Low-Dose Tolerance Is Mediated by the Microfold Cell Ligand, Reovirus Protein σ1 Agnieszka Rynda, Massimo Maddaloni, Dagmara Mierzejewska, Javier Ochoa-Repáraz, Tomasz Maslanka, This information is current as Kathryn Crist, Carol Riccardi, Beata Barszczewska, Kohtaro of September 29, 2021. Fujihashi, Jerry R. McGhee and David W. Pascual J Immunol 2008; 180:5187-5200; ; doi: 10.4049/jimmunol.180.8.5187

http://www.jimmunol.org/content/180/8/5187 Downloaded from

References This article cites 65 articles, 29 of which you can access for free at: http://www.jimmunol.org/content/180/8/5187.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Low-Dose Tolerance Is Mediated by the Microfold Cell Ligand, Reovirus Protein ␴11

Agnieszka Rynda,* Massimo Maddaloni,* Dagmara Mierzejewska,† Javier Ochoa-Repa´raz,* Tomasz Mas´lanka,* Kathryn Crist,* Carol Riccardi,* Beata Barszczewska,* Kohtaro Fujihashi,‡ Jerry R. McGhee,‡ and David W. Pascual2*

Mucosal tolerance induction generally requires multiple or large Ag doses. Because microfold (M) cells have been implicated as being important for mucosal tolerance induction and because reovirus attachment protein ␴1(p␴1) is capable of binding M cells, we postulated that targeting a model Ag to M cells via p␴1 could induce a state of unresponsiveness. Accordingly, a genetic fusion between OVA and the M cell ligand, reovirus p␴1, termed OVA-p␴1, was developed to enhance tolerogen uptake. When applied nasally, not parenterally, as little as a single dose of OVA-p␴1 failed to induce OVA-specific Abs even in the presence of adjuvant. Moreover, the mice remained unresponsive to peripheral OVA challenge, unlike mice given multiple nasal OVA doses that Downloaded from rendered them responsive to OVA. The observed unresponsiveness to OVA-p␴1 could be adoptively transferred using cervical lymph node CD4؉ T cells, which failed to undergo proliferative or delayed-type hypersensitivity responses in recipients. To discern the cytokines responsible as a mechanism for this unresponsiveness, restimulation assays revealed increased production of reg- ulatory cytokines, IL-4, IL-10, and TGF-␤1, with greatly reduced IL-17 and IFN-␥. The induced IL-10 was derived predominantly (from FoxP3؉CD25؉CD4؉ T cells. No FoxP3؉CD25؉CD4؉ T cells were induced in OVA-p␴1-dosed IL-10-deficient (IL-10؊/؊ http://www.jimmunol.org/ mice, and despite showing increased TGF-␤1 synthesis, these mice were responsive to OVA. These data demonstrate the feasibility of using p␴1 as a mucosal delivery platform specifically for low-dose tolerance induction. The Journal of Immunology, 2008, 180: 5187–5200.

ϩ ucosal tolerance is a dose-dependent process (1–3) re- 5–10% of total peripheral CD4 T cells (8, 9). Specific Treg cells quiring either high doses or multiple administrations are known to express the nuclear forkhead box P3 (FoxP3) tran- M of Ag typically applied orally. The former mode in- scription factor and suppress the immune response in an IL-10- duces tolerance by clonal anergy/deletion of effector cells, whereas and/or TGF-␤-dependent fashion (10).

the latter, based on repeated low-dose administration, causes active Peyer’s patches (PPs) are thought to be required for induction of by guest on September 29, 2021 suppression of effector cells (3–7). Such suppression occurs via oral tolerance (1, 6, 11) based upon the findings that treatment of ϩ ϩ activation of specific regulatory cells, among which CD25 CD4 female mice with soluble lymphotoxin-␤ receptor-Ig fusion pro- 3 T regulatory (Treg) cells have been best described (2, 6). Although tein during gestation results in the disruption of the peripheral the phenotypic characteristics of Treg cells are still being investi- ϩ ϩ lymph nodes (LNs) and PPs in their offspring, leaving the mesen- gated, currently, this naturally anergic peripheral CD25 CD4 T teric, sacral, and cervical LNs (CLNs) intact (12). Offspring of cell population is thought to normally constitute not more than such PPnull mice subjected to a high-dose OVA oral tolerance reg- imen do not respond to peripheral OVA challenge (11). The PPs *Veterinary Molecular Biology, Montana State University, Bozeman, MT 59718; (1, 6, 11) and an analogous structure in the upper respiratory tract, †Department of Food Chemistry, Institute of Food Research, Polish Academy of Science, Olsztyn, Poland; and ‡Departments of Pediatric Dentistry and Microbiology, the nasopharyngeal - associated lymphoid tissue (NALT; Refs. 13 Immunobiology Vaccine Center, University of Alabama at Birmingham, Birmingham and 14), actively facilitate immunity or unresponsiveness by lu- AL 35294 minal Ag sampling (2, 14, 15) via a specialized epithelium con- Received for publication July 27, 2007. Accepted for publication January 21, 2008. taining microfold (M) cells (16). Ags are subsequently transported The costs of publication of this article were defrayed in part by the payment of page from the luminal surface via M cells, which localize in the follicle- charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. associated epithelium to the subepithelial dome area for eventual 1 This work was supported by Public Health Service Grants AI-56286, DE-13812, presentation to mucosal B and T cells (15, 17). A number of patho- DE-12242, AI-18958, and AG-25873, and in part, by the Montana Agricultural Sta- gens, such as reovirus and Salmonella, specifically target this spe- tion and U.S. Department of Agriculture Formula Funds. The Veterinary Molecular Biology flow cytometry facility was, in part, supported by National Institutes of cialized follicle-associated epithelium to infect the host (18–22). Health/National Center for Research Resources, Centers of Biomedical Excellence Reovirus infects the host via its cell adhesin, protein ␴1(p␴1), that P20 RR-020185, and an equipment grant from the M. J. Murdock Charitable Trust. is responsible for reovirus attachment to M cells (14, 18–20). Pre- 2 Address correspondence and reprint requests to Dr. David W. Pascual, Veterinary ␴ Molecular Biology, Montana State University, P.O. Box 173610, Bozeman, MT vious studies demonstrated binding of recombinant fusion p 1to 59717-3610. E-mail address: [email protected] NALT, suggesting that a p␴1-based vehicle can be applied for 3 Abbreviations used in this paper: Treg, T regulatory; FoxP3, forkhead box P3; PP, genetic vaccination of mucosal tissues (14, 23). A modified ver- ␴ ␴ Peyer’s patch; LN, lymph node; CLN, cervical LN; p 1, protein 1; CT, cholera sion of p␴1 obtained by chemically conjugating p␴1 to poly-L- toxin; ODN, oligodeoxynucleotide; DTH, delayed-type hypersensitivity; MLN, mes- enteric LN; HNLN, head and neck LN; NALT, nasopharyngeal-associated lymphoid lysine significantly enhanced immunity to the encoded DNA vac- tissue; M cell, microfold cell; Tg, transgenic; sPBS, sterile PBS; p.i., cine following nasal administration (14, 24). Due to these targeting postimmunization. capabilities, we queried whether recombinant p␴1 could ferry sol- Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 uble proteins to mucosal tissues as well.

www.jimmunol.org ␴ ϩ 5188 p 1 STIMULATES IL-10 Treg CELLS

To test this possibility, a cDNA encoding for the model Ag, OVA (10 mg/ml) with or without adjuvant (CT or ODN). For peripheral OVA, was cloned 5Ј to p␴1 as a histidine-tag fusion protein and challenge, mice were given a s.c. injection at 1:1 ratio of 100 ␮gofOVA ␮ termed OVA-p␴1. We demonstrated here that mice nasally immu- in IFA (Sigma-Aldrich) for a total volume of 100 l/mouse. nized with the OVA-p␴1 fusion protein become tolerogenic to Sample collections and Ab ELISA OVA and resistant to peripheral challenge as a result of the gen- Serum (saphenous vein) and fecal samples were collected weekly from eration of Ag-specific Treg cells, which, in turn, actively suppress each mouse. Fecal extractions (4, 14, 25) and vaginal washes (25) were effector T cells. Immunization with OVA-p␴1 significantly in- performed, as previously described. OVA-specific endpoint Ab titers were creased the numbers of IL-4-producing CD25ϪCD4ϩ T cells, to- measured by ELISA, as previously described (17), using purified OVA (grade V) as coating Ag. Specific reactivity to OVA was determined using gether with IL-10-producing Treg cells, which inhibited the prolif- ϩ HRP conjugates of goat anti-mouse IgG-, IgA-specific Abs (1.0 ␮g/ml; eration of OVA-specific CD4 T cells in vivo and successfully Southern Biotechnology Associates), and ABTS (Moss) enzyme substrate. suppressed production of proinflammatory cytokines. In the ab- The absorbances were measured at 415 nm on a Kinetics reader model sence of IL-10, OVA-p␴1-mediated tolerance was lost. Thus, these ELx808 (Bio-Tek Instruments). Endpoint titers were expressed as the re- studies show that nasal p␴1-Ag delivery is an effective means to ciprocal dilution of the last sample dilution, giving an absorbance of 0.1 OD units above the OD of negative controls after1hofincubation (4, induce systemic tolerance. 415 25). Materials and Methods Measurement of delayed-type hypersensitivity (DTH) responses ␴ Preparation of OVA-p 1 To measure OVA-specific DTH responses in vivo (17), 10 ␮gofOVA ␮ Protein ␴1 was recloned without its fusion maltose-binding protein partner were injected into the left ear pinna, and PBS alone (20 l) was adminis- (23) to allow expression in the yeast Pichia pastoris vector pPICB bearing tered to the right ear pinna as a control. Ear swelling was measured 24 h Downloaded from a his-tag C terminus for protein purification (Invitrogen Life Technolo- later with an electronic digital caliper (World Precision Instruments). The gies), referred to as p␴1. To obtain the fusion protein OVA-p␴1, OVA was DTH response was calculated as the increase in ear swelling after OVA amplified with appropriate pairs of primers from an OVA cDNA. The 5Ј injection following subtraction of swelling in the control site injected primer encoded an EcoRI site and an ATG initiation codon embedded into with PBS. Ј an optimal Kozak’s sequence. The 3 primer provided a SalI site. The PCR Isolation of CD4ϩ T cells and T cell ELISPOT product was gel-purified and cloned into an intermediate topocloning vec-

