DOCSLIB.ORG

Enzyme Relationships Ina Sorbitol Pathway That Bypasses Glycolysis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Enzyme Relationships Ina Sorbitol Pathway That Bypasses Glycolysis Proc. Nati. Acad. Sci. USA Vol. 80, pp. 901-905, Februarv 1983 Biochemistry Enzyme relationships in a sorbitol pathway that bypasses glycolysis and pentose phosphates in glucose metabolism (isozymes/diabetes/alcohol dehydrogenase/reductases/alcoholism) JONATHAN JEFFERY* AND HANS JORNVALLt *Department of Biochemistry, University ofAberdeen, Marischal College, Aberdeen, AB9 lAS Scotland, United Kingdom; and tDepartment of Chemistry I, Karolinska Institutet, S-104 01 Stockholm 60, Sweden Communicated by Sune Bergstr6m, September 17, 1982 ABSTRACT A pathway from glucose via sorbitol bypasses the fructose (8). Increased operation ofthe glycerol phosphate shut- control points of hexokinase and phosphofructokinase in glucose tle could also mediate the effect (9). metabolism. It also may produce glycerol, linking the bypass to The structural relationships, the diverse and unrelated met- lipid synthesis. Utilization of this bypass is favored by a plentiful abolic suggestions, the apparent associations of some interme- supply of glucose-hence, conditions under which glycolysis also diate compounds, and the possible convergent relationships is active. The bypass further involves oxidation of NADPH, so the motivate a search for unifying explanations, detailing the sor- pentose phosphate pathway and the bypass are mutually facilita- bitol pathway and its consequences. tive. Possible consequences in different organs under normal and pathological, especially diabetic, conditions are detailed. Enzymes with related structures (for example, sorbitol dehydrogenase and MATERIALS AND METHODS alcohol dehydrogenase, and possibly, aldehyde reductase and al- Glucose Metabolism via a Five-Step Sorbitol Pathway By- dose reductase, respectively) are linked functionally by this passing the scheme. Some enzymes of the bypass also feature in glycolysis Regulatory Steps of Glycolysis. In glucose metab- (aldolase and alcohol dehydrogenase), and these enzymes, with the olism, flux through the glycolytic and pentose phosphate path- reductases involved, are proteins known to occur in different ways is regulated at phosphofructokinase (10) and glucose-6- classes or multiple isozyme forms. Two of the enzymes (aldolase phosphate dehydrogenase (11). Hexokinase is generally also a and alcohol dehydrogenase) both involve classes with and without control point, though the effect in liver is overcome at high a catalytic metal (zinc). The existence ofparallel pathways and the glucose concentrations by glucokinase. However, as shown in occurrence of similar enzymic steps in one pathway may help to Fig. 1, a complete pathway similar to glycolysis but fully by- explain the abundance and multiplicity ofenzymes such as reduc- passing the hexokinase and phosphofructokinase steps also is tases, aldolases, and alcohol dehydrogenases. possible. It involves oxidation of one or two molecules of NADPH, thus favoring operation of the pentose phosphate Although alcohol dehydrogenase is widespread in nature, is pathway, and is linked to lipid synthesis via glycerol formation common in liver, and has been structurally characterized from (Fig. 1). several sources (1), its exact role in mammalian organs generally The first step of the pathway is conversion of glucose into has remained unclear. In addition to ethanol oxidation, func- sorbitol by aldose reductase and NADPH. Oxidation ofsorbitol tions in bile acid formation, fatty acid degradation, vitamin A by sorbitol dehydrogenase and NAD' then yields fructose. metabolism, a hydroxysteroid reaction, and other areas of me- Fructose is not a substrate for glucokinase, but in some circum- tabolism have been considered (2). Different and multiple func- stances hexokinase and ATP could