DOCSLIB.ORG

Human Papilloma Virus (HPV) Integration Signature in Cervical Cancer: Identification of MACROD2 Gene As HPV Hot Spot Integration Site

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Human Papilloma Virus (HPV) Integration Signature in Cervical Cancer: Identification of MACROD2 Gene As HPV Hot Spot Integration Site www.nature.com/bjc ARTICLE Molecular Diagnostics Human papilloma virus (HPV) integration signature in Cervical Cancer: identification of MACROD2 gene as HPV hot spot integration site Maud Kamal1,2, Sonia Lameiras3, Marc Deloger4, Adeline Morel5, Sophie Vacher5, Charlotte Lecerf1,2, Célia Dupain1,2, Emmanuelle Jeannot 5,6, Elodie Girard4, Sylvain Baulande3, Coraline Dubot1,2, Gemma Kenter7, Ekaterina S. Jordanova 7,8, Els M. J. J. Berns9, Guillaume Bataillon6, Marina Popovic10, Roman Rouzier11,12, Wulfran Cacheux13, Christophe Le Tourneau 1,2,4,12, Alain Nicolas14, Nicolas Servant4, Suzy M. Scholl1,2, Ivan Bièche5,15 and RAIDs Consortium BACKGROUND: Cervical cancer (CC) remains a leading cause of gynaecological cancer-related mortality with infection by human papilloma virus (HPV) being the most important risk factor. We analysed the association between different viral integration signatures, clinical parameters and outcome in pre-treated CCs. METHODS: Different integration signatures were identified using HPV double capture followed by next-generation sequencing (NGS) in 272 CC patients from the BioRAIDs study [NCT02428842]. Correlations between HPV integration signatures and clinical, biological and molecular features were assessed. RESULTS: Episomal HPV was much less frequent in CC as compared to anal carcinoma (p < 0.0001). We identified >300 different HPV-chromosomal junctions (inter- or intra-genic). The most frequent integration site in CC was in MACROD2 gene followed by MIPOL1/TTC6 and TP63. HPV integration signatures were not associated with histological subtype, FIGO staging, treatment or PFS. HPVs were more frequently episomal in PIK3CA mutated tumours (p = 0.023). Viral integration type was dependent on HPV genotype (p < 0.0001); HPV18 and HPV45 being always integrated. High HPV copy number was associated with longer PFS (p = 0.011). CONCLUSIONS: This is to our knowledge the first study assessing the prognostic value of HPV integration in a prospectively annotated CC cohort, which detects a hotspot of HPV integration at MACROD2; involved in impaired PARP1 activity and chromosome instability. British Journal of Cancer (2021) 124:777–785; https://doi.org/10.1038/s41416-020-01153-4 BACKGROUND genome. Both patterns may be present jointly (episomal/ Cervical cancer (CC) remains a leading cause of gynaecological integrated).5 It is thought that the longer half-life of integrated cancer-related mortality worldwide and constitutes the second viral transcripts compared to half-life of episomal transcripts most common malignancy in women.1 Although patients with CC favours cellular immortalisation and transformation into cancer exhibit differences in clinical behaviour, infection by high-risk cells while also providing a selective growth advantage.6 Most human papilloma virus (HPV) remains an important initiating often, the integration of HPV DNA leads to a breakpoint in the E2 event in CC tumorigenesis,2 and one of the most important risk gene, resulting in de-repression of the E6 and E7 viral oncogenes. factors for developing CC.3 Most HPV infections are cleared When the virus remains episomal, expression of E6 and E7 spontaneously by the immune system, yet in some cases, it proteins may result from leaky expression or epigenetics persists leading to cancer.4 Following infection, the virus can dysregulation. E6 and E7 proteins impact the function of p53 remain in its episomal form, or become integrated into the host and pRb proteins, allowing squamous cell tumorigenesis.6 1Department of Drug Development and Innovation, Institut Curie, PSL Research University, 