Journal of Cell Science o:10.1242/jcs.107995 doi: 4609–4619 125, Science Cell of Journal 2012 June 7 Accepted ae .McKee K. Karen of activities integration laminin requires myelination cell Schwann Article Research rlfrto Bnigre l,20;Brie l,21;Nodari to cell bind 2011; also Schwann BMs al., 2009). and et al., et sorting Berti Pereira 2007; mediate 2007; al., et al., to et ligands (Benninger BM proliferation to upon dependent bind is process that The 1971; 1973). Webster, al., 1986; et al., Webster et (Bunge axonal critical myelination radial to promoting a leading by cells sorting play Schwann of (BMs) maturation the membranes in role basement nerve, peripheral In Introduction words: Key to weakly bind to engineered Laminins myelination. induce no that almost to or and domains, activities, (LN) BMs N-terminal reduced or receptor-binding critical proliferation caused removed either that domains, and a than deletions (LG) concentrations through architecture-forming globular laminin polymerize higher cell-adhesive to different require unable lacked to were lacking found that was Laminins cells -111 ensheathment. Schwann axonal by and interactions, unlike axons laminin latter of laminin-211 participating the Myelin-wrapping dissect proliferation, myelination. recombinant to cell and Schwann with this, normal for but basis treated amyelination the with identify defect To surfaces, sorting null. laminin cell axonal the for an Schwann hypomorphic exhibited on Mice density (BMs) understood. component membranes reduced well not basement are assembling however, by process, of myelination activation nerve peripheral to of leading stages early promote Laminins Summary work this to equally ` contributed authors *These 4 3 2 1 ucin yitrcigwt nern n dystroglycan and integrins BM-dependent with mediate interacting also by and Laminins 2007; al., polymerization, functions et 2011). McKee surfaces, 2005; al., et cell Yurchenco, (Li agrin and to nidogens depends agrin to Assembly adhesion binding 1999). and al., laminin et required perlecan (Smyth are upon assembly Laminins proteoglycans BM BMs. initiate the of to components and major the collagen constitute IV type this for Despite myelination. required to leading are receptor 2011). stages that critical of BMs al., progression the of the contributions about et structural known and (Ma actually ligands is neuregulin factors little al., growth soluble information, et heparin-binding Saito as tether 2008; may al., such myelin-sheath et BMs Nodari Finally and 2011; 2003). al., development et (Berti nodal stabilization affecting myelination, and iooh Sekiguchi Kiyotoshi nert cfodfrigadcl-deinatvte oasml nednuilB,wt ylnto n rlfrto requiring proliferation and myelination with laminins that BM, reveal endoneurial findings an these assemble Collectively to polymerization. and activities domains additional cell-adhesion LG and to scaffold-forming binding integrin integrate both upon depended Proliferation uhrfrcrepnec ( correspondence for Author aoaoyo xrclua arxBohmsr,IsiuefrPoenRsac,OaaUiest,Sia sk 6-81 Japan 565-0871, Osaka Japan Suita, 565-0871, University, Osaka Osaka Suita, Research, University, Protein Osaka for Research, Institute Protein USA Biochemistry, USA for 10021, Matrix 08854, Institute NY Extracellular NJ Expression, York, of Piscataway, and New Laboratory School, Synthesis University, Medical Protein Rockefeller Johnson of Genetics, Wood Laboratory and Robert Neurobiology Medicine, of Laboratory Laboratory and Pathology of Department 6 02 ulse yTeCmayo ilgssLtd Biologists of Company The by Published 2012. aiisaeafml fgyortista ln ihnidogens, with along that glycoproteins of family a are Laminins b and/or 1 a 6 b nern oee,teemdaeltrsae of stages later mediate these however, integrin; 4 a 6 eihrlnuoah,Msua ytoh,Bsmn ebae xnlsrig Integrin sorting, Axonal membrane, Basement dystrophy, Muscular neuropathy, Peripheral b a 1/ 7 b a nern hog hi Gdmis vntog hycudefcieyasml M,dcesdmyelination. decreased BMs, assemble effectively could they though even domains, LG their through integrins 1 7 b 1, -aii Gdmi neatos n htahg Mlgn/tutrldniyi eddfrefcetmyelination. efficient for needed is density ligand/structural BM high a that and interactions, domain LG 1-laminin ,Dn-u Yang Dong-Hua *, [email protected] b 4 nern n te eetr.TeB opsto,srcua od n iad eddt eit this mediate to needed ligands and bonds structural composition, BM The