convert it into fructose 6- tions of alcohol dehydrogenase would be consistent with the phosphate, leading into glycolysis at the phosphofructokinase considerable species variations and extensive evolutionary reaction. This loop via sorbitol then would serve as a transhy- changes found. drogenase function (reduction of NAD+ and oxidation of Recently, another common liver enzyme, sorbitol dehydro- NADPH). Alternatively, fructokinase and ATP could convert genase, was shown to be structurally, mechanistically, and an- fructose into fructose 1-phosphate. This compound can be cestrally related to alcohol dehydrogenase (3). The substrates of cleaved by aldolase B to give dihydroxyacetone phosphate and sorbitol dehydrogenase, fructose and sorbitol, are considered glyceraldehyde. Glyceraldehyde 3-phosphate results from the important in special organs, such as male sexual organs (4), or action oftriosephosphate isomerase on dihydroxyacetone phos- special disease states, such as hyperglycemic cataract formation phate or oftriokinase on glyceraldehyde. Entry at this stage into (5) and possibly diabetic neuropathy (6) and glomerulosclerosis glycolysis via glyceraldehyde 3-phosphate bypasses the hexo- (7), but a more general metabolic significance that is compatible kinase and phosphofructokinase reactions. Conversion of glyc- with the structural similarity of these enzymes has not been clear. eraldehyde to glycerol is an alternative to phosphorylation. The The structural link between alcohol and polyol dehydroge- reduction can be effected by alcohol dehydrogenase and NADH nases showed a type ofparallel or convergent evolution ofa sec- or by aldehyde reductase and NADPH. ond, different enzyme in each case with related specificity (3). Occurrence of the individual enzymes of the pathway is de- Enhancement of alcohol metabolism by fructose gave one as- scribed in relation to the organs mentioned below. The initial sociation between the substrates for sorbitol and alcohol dehy- steps of the pathway, with the glucose-fructose conversion drogenases. This effect may stem from avoidance of the rate- (sometimes also called the "sorbitol pathway"), have been dis- limiting NADH dissociation off alcohol dehydrogenase by an cussed further in relation to diabetes or insulin effects (12), but in situ coenzyme reoxidation with glyceraldehyde formed from usually not the associated, later combination into glycolysis or lipogenesis. The publication costs ofthis article were defrayed in part by page charge In summary, the essential steps providing the bypass are payment. This article must therefore be hereby marked "advertise- those leading via sorbitol and fructose 1-phosphate to glycer- ment" in accordance with 18 U. S. C. §1734 solely to indicate this fact. aldehyde 3-phosphate and linking, among other enzymes, sor- 901 Downloaded by guest on September 23, 2021 902 Biochemistry: Jeffery and Jbrnvall Proc. Natl. Acad. Sci. USA 80 (1983) bitol dehydrogenase and alcohol dehydrogenase with various ofthe aldose reductase type (that is, NADPH-linked aldehyde reductases and aldolases. reductases) have little (15) activity towards glucose, and much hepatic sorbitol dehydrogenase is present. These aspects sug- RESULTS AND DISCUSSION gest that liver may not be the main functional site ofthe entire Normal Occurrence. The scheme in Fig. 1 and the enzymes bypass for energy production but rather for permitting metab- shown demonstrate that the bypass or parts ofit may be offunc- olism of important compounds in any ratios. tional significance. In this respect, five tissues or organs appear Pancreas. Sorbitol is present in pancreas and glucose-induced of special interest in normal conditions. They are, on the one insulin release evidently requires both NADPH and aldose re- hand, the liver, pancreas, and placenta, where some com- ductase activity within the f3 cells (12). Reduction ofglucose to pounds ofthe scheme may