75005 Paris & 92210, Saint-Cloud, France; 2Department of Drug Development and Innovation, Institut Curie, PSL Research University, 92210 Saint-Cloud, France; 3Institut Curie, Genomics of Excellence (ICGex) Platform, PSL Research University, 75005 Paris, France; 4Bioinformatics and Computational Systems Biology of Cancer, PSL Research University, Mines Paris Tech, INSERM U900, 75005 Paris, France; 5Department of Genetics, Institut Curie, PSL Research University, 75005 Paris, France; 6Department of Pathology, Institut Curie, PSL Research University, 75005 Paris, France; 7Center for Gynaecologic Oncology Amsterdam, Amsterdam UMC and The Netherlands Cancer Institute - Antoni van Leeuwenhoek Hospital, Amsterdam, The Netherlands; 8Department of Pathology, Leiden University Medical Center, Leiden, The Netherlands; 9Department of Medical Oncology, Erasmus MC, 3000 CA Rotterdam, The Netherlands; 10Oncology Institute of Vojvodina, Put doktora Goldmana, 421204 Sremska Kamenica, Serbia; 11Department of Surgery, Institut Curie, PSL Research University, 92210 Saint-Cloud, France; 12Paris-Saclay University, Paris, France; 13Hopital Privé Pays de Savoie, Service d’oncologie médicale, 19 avenue Pierre Mendès France, 74100 Annemasse, France; 14Institut Curie, PSL Research University, CNRS UMR3244, 75248 Paris, France and 15Faculty of Pharmaceutical and Biological Sciences, INSERM U1016, Paris Descartes University, 75005 Paris, France Correspondence: Maud Kamal ([email protected]) Members of the RAIDs Consortium are listed end of the paper. These authors contributed equally: Suzy M. Scholl, Ivan Bièche. Received: 18 March 2020 Revised: 2 October 2020 Accepted: 15 October 2020 Published online: 16 November 2020 © The Author(s) 2020 Published by Springer Nature on behalf of Cancer Research UK Human papilloma virus (HPV) integration signature in Cervical Cancer:. M Kamal et al. 778 Several mechanisms of integration have been reported in the Table 1. Clinical and biological characteristics of 272 patients with literature; the “looping” model of HPV integration following DNA HPV-positive cervical cancer, in relation to progression-free survival. replication and recombination (resulting in DNA concatemers)7 is the most widely accepted but not experimentally reconstituted. Patients (%) Events (%)a PFS (p HPV DNA integration into the human genome triggers various value)b genetic alterations, such as oncogenes amplification, tumour suppressor gene inactivation, inter- or intra- chromosomal Total 272 (100.0) 84 (30.9) 6,8 rearrangements as well as genetic instability. Genes localised Age near the integration sites of viral genomes can experience ≤50 140 (51.5) 41 (29.3) 0.40 (NS) changes in RNA and protein expression levels, leading to over- >50 132 (48.5) 43 (32.6) or under-expression. In 2015, whole-genome sequencing and high-throughput viral integration methods identified as many as Histologic subtype 3667 HPV integration breakpoints in cervical neoplastic lesions. Squamous cell carcinoma 230 (84.6) 71 (30.9) 0.56 (NS) Frequent integration sites have been reported in genes relevant to Adenocarcinoma 27 (9.9) 8 (29.6) 9 the neoplastic process, such as the MYC oncogene. Loss of Adenosquamous 10 (3.7) 4 (40.0) function (LOF) in the RAD51B tumour suppressor gene following carcinoma HPV DNA insertion was reported to affect the DNA repair pathway 10 Mixed form or 5 (1.8) 1 (20.0) and genomic instability in CC. undifferentiated HPV DNA integration occurs as a single copy or in multiple HPV status repeats (in tandem or dispersed).11 In 2016, Holmes et al. developed a Capture HPV method to identify five different HPV Genotype 16 155 (57.0) 50 (32.3) 0.13 (NS) signatures in 72 CC. The first two signatures contain two hybrid Genotype 18 36 (13.2) 14 (38.9) chromosomal–HPV junctions which are co-linear (2 Junctions Genotype 45 27 (9.9) 10 (37.0) “ ” “ ” Colinear 2J-COL ) or non-linear (2 Junctions Non-Linear 2J-NL ) Genotype 31 9 (3.3) 0 (0) depending on their relative orientations. It reflects two modes of Genotype 33 11 (4.0) 0 (0) viral integration, associated with chromosomal deletion or c amplification events, respectively. The third and fourth signatures Other genotypes 34 (12.5) 10 (29.4) 1234567890();,: exhibit several hybrid junctions either clustered in one chromo- FIGO stage somal region (Multiple Junctions Clustered “MJ-CL”) or scattered at I/II 205 (75.4) 50 (24.4) <0.0001 “ ” fi distinct loci (Multiple Junctions Scattered MJ-SC ) while the fth III/IV 67 (24.6) 34 (50.7) signature consists of episomal forms of HPV (EPI).12 Nodal involvement On the assumption that HPV integration types/signatures/ pattern might predict clinical outcomes, we analysed the Yes 167 (61.4) 62 (37.1) 0.0028 association between the different viral integration signatures, No 105 (38.6) 22 (21.0) clinical and pathological parameters and outcome in the large Pelvic lymph nodes cohort of 272 HPV-positive CC patients enrolled in the prospective Yes 165 (60.7) 62 (37.6) 0.0015 BioRAIDs study [NCT02428842]. No 107 (39.3) 22 (20.6) Para-aortic lymph nodes METHODS Yes 43 (15.8) 22 (51.2) 0.0001 Patients and samples No 229 (84.2) 62 (27.1) Patients included in this study were enrolled in the EU-funded Initial therapy RAIDs Network (Rational Molecular Assessment and Innovative Surgery 54 (19.9) 10 (18.5) 0.0008 Drug Selection, www.raids-fp7.eu) prospective CC BioRAIDs study [NCT02428842]. The clinical protocol together with tumour Radiotherapy 176 (64.7) 52 (29.5) sampling procedures, quality control of samples and treatment Neoadjuvant 42 (15.4) 22 (52.4) in 18 European centres (seven European countries) as well as chemotherapy – study results have been previously published.13 15 PIK3CA mutational statusd WT 182 (67.7) 60 (33.0) 0.23 (NS) HPV typing Mutated 87 (32.3) 23 (26.4) All samples included in this study were analysed for HPV type, using the SPF10 primer set and INNO-LiPA HPV genotyping extra Significant results are displayed
Load more

Recommended publications
  • A Genome-Wide Association Study of Bisphosphonate-Associated
    Calcifed Tissue International (2019) 105:51–67 https://doi.org/10.1007/s00223-019-00546-9 ORIGINAL RESEARCH A Genome‑Wide Association Study of Bisphosphonate‑Associated Atypical Femoral Fracture Mohammad Kharazmi1 · Karl Michaëlsson1 · Jörg Schilcher2 · Niclas Eriksson3,4 · Håkan Melhus3 · Mia Wadelius3 · Pär Hallberg3 Received: 8 January 2019 / Accepted: 8 April 2019 / Published online: 20 April 2019 © The Author(s) 2019 Abstract Atypical femoral fracture is a well-documented adverse reaction to bisphosphonates. It is strongly related to duration of bisphosphonate use, and the risk declines rapidly after drug withdrawal. The mechanism behind bisphosphonate-associated atypical femoral fracture is unclear, but a genetic predisposition has been suggested. With the aim to identify common genetic variants that could be used for preemptive genetic testing, we performed a genome-wide association study. Cases were recruited mainly through reports of adverse drug reactions sent to the Swedish Medical Products Agency on a nation- wide basis. We compared atypical femoral fracture cases (n = 51) with population-based controls (n = 4891), and to reduce the possibility of confounding by indication, we also compared with bisphosphonate-treated controls without a current diagnosis of cancer (n = 324). The total number of single-nucleotide polymorphisms after imputation was 7,585,874. A genome-wide signifcance threshold of p < 5 × 10−8 was used to correct for multiple testing. In addition, we performed candidate gene analyses for a panel of 29 genes previously implicated in atypical femoral fractures (signifcance threshold of p < 5.7 × 10−6). Compared with population controls, bisphosphonate-associated atypical femoral fracture was associated with four isolated, uncommon single-nucleotide polymorphisms.