tor. The insert was excised by cutting with EcoRI and SalI and gel-purified Lymphocytes were isolated from mesenteric lymph nodes (MLNs), head http://www.jimmunol.org/ again, resulting in EcoRI and SalI ends. The upstream primer for p␴1 and neck LNs (HNLNs), and spleens. LNs and spleens were obtained and contained a SalI site designed to frame the OVA SalI end; the downstream lymphoid cells isolated, as previously described (4, 27). Splenic mononu- primer contained a KpnI primer designed to frame the fused protein to the clear cell suspensions were subjected to lympholyte-M (Accurate Chemical his tag present in the P. pastoris expression vector pPICB. The PCR prod- and Scientific) density gradient centrifugation, and CD4ϩ T cells were ucts were gel-purified and cloned into a topocloning vector. The inserts isolated by negative selection (Dynal Mouse CD4 Negative Isolation kit; were then excised by cutting with SalI and KpnI and gel-purified again, Invitrogen Life Technologies). An aliquot of 2 ϫ 106 CD4ϩ T cells were thus having SalI and KpnI ends. Finally, the yeast expression vector, cultured for 72 h (37°C, 5% CO2) with an equal number of splenic feeder pPICB, was cut with EcoRI and KpnI. A tripartite ligation was set up to cells (T cell depleted, mitomycin C treated) in the presence or absence of join together these components: 1) the “Ag” (OVA) as an EcoRI-SalI frag- ␮ 1 mg/ml OVA (17) or 1 g/ml OVA323–329 peptide. For T cell ELISPOT ment; 2) the “transporter” (p␴1), as a SalI-KpnI fragment; and 3) the vector analysis, CD4ϩ T cells were added to cytokine-coated, nitrocellulose-bot- cut with EcoRI and KpnI. The junction between the “passenger Ag” and the tom microtiter plates (Millipore; MultiScreen). For detection of IFN-␥, by guest on September 29, 2021 “transporter” featured a flexible linker (Gly-Arg-Pro) to minimize steric IL-2, IL-4, IL-10, IL-13, and IL-17, the plates were coated with 5 ␮g/ml hindrance between the components. The resulting construct was sequenced purified mAbs (BD Pharmingen), and the reaction was detected using 0.5 and expressed in the yeast P. pastoris, according to the manufacturer’s ␮g/ml appropriate biotinylated mAbs (BD Pharmingen). For TGF-␤1 directions (Invitrogen Life Technologies). Recombinant proteins were ex- ELISPOT, an anti-TGF-␤1 mAb (10 ␮g/ml; clone 1D11; R&D Systems) tracted from yeast cells by a bead-beater (Biospec Products) and purified was used for coating, and a biotinylated chicken anti-human TGF-␤1Ab on a Talon metal affinity resin (BD Biosciences), according to manufac- (5.0 ␮g/ml; R&D Systems) was used for detection. The color reaction was turer’s instructions. Proteins were assessed for purity and quality by Coo- developed using a HRP-conjugated goat anti-biotin Ab (Vector Laborato- massie-stained polyacrylamide gels and by Western blot analysis using a ries) and 3-amino-9-ethylcarbazole reagent (Moss) and enumerated, as pre- polyclonal rabbit anti-p␴1 (produced in-house) or a polyclonal rabbit anti- viously described (14, 27). OVA Ab (Sigma-Aldrich). All recombinant proteins migrated as a single band with the expected molecular weight. FACS analysis Mice Lymphocytes from CLNs, HNLNs, MLNs, PPs, and spleens from different immunization groups following OVA plus IFA challenge were cultured at Female BALB/c and C57BL/6N mice (Frederick Cancer Research Facility, 5 ϫ 106 cells/ml in medium alone or in the presence of OVA (1 mg/ml). National Cancer Institute, Frederick, MD) were used throughout this study. Cells were then stained for FACS analysis with Abs to cell surface mol- Ϫ/Ϫ DO11.10 and IL-10 breeder pairs were obtained from The Jackson ecules: FITC-anti-mouse CD4 (GK1.5; BD Pharmingen), streptavidin-PE- Laboratory to establish our colonies. All mice were maintained in the Mon- Cy5 (BD Pharmingen) for biotinylated chicken anti-human TGF-␤1 IgY tana State University (MSU) Animal Resources Center under pathogen- (R&D Systems), and PE-Cy5- or allophycocyanin-anti-mouse CD25 (both free conditions in individually ventilated cages under HEPA-filtered barrier clones PC61; eBioscience). Intracellular staining was performed following conditions and were fed sterile food and water ad libitum. The mice were standard protocols with 2% paraformaldehyde and 0.2% saponin to stain free of bacterial and viral pathogens, as determined by Ab screening and with PE- or allophycocyanin-anti-mouse/rat FoxP3 (clone FJK-16s; eBio- histopathologic analysis of major organs and tissues. All animal studies science) or PE-rat anti-mouse IL-10 (BD Pharmingen), as previously de- were approved by the MSU Institutional Animal Care and Use Committee. scribed (27). Fluorochrome-conjugated rat IgG2a (clone eBR2a), IgG2b (clone A95-1), and IgG1 (clone R3-34) were used as isotype control Abs. Immunizations, tolerance induction, and OVA-specific challenge FACS analysis was performed on FACSCalibur (BD Biosciences). At least For tolerance induction, mice (five mice per group) were nasally dosed up 50,000 events were collected for each sample. to three times, as described in the text, with 50–100 ␮g of OVA-p␴1 alone ϩ or in combination with cholera toxin (CT; List Biologicals): 5 ␮gofCTfor Adoptive transfer of CD4 T cell subsets the initial dose and 2.5 ␮g with each boost (25). OVA-p␴1 was adminis- Adoptive transfer presented in Fig. 2A. Aliquots of 1 ϫ 107 CD4ϩ T tered nasally in a volume of no Ͼ20 ␮l/dose up to four times a day, with cells isolated from spleens of naive DO11.10 TCR-transgenic (Tg) mice no less than 2.5-h intervals between each administration. Mice were nasally were adoptively transferred via i.v. injection into naive BALB/c mice, dosed with OVA or OVA-p␴1 plus 25 ␮g of CpG oligodeoxynucleotide which, after 24 h, were dosed nasally with sterile PBS (sPBS), 400 ␮gof cDNA (CpG-ODN; Sigma-Aldrich), TCCATGACGTTCCTGACGTT OVA, or 80 ␮g of OVA-p␴1 or i.m. (tibialis anterior muscle) with 400 ␮g (26). As a tolerance control, a group of age-matched mice received a single of OVA. Three days later, total CLN CD4ϩ T cells (2 ϫ 105) isolated by oral 25-mg dose of OVA (grade V; Sigma-Aldrich) in 200 ␮l of saline (17). cell sorting were adoptively transferred into naive BALB/c mice, which, To stimulate anti-OVA immunity, mice were nasally dosed with 100 ␮gof 24 h later, were challenged s.c. with 100 ␮g of OVA in IFA. CD4ϩ T cells The Journal of Immunology 5189

were isolated from the CLNs and spleens 5 days later and subjected to an mucosal adjuvant (Fig. 1F). To discern whether OVA-p␴1 induces in vitro proliferation assay. tolerance to p␴1, serum samples collected from BALB/c mice na- Adoptive transfer experiments are presented in Figs. 2, B and C, and 3. sally dosed with OVA-p␴1 or with DNA complexes with p␴1- Naive BALB/c mice were adoptively transferred with Vybrant CM-Dil ␴ ϩ ϫ 7 poly-L-lysine were tested by Ab ELISA. Virtually, no p 1-specific (Molecular Probes)-labeled DO11.10 Tg CD4 T cells (1 10 ) isolated ␴ from naive OVA-Tg mice and with 6 ϫ 105 of one of the following T cell IgG Ab titers were detected in mice dosed with OVA-p 1 com- subsets: CD25ϩCD4ϩ, CD25ϪCD4ϩ, or total CD4ϩ T cells from OVA- pared with mice given DNA complexes with p␴1-poly-L-lysine, p␴1-dosed mice or with total CD4ϩ T cells from OVA-dosed mice. Con- which exhibited IgG titers in excess of 213 (Fig. 1G). Thus, OVA- ϩ trol mice received Tg DO11.10 CD4 T cells and PBS (positive prolifer- p␴1 tolerizes the host to p␴1- and OVA-specific B and T cell ation control). All recipients were challenged 24 h later with OVA, as described above, and 4 days later, HNLNs, MLNs, and spleens were eval- responses, even in the presence of coadministered CT, and these uated by FACS for proliferation of total and Vybrantϩ CD4ϩ T cells. results show the feasibility of using p␴1 as a mucosal vaccine delivery platform for induction of mucosal tolerance, rather than In vitro T cell assays immunity. Cell-sorted CD4ϩ T cells isolated from CLNs, HNLNs, MLNs, and spleens were cultured, as described elsewhere (27). Cells were pulsed with Tolerance can be adoptively transferred with OVA-specific [3H]TdR (0.5 ␮Ci/well), and [3H]TdR incorporation by proliferating CD4ϩ CD4ϩ T cells T cells (triplicate cultures) was measured and expressed as a stimulation Using CD4ϩ T cells isolated from OVA-Tg DO11.10 TCR mice, index (SI) (27). To assess cytokine production by Treg cells and effector T cells, CD25ϩCD4ϩ and CD25ϪCD4ϩ T cells (2 ϫ 105) were stimulated in we hypothesized that OVA-p␴1 would induce tolerance in an vitro with anti-CD3 mAb-coated wells (10 ␮g/ml; BD Pharmingen) and a OVA-specific fashion. Splenic CD4ϩ T cells isolated from ␮ soluble anti-CD28 mAb (5 g/ml; BD Pharmingen) for 5 days (final vol- DO11.10-Tg mice were adoptively transferred into naive BALB/c Downloaded from ume of 300 ␮l in a 48-well plate). Capture ELISA was used to quantify triplicate sets of samples to measure cytokine production (27). mice. Twenty-four hours after adoptive transfer, the recipient mice Cytokine secretion by DO11.10 T cells cultured for 24 or 72 h with or were dosed nasally with 400 ␮g of OVA to induce tolerance (28) without OVA, OVA-p␴1, OVA plus p␴1, or p␴1 stimulation was assessed or with only 80 ␮g of OVA-p␴1. Control mice received an i.m. by cytokine ELISA. Cytokine ELISA was conducted, as previously de- injection of 400 ␮g of OVA as a positive immunized control group scribed (27), to determine the levels of IFN-␥, IL-4, IL-10, and IL-17 in (28) or nasal sPBS (negative control group). Because Treg cells are each sample. ϩ

highly enriched in CLNs (28), CD4 T cells were isolated from http://www.jimmunol.org/ Apoptosis assay recipient CLNs and were adoptively transferred 3 days after im- Lymphocytes isolated from spleens of naive DO11.10 mice were cultured munization into a second group of naive recipient BALB/c mice,

with or without stimulation for 24 or 72 h in 37°C with 5% CO2. Cells were which, 24 h later, were challenged s.c. with OVA. Five days post- stimulated with one of the following per 1 ml of culture: 1 mg of OVA, peripheral challenge, the second recipient mice were evaluated for ␴ ␴ ␴ ␮ ␴ OVA-p 1, p 1,1mgofOVAplus1mgofp 1, 50 g of OVA-p 1, 50 tolerance induction by an in vitro OVA-specific proliferation assay ␮gofp␴1, or 1 mg of OVA plus 50 ␮gofp␴1. Percentage of apoptosis of ϩ CD4ϩ T cells was determined by FACS based on the costaining of CD4ϩ (Fig. 2A). Contrary to the i.m.-immunized group, CD4 T cells T cells with Cy-7-aminoactinomycin D (BD Pharmingen), and PE-annexin originating from mice dosed nasally with OVA-p␴1 or with a high V (BD Pharmingen) according to the manufacturer’s instructions. dose of OVA failed to proliferate following in vitro stimulation

ϩ by guest on September 29, 2021 Statistical analysis with OVA (Fig. 2A). The CD4 T cells originated from the i.m. OVA-dosed mice showed a ϳ5-fold increase in OVA-specific pro- Ͻ One-way ANOVA ( p 0.05) followed by a post-hoc Tukey test was liferation. Thus, these data show that OVA-p␴1 can stimulate applied to evaluate statistical differences between groups in Figs. 1F,4,and ϩ 7A. The remaining groups were analyzed by a Student t test to evaluate OVA-specific tolerance via CD4 T cells. statistical differences between groups or treatments in performed experi- ␴ ϩ ments, and p values Ͻ0.05 are indicated. Dosing with OVA-p 1 induces FoxP3 Treg cells

To define the possible Treg cells induced by tolerization with Results OVA-p␴1, FACS analysis was performed. Mice given nasal OVA- ␴ Nasal immunization with OVA-p 1 induces B and T cell p␴1 revealed a significant induction of FoxP3ϩCD25ϩCD4ϩ T unresponsiveness to OVA cells (Fig. 2E), even following a peripheral OVA challenge (Ta- Our past studies (14, 23) have shown that chemically modified p␴1 bles I and II). A more than 40% increase in FoxP3ϩ CD25ϩCD4ϩ can be successfully used for mucosal delivery of DNA vaccines. T cells in HNLNs (Fig. 2E) and in MLNs (data not shown) was To further exploit p␴1 as a mucosal vaccine delivery platform, observed in mice given nasal OVA-p␴1, when compared with na- OVA cDNA was genetically fused 5Ј to the p␴1 gene so as not to ive mice (Fig. 2, D and E, upper histograms). In a similar fashion, disrupt the binding capacity of p␴1. The resulting fusion protein OVA-p␴1-dosed mice, but not naive mice, showed a Ͼ60% in- was termed OVA-p␴1 (Fig. 1A). This modified OVA retained its crease in FoxP3ϩCD25ϪCD4ϩ T cells (Fig. 2, D and E, lower

Ag integrity when detected using an anti-OVA mAb (Fig. 1B), and histograms). The effector function of Treg cells is often associated the p␴1 portion retained its binding activity to L cells (Fig. 1C). To with secretion of regulatory cytokines, such as IL-10 and/or TGF- ␴ ␤ test its immunogenicity, OVA-p 1 was applied nasally with or 1. Subsequent FACS analysis confirmed that increased Treg cells without the potent mucosal adjuvant CT (Fig. 1, D–F). BALB/c in OVA-p␴1-dosed mice expressed significantly more IL-10, but mice dosed with OVA-p␴1 or OVA-p␴1 plus CT were unrespon- not TGF-␤1, when compared with PBS-dosed mice (Table I). sive, as evident by the depressed or lack of OVA-specific IgG and These results further suggest that tolerance induced by OVA-p␴1

IgA Abs, when compared with mice given OVA alone or OVA is supported by Treg cells, which may act in an IL-10-dependent plus CT (Fig. 1, D and E). Even immunization with OVA alone, manner.

which is a poor mucosal immunogen, elicited greater Ag-specific Ϫ ϩ ␴ OVA-specific Treg, as well as CD25 CD4 T cells, suppress in IgG Ab titers than did OVA-p 1-dosed mice (Fig. 1E). To test ϩ unresponsiveness to OVA challenge, mice dosed with OVA, OVA vivo proliferation of Ag-specific effector CD4 T cells plus CT, or OVA-p␴1 and CT as mucosal adjuvant were periph- The combined evidence from the adoptive transfer study and from erally challenged with OVA. Results showed significantly lower the phenotypic analysis suggests that OVA-p␴1 induces Ag-spe- ␴ ␴ OVA-specific DTH responses by OVA and OVA-p 1 plus CT- cific Treg cells. To investigate the ability of OVA-p 1-induced Treg dosed mice when compared with mice given OVA plus CT as cells to inhibit proliferation of OVA-specific effector CD4ϩ T cells ␴ ϩ 5190 p 1 STIMULATES IL-10 Treg CELLS