have special roles, and, on the other sorbitol possibly primes or activates an element in the insulin hand, the brain and the reproductive system, where the bypass release mechanism (12). Therefore, it appears possible that in appears capable of having a more general metabolic role. the pancreas, the initial steps ofthe scheme in Fig. 1 may have Liver. As the main processorofingestedcompounds, the liver special functions. As in the liver, they may not be ofenergetic might be expected to encounter sorbitol. However, orally in- value in an entire bypass ofglycolysis but serve other functions, gested sorbitol is poorly absorbed in man and animals, and prod- which in the case of pancreas may be metabolic regulation via ucts ofits metabolism by intestinal microorganisms, rather than insulin release. sorbitol itself, are absorbed (13, 14). Nevertheless, sorbitol en- Placenta. Glucose is converted into fructose by the aldose tering the livercould be oxidized byhepatic sorbitol dehydroge- reductase and sorbitol dehydrogenase of normal placenta (16) nase in the same way that ethanol is oxidized by alcohol dehy- and umbilical cord (17) in species including man. High concen- drogenase. trations offructose in the fetal blood ofungulates (for example, Most important, liver deals with high postprandial concen- sheep and pig) apparently result from nonutilization offructose trations of glucose. Accumulation of sorbitol formed from glu- by their fetuses (18). Because fructose is not an important fetal cose within the liver then would be disadvantageous, raising the energy source in these cases, the loop from glucose to fructose osmotic pressure of the cells. Significantly, the liver enzymes may have an osmoregulatory role or serve a transhydrogenase Glucose aldose hexokinase (Iglucokinase) Glucose-6-P sorbi tol dehydrogenase Fructose I11 Fructose-6-P phospho- fructokinase fructokinase Fructose-l-P Fructose-1,6-bisP
Load more

Recommended publications
  • Study of the Partial and Exhaustive Intramolecular Dehydration of D-Sorbitol
    Available online at http://journal-of-agroalimentary.ro Journal of Journal of Agroalimentary Processes and Agroalimentary Processes and Technologies 2013, 19(2), 259-270 Technologies Study of the partial and exhaustive intramolecular dehydration of D-sorbitol Ileana Cocan *, Monica Viorica Negrea, Ionel Vasile Jianu ”Dunărea de Jos” University of Galati, Faculty of Food Science and Engineering, Domnească Street, 47, RO-800008, Galati, Romania Received: 07 February 2013; Accepted: 09 March 2013 ______________________________________________________________________________________ Abstract Sweetener, humectants, sequestrant, texturizer, stabilizer, bulking agent, D-sorbitol represents a leading product in the processing of the polysorbate class. The scope of this work is to obtain details on the preparation and accession of D-sorbitol mono- and dianhydride as a method of chemical protection of primary and secondary hydroxyl functional groups (1:4) (3:6) as part of the strategy of controlled processing of polysorbates containing “homogeneous” polyoxyethylenic chains (n = 3, 6, 9, 18). This work is investigating the dependence of yield of internal dehydration (partial and/or exhaustive, direct of D-sorbitol) on temperature (100-160°C and 120-200°C , respectively ) and duration (5–35 minutes and 10–100 minutes , respectively ) for the processing of 1,4-sorbitan and 2,5-isosorbide. The evolution of the hydroxyl number (mg KOH/g D-sorbitol) (mg KOH/g 1,4-sorbitan) related to the theoretical (initial) value was followed and optimal values for the yield and dehydration parameters were established. Also in this work, the mathematical modeling of the dependence curves experimentally registered is realized. Keywords : izosorbide, D-sorbitol, D-glucitol, D-sorbit, 1,4-sorbitan ______________________________________________________________________________________ 1.