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • PDF Datasheet
    Product Datasheet C9orf85 Overexpression Lysate NBL1-08604 Unit Size: 0.1 mg Store at -80C. Avoid freeze-thaw cycles. Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/NBL1-08604 Updated 3/17/2020 v.20.1 Earn rewards for product reviews and publications. Submit a publication at www.novusbio.com/publications Submit a review at www.novusbio.com/reviews/destination/NBL1-08604 Page 1 of 2 v.20.1 Updated 3/17/2020 NBL1-08604 C9orf85 Overexpression Lysate Product Information Unit Size 0.1 mg Concentration The exact concentration of the protein of interest cannot be determined for overexpression lysates. Please contact technical support for more information. Storage Store at -80C. Avoid freeze-thaw cycles. Buffer RIPA buffer Target Molecular Weight 18.1 kDa Product Description Description Transient overexpression lysate of chromosome 9 open reading frame 85 (C9orf85) The lysate was created in HEK293T cells, using Plasmid ID RC208807 and based on accession number NM_182505. The protein contains a C- MYC/DDK Tag. Gene ID 138241 Gene Symbol C9ORF85 Species Human Notes HEK293T cells in 10-cm dishes were transiently transfected with a non-lipid polymer transfection reagent specially designed and manufactured for large volume DNA transfection. Transfected cells were cultured for 48hrs before collection. The cells were lysed in modified RIPA buffer (25mM Tris-HCl pH7.6, 150mM NaCl, 1% NP-40, 1mM EDTA, 1xProteinase inhibitor cocktail mix, 1mM PMSF and 1mM Na3VO4, and then centrifuged to clarify the lysate. Protein concentration was measured by BCA protein assay kit.This product is manufactured by and sold under license from OriGene Technologies and its use is limited solely for research purposes.
    [Show full text]
  • Open Dogan Phdthesis Final.Pdf
    The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues.
    [Show full text]
  • List of Genes Associated with Sudden Cardiac Death (Scdgseta) Gene
    List of genes associated with sudden cardiac death (SCDgseta) mRNA expression in normal human heart Entrez_I Gene symbol Gene name Uniprot ID Uniprot name fromb D GTEx BioGPS SAGE c d e ATP-binding cassette subfamily B ABCB1 P08183 MDR1_HUMAN 5243 √ √ member 1 ATP-binding cassette subfamily C ABCC9 O60706 ABCC9_HUMAN 10060 √ √ member 9 ACE Angiotensin I–converting enzyme P12821 ACE_HUMAN 1636 √ √ ACE2 Angiotensin I–converting enzyme 2 Q9BYF1 ACE2_HUMAN 59272 √ √ Acetylcholinesterase (Cartwright ACHE P22303 ACES_HUMAN 43 √ √ blood group) ACTC1 Actin, alpha, cardiac muscle 1 P68032 ACTC_HUMAN 70 √ √ ACTN2 Actinin alpha 2 P35609 ACTN2_HUMAN 88 √ √ √ ACTN4 Actinin alpha 4 O43707 ACTN4_HUMAN 81 √ √ √ ADRA2B Adrenoceptor alpha 2B P18089 ADA2B_HUMAN 151 √ √ AGT Angiotensinogen P01019 ANGT_HUMAN 183 √ √ √ AGTR1 Angiotensin II receptor type 1 P30556 AGTR1_HUMAN 185 √ √ AGTR2 Angiotensin II receptor type 2 P50052 AGTR2_HUMAN 186 √ √ AKAP9 A-kinase anchoring protein 9 Q99996 AKAP9_HUMAN 10142 √ √ √ ANK2/ANKB/ANKYRI Ankyrin 2 Q01484 ANK2_HUMAN 287 √ √ √ N B ANKRD1 Ankyrin repeat domain 1 Q15327 ANKR1_HUMAN 27063 √ √ √ ANKRD9 Ankyrin repeat domain 9 Q96BM1 ANKR9_HUMAN 122416 √ √ ARHGAP24 Rho GTPase–activating protein 24 Q8N264 RHG24_HUMAN 83478 √ √ ATPase Na+/K+–transporting ATP1B1 P05026 AT1B1_HUMAN 481 √ √ √ subunit beta 1 ATPase sarcoplasmic/endoplasmic ATP2A2 P16615 AT2A2_HUMAN 488 √ √ √ reticulum Ca2+ transporting 2 AZIN1 Antizyme inhibitor 1 O14977 AZIN1_HUMAN 51582 √ √ √ UDP-GlcNAc: betaGal B3GNT7 beta-1,3-N-acetylglucosaminyltransfe Q8NFL0