A His-6 ovalbumin shaft head Myc B Anti - OVA Anti - pσ1

OVApσ1 OVApσ1 OVApσ1 OVApσ1

100 kDa 94 kDa FIGURE 1. Nasal administration of OVA-p␴1 sup- presses OVA-specific immune responses. A, Schematic 50 kDa 51 kDa representation of OVA-p␴1 protein: tolerogen, OVA, and p␴1 (shaft and head), 6-histidine tag, and Myc-Ag 37 kDa 43 kDa tag (components are not drawn to scale). B, Western immunoblot of OVA-p␴1, p␴1, and OVA probed with mouse IgG anti-OVA mAb (left panel) or rabbit anti- C p␴1 polyclonal Ab (right panel). C, Recombinant p␴1 Downloaded from binds to L cells. L cells were incubated with 2 ␮g(left σ -pσ1 -p 1 panel)or25␮g(right panel)ofhis/myc-tagged p␴1, μ σ +2 μg pσ1 +25 gp 1 followed by an addition of a biotinylated anti-p␴1 mAb and streptavidin-PE to detect p␴1 by FACS; thus, the his/myc tag on p␴1’s C terminus does not interfere with L cell binding. D–F, BALB/c mice were nasally dosed

with OVA or OVA-p␴1, with or without CT. D and E, http://www.jimmunol.org/ Serum, vaginal, and fecal samples collected on day 28 p.i. were analyzed for IgA and IgG OVA-specific titers by ELISA. Mean of 10 mice Ϯ SEM is depicted. -p Ͻ 0.05 for OVA-p␴1- vs OVA ,ءء ;p Ͻ 0.001 ,ء dosed, and OVA-p␴1 ϩ CT- vs OVA ϩ CT-dosed mice, calculated by Student’s t test. F, DTH reactions to OVA were measured at day 35 p.i. Mean Ϯ SEM of six mice per group. Statistical significance between groups was calculated by one-way ANOVA followed by post- by guest on September 29, 2021 p Ͻ 0.05 vs OVA ϩ CT; OVA vs ,ء .hoc Tukey test OVA-p␴1 were not significantly different. G, Anti-p␴1 Ab ELISA was performed on serum samples collected from BALB/c mice dosed nasally with OVA-p␴1or p␴1-poly-L-lysine-DNA. Mice dosed with p␴1-PL- DNA, but not OVA-p␴1, showed the p␴1-specific IgG -p Ͻ 0.001 for OVA-p␴1vsp␴1-poly-L ,ء .response lysine-DNA was calculated by Student’s t test.

in vivo, naive BALB/c mice were adoptively transferred with these cells underwent cell division (Fig. 2B). In contrast, adop- CD4ϩ, CD25ϩCD4ϩ, or CD25ϪCD4ϩ T cells isolated from mice tively transferred CD4ϩ T cells from OVA-immunized mice, al- given nasal OVA-p␴1 or with CD4ϩ T cells from mice given only lowed expansion of the Tg CD4ϩ T cells, as evidenced by Ͼ55% nasal OVA. All recipient mice simultaneously received Vybrant- of them undergoing proliferation (Fig. 2B). Significant suppression labeled OVA-specific CD4ϩ T cells isolated from Tg DO11.10 of the Tg CD4ϩ T cell proliferation was also obtained using mice. Recipient mice were s.c. challenged with OVA in IFA 24 h CD25ϪCD4ϩ and total CD4ϩ T cells from OVA-p␴1-dosed mice after adoptive transfer, and 4 days later, Tg CD4ϩ T cells were ( p Ͻ 0.001), but to a lesser extent (20% proliferation). This study ␴ evaluated by flow cytometry for in vivo proliferation (Fig. 2B). shows that OVA-p 1-derived Treg cells significantly inhibited the Proliferation of the Tg CD4ϩ T cells was significantly reduced in proliferation of Tg CD4ϩ T cells greater than OVA-p␴1-derived ␴ Ϫ ϭ ␴ ϩ ϭ mice receiving OVA-p 1-specific Treg cells, because only 15% of CD25 ( p 0.009) or OVA-p 1-derived total CD4 T cells ( p The Journal of Immunology 5191

AB

FIGURE 2. OVA-p␴1-induced unresponsiveness is mediated by CD4ϩ T cells. A, CD4ϩ T cells isolated from CLNs and spleens of mice adoptively transferred with CLN-derived CD4ϩ T cells from OVA-p␴1- or OVA-dosed mice were cultured in vitro without or with 1 mg/ml of OVA for 5 days. [3H]TdR incorporation was measured and expressed as a stimulation index (SI). For p ϭ ,ءء :CLN: §, p Յ 0.001 vs i.m. OVA; for spleen p ϭ 0.006 vs i.m. OVA, calculated by Stu- C ,ءءء ,0.003 dent’s t test. B and C, BALB/c mice were adoptively transferred with Vybrant-labeled DO11.10-Tg CD4ϩ T (responder) cells and with the designated T cell popu- lation (donor CD4ϩ T cells) isolated from OVA-p␴1- or OVA-dosed mice. B, In vivo suppression of prolifera- tion of DO11.10-Tg CD4ϩ T cells following challenge p Յ 0.001 vs Downloaded from ,ء .with OVA was measured by FACS mice given CD4ϩ T cells from OVA-dosed mice, cal- culated by Student’s t test. C, Lymphocytes pooled from HNLNs, MLNs, and spleens from recipient mice were stained with anti-CD4, anti-CD25, and anti-FoxP3 mAbs and analyzed by FACS. The mean percentage (ϮSD) of FoxP3ϩCD25ϪCD4ϩ T cells and FoxP3ϩCD25ϩCD4ϩ T cells as a (left panel) propor- http://www.jimmunol.org/ ϩ D E tion of total CD4 T cells, or (right panel) DO11.10 87.4 ± 0.9 98.2 ± 1.6 p Յ 0.001 vs CD25ϩCD4ϩ ,ء .CD4ϩ T cells is depicted T cells from mice given CD4ϩ T cells from OVA-dosed p Յ 0.05 vs CD25ϪCD4ϩ T FoxP3 FoxP3 ,ءء ,mice; §, p Յ 0.001 cells from mice given CD4ϩ T cells from OVA-dosed 4 mice, calculated by Student’s t test. D and E, FACS Naïve 4 OVA-pσ1 10 analysis was performed on lymphocytes isolated from 10 3 9.07 ± 0.4 3 14.1 ± 1.2 C57BL/6 mice (D) naive or (E) nasally dosed with 10 ␴ 10

OVA-p 1 three times at weekly intervals. Depicted are by guest on September 29, 2021 2 2 10 percentages of unstimulated Treg cells isolated from 10 ϩ 1 HNLNs. Percentage of FoxP3 Treg cells (upper filled 1 10 histogram) and FoxP3ϩCD25ϪCD4ϩ T cells (lower 10 0 ϩ 0

filled histograms) as a proportion of CD4 T cells are 10 10 plotted vs isotype control for FoxP3 (empty histogram). 100 101 102 103 104 100 101 102 103 104 CD25 Results are presented as an average Ϯ SD of five ani- mals per tissue. CD4 4.71 ± 0.87 17.8 ± 1.35

FoxP3 FoxP3

0.001). Collectively, these results suggest that OVA-p␴1-induced tol- erance is mediated by CD25ϩCD4ϩ T cells and, interestingly, may also be contributed to in part by CD25ϪCD4ϩ T cells, which inhibited the proliferation of OVA-specific effector T cells. Table I. Nasal immunization with OVA-p␴1 induces IL-10-secreting ϩ ϩ In an effort to define the mechanism by which OVA-p␴1-de- CD25 CD4 Treg cells rived CD4ϩ T cells inhibit proliferation of these Tg DO11.10 ϩ ϩ Immunization Groupa OVA-p␴1b sPBSb CD4 T cells, we analyzed the phenotypes of the CD4 T cells isolated from the OVA-challenged recipients. Mice receiving ϩ ϩ Ϯ c Ϯ Ϫ ϩ % CD25 CD4 Treg 15.4 4.5 9.7 3.1 OVA-p␴1-derived CD25 CD4 T cells showed significant in- ϩ Ϯ d Ϯ % IL-10 Treg 63.2 6.4 45.1 6.6 ϩ Ϫ ϩ ␤ϩ Ϯ Ϯ creases in FoxP3 CD25 CD4 T cells (ϳ40%) and elevated % of TGF- Treg 49.4 3463.2 numbers of FoxP3ϩ T cells (ϳ20%; Fig. 2C, left panel). In a ␮ ␴ reg C57BL/6 mice were given 100 g of OVA-p 1 or PBS nasally on days 0, 1, and contrast, mice adoptively transferred with OVA-p␴1-derived 2, and were challenged s.c. on day 10 p.i. with OVA in IFA. ϩ ϩ ϩ b FACS analysis was performed on lymphocytes isolated from HNLNs and in CD25 CD4 T cells showed even greater increases in FoxP3 vitro stimulated for 72 h with 1 mg of OVA. Mean Ϯ SEM of five mice per group is ϳ ϩ Ϫ ϩ Treg cells ( 30%), but FoxP3 CD25 CD4 T cells in these mice presented. Mice nasally dosed with OVA-p␴1 showed significant increases in OVA- ϩ ϩ specific Treg cells that were IL-10 . were not elevated and, in fact, were equivalent with control CD4 c Statistical significance was calculated by Student’s t test. Differences between T cells from OVA-immunized or PBS-dosed mice (Fig. 2C, left OVA-p␴1- vs PBS-dosed mice; p ϭ 0.031. d Statistical significance was calculated by Student’s t test. Differences between panel). To determine whether adoptively transferred OVA- or ␴ ϭ ␴ ϩ ϩ OVA-p 1- vs PBS-dosed mice; p 0.008. OVA-p 1-derived CD4 T cells induce CD4 Treg cells among ␴ ϩ 5192 p 1 STIMULATES IL-10 Treg CELLS

Table II. Nasal immunization with OVA-p␴1 induces FoxP3ϩCD25ϩ and FoxP3ϩCD25ϪCD4ϩ T cells

Immunization Groupa OVA-p␴1b OVA Oralb OVA Nasalb sPBSb

% FoxP3ϩCD25ϩCD4ϩ T cells CLN 19.15 Ϯ 1.13c,d 11.6 Ϯ 1.07 6.92 Ϯ 0.8 5.92 Ϯ 1.44 HNLN 18.04 Ϯ 1.5c,d 11.98 Ϯ 1.71 7.29 Ϯ 1.4 7.5 Ϯ 1.03 MLN 17.46 Ϯ 2.8d 17.45 Ϯ 0.5 8.07 Ϯ 1.01 7.3 Ϯ 1.4 PP 18.35 Ϯ 1.48c,d 14.45 Ϯ 1.4 6.91 Ϯ 0.9 6.7 Ϯ 1.84 Spleen 15.95 Ϯ 2.69c,d 9.49 Ϯ 2.57 5.56 Ϯ 1.16 7.33 Ϯ 2.08 % FoxP3ϩCD25ϪCD4ϩ T cells CLN 22 Ϯ 1.42c,d 16.7 Ϯ 2.4 14 Ϯ 2.55 14.5 Ϯ 3.39 HNLN 21.88 Ϯ 2.71c,d 15.6 Ϯ 1.5 14.13 Ϯ 1.05 10.5 Ϯ 1.14 MLN 19.83 Ϯ 2.4c,d 10.02 Ϯ 1.7 13 Ϯ 0.95 12.9 Ϯ 1 PP 19.93 Ϯ 2.16c,d 12.03 Ϯ 3.36 12.05 Ϯ 1.64 12.25 Ϯ 2.19 Spleen 21.73 Ϯ 2.81c,d 10.5 Ϯ 1.42 10.2 Ϯ 3.01 9.62 Ϯ 3.51

a C57BL/6 mice were nasally dosed with 100 ␮g of OVA-p␴1, OVA, or PBS, or orally with 25 mg of OVA and challenged, as described in Table I. b FACS analysis was performed on lymphocytes isolated from CLNs, HNLNs, MLNs, PPs, and spleens and in vitro stim- ulated for 72 h with 1 mg of OVA. Mean Ϯ SD of five mice per group is presented. Mice nasally dosed with OVA-p␴1 showed significant increases in OVA-specific FoxP3ϩCD25ϩCD4ϩ T cells and FoxP3ϩCD25ϪCD4ϩ T cells. c Statistical significance was calculated by Student’s t test; p Ͻ 0.04, differences between OVA-p␴1- vs OVA oral-dosed mice. Downloaded from d Statistical significance was calculated by Student’s t test; p Ͻ 0.005, differences between OVA-p␴1- vs intranasally OVA- and PBS-dosed mice.

the responder DO11.10 CD4ϩ T cell subset, the percentages of cells. Interestingly, more than a 3-fold increase in Tg FoxP3ϩ DO11.10 FoxP3ϩCD25ϪCD4ϩ and FoxP3ϩCD25ϩCD4ϩ T CD25ϪCD4ϩ T cells was observed in mice cotransferred with cells in mice given OVA- or OVA-p␴1-derived CD4ϩ T cells OVA-p␴1-derived CD25ϪCD4ϩ T cells. By examining the ex- http://www.jimmunol.org/ were evaluated. FACS analysis revealed that before the adop- pansion of Tg FoxP3ϩCD25ϪCD4ϩ T cells in mice given tive transfer, the Tg DO11.10 CD4ϩ T cell population con- OVA-p␴1-derived CD25ϩCD4ϩ T cells, it was found that these ϳ ϳ ϩ Ϫ ϩ ϩ Ϫ ϩ tained 5% Treg cells and 10% FoxP3 CD25 CD4 T cells FoxP3 CD25 CD4 T cells expanded to a lesser extent. No (Fig. 2C, right panel). These FoxP3ϩCD25ϩCD4ϩ T cells ex- increases in FoxP3ϩCD25ϪCD4ϩ T cells were observed in panded in mice given OVA-p␴1-derived (both CD25ϩ and mice given OVA- or PBS-dosed recipients given Tg CD4ϩ T CD25Ϫ) CD4ϩ T cells, although the greatest increase, by nearly cells (Fig. 2C, right panel). This evidence suggests that OVA- 5-fold, was in mice given OVA-p␴1-derived CD25ϩCD4ϩ T p␴1-induced FoxP3ϩCD25ϪCD4ϩ T cells do contribute to ␴

cells (Fig. 2C, right panel). In contrast, expansion of DO11.10 OVA-p 1-mediated inhibition of effector T cell proliferation, by guest on September 29, 2021 FoxP3ϩCD25ϩCD4ϩ T cells was not observed in mice dosed possibly via expansion of either CD4ϩ T cell subset or via with PBS or adoptively transferred with OVA-derived CD4ϩ T conversion of FoxP3ϩ T cells (29).