    [Show full text]
  • Indications for a Central Role of Hexokinase Activity in Natural Variation of Heat Acclimation in Arabidopsis Thaliana
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 14 June 2020 doi:10.20944/preprints202006.0169.v1 Article Indications for a central role of hexokinase activity in natural variation of heat acclimation in Arabidopsis thaliana Vasil Atanasov §, Lisa Fürtauer § and Thomas Nägele * LMU Munich, Plant Evolutionary Cell Biology, Großhaderner Str. 2-4, 82152 Planegg, Germany § Authors contributed equally * Correspondence: [email protected] Abstract: Diurnal and seasonal changes of abiotic environmental factors shape plant performance and distribution. Changes of growth temperature and light intensity may vary significantly on a diurnal, but also on a weekly or seasonal scale. Hence, acclimation to a changing temperature and light regime is essential for plant survival and propagation. In the present study, we analyzed photosynthetic CO2 assimilation and metabolic regulation of the central carbohydrate metabolism in two natural accessions of Arabidopsis thaliana originating from Russia and south Italy during exposure to heat and a combination of heat and high light. Our findings indicate that it is hardly possible to predict photosynthetic capacities to fix CO2 under combined stress from single stress experiments. Further, capacities of hexose phosphorylation were found to be significantly lower in the Italian than in the Russian accession which could explain an inverted sucrose-to-hexose ratio. Together with the finding of significantly stronger accumulation of anthocyanins under heat/high light these observations indicate a central role of hexokinase activity in stabilization of photosynthetic capacities within a changing environment. Keywords: photosynthesis; carbohydrate metabolism; hexokinase; heat acclimation; environmental changes; natural variation; high light; combined stress. 1. Introduction Changes of growth temperature and light intensity broadly affect plant molecular, physiological and developmental processes.
    [Show full text]
  • Labeled in Thecourse of Glycolysis, Since Phosphoglycerate Kinase
    THE STATE OF MAGNESIUM IN CELLS AS ESTIMATED FROM THE ADENYLATE KINASE EQUILIBRIUM* BY TRWIN A. RoSE THE INSTITUTE FOR CANCER RESEARCH, PHILADELPHIA Communicated by Thomas F. Anderson, August 30, 1968 Magnesium functions in many enzymatic reactions as a cofactor and in com- plex with nucleotides acting as substrates. Numerous examples of a possible regulatory role of Mg can be cited from studies with isolated enzymes,'- and it is known that Mg affects the structural integrity of macromolecules such as trans- fer RNA" and functional elements such as ribosomes.'0 The major problem in translating this information on isolated preparations to the functioning cell is the difficulty in determining the distribution of Mg and the nucleotides among the free and complexed forms that function in the region of the cell for which this information is desired. Nanningall based an attempt to calculate the free Mg2+ and Ca2+ ion concentrations of frog muscle on the total content of these metals and of the principal known ligands (adenosine 5'-triphosphate (ATP), creatine-P, and myosin) and the dissociation constants of the complexes. However, this method suffers from the necessity of evaluating the contribution of all ligands as well as from the assumption that all the known ligands are contributing their full complexing capacity. During studies concerned with the control of glycolysis in red cells and the control of the phosphoglycerate kinase step in particular, it became important to determine the fractions of the cell's ATP and adenosine 5'-diphosphate (ADP) that were present as Mg complexes. Just as the problem of determining the distribution of protonated and dissociated forms of an acid can be solved from a knowledge of pH and pKa of the acid, so it would be possible to determine the liganded and free forms of all rapidly established Mg complexes from a knowledge of Mg2+ ion concentration and the appropriate dissociation constants.