receptors. other and integrins 1 n ee .Yurchenco D. Peter and ) 1, ,Rjs Patel Rajesh *, a -dystroglycan b integrins 1 1, ` 1 uLnChen Zu-Lin , noera aii-1 (Lm211, laminin-211 endoneurial contributions. laminin distinguish non-laminin a to from inability poses relative the requirement and of BMs laminin complexity within the ligands The given contributions 2002). BM dissecting al., for challenge et Li by (reviewed ies,priual eeei 5B6bcgon,smlrt the to similar the background, LAMC1 C57Bl6 of a Inactivation in nerve severe peripheral 2005). particularly substantial al., disease, caused Strickland, cells et Schwann Yang in and gene 2005; integrin al., (Chen et proliferation Yu 2003; reduced and by characterized neuropathy amyelination peripheral severe a the caused each of genes inactivation of combined Inactivation or 511. and expression 411 laminins minor the and aiisrvae htlmnncl ufc nhrg and anchorage surface cell and laminin cultured secrete in to that factors, domains incompetent revealed functional rendered (DRG) their myelination laminins ganglia and root laminins of hypomyelination, cell dorsal of Investigation dystrophy. role by and Schwann the atrophy characterized muscle by was of accompanied defect alterations This states. distinct attribute latter the the from proliferation, cell accompanied Schwann not reduced defect sorting by axonal an with expression subunit cwn ellmnn hr the share laminins cell Schwann enwdsrb os ihitreit-ee laminin intermediate-level with mouse a describe now We c -uui xrsinta sebe noera M with BMs endoneurial assembled that expression 1-subunit cwn elkoku hntp Brie l,2011). al., et (Berti phenotype knockout cell Schwann LAMC1 2 inyStrickland Sidney , LAMC1 aii ncotadohrlaminin-deficiency other and knockout laminin eeiatvtddra otgnlawere ganglia root dorsal gene-inactivated a 2 2 c uih Takagi Junichi , b uui nteprincipal the in subunit 1 1 c uui composition) subunit 1 LAMA2 LAMC1 and 3 LAMA4 , 4609 gene b c c 1 1 1 Journal of Cell Science rmtheir from asteddntdvlpagi bomlt n perdnra in life. gait normal throughout appeared behavior and abnormality their the gait the fl/ a develop of finding that not the did presence cassette by possibility the supported to was The due cassette hindlimbs ambulation. be and back might in lower abnormality the difficulty in mass with contractures muscle hindlimb of sustained reductions of exhibited weeks and mice 8-10 affected By the inwards. retracted age, and tremulous slightly were icniute ln h Psrae n otoso cwn cell fl Schwann frequent the of in possessed portions bodies and BMs by surfaces LP separation cell the along and Schwann discontinuities penetration processes. in extensive cell larger were less Schwann bundles with axon nerve naked panel), the mutant (lower However, were axons well. axons was as the myelinated BM present Scattered as structure. the of side which polarity opposite a in reflecting the axons on of located groups always encompass to were seen bodies often cell Schwann from extending processes Longer nerve. eiti etoso cai ev n ev ot ffl of roots nerve blue-stained and Methylene nerve S1). sciatic of Fig. sections material semi-thin supplementary 1; (Fig. hi idib uwrs ncnrs,hnlmso fl of hindlimbs contrast, In outwards. hindlimbs their PBsrltv oteudryn lsammrnsrvae a revealed membranes BM. plasma of underlying decrease essentially the two-fold to were of relative measurements hand, BMs Length other LP nerves. mutant the and control on in (MA), continuous axons myelinated of ek fae hnlfe yteti,tefl the tail, the by lifted When age. of weeks meiae ra eefudi h fl Larger the 1A-D). in (Fig. found controls were littermate areas to amyelinated amyelinated compared to corresponding axons areas pale-staining multiple exhibited tt.RAetat rmtenre uce n te organs other and muscle, nerve, the from deficiency laminin extracts a RNA suggested phenotype state. muscle and nerve The mRNA Laminin envelop to and both axons, in of groups, bundles axon divide and (supplementary and axons into axonal-sorting were extend (LP) to active processes noted lamellipodial cell of Schwann S3). stage Fig. material 5 the day post-natal during at examined (P5) also was ultrastructure nerve Sciatic nerve Post-natal fl from dissected were tissues other and nerves nerve Sciatic peripheral adult of Morphology LAMC1 mice hypomorphic Laminin Results ensheathment proliferation, myelination. promote and to and contribute laminin