FIGURE 3. OVA-p␴1-induced tolerance is dependent upon increased production of anti-inflammatory/regulatory cytokines and depression of proin- flammatory cytokines. CD4ϩ T cells were isolated from (A) HNLNs and (B) spleens of recipient mice given the various CD4ϩ T cell subsets plus responding Tg CD4ϩ T cells in Fig. 2, B and C. To evaluate differences in cytokine production by the responder (DO11.10) CD4ϩ T cells influenced to become tolerogenic or immunogenic, CD4ϩ T cells were isolated from recipient mice and subjected to T cell ELISPOT assay after in vitro restimulation with 6 ϩ OVA323–339 peptide. Results are depicted as cytokine-forming cells (CFC) per 10 CD4 T cells corrected for unstimulated responses. Adoptive transfer of OVA-p␴1-specific CD25ϩCD4ϩ T cells or CD25ϪCD4ϩ T cells significantly enhanced numbers of IL-10- and IL-4-producing CD4ϩ T cells, respec- tively, in recipient mice with concomitant reductions in IFN-␥ and IL-17 CFC responses. Adoptive transfer of OVA-stimulated CD4ϩ T cells showed ,p Յ 0.05 vs mice given CD4ϩ T cells from OVA-dosed mice ,ءء ;p Ͻ 0.001 ,ء .enhanced IFN-␥ and IL-17 CFCs with little to no IL-4 or IL-10 CFCs calculated by Student’s t test. The Journal of Immunology 5193

FIGURE 4. OVA-p␴1-induced tolerance is mediated by IL-10-produc- ing CD25ϩCD4ϩ T cells and supported by IL-4-producing CD25ϪCD4ϩ T 7 cells. BALB/c mice were adoptively transferred with 1 ϫ 10 DO11.10-Tg Downloaded from CD4ϩ T cells and 24 h later were nasally dosed with 50 ␮g of OVA-p␴1 or OVA only. Mice were challenged s.c. on day 3 after transfer and sac- rificed 4 days later. CD25ϩCD4ϩ T cells and CD25ϪCD4ϩ T cells were isolated from HNLNs, MLNs, and spleens of these mice and cultured in vitro. Presence of (A and B) proinflammatory and (C–E) regulatory cyto- kines in cultured supernatants was measured by ELISA. CD25ϩCD4ϩ T

cells from OVA-p␴1-dosed mice produced significantly more (D) IL-10, http://www.jimmunol.org/ whereas the majority of (C) IL-4 was secreted by CD25ϪCD4ϩ T cells. Mean Ϯ SEM of five mice per group is shown. Statistical significance for FIGURE 5. IL-10 is required for induction and maintenance of OVA- Ϫ Ϫ ϩ ϩ cytokine-producing CD25Ϫ or CD25ϩ CD4ϩ T cells was calculated by p␴1-mediated tolerance. IL-10 / and C57BL/6 (IL-10 / ) (B6) mice one-way ANOVA followed by a post-hoc Tukey test. §, p Ͻ 0.05 for were given 100 ␮g of OVA-p␴1 or PBS nasally on days 0, 1, and 2 and p Ͻ 0.05 for OVA-p␴1- vs OVA-dosed were then challenged s.c. on day 10 p.i. with OVA in IFA. A, OVA-specific ,ء ;OVA-p␴1- vs PBS-dosed mice mice. ELISA was performed on serum samples collected from OVA-p␴1- and PBS-dosed C57BL/6 and IL-10Ϫ/Ϫ mice on day 17 p.i. OVA-p␴1-dosed IL-10Ϫ/Ϫ mice elicited a serum IgG anti-OVA response. B, OVA-specific DTH responses measured on day 15 p.i. OVA-p␴1-dosed IL-10Ϫ/Ϫ mice OVA-p␴1-induced tolerance is mediated by increased regulatory by guest on September 29, 2021 were responsive to OVA. C, CD4ϩ T cells isolated from HNLNs, MLNs, cytokine production ϩ ϩ and spleens of OVA-p␴1- or PBS-dosed C57BL/6 (IL-10 / ) and IL- To investigate the specific mechanisms of the observed tolerance, 10Ϫ/Ϫ mice were measured for their proliferative responses after in vitro ϩ Ϫ Ϫ cytokine secretion by CD4ϩ T cells was measured. Total CD4ϩ T stimulation with OVA. CD4 T cells from IL-10 / mice dosed with cells were isolated from recipient HNLNs and spleens given Tg OVA-p␴1 or PBS, and PBS-dosed C57BL/6 mice proliferated in response ϩ ϩ to OVA. Depicted values are corrected for [3H]TdR uptake by unstimu- CD4 T cells and various CD4 T cell subsets, as described in the ϩ ϩ ϩ adoptive transfer studies in Fig. 2, B and C. After in vitro restimu- lated cells. D, Percentages of FoxP3 CD25 CD4 T cells were measured by FACS after in vitro stimulation with OVA, and depicted are values lation with OVA323–339 peptide, the cytokine profiles of the re- Ϫ/Ϫ ϩ corrected for unstimulated cells. IL-10 mice failed to show induction of sponding OVA-specific CD4 T cells were analyzed. Unlike con- T cells independent of treatment. The mean of two experiments Ϯ SEM ␴ ϩ Ϫ reg -p Ͻ 0.05 for OVA-p␴1- vs PBS ,ءء ,p Ͻ 0.001 ,ء .trols, mice receiving OVA-p 1-derived (CD25 , CD25 , and per group is shown ϩ ϩ total CD4 ) T cells failed to induce IL-17-secreting CD4 T cells dosed C57BL/6 or IL-10Ϫ/Ϫ mice; NS, calculated by Student’s t test. E, ϩ and showed no or reduced IFN-␥-secreting CD4 T cells in all Depicted is the percentage of CD25ϩCD4ϩ T cells for the combined tested lymphoid tissues (Fig. 3). Instead, these mice showed MLNs, PPs, and spleens from five naive IL-10Ϫ/Ϫ mice. Results deter- ϩ ϩ greater anti-inflammatory responses, as evidenced by significant mined by FACS show the mean Ϯ SD. F, Percentages of FoxP3 IL-10 ϩ ϩ ϩ increases in the numbers of IL-10- and IL-4-producing CD4 T Treg cells, as a proportion of CD25 CD4 T cells, were measured by ␴ FACS. Treg cells induced in C57BL/6 mice given nasally OVA-p 1ex- cells. Adoptive transfer of Treg cells resulted in a 15-fold enhance- ment in IL-10-producing CD4ϩ T cells, whereas recipient mice pressed IL-10, whereas significantly less IL-10 was expressed by PBS- p Ͻ 0.001 ,ء .Ϫ ϩ dosed C57BL/6 mice. Average Ϯ SEM of four mice is shown given CD25 CD4 T cells from OVA-p␴1-dosed mice showed a for OVA-p␴1- vs PBS-dosed C57BL/6 mice, calculated by Student’s t test. 10-fold enhancement in IL-4-producing CD4ϩ T cells when com- pared with recipient mice given CD4ϩ T cells from OVA-vacci- nated or PBS-dosed mice (Fig. 3). mAbs. Analysis of cytokines produced by cultured cells revealed To evaluate the specific cytokine profiles for CD25ϩ and that the majority of IL-10 from OVA-p␴1-dosed mice was derived Ϫ ␴ CD25 T cell subsets from OVA-p 1-dosed mice, BALB/c mice from Treg cells (Fig. 4D), whereas almost all of the IL-4 was pro- adoptively transferred with DO11.10 Tg CD4ϩ T cells were given duced by CD25ϪCD4ϩ T cells (Fig. 4C). These data further con- a single nasal dose of OVA-p␴1, OVA, or PBS. Recipient mice firm that OVA-p␴1-induced tolerance depends largely upon IL-

were then challenged with OVA/IFA on day 3 postimmunization 10-producing Treg cells and is further supported by Th2 cells. (p.i.) and sacrificed on day 7 p.i. Induction of tolerance was con- Although TGF-␤1 was secreted by both CD25ϩ and CD25ϪCD4ϩ firmed in OVA-p␴1-dosed mice by the absence of an OVA-spe- T cells, this cytokine was not strikingly elevated in OVA-p␴1- cific DTH response (data not shown). CD25ϩCD4ϩ and dosed mice when compared with OVA- and PBS-dosed mice (Fig. CD25ϪCD4ϩ T cells from pooled HNLNs, MLNs, and spleens 4E), further implying that TGF-␤1 may have a lesser role for were stimulated with plate-bound anti-CD3 and soluble anti-CD28 OVA-p␴1-induced tolerance. Contrary to control mice, production ␴ ϩ 5194 p 1 STIMULATES IL-10 Treg CELLS Downloaded from http://www.jimmunol.org/

Ϫ Ϫ ϩ FIGURE 6. Immunization of IL-10 / mice with OVA-p␴1 increases IL-17- and IFN-␥-producing CD4 T cells with concomitant increases in by guest on September 29, 2021 anti-inflammatory cytokine (IL-4 and IL-13) responses when compared with similarly treated C57BL/6 mice. C57BL/6 (IL-10ϩ/ϩ) (B6) and IL-10Ϫ/Ϫ mice were immunized and challenged, as described in Fig. 5 legend. CD4ϩ T cells isolated from HNLNs, MLNs, and spleens were restimulated with OVA, and cytokine-specific T cell ELISPOT was performed. CFC/106 CD4ϩ T cells in C57BL/6 (A and C) and IL-10Ϫ/Ϫ (B and D) mice are depicted. For OVA-p␴1-dosed C57BL/6 mice, CD4ϩ T cells producing anti-inflammatory cytokines in MLNs and HNLNs were significantly elevated when compared with (C) PBS-dosed mice. The numbers of CD4ϩ T cells producing (A) proinflammatory cytokines were significantly reduced in OVA-p␴1-dosed mice vs PBS-dosed C57BL/6 mice. OVA-p␴1-dosed IL-10Ϫ/Ϫ mice showed significant increases when compared with PBS-dosed mice in (B and D) IL-4-, IL-13-, and IL-17-producing CD4ϩ T cells, but not TGF-␤1-producing CD4ϩ T cells. IFN-␥- and IL-17-producing CD4ϩ T cells were significantly elevated ,ء .in IL-10Ϫ/Ϫ mice given OVA-p␴1 when compared with OVA-p␴1-dosed C57BL/6 mice (A and B). Depicted is the mean of two experiments Ϯ SEM .p Ͻ 0.05 for OVA-p␴1- vs PBS-dosed C57BL/6 or IL-10Ϫ/Ϫ mice, calculated by Student’s t test ,ءء ,p Ͻ 0.001 of proinflammatory cytokines, IFN-␥ (Fig. 4A), and IL-17 (Fig. cells obtained from tolerized C57BL/6 mice. As evidenced in Ϫ ϩ ␴ 4B) was significantly diminished by both Treg and CD25 CD4 T OVA-p 1-dosed C57BL/6 mice, these had at least 3-fold less cell subsets. CD4ϩ T cell proliferative responses to OVA in HNLNs and spleens than their PBS-dosed littermates (Fig. 5C). Interestingly, IL-10 is necessary for induction of OVA-p␴1-mediated tolerance ϩ FACS analysis of FoxP3 Treg cells revealed no differences in Treg Ϫ Ϫ Results thus far have shown that mucosal administration of OVA- cell numbers between PBS- and OVA-p␴1-dosed IL-10 / mice p␴1 induces secretion of regulatory cytokines, IL-4, IL-10, and (Fig. 5D), and, in fact, they resembled baseline levels of ϩ ϩ TGF-␤1, although the most pronounced increase was observed in CD25 CD4 T cells in these mice (Fig. 5E). In contrast, the the production of IL-10. Because past studies have shown that HNLNs and spleens of OVA-p␴1-dosed C57BL/6 mice contained

