other members of 24 the microbiota by inducing host pathology and inflammation. The pathogen Clostridium 25 difficile (Cd) is responsible for a toxin-mediated colitis that causes 15,000 deaths in the U.S. 26 yearly1, yet the molecular mechanisms by which Cd benefits from toxin-induced colitis 27 remain understudied. Up to 21% of healthy adults are asymptomatic carriers of toxigenic 28 Cd2, indicating that Cd can persist as part of a healthy microbiota; antibiotic-induced 29 perturbation of the gut ecosystem is associated with transition to toxin-mediated disease. -
Collateral Glucose-Utlizing Pathwaya in Diabetic Polyneuropathy
International Journal of Molecular Sciences Review Collateral Glucose-Utlizing Pathwaya in Diabetic Polyneuropathy Hiroki Mizukami 1,* and Sho Osonoi 1,2 1 Department Pathology and Molecular Medicine, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, Aomori 036-8562, Japan; [email protected] 2 Department of Endocrinology and Metabolism, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, Aomori 036-8562, Japan * Correspondence: [email protected]; Tel.: +81-172-39-5025 Abstract: Diabetic polyneuropathy (DPN) is the most common neuropathy manifested in diabetes. Symptoms include allodynia, pain, paralysis, and ulcer formation. There is currently no established radical treatment, although new mechanisms of DPN are being vigorously explored. A pathophysio- logical feature of DPN is abnormal glucose metabolism induced by chronic hyperglycemia in the peripheral nerves. Particularly, activation of collateral glucose-utilizing pathways such as the polyol pathway, protein kinase C, advanced glycation end-product formation, hexosamine biosynthetic pathway, pentose phosphate pathway, and anaerobic glycolytic pathway are reported to contribute to the onset and progression of DPN. Inhibitors of aldose reductase, a rate-limiting enzyme involved in the polyol pathway, are the only compounds clinically permitted for DPN treatment in Japan, although their efficacies are limited. This may indicate that multiple pathways can contribute to the pathophysiology of DPN. Comprehensive metabolic analysis may help to elucidate global changes in the collateral glucose-utilizing pathways during the development of DPN, and highlight therapeutic targets in these pathways. Keywords: diabetic polyneuropathy; glycolysis; oxidative stress; polyol pathway; hexosamine biosynthetic pathway; advanced glycation end-products; PKC; glucosamine; pentose phosphate pathway; anaerobic glycolytic pathway Citation: Mizukami, H.; Osonoi, S.