differentially that polymerization, and assembly BM concentration, for important are polymerization 4610 hcns fautShancl M a on ob h same. the The be to found ratios. was BMs axon/myelin+axon cell Schwann adult increased of thickness with hypomyelinated oae daett ae axons. naked mostly myelinate, to not do adjacent that cells Schwann by located accompanied in was increase near-complete This sevenfold S2A). and a Fig. material axons axons supplementary naked many 1; myelinated with (Fig. bundles) of (Remak axons enveloped reduction of absence twofold a had fl their naut Fg GH.Cmae oltemt otos fl controls, littermate to Compared 1G,H). (Fig. of adults ultrastructure in The 1C,F). (Fig. neo fl +ltemts(02 ek)a weeks) (10-24 littermates /+ neo/ ora fCl cec 2 (19) 125 Science Cell of Journal LAMC1 2 neo abeitdfl (abbreviated / 2 fl neo/ evsi otatt fl to contrast in nerves abeitdfl (abbreviated + neo LAMC1 – iewr indistinguishable were mice /–) h cai evswsexamined was nerves sciatic the LAMC1 deaie ymicroscopy by examined nd fl b neo 2 neo -nerninteractions 1-integrin neo + itrae ni 3 until littermates /+) +adfl and /+ fsrn akn the lacking offspring fl neo +nre.TeBMs The nerves. /+ neo neo +mc extended mice /+ / / 2 2 neo neo neo evswere nerves ev roots nerve / neo 2 neo neo / / 2 selection 2 ieand mice / / 2 2 sciatic nerves mice mice ev ( nerve 1-ekod ie ntefl the In mice. (12-week-old) as frdcdepeso.Ti si epn ihpublished with keeping in is the This that reports expression. cassette reduced the neo of implicating of the cause S1A), of those Fig. presence approaching material the to levels (supplementary sufficient was state to alone wild-type expression allele floxed mRNA the from restore cassette neo the of I n Lm and (I) fmN a bevdfrmN sltdfrom isolated mRNA for type), observed reduction wild of was degree mRNA lesser to basis a of Since the relative expression. as laminin null-allele average reduced a of with paired (36% floxed-allele the mice implicating (+/+) wild-type h ylnhdmn nodns(ne,arw) ( addition, arrows). In (inset, root. Lm infoldings the many in had pronounced myelin most is the but patchy, is axons unmyelinated upeetr aeilFg 1,) hr a euto of 2A; reduction (Fig. a RT-PCR was There real-time S1A,B). laminin- Fig. quantitative material by supplementary measured were splmnaymtra i.S1B). Fig. material (supplementary ewe h w dnia lee o rsn nfl in present not alleles identical interaction an two an the suggesting from between result negligible, may fl almost expression mRNA was from of enhancement mice mRNA wild-type it in to disease, decrease relative the of surprisingly, from evidence phenotype Somewhat a no of have development for a that threshold the 67%) that suggests of (average mice sciatic and Lm A,B,D,E) of (sn, C,F) nerve (snr, sciatic root of nerve sections (B,C,E,F) cross and (A,D) nerve. Sciatic 1. Fig. daetnnmeiaigShancls(ros o eni fl in seen not (arrows) cells Schwann non-myelinating adjacent ta. 98 hno ta. 06.TemN ee o laminin for level mRNA The 2006). (Meyers al., expression et b gene Shannon neighboring 1998; reduced al., of et cause a be can on o ob ifrn o fl for different be to not found 1, LAMC1 c c 1fl 3, G neo .EdnuilBsaecniuu n fsmlrtikesi fl in thickness similar of and continuous are BMs Endoneurial ). a c and 2 / c RAioae rmfl from isolated mRNA 1 2 1fl RAeit ewe 6ad6%o idtype. wild of 67% and 36 between exists mRNA H ev eel ude fnkdaosadnab and nearby and axons naked of bundles reveals nerve (H) neo a / neo 2 nre uce,and muscle), (nerve, 4 J cwn cells. Schwann (J) ( A-F aste(nldn hto the of that (including cassette c ehln-lesandsm-hnlongitudinal semi-thin Methylene-blue-stained ) 1fl neo / neo 2 +(-)adLm and (A-C) /+ ev n ottedsrbto of distribution the root and nerve neo cis neo / +adfl and /+ 2 oteatv leea the as allele active the to a iecmae ota of that to compared mice kde n ug was lung) and (kidney 5 G-J lcrnmcorp of micrograph Electron ) c 1fl neo neo neo / / 2 LAMA5 2 / neo 2 DF adult (D-F) LAMC1 littermates Removal . +littermate /+ neo gene) /fl neo +/ neo /+ 2 Journal of Cell Science fl N rmfv ieo ahgntp) ( genotype). using each triplicate of in mice performed five experiments from of RNA deviation other standard and in and muscle detected average nerve, were in reductions controls Lesser wild-type tissues. to compared threefold about eutoso aii subunits laminin of BM-pattern reductions similar revealed nerve sciatic