IL-10 is not responsible for tolerance induction (30–32), we que- significantly more OVA-specific Treg cells than the HNLNs and ried whether tolerance could be induced in IL-10Ϫ/Ϫ mice given spleens of both PBS-dosed C57BL/6 mice and OVA-p␴1-dosed ␴ ␴ Ϫ/Ϫ nasal OVA-p 1. C57BL/6 mice given nasal OVA-p 1 were un- IL-10 mice, the latter result suggesting that Treg cells in responsive to OVA, as evidenced by the low plasma IgG and mu- IL-10Ϫ/Ϫ mice were simply not induced (Fig. 5D). Addition- ϩ cosal IgA anti-OVA Ab titers and a lack of DTH responses, when ally, almost 50% of the FoxP3 Treg cells in HNLNs and compared with PBS-primed mice (Fig. 5, A and B). In contrast, spleens of OVA-p␴1-dosed C57BL/6 mice showed intracellular OVA-p␴1-dosed IL-10Ϫ/Ϫ mice became immune to OVA after expression of IL-10 (Fig. 5F), confirming the supportive role of peripheral challenge, as did PBS-primed IL-10Ϫ/Ϫ mice (Fig. 5, A IL-10 in OVA-p␴1-induced tolerance. Upon OVA restimula- and B). CD4ϩ T cells isolated from HNLNs, MLNs, and spleens of tion, analysis of cytokine-secreting CD4ϩ T cells from IL-10Ϫ/Ϫ mice dosed with OVA-p␴1 showed significant increases C57BL/6 (Fig. 6, A and C) and IL-10Ϫ/Ϫ mice (Fig. 6, B and D) in OVA-specific T cell proliferation when compared with the same was performed. As expected, OVA-p␴1-dosed C57BL/6 mice The Journal of Immunology 5195

FIGURE 8. Parenteral immunization with OVA-p␴1 induces an anti- OVA Ab response following OVA challenge. C57BL/6 mice were i.m. immunized with (A) PBS, 50 ␮g of OVA, or OVA-p␴1, or (B) with 50 ␮g of OVA or OVA-p␴1 ϩ 1 ␮g of CT, on days 0, 7, and 14. On day 21, sera Downloaded from were collected and analyzed for the presence of anti-OVA IgG Abs by Ⅺ ␴ FIGURE 7. A single nasal dose of OVA-p␴1 is sufficient to induce ELISA ( ), and showed unresponsiveness by PBS-, OVA-p 1-, and ␴ ϩ tolerance to OVA. A and B, C57BL/6 mice were given OVA-p␴1, OVA, OVA-p 1 CT-dosed mice. On day 28, mice were s.c. challenged with or sPBS and were subsequently challenged s.c. with OVA/IFA. A, Data OVA in IFA. Sera collected from mice 1 wk postchallenge (day 35) re- f depict serum IgG anti-OVA Ab titers at 18 days postchallenge (28 days vealed the presence of IgG anti-OVA Abs ( ) in all tested groups, although the anti-OVA response was higher in mice dosed with OVA ϩ CT com- p.i.). Statistical significance was calculated by one-way ANOVA fol- http://www.jimmunol.org/ Ͻ ء ␴ ϩ -p Ͻ 0.05 vs mice nasally given 50 ␮g pared with OVA-p 1 CT-dosed mice. , p 0.001 for OVA vs OVA ,ء .lowed by post-hoc Tukey test ␴ ϩ ␴ ϩ of OVA-p␴1; §, p Ͻ 0.05 vs mice given nasally 50 ␮g of OVA. B, p 1 and OVA CT vs OVA-p 1 CT-dosed mice, calculated by Stu- OVA-specific DTH responses were measured at day 15 p.i. (day 5 post- dent’s t test. challenge). A single 50-␮g dose of OVA-p␴1, but not OVA alone, was p Ͻ 0.001 for OVA-p␴1-dosed vs ,ء .sufficient for tolerance induction control mice, calculated by Student’s t test. Data are representative of three separate experiments. C and D, BALB/c mice were nasally given C57BL/6 mice were nasally given either 100 ␮g per dose of OVA, ␮ ␴ ␮ 100 g of OVA-p 1 or OVA, with or without 25 g of CpG. Ten days OVA-p␴1, or sPBS for 3 consecutive days, or a single 50-␮g dose p.i., mice were challenged s.c. with OVA/IFA. Data depict (C) plasma of OVA-p␴1 or OVA alone. Additionally, a group of C57BL/6 by guest on September 29, 2021 IgG and fecal IgA anti-OVA Ab titers 18 days postchallenge (28 days p.i.), and (D) OVA-specific DTH responses at day 15 p.i. (day 5 post- mice was given 0.5 mg of OVA nasally for 5 consecutive days. .p Ͻ 0.001 for OVA-p␴1 vs OVA- Ten days p.i., all mice were challenged with OVA by the s.c. route ,ء :challenge). Statistical significance dosed mice, or for OVA-p␴1 ϩ CpG vs OVA ϩ CpG-dosed mice, One day before challenge, no OVA-specific serum IgG Ab re- calculated by Student’s t test. sponses in either immunization group were detected (data not shown). By day 18 postchallenge (day 28 p.i.), mice given OVA or PBS revealed significantly elevated OVA-specific Ab titers showed a significant increase in CD4ϩ T cells secreting regu- in both mucosal (data not shown) and systemic immune com- latory cytokines IL-10 and TGF-␤1 in HNLNs and MLNs, and partments, and these responses were sustained (Fig. 7A). More- IL-4-producing cells in all tested tissues when compared with over, we were unable to induce tolerance to OVA, even in mice PBS-dosed mice (Fig. 6C). Numbers of CD4ϩ T cells producing dosed nasally with as much as 2.5 mg of OVA alone. In con- IL-13 were not significantly different between immunized and trast, virtually no OVA-specific serum-IgG Abs (Fig. 7A) nor control mice (Fig. 6C). DTH responses (Fig. 7B) were observed in OVA-challenged Production of proinflammatory cytokines, IFN-␥, IL-2, and mice given a single or three nasal doses of OVA-p␴1. These IL-17 (Fig. 6A), was significantly inhibited in all tested tissues of data show that mice given OVA-p␴1 nasally are tolerized to OVA-p␴1-dosed C57BL/6 mice. IL-10Ϫ/Ϫ mice revealed that, al- OVA and that this tolerance can be induced by substantially though the IL-4 and IL-13 responses were significantly more ele- lower doses of p␴1-delivered Ag. vated in OVA-p␴1- than PBS-dosed mice (Fig. 6D), TGF-␤1-se- Although OVA-p␴1 can induce tolerance to OVA, even in the creting CD4ϩ T cells were significantly depressed, except in the presence of CT, chemically modified p␴1 is found to be immuno- spleen (Fig. 6D). No significant differences in numbers of IL-2- genic. Mucosal delivery of DNA complexed to poly-L-lysine-mod- producing CD4ϩ T cells were observed between OVA-p␴1- and ified p␴1 results in enhanced transgene-specific immune responses PBS-dosed IL-10Ϫ/Ϫ mice. Consistent with an antagonistic rela- (14). To determine whether there is an adjuvant effect by the plas- tionship between IFN-␥ and IL-17 (33), there was a significant mid cDNA that can overcome the OVA-p␴1-induced tolerance, decrease in IFN-␥ and a concomitant increase in the IL-17 in BALB/c mice were given a single nasal dose of OVA or OVA-p␴1 OVA-p␴1-dosed IL-10Ϫ/Ϫ mice when compared with PBS-dosed alone, or coadministered with CpG-ODN. In contrast to mice mice (Fig. 6B). dosed with OVA or OVA plus ODN, mice dosed with OVA-p␴1 alone or OVA-p␴1 plus ODN showed significantly reduced OVA- ␴ OVA-p 1-mediated tolerance can be induced after a single dose specific serum and mucosal Ab (Fig. 7C) and DTH responses (Fig. Because the p␴1-based approach offers the possibility of inducing 7D). Therefore, the tolerogenic effect of this p␴1-based delivery tolerance while using significantly less Ag, the persistence of system cannot be overridden by coadministration of the immune- OVA-p␴1-induced tolerance was investigated after a single dose. modulatory molecule CpG-ODN. ␴ ϩ 5196 p 1 STIMULATES IL-10 Treg CELLS

Table III. Apoptosis of Tg DO11.10 CD4ϩ T cells

Treatmenta % Apoptosis of DO11.10-Tg CD4ϩ T Cellsb

c d e f Ag Dose, in mg/ml 24 h p1 72 h p2 Media 7.06 Ϯ 0.6 10.37 Ϯ 0.92 OVA 1 10.96 Ϯ 2.82 12.73 Ϯ 6.53 OVA-p␴1 1 67.35 Ϯ 7.97 Ͻ0.001 83.80 Ϯ 7.10 Ͻ0.001 OVA-p␴1 0.05 30.99 Ϯ 3.98 Ͻ0.001 54.41 Ϯ 11.6 0.003 p␴1 1 77.82 Ϯ 4.82 Ͻ0.001 86.52 Ϯ 11.8 Ͻ0.001 p␴1 0.05 32.43 Ϯ 7.26 0.005 62.58 Ϯ 10.6 Ͻ0.001 OVA ϩ p␴1 1,1 77.56 Ϯ 8.42 Ͻ0.001 80.34 Ϯ 8.44 Ͻ0.001 OVA ϩ p␴1 1,0.05 29.83 Ϯ 9.86 0.025 62.29 Ϯ 10.13 Ͻ0.001

a Lymphocytes were isolated from spleens of naive DO11.10-Tg mice. Cells were stimulated in vitro with designated concentrations of Ags and analyzed by FACS. b Apoptosis was determined by costaining with annexin V and 7-aminoactinomycin D. c Mean Ϯ SD of three to four replicates are presented after 24 h of culture. d Values of p for DO11.10 CD4ϩ T cells stimulated with OVA vs OVA-p␴1, p␴1, or OVA ϩ p␴1 for 24 h. e Mean Ϯ SD of three to four replicates are presented after 72 h of culture. f Values of p for DO11.10 CD4ϩ T cells stimulated with OVA vs OVA-p␴1, p␴1, or OVA ϩ p␴1 for 72 h. Downloaded from Mucosal administration of OVA-p␴1 is necessary for induction induction of the optimal tolerance to OVA via the use of p␴1 of tolerance requires mucosal, not parenteral, administration of OVA-p␴1 We have shown here that mucosal administration of OVA-p␴1 (Fig. 8). induces a low-dose tolerance to OVA. In an effort to determine ␴ ϩ whether the p␴1-mediated tolerance can be induced via a nonmu- OVA-p 1 induces apoptosis of OVA-Tg CD4 T cells in vitro ␴ http://www.jimmunol.org/ cosal route, mice were i.m. immunized on days 0, 7, and 14 with Mucosal delivery of OVA-p 1 triggers the Treg cell response and OVA-p␴1 without or with CT and compared with mice similarly secretion of anti-inflammatory cytokines. In contrast, parenteral immunized with OVA (Fig. 8). On day 21 (1 wk after the last administration of OVA-p␴1 induces anti-OVA Ab response after immunization), mice were evaluated for serum IgG anti-OVA Ab s.c. challenge with OVA. To evaluate whether p␴1 has a direct titers by ELISA. As expected, OVA-immunized mice responded impact on CD4ϩ T cell populations, or whether the induction of well, but naive and OVA-p␴1-immunized mice remained OVA tolerance relies solely on p␴1 interaction with the mucosal epithe- unresponsive (Fig. 8). All mice were subsequently challenged on lium, an in vitro study was performed. Lymphocytes isolated from day 28 with OVA in IFA, and 1 wk later, serum from individual naive DO11.10-Tg mice were cultured with a high (1 mg/ml) or ␴ ␴ mice was collected and measured for IgG anti-OVA titers. Even low dose (0.05 mg/ml) of OVA-p 1orp 1 and compared with in by guest on September 29, 2021 though mice dosed with OVA-p␴1 plus CT (Fig. 8B) showed re- vitro cultures stimulated with OVA or OVA plus p␴1. After 24 or duced Ab titers relative to OVA plus CT-dosed mice, these anti- 72 h, cells and culture supernatants were harvested and evaluated OVA Ab titers were greater than those obtained in the OVA-chal- for CD4ϩ T cell apoptosis by FACS, and cytokine production by lenged, naive mice (Fig. 8A). Thus, these results show that ELISA, respectively. Only ϳ13% of Tg CD4ϩ T cells underwent