    [Show full text]
  • Sorbitol Malabsorption 1/2
    Internal Medicine and Gastroenterology Clinic Dres. Mares,M.Hanig,Mares, Hanig, Rambow, S.Blau, Blau, M.Seip, Hanig, Seip, A.Borchers,Blau,Kirchner, Hochstr. Hochstr. Hochstr. 43, 60313 43, 43, 60313 60313 Frankfurt/Main, Frankfurt/M., Frankfurt/M., www.gastroenterologie-ffm.de www.gastroenterologie-ffm.de www.gastroenterologie-ffm.de Nutrition hints for sorbitol malabsorption 1/2 Sorbitol intolerance Sorbitol incompatibility 1. What does this mean for nutrition? Avoid sorbitol as a sweetener and foods high in sorbitol. Small amount of sorbitol can often be tolerated (at most 10-10 g per day, sometimes less). In order to prevent general upper GI problems, easily digestible foods that do not cause gas are recommended. 2. Key points about foods – Avoid sorbitol and foods containing sorbitol – easily digestible food that does not cause gas 3. vegetables and fruits low in fibre (see 5) 4. Choice of foods The following foods are high in sorbitol and not suitable: – Sorbitol as sweetener: e.g. Sionon, Flarom, diabetic sweetener – Dietetic foods produced with sorbitol: for example, diabetic marmalades, diabetic sweets, diabetic baked goods – Types of fruit which have a naturally high sorbitol content: Apples, pears, cherries, prunes, plums, dates fruits with seeds, such as mirabelles, apricots, nectarines, and all fruit syrups made from these types of fruits – Types of fruit which have a naturally low sorbitol content: Berry fruits such as strawberries, raspberries, blackberries, blueberries, currants, gooseberries, citrus fruits, bananas, pineapples, kiwis – Sorbitol as a coating for: sultanas, raisins, and dried fruit or candied fruit – Sorbitol in sweets: chewing gum, jelly babies, jelly fruits, candies, chocolate bars, filled wafers, chocolate, etc.
    [Show full text]
  • Copyrighted Material
    Index Abbreviations receptor sites 202, 211 weak 122 amino acids, Table 500–1 muscarinic 413 weak, pH calculation 147–8 nucleic acids 551 nicotinic 413 Acid–base nucleotides, Table 551 as quaternary ammonium salt 202 catalysis, enzymes 516 peptides and proteins 504 Acetylcholinesterase equilibria 121 phosphates and diphosphates 277 enzyme mechanism 519–21 interactions, predicting 155–7 structural, Table 14 hydrolysis of acetylcholine 279 Acidic reagents, Table 157 ACE (angiotensin-converting enzyme) inhibitors 279 Acidity enzyme action 532 Acetyl-CoA carboxylase, in fatty acid acidity constant 122 inhibitors 532 biosynthesis 595 bond energy effects 125 Acetal Acetyl-CoA (acetyl coenzyme A) definition 121 in etoposide 233 as acylating agent 262 electronegativity effects 125 formation 229 carboxylation to malonyl-CoA 595, hybridization effects 128 polysaccharides as polyacetals 232 609 inductive effects 125–7 as protecting group 230 Claisen reaction 381 influence of electronic and structural Acetal and ketal enolate anions 373 features 125–34 cyclic, as protecting groups 481 in Krebs cycle 585 and leaving groups, Table 189 groups in sucrose 231 from β-oxidation of fatty acids 388 pKa values 122–5 Acetaldehyde, basicity 139 as thioester 262, 373 resonance / delocalization effects 129–34 Acetamide, basicity 139 Acetylene, bonding molecular orbitals 31 Acidity (compounds) Acetaminophen, see paracetamol Acetylenes, acidity 128 acetone 130 Acetoacetyl-CoA, biosynthesis from N-Acetylgalactosamine, in blood group acetonitrile 365 acetyl-CoA 392
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Polyols Have a Variety of Functional Properties That Make Them Useful Alternatives to Sugars in Applications Including Baked Goods
    Polyols have a variety of functional properties that make them useful alternatives to sugars in applications including baked goods. Photo © iStockphoto.com/Synergee pg 22 09.12 • www.ift.org BY LYN NABORS and THERESA HEDRICK SUGAR REDUCTION WITH Polyols Polyols are in a unique position to assist with reduced-sugar or sugar-free reformulations since they can reduce calories and complement sugar’s functionality. ugar reduction will be an important goal over the of the product’s original characteristics may still be main- next few years as consumers, government, and in- tained with the replacement of those sugars by polyols. Sdustry alike have expressed interest in lower-calorie In addition, excellent, good-tasting sugar-free products and lower-sugar foods. The 2010 Dietary Guidelines for can be developed by using polyols. Polyols are in a unique Americans put a strong emphasis on consuming fewer position to assist with reduced-sugar or sugar-free refor- calories and reducing intake of added sugars. The In- mulations; since they are only partially digested and ab- stitute of Medicine (IOM) held a public workshop in sorbed, they can reduce calories and complement sugar’s November 2010 to discuss ways the food industry can functionality. Polyols provide the same bulk as sugars and use contemporary and innovative food processing tech- other carbohydrates. Additionally, polyols have a clean, nologies to reduce calorie intake in an effort to reduce sweet taste, which is important since consumers are not and prevent obesity, and in October 2011 recommended likely to sacrifice taste for perceived health benefits. Poly- front-of-package labeling that includes rating the product ols have a host of other functional properties that make based on added sugars content.