adult of Immunostaining and nerve tissues peripheral other in protein membrane Basement Lm revealed RT-PCR real-time quantitative expression. Laminin 2. Fig. pr) n olgnI ClV,btntitgi uuis(Itg subunits integrin not but a (ColIV), collagen-IV and (perl), Vadprea Fg B.Itgi subunits Integrin 2B). (Fig. perlecan and IV rncitoa fiinyo ohg eesof levels high to or adults comparable efficiency in despite those transcriptional laminin Lm tissues, of to lack non-neuromuscular reduced similar relative in The colon differences S4). reductions revealed in Fig. material E18.5, P5 appreciated (supplementary at and nerve reductions Hindlimb P1 S1D,E). no Fig. material with (supplementary Lm glomeruli of reductions kidney Slight material S1C). for (supplementary nerve peripheral Fig. noted in noted those were as not great dystroglycan, were as reductions or these however, (quadriceps); integrin BM muscle of hindlimb Reductions not 2007). al., but et McKee 2005; components, al., et (Li Li expression laminin 2002; upon al., dependent et is BM a of predicted formation is given components components. laminin-associated these these of in the reduction density The that lower concluded a possessed was BMs it endoneurial ultrastructure, without immunostaining in by changes structural bright recognizable BM less adult were the nerve Since in all. components at if little changed dystroglycan uui yteie nlataon Yrhnoe l,1997). al., et (Yurchenco amount the least by limited in is is synthesized possibility laminins subunit of latter secretion that The finding subunits. the by other suggested the to relative production dsrgya ( -dystroglycan neo / 2 dl cai ev eeldcessi aii uuis perlecan subunits, laminin in decreases reveal nerve sciatic adult c a RA ih edeete oahigher a to either due be might mRNA, 1 G oprdwt fl with compared DG) ( A oprsno aii RAby mRNA laminin of Comparison ) c 1, b neo 1, B +littermates. /+ c LAMC1 muoloecneiae of images Immunofluorescence ) c a eentdi ugand lung in noted were 1 1fl 2, a neo 4, / +/ 2 c 2 sih) collagen- (slight), 3 RAwsdecreased was mRNA ise posare (plots tissues a 6and b c ,Itg 1, subunit 1 b a 1and )or 6) iia nfl in similar AIt opr N ytei sonwt F one-ti,green). counter-stain, with NFL stained with and (shown EdU synthesis ( with DNA labeled compare were to (C,D) DAPI littermates 1 day post-natal n tnaddvaino he ar)a 1. G n 1() osignificant No (H). P1 and ( (G) detected. E18.5 (average at was pairs) determined difference three was of nerves deviation ( in standard F. nuclei and in (blue) axons seen DAPI-stained NFL-stained are (red) of state positive Groups mutant antibody. the NFL of and characteristic DAPI with stained were atr Jn c6adSx n eutoso rx0 h p75 the Krox20, of reductions transcription and the Sox2 of and Elevations Oct6 3C,D). cJun, (Fig. factors adult nerve in sciatic RT-PCR involved P5 quantitative cell-factors and by in Schwann determined plots were for with myelination levels 3A,B that in mRNA (Fig. proliferation birth The of peak 3G,I). time of the Fig. in at time and detected before the just not at occurs was even proliferation nerve, cell hypomorphic Schwann reduced 2005), Ng) lvtoswr dniidfrcJn c- n o2 h patterns The Sox2. stages. and both Oct-6 at c-Jun, similar for were identified were Elevations nerves (Nrg1). mutant in laminin- Reductions for graphs). identified in were digits small with indicated samples of J n 5()mc olwdb N xrcinadqatttv real-time quantitative and extraction RNA (fl by mRNA followed for mice RT-PCR adult (K) from P5 isolated and were segments (J) nerve sciatic Proximal factors. myelination hl hr sdmnse cwn elpoieaini the in proliferation cell Schwann cell Schwann diminished conditional is there While factor myelination expression and proliferation cell Schwann i.3 cwn elpoieainadmeiainfactors. myelination and proliferation ( cell Schwann 3. Fig. E A-D , F cai ev rm1-ekodfl 10-week-old from nerve Sciatic ) idibnrefo fl from nerve Hindlimb ) neo +adfl and /+ aii-eedn ylnto 4611 myelination Laminin-dependent neo neo / I / 2 2 h ubro uliprnrescinwas section nerve per nuclei of number The ) c LC) rx2,MZ 7 n neuregulin-1 and p75 MPZ, Krox-20, (LmC1), 1 ofl to dls ( adults. neo neo LAMC1 +adfl and /+ +rto fteidctdpoen (number proteins indicated the of ratio) /+ J , K neo taysaemN eesof levels mRNA Steady-state ) neo +()adfl and (E) /+ eekoku Y tal., et (Yu knockout gene / 2 mro E85 ,)and A,B) (E18.5; embryos G-I h rcino