Table IV. Cytokine production by in vitro cultured DO11.10 lymphocytesa

Treatmentb

Ag Dose, in mg/ml IL-4 (ng/ml)c IL-10 (ng/ml)c IL-17 (ng/ml)c IFN-␥ (ng/ml)c

Cytokine secretion after 24 hd OVA 1 0.58 Ϯ 0.03 0.66 Ϯ 0.04 5.59 Ϯ 0.54 4.06 Ϯ 0.52 OVA-p␴1 1 1.20 Ϯ 0.1§ 2.76 Ϯ 0.14* 0.37 Ϯ 0.11* 0.31 Ϯ 0.08§ OVA-p␴1 0.05 1.67 Ϯ 0.2§ 4.73 Ϯ 0.29* 0 Ϯ 0* 0 Ϯ 0* p␴110Ϯ 0* 0.26 Ϯ 0.04§ 0.63 Ϯ 0.17* 0.22 Ϯ 0.07§ p␴1 0.05 0 Ϯ 0* 0 Ϯ 0* 0.58 Ϯ 0.14* 0 Ϯ 0* OVA ϩ p␴1 1,1 0 Ϯ 0* 0.56 Ϯ 0.02 4.17 Ϯ 0.6 2.6 Ϯ 0.45 OVA ϩ p␴1 1,0.05 0 Ϯ 0* 0.42 Ϯ 0.17 1 Ϯ 0.14§ 0.97 Ϯ 0.08§ Cytokine secretion after 72 he OVA 1 2.21 Ϯ 0.13 1.82 Ϯ 0.12 6.22 Ϯ 0.46 10.1 Ϯ 0.98 OVA-p␴11 0Ϯ 0* 0 Ϯ 0* 0 Ϯ 0* 0 Ϯ 0* OVA-p␴1 0.05 3.54 Ϯ 0.15§ 2.2 Ϯ 0.03§ 0.52 Ϯ 0.13* 0.38 Ϯ 0.03* p␴110Ϯ 0* 0 Ϯ 0* 0.58 Ϯ 0.14* 0.72 Ϯ 0.05* p␴1 0.05 0 Ϯ 0* 0.29 Ϯ 0.02* 0 Ϯ 0* 0.94 Ϯ 0.09* OVA ϩ p␴1 1,1 0 Ϯ 0* 0.37 Ϯ 0.19§ 0.72 Ϯ 0.18* 0.77 Ϯ 0.2* OVA ϩ p␴1 1,0.05 1.22 Ϯ 0.18* 0.46 Ϯ 0.16§ 2.87 Ϯ 0.47§ 2.3 Ϯ 0.29§ p Յ 0.001, §, p Ͻ 0.05 for the differences between cells ,ء ;a Statistical significance was calculated by Student’s t test stimulated with OVA vs OVA-p␴1, p␴1, or OVA ϩ p␴1-stimulated cells, for each time point. b Lymphocytes were isolated from spleens of naive DO11.10-Tg mice. Cultured supernatants from cells stimulated in vitro with designated concentrations of Ags were analyzed by cytokine ELISA. c Cytokine concentration was measured in triplicate and is depicted as an average Ϯ SEM. Presented cytokine concentration is corrected over the cytokine production by unstimulated cells. d Cells were cultured with or without Ag for 24 h. e Cells were cultured with or without Ag for 72 h. The Journal of Immunology 5197

apoptosis in response to in vitro stimulation with OVA for up to beyond the initial cell binding to the mucosal epithelium or M 72 h. In contrast, stimulation with p␴1, OVA-p␴1, or OVA plus cells. p␴1 induced much greater apoptosis of Tg DO11.10 CD4ϩ T cells Induction of peripheral tolerance to a number of mucosally de- after 24 and 72 h (Table III), and the extent of this apoptosis was livered Ags has been demonstrated previously using both high- time and dose dependent. Less than 31% of these cells died after and low-dose tolerization regimens (2, 7, 17, 28, 35); however, 24 h of culture with a low-dose (0.05 mg/ml) stimulation, whereas we propose that fusion of p␴1 to a protein Ag can significantly 1 mg/ml OVA-p␴1, p␴1 or OVA plus p␴1 doubled the number of improve both mucosal and systemic unresponsiveness to this Ag. apoptotic cells at this time point (Table III). After 72 h, low-dose Previously, we have shown that chemically modified p␴1 with ϩ p␴1 exposure resulted in ϳ54–62% of Tg CD4 T cells under- poly-L-lysine significantly enhances immunity to delivered DNA going apoptosis unlike high-dose treatment that resulted in ϳ80% (14), and because of this modification, Abs to p␴1 are induced, but apoptosis (Table III). Concomitant cytokine analysis of cultured not to the unmodified p␴1. Thus, genetic fusion of an Ag to p␴1 supernatants revealed increased production of IL-4 and IL-10 by is instrumental to stimulate tolerance. When OVA-p␴1 was coad- the cells stimulated for 24 h with 1 mg/ml OVA-p␴1 or 72 h with ministered with potent mucosal adjuvants, CT or CpG-ODN, the 0.05 mg/ml OVA-p␴1 (Table IV). Consistently, these OVA-p␴1- results provided further evidence that immunity to OVA was im- stimulated cells showed significant reduction in inflammatory cy- paired. This finding was surprising because it is well-established ␥ tokines IFN- and IL-17 at both time points, when compared with that CT given mucosally always induces Ag-specific Abs (36). OVA-stimulated cells. Cells cultured with a high dose of OVA- Although the mechanism by which OVA-p␴1-induced tolerance ␴ p 1 for 72 h failed to produce any cytokines, presumably due to overrides the immunostimulatory effects of CT is unclear, it is apoptosis of 80% of these cells (Table III). Interestingly, cells plausible that OVA-p␴1 resists cotreatment with CT due to the Downloaded from ␴ incubated with unconjugated p 1 and OVA mimicked the inflam- p␴1-adhesive properties which, in turn, may act on different re- matory response of OVA-stimulated cells, showing elevated IL-17 ceptors than CT-B. Nonetheless, p␴1-induced tolerance to OVA ␥ and IFN- secretion after 24 h, and even after 72 h, the production remained effective. Another mucosal immune modulator, the un- of IL-10 and IL-4 by these cells was significantly reduced in re- methylated CG dinucleotides CpG-containing motifs (CpG-ODN), lation to OVA-stimulated cells (Table IV). These results offer an was also shown to enhance immunity to OVA after oral adminis-

␴ http://www.jimmunol.org/ alternative mechanism in which p 1 may induce apoptosis of tration (26). Here, it was shown that nasal coadministration of OVA-responsive CD4ϩ T cells if intact p␴1 survives delivery be- OVA-p␴1 plus CpG-ODN also resulted in tolerance. In contrast to yond the initial cell binding to the mucosal epithelium or M cells. mice given OVA plus CpG-ODN, OVA-p␴1 plus CpG-ODN- In summary, these studies show that OVA-p␴1 can readily ac- dosed mice lacked OVA-specific DTH responses and showed lim- complish tolerance with a single dose and stimulate the production ited OVA-specific systemic and mucosal Ab titers, suggesting that of FoxP3ϩ T cells producing IL-10, and tolerance induction is reg the presence of a plasmid cDNA does not affect tolerogenic prop- IL-10 dependent. erties of genetically modified p␴1. Discussion Despite the reported feasibility to induce low-dose nasal toler-

ance with OVA (28, 37), a sustainable tolerance by a variety of by guest on September 29, 2021 We previously showed that the reovirus adhesin, p␴1, can enhance nasal OVA doses (0.05–2.5 mg) could not be induced, but a single the efficacy of mucosal DNA vaccination (14). In this work, we oral 25-mg dose of OVA was found effective. In contrast, as little investigated whether a genetic fusion between p␴1 and a model Ag as a single 50-␮g nasal dose of OVA-p␴1 was sufficient to induce (OVA) would have the same effect. Unlike the previous findings, it was learned that when p␴1 was fused to a protein Ag, tolerance OVA-specific tolerance that was long-lasting and resisted periph- ␴ was induced. In fact, tolerance could be accomplished even with a eral challenge with OVA in IFA, showing that OVA-p 1 is at least single dose of OVA-p␴1 delivered mucosally. In contrast, paren- a 1000-fold more efficient on a molar basis. teral delivery of OVA-p␴1 failed to induce tolerance to OVA. This Previous studies have shown that the CT-B subunit could be p␴1-based mucosal tolerance even resisted cotreatment with po- adapted for mucosal tolerance induction (38–41). In those reports, tent mucosal adjuvants (CT and CpG-ODN), and tolerance was not efficiency of Ag-specific tolerance was improved by its conjuga- broken after peripheral challenge with OVA. In contrast to OVA- tion to CT-B, as evidenced by reduced Ag-specific Ab and DTH p␴1, nasal administration of OVA alone, which is known to be a responses following mucosal delivery. Many of these studies de- poor mucosal immunogen (34), elicited greater Ag-specific Ab re- pended upon chemically coupling the tolerogen, which produces a sponses than did OVA-p␴1. Moreover, the mechanism for this heterogeneous population of carrier conjugates and may limit only p␴1-induced tolerance was CD4ϩ T cell dependent and could be a fraction of these to bind the intended cell surface receptor (42). adoptively transferred into naive mice. Adoptive transfer of CLN- Additionally, CT-B is also commonly used as a mucosal adjuvant derived CD4ϩ T cells from mice tolerized with OVA-p␴1 signif- (43, 44) because it lacks the toxic moieties associated with native icantly inhibited OVA-specific proliferation of CD4ϩ T cells in CT (45). To circumvent these potential barriers for using CT-B to vitro. In subsequent analysis, it was revealed that tolerization via induce tolerance, a genetic fusion between CT-B and proteolipid OVA-p␴1 induced significant increases in FoxP3ϩ CD25ϩCD4ϩ protein immunodominant peptide was done to ameliorate the clin- T cells, as well as an elevation in FoxP3ϩCD25ϪCD4ϩ T cells. ical manifestations of experimental autoimmune encephalomyeli- Adoptive transfer of OVA-p␴1-primed CD25ϩCD4ϩ or tis (42). Although multiple doses were required, nasal administra- CD25ϪCD4ϩ T cells significantly inhibited Ag-specific prolifer- tion of this CT-B-proteolipid protein peptide fusion protein was ation of OVA-Tg CD4ϩ T cells in vivo. This suppression was due effective for inducing tolerance. ␴ to increased production of IL-10 by OVA-p 1-induced Treg cells, Treg cells consist of a phenotypically diverse group bearing a as evidenced by cytokine and FACS analyses, as well as by the variety of cell surface receptors, but they commonly share their lack of OVA-specific tolerance in OVA-p␴1-dosed IL-10Ϫ/Ϫ ability to suppress T cell function (Refs. 46–48; Immunological mice. Additionally, it was learned from the in vitro studies that Aging Research Group Tokyo Metropolitan Institute of Gerontol- OVA-p␴1 induces apoptosis of OVA-responsive CD4ϩ T cells in ogy, www.tmig.or.jp/topic/topic_01.html). Induction and mainte- a time- and a dose-dependent manner, offering an additional po- nance of low-dose mucosal tolerance has been associated with ac- ␴ tential mechanism for the action of p 1 if it can survive delivery tivation of Treg cells acting in an Ag-specific fashion (6, 7, 49–51). ␴ ϩ 5198 p 1 STIMULATES IL-10 Treg CELLS