    [Show full text]
  • Phosphine Stabilizers for Oxidoreductase Enzymes
    Europäisches Patentamt *EP001181356B1* (19) European Patent Office Office européen des brevets (11) EP 1 181 356 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.7: C12N 9/02, C12P 7/00, of the grant of the patent: C12P 13/02, C12P 1/00 07.12.2005 Bulletin 2005/49 (86) International application number: (21) Application number: 00917839.3 PCT/US2000/006300 (22) Date of filing: 10.03.2000 (87) International publication number: WO 2000/053731 (14.09.2000 Gazette 2000/37) (54) Phosphine stabilizers for oxidoreductase enzymes Phosphine Stabilisatoren für oxidoreduktase Enzymen Phosphines stabilisateurs des enzymes ayant une activité comme oxidoreducase (84) Designated Contracting States: (56) References cited: DE FR GB NL US-A- 5 777 008 (30) Priority: 11.03.1999 US 123833 P • ABRIL O ET AL.: "Hybrid organometallic/enzymatic catalyst systems: (43) Date of publication of application: Regeneration of NADH using dihydrogen" 27.02.2002 Bulletin 2002/09 JOURNAL OF THE AMERICAN CHEMICAL SOCIETY., vol. 104, no. 6, 1982, pages 1552-1554, (60) Divisional application: XP002148357 DC US cited in the application 05021016.0 • BHADURI S ET AL: "Coupling of catalysis by carbonyl clusters and dehydrigenases: (73) Proprietor: EASTMAN CHEMICAL COMPANY Redution of pyruvate to L-lactate by dihydrogen" Kingsport, TN 37660 (US) JOURNAL OF THE AMERICAN CHEMICAL SOCIETY., vol. 120, no. 49, 11 October 1998 (72) Inventors: (1998-10-11), pages 12127-12128, XP002148358 • HEMBRE, Robert, T. DC US cited in the application Johnson City, TN 37601 (US) • OTSUKA K: "Regeneration of NADH and ketone • WAGENKNECHT, Paul, S. hydrogenation by hydrogen with the San Jose, CA 95129 (US) combination of hydrogenase and alcohol • PENNEY, Jonathan, M.
    [Show full text]
  • Vitamin K1 Prevents Diabetic Cataract by Inhibiting Lens Aldose Reductase 2 (ALR2) Activity Received: 21 May 2019 R
    www.nature.com/scientificreports OPEN Vitamin K1 prevents diabetic cataract by inhibiting lens aldose reductase 2 (ALR2) activity Received: 21 May 2019 R. Thiagarajan1,5, M. K. N. Sai Varsha2, V. Srinivasan3, R. Ravichandran4 & K. Saraboji1 Accepted: 24 September 2019 This study investigated the potential of vitamin K1 as a novel lens aldose reductase inhibitor in a Published: xx xx xxxx streptozotocin-induced diabetic cataract model. A single, intraperitoneal injection of streptozotocin (STZ) (35 mg/kg) resulted in hyperglycemia, activation of lens aldose reductase 2 (ALR2) and accumulation of sorbitol in eye lens which could have contributed to diabetic cataract formation. However, when diabetic rats were treated with vitamin K1 (5 mg/kg, sc, twice a week) it resulted in lowering of blood glucose and inhibition of lens aldose reductase activity because of which there was a corresponding decrease in lens sorbitol accumulation. These results suggest that vitamin K1 is a potent inhibitor of lens aldose reductase enzyme and we made an attempt to understand the nature of this inhibition using crude lens homogenate as well as recombinant human aldose reductase enzyme. Our results from protein docking and spectrofuorimetric analyses clearly show that vitamin K1 is a potent inhibitor of ALR2 and this inhibition is primarily mediated by the blockage of DL-glyceraldehyde binding to ALR2. At the same time docking also suggests that vitamin K1 overlaps at the NADPH binding site of ALR2, which probably shows that vitamin K1 could possibly bind both these sites in the enzyme. Another deduction that we can derive from the experiments performed with pure protein is that ALR2 has three levels of afnity, frst for NADPH, second for vitamin K1 and third for the substrate DL-glyceraldehyde.