    [Show full text]
  • Dual Proteome-Scale Networks Reveal Cell-Specific Remodeling of the Human Interactome
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dual Proteome-scale Networks Reveal Cell-specific Remodeling of the Human Interactome Edward L. Huttlin1*, Raphael J. Bruckner1,3, Jose Navarrete-Perea1, Joe R. Cannon1,4, Kurt Baltier1,5, Fana Gebreab1, Melanie P. Gygi1, Alexandra Thornock1, Gabriela Zarraga1,6, Stanley Tam1,7, John Szpyt1, Alexandra Panov1, Hannah Parzen1,8, Sipei Fu1, Arvene Golbazi1, Eila Maenpaa1, Keegan Stricker1, Sanjukta Guha Thakurta1, Ramin Rad1, Joshua Pan2, David P. Nusinow1, Joao A. Paulo1, Devin K. Schweppe1, Laura Pontano Vaites1, J. Wade Harper1*, Steven P. Gygi1*# 1Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA. 2Broad Institute, Cambridge, MA, 02142, USA. 3Present address: ICCB-Longwood Screening Facility, Harvard Medical School, Boston, MA, 02115, USA. 4Present address: Merck, West Point, PA, 19486, USA. 5Present address: IQ Proteomics, Cambridge, MA, 02139, USA. 6Present address: Vor Biopharma, Cambridge, MA, 02142, USA. 7Present address: Rubius Therapeutics, Cambridge, MA, 02139, USA. 8Present address: RPS North America, South Kingstown, RI, 02879, USA. *Correspondence: [email protected] (E.L.H.), [email protected] (J.W.H.), [email protected] (S.P.G.) #Lead Contact: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Transcriptional Control of Tissue-Resident Memory T Cell Generation
    Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Comprehensive Identification of Genes Driven by ERV9-Ltrs Reveals TNFRSF10B As a Re-Activatable Mediator of Testicular Cancer Cell Death
    Cell Death and Differentiation (2016) 23, 64–75 & 2016 Macmillan Publishers Limited All rights reserved 1350-9047/16 www.nature.com/cdd Comprehensive identification of genes driven by ERV9-LTRs reveals TNFRSF10B as a re-activatable mediator of testicular cancer cell death U Beyer1,2,5, SK Krönung1,5, A Leha3, L Walter4 and M Dobbelstein*,1 The long terminal repeat (LTR) of human endogenous retrovirus type 9 (ERV9) acts as a germline-specific promoter that induces the expression of a proapoptotic isoform of the tumor suppressor homologue p63, GTAp63, in male germline cells. Testicular cancer cells silence this promoter, but inhibitors of histone deacetylases (HDACs) restore GTAp63 expression and give rise to apoptosis. We show here that numerous additional transcripts throughout the genome are driven by related ERV9-LTRs. 3' Rapid amplification of cDNA ends (3’RACE) was combined with next-generation sequencing to establish a large set of such mRNAs. HDAC inhibitors induce these ERV9-LTR-driven genes but not the LTRs from other ERVs. In particular, a transcript encoding the death receptor DR5 originates from an ERV9-LTR inserted upstream of the protein coding regions of the TNFRSF10B gene, and it shows an expression pattern similar to GTAp63. When treating testicular cancer cells with HDAC inhibitors as well as the death ligand TNF-related apoptosis-inducing ligand (TRAIL), rapid cell death was observed, which depended on TNFRSF10B expression. HDAC inhibitors also cooperate with cisplatin (cDDP) to promote apoptosis in testicular cancer cells. ERV9-LTRs not only drive a large set of human transcripts, but a subset of them acts in a proapoptotic manner.