␴ Ϫ ϩ Evidence provided in this study shows that OVA-p 1-induced tol- Treg cells, as well as possibly CD25 CD4 T cells, mediate the erance is mediated by Ag-specific CD4ϩ T cells, because adoptive observed p␴1-induced tolerance. transfer of these OVA-p␴1-primed CD4ϩ T cells conferred unre- The role of TGF-␤1 appears to be less essential for OVA-p␴1- sponsiveness in naive recipients to in vivo peripheral OVA chal- induced tolerance. TGF-␤1 was only modestly induced in OVA- lenge and inhibited OVA-specific CD4ϩ T cell proliferation. Stud- p␴1-tolerized BALB/c mice; however, TGF-␤1 was induced in ies have also found that low-dose mucosal tolerance is mediated by OVA-p␴1-tolerized C57BL/6 mice and greatly reduced in OVA- ␴ Ϫ/Ϫ Treg cells that express the FoxP3 transcription factor (5, 47, 52– p 1-dosed IL-10 mice. The PBS-dosed, OVA-challenged IL- 54). Consistent with these findings, nasal administration of OVA- 10Ϫ/Ϫ mice also showed elevated numbers of TGF-␤1-producing ␴ ϩ ␤ p 1 significantly increased the numbers of Treg cells, in which CD4 T cells. This suggests that TGF- 1 may play a supportive Ͼ97% were FoxP3ϩ. Along these lines, expression of FoxP3 was role in OVA-p␴1-induced tolerance, and secretion of TGF-␤1in also induced in CD25ϪCD4ϩ T cells following tolerization with OVA-p␴1-tolerized mice depends upon the presence of IL-10, as OVA-p␴1, although the intensity of FoxP3 staining was ϳ50-fold previously suggested (62). Alternatively, the production of less than that observed for the CD25ϩCD4ϩ T cells. A low-level TGF-␤1 may contribute to the conversion of CD25ϪCD4ϩ to intensity of FoxP3 and its transient expression on activated human CD25ϩCD4ϩ T cells in tolerized mice, as implicated by recent CD25Ϫ T cells has been previously reported (55). These FoxP3- studies demonstrating that TGF-␤1 induces conversion of naive Ϫ Ϫ ϩ expressing CD25 T cells are not capable of inhibiting cytokine peripheral CD25 CD4 T cells into Treg cells by enhancing production nor proliferation, and expression of FoxP3 on these FoxP3 expression (29, 35, 56). Further evidence for the supportive ␤ ␴ cells is not correlated with the induction of a Treg cell phenotype role of TGF- 1 in OVA-p 1-mediated tolerance is suggested by ϩ ϩ (55). In contrast to that study, adoptive transfer of OVA-p␴1- the depressed levels of TGF-␤1 CD4 T cells in the OVA-p␴1- Downloaded from primed CD25ϩ or CD25Ϫ T cells significantly inhibited in vivo dosed IL-10Ϫ/Ϫ mice. proliferation of OVA-Tg CD4ϩ T cells. Additionally, FACS anal- We have demonstrated, here and elsewhere (14, 23), that reo- ysis of lymphocytes isolated from mice adoptively transferred with virus adhesin, p␴1, can be engineered to induce either immunity or OVA-p␴1-derived CD25Ϫ T cells showed significant enrichment tolerance, although the exact mechanism of p␴1-mediated modu- in FoxP3ϩCD25ϪCD4ϩ T cells. A significant increase in FoxP3 lation of an immune response remains undefined. P␴1, aside from ϩ ϩ expression in DO11.10 responder CD4 T cells (both CD25 and binding M cells in murine NALT (14), interacts with a variety of http://www.jimmunol.org/ CD25Ϫ) was observed in mice adoptively transferred with OVA- rodent and human cell types, including murine L929 (L) cells, p␴1-derived CD25ϩ or CD25Ϫ CD4ϩ T cells, suggesting that RFL-6 cells, and Caco-2 cells (23). Additionally, p␴1 binds to OVA-p␴1-derived CD4ϩ T cells induce FoxP3ϩ expression by the mammalian erythrocytes (63), as well as to intestinal epithelial responder CD4ϩ T cells. This finding is not surprising, because cells (64). It is known that p␴1 has two distinct binding domains tolerance induction can occur via conversion of CD25Ϫ to (64, 65). One domain, located in p␴1’s head structure, has been FoxP3ϩCD25ϩCD4ϩ T cells, as reported by others (29, 56), and shown to interact with cells expressing the junctional adhesion these FoxP3-expressing CD25ϪCD4ϩ T cells, as well as converted molecule 1, whereas a second binding domain in p␴1’s tail is CD25ϩCD4ϩ T cells, are potent inhibitors of CD4ϩ T cell expan- thought to be responsible for binding to ubiquitously expressed sion in vivo (29). Thus, the OVA-p␴1-induced CD25Ϫ T cells also sialic acid (64). Interaction of p␴1 with host cells may be junc- by guest on September 29, 2021 have regulatory properties, as evident by being able to suppress tional adhesion molecule 1-mediated, because some of them, in- proliferation of Tg CD4ϩ T cells. cluding primary human DCs and epithelial cells, express this mol- ϩ ␴ Examination of OVA323–339-specific CD4 T cell cytokine pro- ecule (64). A possible mechanism for p 1-induced modulation of duction in recipient mice adoptively transferred with either total an immune response could be a well-described ability of p␴1to CD25Ϫ or CD25ϩ CD4ϩ T cells from OVA-p␴1-primed mice induce apoptosis (65, 66). Interestingly, the efficiency of p␴1-me- revealed greatly reduced numbers of CD4ϩ T cells secreting the diated apoptosis has been linked to the presence of sialic acid- proinflammatory cytokines, IFN-␥ and IL-17, and instead pro- binding domain, because p␴1 mutants, unable to bind sialic acid, duced IL-4 and IL-10. These primarily segregated with IL-4 com- are insufficient inducers of apoptosis (65). Given these findings, we ing from recipients given OVA-p␴1-primed CD25ϪCD4ϩ T cells showed here that OVA-p␴1 and p␴1 trigger apoptosis of OVA-Tg ␴ ϩ ␴ and with IL-10 from recipients given OVA-p 1-primed Treg cells. CD4 T cells in vitro. However, in contrast to p 1 alone, or un- The increased production of IL-4 may play a beneficial role in conjugated p␴1 plus OVA, only OVA-p␴1 was capable of stim- OVA-p␴1-mediated tolerance, perhaps, via the induction of a Th2- ulating these cells to produce increased levels of regulatory cyto- type immune bias, which was previously shown to support muco- kines. The means by which p␴1 induces tolerance are still being sal tolerance (57, 58). Additionally, IL-4 can also facilitate induc- investigated, and our results suggested that more than one mech- Ϫ ϩ tion of Treg cells from naive, peripheral CD25 CD4 T cells, as anism may be associated with this process. Nonetheless, mucosal recently demonstrated in vitro by others (57). The role for IL-10 in delivery of OVA-p␴1 is obviously crucial for the induction of maintenance of tolerance is well-established (30–32), even though OVA-specific unresponsiveness. It is known that stimulation of its role in the induction of both mucosal and peripheral unrespon- mucosal tolerance is dose dependent, resulting from active sup- siveness remains controversial (59–61). One report has shown that pression, induction of anergy, or clonal deletion of effector cells (2, the early production of IL-10 by CD4ϩ T cells is important for 5). Results presented here suggest that a low dose of OVA-p␴1 induction of high-dose oral tolerance (59). Here, we demonstrated delivered mucosally induces active suppression of anti-OVA im- that IL-10 is also necessary for induction of a low-dose nasal tol- mune responses by regulatory CD4ϩ T cells. Although the in vitro erance mediated by p␴1, because OVA-p␴1-mediated tolerance studies suggested possible clonal deletion because of the accom- could not be established in IL-10Ϫ/Ϫ mice. IL-10Ϫ/Ϫ mice given panied p␴1-induced apoptosis of OVA-specific effector CD4ϩ T OVA-p␴1 nasally developed elevated serum IgG anti-OVA Ab cells, it remains to be determined whether such events occur in and DTH responses. In contrast to C57BL/6 mice, immunization vivo following mucosal delivery. Ϫ/Ϫ ␴ ␴ of IL-10 mice with OVA-p 1 failed to induce Ag-specific Treg In summary, we showed that p 1-mediated tolerance to OVA cells and failed to inhibit Ag-specific proliferation of CD4ϩ T can be established with a minimal amount of tolerogen when ge- cells. Therefore, we conclude that IL-10 is essential for induction netically fused to p␴1 and when applied mucosally. In some in- and maintenance of p␴1-induced tolerance, and IL-10-producing stances, a single nasal administration using ϳ1000-fold less OVA The Journal of Immunology 5199

was sufficient to induce tolerance to OVA. Tolerance induced by 16. Fleeton, M., N. Contractor, F. Leon, J. He, D. Wetzel, T. Dermody, A. Iwasaki, OVA-p␴1 resisted cotreatment with CT, as well as peripheral chal- and B. Kelsall. 2004. Involvement of dendritic cell subsets in the induction of oral tolerance and immunity. Ann. NY Acad. Sci. 1029: 60–65. lenge with OVA and IFA. Although IL-4 and TGF-␤1 seemed to 17. Kato, H., K. Fujihashi, R. Kato, Y. Yuki, and J. R. McGhee. 2001. Oral tolerance have supportive roles, p␴1-delivered tolerance relied largely on revisited: prior oral tolerization abrogates cholera toxin-induced mucosal IgA activation of specific FoxP3ϩ T cells that acted in an IL-10- responses. J. Immunol. 166: 3114–3121. reg 18. Wolf, J. L., R. S. Kauffman, R. Finberg, R. Dambrauskas, B. N. Fields, and dependent manner. The induced tolerance was IL-10 dependent J. S. Trier. 1983. Determinants of reovirus interaction with the intestinal M cells because IL-10Ϫ/Ϫ mice were unable to undergo tolerance by and absorptive cells of murine intestine. Gastroenterology 85: 291–300. ␴ 19. Mah, D. C. W., G. Leone, J. M. Jankowski, and P. W. K. Lee. 1990. The N- OVA-p 1 presumably via the failure to produce Treg cells. The terminal quarter of reovirus cell attachment protein ␴1 possesses intrinsic virion- ␴ impact by the OVA-p 1-induced Treg cells was enhanced by reg- anchoring function. Virology 179: 95–103. ulatory CD25ϪCD4ϩ T cells because a subset of these was 20. Turner, D. L., R. Duncan, and P. W. Lee. 1992. Site-directed mutagenesis of the ␴ FoxP3ϩ and produced predominantly IL-4 in addition to IL-10. C-terminal portion of reovirus protein 1: evidence for a conformation-dependent Ϫ ϩ receptor binding domain. Virology 186: 219–227. These CD25 CD4 T cells could also inhibit the proliferation of 21. Barton, E. S., J. D. Chappell, J. L. Connolly, J. C. Forrest, and T. S. Dermody. OVA-Tg CD4ϩ T cells. TGF-␤1 appeared to have a supportive 2001. Reovirus receptors and apoptosis. Virology 290: 173–180. ␴ ␤ 22. Kato, T., and R. L. Owen. 2005. Structure and function of intestinal mucosal role in tolerance induction by OVA-p 1. Depression of TGF- 1- epithelium. In Mucosal Immunology, Ch. 8. J. Mestecky, M. E. Lamm, ϩ Ϫ/Ϫ producing CD4 T cells in OVA-p␴1-dosed IL-10 mice was W. Strober, J. Bienenstock, J. R. McGhee, and L. Mayer, eds. Elsevier-Academic observed suggesting that the production of this cytokine may be Press, San Diego, pp. 131–151. 23. Wu, Y., M. J. Boysun, K. L. Csencsits, and D. W. Pascual. 2000. Gene transfer triggered by IL-10. These collective data show that IL-10 is pivotal facilitated by a cellular targeting molecule, reovirus protein sigma1. Gene Ther. in OVA-p␴1-induced tolerance. This finding is relevant because of 7: 61–69.

the low dose of Ag required for tolerance induction and its poten- 24. Wang, X., D. M. Hone, A. Haddad, M. T. Shata, and D. W. Pascual. 2003. M cell Downloaded from DNA vaccination for CTL immunity to HIV. J. Immunol. 171: 4717–4725. tial applicability to treat or prevent a variety of autoimmune 25. Csencsits, K. L., N. Walters, and D. W. Pascual. 2001. Cutting edge: dichotomy ␴ ␣ diseases and allergies. The opportunity to deliver p 1-based of homing receptor dependence by mucosal effector B cells: E versus L-selectin. tolerogens via the nasal route offers a safer, easier, and more cost- J. Immunol. 167: 2441–2445. 26. Alignani, D., B. Maletti, M. Liskovsky, A. Ro´polo, G. Moro´n, and effective alternative for tolerization. M. C. Pistoresi-Palencia. 2005. Orally administered OVA/CpG-ODN induces specific mucosal and systemic immune response in young and aged mice. J. Leu- kocyte Biol. 77: 898–905. http://www.jimmunol.org/ Acknowledgments 27. Ochoa-Repa´raz, J., C. Riccardi, A. Rynda, S. Jun, G. Callis, and D. W. Pascual. We thank Dr. Arnold Stein (Purdue University) for kindly providing the 2007. Regulatory T cell vaccination without autoantigen protects against exper- OVA cDNA, Sue Brumfield for her assistance at MSU’s fermentation fa- imental autoimmune encephalomyelitis. J. Immunol. 178: 1791–1799. 28. Unger, W. W., F. Hauet-Broere, W. Jansen, L. A. van Berkel, G. Kraal, and cility, and Nancy Kommers for her assistance in preparing this manuscript. J. N. Samsom. 2003. Early events in peripheral regulatory T cell induction via the nasal mucosa. J. Immunol. 171: 4592–4603. 29. Chen, W., W. Jin, N. Hardegen, K. J. Lei, L. Li, N. Marinos, G. McGrady, and Disclosures S. M. Wahl. 2003. Conversion of peripheral CD4ϩCD25Ϫ naive T cells into The authors have no financial conflict of interest. CD4ϩCD25ϩ regulatory T cells by TGF-␤ induction of transcription factor FoxP3. J. Exp. Med. 198: 1875–1886. 30. Gonnella, P. A., H. P. Waldner, D. Kodali, and H. L. Weiner. 2004. Induction of