    [Show full text]
  • Clostridium Difficile Exploits a Host Metabolite Produced During Toxin-Mediated Infection
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.14.426744; this version posted January 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Clostridium difficile exploits a host metabolite produced during toxin-mediated infection 2 3 Kali M. Pruss and Justin L. Sonnenburg* 4 5 Department of Microbiology & Immunology, Stanford University School of Medicine, Stanford 6 CA, USA 94305 7 *Corresponding author address: [email protected] 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 bioRxiv preprint doi: https://doi.org/10.1101/2021.01.14.426744; this version posted January 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 23 Several enteric pathogens can gain specific metabolic advantages over other members of 24 the microbiota by inducing host pathology and inflammation. The pathogen Clostridium 25 difficile (Cd) is responsible for a toxin-mediated colitis that causes 15,000 deaths in the U.S. 26 yearly1, yet the molecular mechanisms by which Cd benefits from toxin-induced colitis 27 remain understudied. Up to 21% of healthy adults are asymptomatic carriers of toxigenic 28 Cd2, indicating that Cd can persist as part of a healthy microbiota; antibiotic-induced 29 perturbation of the gut ecosystem is associated with transition to toxin-mediated disease.
    [Show full text]
  • Collateral Glucose-Utlizing Pathwaya in Diabetic Polyneuropathy
    International Journal of Molecular Sciences Review Collateral Glucose-Utlizing Pathwaya in Diabetic Polyneuropathy Hiroki Mizukami 1,* and Sho Osonoi 1,2 1 Department Pathology and Molecular Medicine, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, Aomori 036-8562, Japan; [email protected] 2 Department of Endocrinology and Metabolism, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, Aomori 036-8562, Japan * Correspondence: [email protected]; Tel.: +81-172-39-5025 Abstract: Diabetic polyneuropathy (DPN) is the most common neuropathy manifested in diabetes. Symptoms include allodynia, pain, paralysis, and ulcer formation. There is currently no established radical treatment, although new mechanisms of DPN are being vigorously explored. A pathophysio- logical feature of DPN is abnormal glucose metabolism induced by chronic hyperglycemia in the peripheral nerves. Particularly, activation of collateral glucose-utilizing pathways such as the polyol pathway, protein kinase C, advanced glycation end-product formation, hexosamine biosynthetic pathway, pentose phosphate pathway, and anaerobic glycolytic pathway are reported to contribute to the onset and progression of DPN. Inhibitors of aldose reductase, a rate-limiting enzyme involved in the polyol pathway, are the only compounds clinically permitted for DPN treatment in Japan, although their efficacies are limited. This may indicate that multiple pathways can contribute to the pathophysiology of DPN. Comprehensive metabolic analysis may help to elucidate global changes in the collateral glucose-utilizing pathways during the development of DPN, and highlight therapeutic targets in these pathways. Keywords: diabetic polyneuropathy; glycolysis; oxidative stress; polyol pathway; hexosamine biosynthetic pathway; advanced glycation end-products; PKC; glucosamine; pentose phosphate pathway; anaerobic glycolytic pathway Citation: Mizukami, H.; Osonoi, S.
    [Show full text]