    [Show full text]
  • Chromosome 14 Transfer and Functional Studies Identify a Candidate Tumor Suppressor Gene, Mirror Image Polydactyly 1, in Nasopharyngeal Carcinoma
    Chromosome 14 transfer and functional studies identify a candidate tumor suppressor gene, Mirror image polydactyly 1, in nasopharyngeal carcinoma Arthur Kwok Leung Cheunga, Hong Lok Lungb, Josephine Mun Yee Kob, Yue Chenga,c, Eric J. Stanbridged, Eugene R. Zabarovskye, John M. Nichollsf, Daniel Chuab, Sai Wah Tsaog, Xin-Yuan Guanb, and Maria Li Lungb,1 aDepartment of Biology and Center for Cancer Research, Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong (SAR), People’s Republic of China; bDepartment of Clinical Oncology, University of Hong Kong, Pokfulam, Hong Kong (SAR), People’s Republic of China; cDepartment of Biology, City of Hope, Beckman Research Institute, Duarte,CA 91010; dDepartment of Microbiology and Molecular Genetics, University of California, Irvine, CA 92697; eDepartment of Microbiology, Tumor and Cell Biology, Karolinska Institute, Stockholm, Sweden; and Departments of fPathology and gAnatomy, University of Hong Kong, Pokfulam, Hong Kong (SAR), People’s Republic of China Edited by George Klein, Karolinska Institutet, Stockholm, Sweden, and approved July 7, 2009 (received for review January 7, 2009) Chromosome 14 allelic loss is common in nasopharyngeal carcinoma particular interest to us that chromosome 14 loss is associated with (NPC) and may reflect essential tumor suppressor gene loss in tumor- cancer metastasis in breast tumors (15) and with poor clinical prognosis igenesis. An intact chromosome 14 was transferred to an NPC cell line for other head and neck cancers (16). Thus, it is possible that a using a microcell-mediated chromosome transfer approach. Microcell chromosome 14 TSG may be a useful prognostic marker in NPC. hybrids (MCHs) containing intact exogenously transferred chromo- In this study, we obtained functional evidence showing definitively some 14 were tumor suppressive in athymic mice, demonstrating that that chromosome 14 is tumor suppressive in NPC.
    [Show full text]
  • Gene Section Review
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Review MIRN21 (microRNA 21) Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson Biology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey Published in Atlas Database: March 2007 Online updated version: http://AtlasGeneticsOncology.org/Genes/MIRN21ID44019ch17q23.html DOI: 10.4267/2042/38450 This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence. © 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology sequences of MIRN21 showed enrichment for Pol II Identity but not Pol III. Hugo: MIRN21 MIRN21 gene was shown to harbor a 5' promoter Other names: hsa-mir-21; miR-21 element. 1008 bp DNA fragment for MIRN21 gene Location: 17q23.1 was cloned (-959 to +49 relative to T1 transcription Location base pair: MIRN21 is located on chr17: site, see Figure 1; A). Analysis of the sequence showed 55273409-55273480 (+). a candidate 'CCAAT' box transcription control element Local order: Based on Mapviewer, genes flanking located approximately about 200 nt upstream of the T1 MIRN21 oriented from centromere to telomere on site. T1 transcription site was found to be located in a 17q23 are: sequence similar to 'TATA' box - TMEM49, transmembrane protein 49, 17q23.1. (ATAAACCAAGGCTCTTACCATAGCTG). To test - MIRN21, microRNA 21, 17q23.1. the activity of the element, about 1kb DNA fragment - TUBD1, tubulin, delta 1, 17q23.1. was inserted into the 5' end of firefly luciferase - LOC729565, similar to NADH dehydrogenase indicator gene and transfected into 293T cells. The (ubiquinone) 1 beta subcomplex, 8, 19 kDa, 17q23.1.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]