References low-dose oral tolerance in IL-10 deficient mice with experimental autoimmune by guest on September 29, 2021 1. Mowat, A. M. 2003. Anatomical basis of tolerance and immunity to intestinal encephalomyelitis. J. Autoimmun. 3: 193–200. antigens. Nat. Rev. Immunol. 3: 331–341. 31. Ghoreishi, M., and J. P. Dutz. 2006. Tolerance induction by transcutaneous im- 2. Weiner, H. L. 2000. Oral tolerance, an active immunologic process mediated by munization through ultraviolet-irradiated skin is transferable through ϩ ϩ multiple mechanisms. J. Clin. Invest. 106: 935–937. CD4 CD25 T regulatory cells and is dependent on host-derived IL-10. J. Im- 3. Xiao, B.-G., and H. Link. 1997. Mucosal tolerance: a two-edged sword to prevent munol. 176: 2635–2644. and treat autoimmune diseases. Clin. Immunol. Immunopathol. 85: 119–128. 32. Seewaldt, S., J. Alferink, and I. Fo¨rster. 2002. Interleukin-10 is crucial for main- 4. Jun, S., W. Gilmore, G. Callis, A. Rynda, A. Haddad, and D. W. Pascual. 2005. tenance but not for developmental induction of peripheral T cell tolerance. Eur. A live diarrheal vaccine imprints a Th2 cell bias and acts as an anti-inflammatory J. Immunol. 32: 3607–3616. vaccine. J. Immunol. 175: 6733–6740. 33. Veldhoen, M., and B. Stockinger. 2006. TGF␤1, a “Jack of all trades”: the link 5. Faria, A. M., and H. L. Weiner. 1999. Oral tolerance: mechanisms and thera- with pro-inflammatory IL-17-producing T cells. Trends Immunol. 27: 358–361. peutic applications. Adv. Immunol. 73: 153–264. 34. Van der Heijden, P. J., A. T. J. Bianchi, M. Dol, J. W. Pals, W. Stok, and 6. Fujihashi, K., H. Kato, F. W. van Ginkel, T. Koga, P. N. Boyaka, R. J. Jackson, B. A. Bokhout. 1991. Manipulation of intestinal immune response against R. Kato, Y. Hagiwara, Y. Etani, I. Goma, et al. 2001. A revisit of mucosal IgA ovalbumin by cholera toxin and its B subunit in mice. Immunology 72: 89–93. immunity and oral tolerance. Acta Odontol. Scand. 59: 301–308. 35. Huber, S., C. Schramm, H. A. Lehr, A. Mann, S. Schmitt, C. Becker, 7. Weiner, H. L. 1997. Oral tolerance: immune mechanisms and treatment of au- M. Protschka, P. R. Galle, M. F. Neurath, and M. Blessing. 2004. Cutting edge: toimmune diseases. Immunol. Today 18: 335–343. TGF-␤ signaling is required for the in vivo expansion and immunosuppressive ϩ ϩ 8. Kraus, T. A., J. Brimnes, C. Muong, J. H. Liu, T. M. Moran, K. A. Tappenden, capacity of regulatory CD4 CD25 T cells. J. Immunol. 173: 6526–6531. P. Boros, and L. Mayer. 2005. Induction of mucosal tolerance in Peyer’s patch- 36. Lycke, N. 2005. From toxin to adjuvant: basic mechanisms for the control of deficient, ligated small bowel loops. J. Clin. Invest. 115: 2234–2243. mucosal IgA immunity and tolerance. Immunol. Lett. 97: 193–198. 9. Reiter, R., and K. Pfeffer. 2002. Impaired germinal center formation and humoral 37. Samson, J. N., L. A. van Berkel, J. M. van Helvoort, W. W. Unger, W. Jansen, immune response in the absence of CD28 and interleukin-4. Immunology 106: T. Thepen, R. E. Mebius, S. S. Verbeek, and G. Kraal. 2005. Fc␥RIIB regulates 222–228. nasal and oral tolerance: a role for dendritic cells. J. Immunol. 174: 5279–5287. 10. Faria, A. M., R. Maron, S. M. Ficker, A. J. Slavin, T. Spahn, and H. L. Weiner. 38. Sun, J.-B., J. Holmgren, and C. Czerkinsky. 1994. Cholera toxin B subunit: an 2003. Oral tolerance induced by continuous feeding: enhanced up-regulation of efficient transmucosal carrier-delivery system for induction of peripheral immu- transforming growth factor-␤/interleukin-10 and suppression of experimental au- nological tolerance. Proc. Natl. Acad. Sci. USA 91: 10795–10799. toimmune encephalomyelitis. J. Autoimmun. 20: 135–145. 39. Sun, J.-B., C. Rask, T. Olsson, J. Holmgren, and C. Czerkinsky. 1996. Treatment 11. Fujihashi, K., T. Dohi, P. D. Rennert, M. Yamamoto, T. Koga, H. Kiyono, and of experimental autoimmune encephalomyelitis by feeding myelin basic protein J. R. McGhee. 2001. Peyer’s patches are required for oral tolerance to proteins. conjugated to cholera toxin B subunit. Proc. Natl. Acad. Sci. USA 93: Proc. Natl. Acad. Sci. USA 98: 3310–3315. 7196–7201. 12. Rennert, P. D., J. L. Browining, and P. S. Hochman. 1997. Selective disruption 40. Sun, J.-B., S. Raghavan, Å. Sjo¨ling, S. Lundin, and J. Holmgren. 2006. Oral of lymphotoxin ligands reveals a novel set of mucosal lymph nodes and unique tolerance induction with antigen-conjugated to cholera toxin B subunit generates effects on lymph node cellular organization. Int. Immunol. 9: 1627–1639. both FoxP3ϩ CD25ϩ and FoxP3ϪCD25ϪCD4ϩ regulatory T cells. J. Immunol. 13. Kiyono, H., and S. Fukuyama. 2004. NALT- versus Peyer’s-patch-mediated mu- 177: 7634–7644. cosal immunity. Nat. Rev. Immunol. 4: 699–710. 41. Bergerot, I., C. Ploix, J. Petersen, V. Moulin, C. Rask, N. Fabien, M. Lindblad, 14. Wu, Y., X. Wang, K. L. Csencsits, A. Haddad, N. Walters, and D. W. Pascual. A. Mayer, C. Czerkinsky, J. Holmgren, and C. Thivolet. 1997. A cholera toxin- 2001. M cell-targeted DNA vaccination. Proc. Natl. Acad. Sci. USA 98: insulin conjugate as an oral vaccine against spontaneous autoimmune diabetes. 9318–9323. Proc. Natl. Acad. Sci. USA 94: 4610–4614. 15. Fleeton, M., N. Contractor, F. Leon, J. D. Wetzel, T. S. Dermody, and 42. Yuki, Y., Y. Byun, M. Fujita, W. Izutani, T. Suzuki, S. Udake, K. Fujihashi, B. L. Kelsall. 2004. Peyer’s patch dendritic cells process viral antigen from ap- J. R. McGhee, and H. Kiyono. 2001. Production of recombinant hybrid molecule optotic epithelial cells in the intestine of reovirus-infected mice. J. Exp. Med. 200: of cholera toxin-B-subunit and proteolipid-protein-peptide for the treatment of 235–245. experimental encephalomyelitis. Biotechnol. Bioeng. 74: 62–69. ␴ ϩ 5200 p 1 STIMULATES IL-10 Treg CELLS

43. Yokohama, Y., and Y. Harabuchi. 2002. Intranasal immunization with lipotei- 55. Allan, S. E., S. O. Crome, N. K. Crellin, L. Passerini, T. S. Steiner, R. Bacchetta, choic acid and cholera toxin evokes specific pharyngeal IgA, and systemic IgG M. G. Roncarolo, and M. K. Levings. 2007. Activation-induced FoxP3 in human responses and inhibits streptococcal adherence to pharyngeal epithelial cells in T effector cells does not suppress proliferation or cytokine production. Int. Im- mice. Int. J. Pediatr. Otohinolaryngol. 63: 235–241. munol. 19: 345–354. 44. Lian, T., T. Bui, and R. J. Ho. 1999. Formulation of HIV-envelope protein with 56. Selvaraj, R. K., and T. L. Geiger. 2007. A kinetic and dynamic analysis of FoxP3 lipid vesicles expressing ganglioside GM1 associated to cholera toxin B enhances induced in T cells by TGF-␤. J. Immunol. 178: 7667–7677. mucosal immune responses. Vaccine 18: 604–611. 57. Skapenko, A., J. R. Kalden, P. E. Lipsky, and H. Schulze-Koops. 2005. The IL-4 45. Lycke, N. 2004. ADP-ribosylating bacterial enzymes for the targeted control of receptor “-chain-binding cytokines, IL-4 and IL-13, induce forkhead box P3- ϩ ϩ Ϫ ϩ mucosal tolerance and immunity. Ann. NY Acad. Sci. 1029: 193–208. expressing CD25 CD4 regulatory T cells from CD25 CD4 precursors. J. Im- 46. Grundstrom, S., L. Cederbom, A. Sundstedt, P. Scheipers, and F. Ivars. 2003. munol. 175: 6107–6116. Superantigen-induced regulatory T cells display different suppressive functions in 58. al Sabbagh, A., A. Miller, L. M. Santos, and H. L. Weiner. 1994. Antigen-driven the presence or absence of natural CD4ϩCD25ϩ regulatory T cells in vivo. J. Im- tissue-specific suppression following oral tolerance: orally administered myelin munol. 170: 5008–5017. basic protein suppresses proteolipid protein-induced experimental autoimmune 47. Olivares-Villagomez, D., Y. Wang, and J. J. Lafaille. 1998. Regulatory CD4ϩ T encephalomyelitis in the SJL mouse. Eur. J. Immunol. 24: 2104–2109. cells expressing endogenous T cell receptor chains protect myelin basic protein- 59. Cong, Y., C. Liu, C. T. Weaver, and C. O. Elson. 2004. Early upregulation of T specific transgenic mice from spontaneous autoimmune encephalomyelitis. cell IL-10 production plays an important role in oral tolerance induction. Ann. NY J. Exp. Med. 188: 1883–1894. Acad. Sci. 1029: 319–320. 60. Maurer, M., W. Seidel-Guyenot, M. Metz, J. Knop, and K. Steinbrink. 2003. 48. Shimizu, J., S. Yamazaki, T. Takahashi, Y. Ishida, and S. Sakaguchi. 2002. Stim- ϩ ϩ Critical role of IL-10 in the induction of low zone tolerance to contact allergens. ulation of CD4 CD25 regulatory T cells through GITR breaks immunological J. Clin. Invest. 112: 432–439. self-tolerance. Nat. Immunol. 3: 135–42. 61. Silva, S. R., J. F. Jacysyn, M. S. Macedo, and E. L. Faquim-Mauro. 2006. Im- 49. Chen, Y., V. K. Kuchroo, J. Inobe, D. A. Hafler, and H. L. Weiner. 1994. Reg- munosuppressive components of Ascaris suum down-regulate expression of co- ulatory T cell clones induced by oral tolerance: suppression of autoimmune en- stimmulatory molecules and function of antigen-presenting cells via an IL-10- cephalomyelitis. Science 265: 1237–1240. mediated mechanism. Eur. J. Immunol. 36: 3227–3237. 50. Mangan, P. R., L. E. Harrington, D. B. O’Quinn, W. S. Helms, D. C. Bullard, 62. Joetham, A., K. Takeda, C. Taube, N. Miyahara, S. Matsubara, T. Koya, C. O. Elson, R. D. Hatton, S. M. Wahl, T. R. Schoeb, and C. T. Weaver. 2006. Y. H. Rha, A. Dakahama, and E. W. Gelfand. 2007. Naturally occurring lung Downloaded from ␤ Transforming growth factor- induces development of the T(H)17 lineage. Na- CD4ϩCD25ϩ T cell regulation of airway allergic response depends on IL-10 ture 441: 231–234. induction of TGF-␤. J. Immunol. 178: 1433–1442. 51. Miyamoto, K., C. I. Kingsley, X. Zhang, C. Jabs, L. Izikson, R. A. Sobel, 63. Dermody, T. S., M. L. Nibert, R. Bassel-Duby, and B. N. Fields. 1990. A ␴1 H. L. Weiner, V. K. Kuchroo, and A. H. Sharpe. 2005. The ICOS molecule plays region important for hemagglutination by serotype 3 reovirus strains. J. Virol. 64: a crucial role in the development of mucosal tolerance. J. Immunol. 175: 5173–5176. 7341–7347. 64. Mercier, G. T., J. A. Campbell, J. D. Chappell, T. Stehle, T. S. Dermody, and 52. Harber, M., A. Sundstedt, and D. Wraith. 2000. The role of cytokines in immu- M. A. Barry. 2004. A chimeric adenovirus vector encoding reovirus attachment nological tolerance: potential for therapy. Expert Rev. Mol. Med. 2000: 1–20. ␴ protein 1 targets cells expressing junctional adhesion molecule 1. Proc. Natl. http://www.jimmunol.org/ 53. Lee, J. H., L. C. Wang, Y. T. Lin, Y. H. Yang, D. T. Lin, and B. L. Chiang. 2006. Acad. Sci. USA 101: 6188–6193. ϩ Inverse correlation between CD4 regulatory T-cell population and autoantibody 65. Connolly, J. V., E. S. Barton, and T. S. Dermody. 2001. Reovirus binding to cell levels in paediatric patients with systemic lupus erythematosus. Immunology 117: surface sialic acid potentiates virus-induced apoptosis. J. Virol. 75: 4029–4031. 280–286. 66. Tyler, K. L., M. K. Squier, S. E. Rodgers, B. E. Schneider, S. M. Oberhaus, 54. Lim, H. W., P. Hillsamer, A. H. Banham, and C. H. Kim. 2005. Cutting edge: T. A. Grdina, J. J. Cohen, and T. S. Dermody. 1995. Differences in the capacity direct suppression of B cells by CD4ϩCD25ϩ regulatory T cells. J. Immunol. of reovirus strains to induce apoptosis are determined by the viral attachment 175: 4180–4183. protein ␴1. J. Virol. 69: 6972–6979. by guest on September 29, 2021