EdU- of fraction The ) neo / 2 F littermates (F) Journal of Cell Science splmnaymtra i.S) h aclma BMs fl sarcolemmal in revealed (atrophy) diameter diameter The muscle muscle ultrastructure the smaller S5). of significantly by Quantitation Fig. normal. appreciated appeared material was in increase fibrils (supplementary distinct and but collagen slight myotubes a the interstitial small at although fibrosis level, scattered endomysial microscopic obvious by of light absence populated the in were nuclei central they that in xrsino h Lm transgenic following the has nerve While Lm111 in of shown). nerve, myelination not expression restore peripheral data to of and found laminin 2002; been principal al., the et is McKee Smirnov Lm211 2009; al., 2007; et al., (McKee that et cells Schwann or BM isolated and on type interactions assembly binding wild self-assembly, characterized shadowing, been are rotary have by that that were and modifications laminins DRGs laminin-domain structural possess laminin-deficient recombinant the and the with analyze assembly, processes, treated concentration To BM these medium. to which laminin culture activities in the of addition and to the contributions 2009), laminin by initiated exogenous al., then (Pa of et are laminin Lm511 adeno-cre- myelination Yu and and the ensheathment 2008; with Lm411 of al., Lm211, expression treated et to prevent common mice to subunit isolated was DRGs virus knockout It with 1987). recombinase overcome conditional be al., can et to with from limitation Eldridge this induced contributions 1989; that is al., found laminin assembly et (Eldridge of BM ascorbate laminin when dissection endogenous particularly further myelination, of this limits for presence cells 1989; Schwann Bunge, approach The by myelination and of 1989). baseline Clark role and production 1987; al., a al., shown et et have (Ard Eldridge (DRG) myelination ganglia in root BMs dorsal rat of al., neurons et (Ido binding a integrin of impede LG downstream similarly 2007). laminin that with residues interactions and four integrin domains for located amino required charged are acid all glutamic nearly that eight residues of consists present acid laminins, tag, the FLAG of C-terminal to gain-of-function two The in for 2009). domains al., allow et laminin agrin (McKee analysis modified fuse and that domains addition, In nidogen proteins 2002). al., et linker Smirnov 2007; laminin-binding al., (McKee et McKee analysis 2009; loss-of-function al., for et allowing have 4) point and (Fig. or deletions domains mutations engineered structural through nidogen- inactivated different selectively to been and map activities polymerization, binding dystroglycan-binding, binding, ganglia conducted. laminins root was recombinant modified dorsal and wild-type cultured with treated laminin-deficient cultures nerve using expression, laminin the analysis absent underlying an and mechanisms reduced from understand resulting better phenotype to order In cultures ganglion laminins root recombinant dorsal with in myelination of Induction become gradually to observed was in mass reduced muscle Hindlimb dystrophy were and atrophy Muscular (MPZ) myelin-protein-zero nerve. mutant and in detected receptor, neuregulin 4612 niaigtelmnnpsesstencsaydmisfrproper for domains necessary the possesses laminin the indicating rvossuiso cwn el utrdwt sensory with cultured cells Schwann of studies Previous integrin- sulfatides), (e.g. glycolipid-binding sulfated Laminin ora fCl cec 2 (19) 125 Science Cell of Journal LAMC1 fl neo a / 2 uui nLm in subunit 1 ie h udieswr abnormal were quadriceps The mice. a -ul( 2-null dy3K neo ¨iva / 2 mice, ) ¨la mice. ¨inen c 1 ioe-idn ou,adn the adding locus, nidogen-binding cell-surface and shown. domains, are laminin LG adhesion binding, through nidogen binding ablate integrin and polymerization, reduce that modifications bearing huh oitrc ihL oan,floe yteFA-a sequence ( FLAG-tag binding. the integrin by with followed interferes (red) domains, that residue LG (yellow) acid with glutamic interact critical to a thought with (violet) ( sequence Lm111. C-terminal sulfate of heparan activities and binding binding (HS) (Nd) nidogen (polym.), polymerization integrin-binding, activities. sites, and attachment domains Laminin 4. Fig. eetdb muotiigwt nioyt Lm was to laminin antibody any if with little immunostaining very principal these laminin, by In between detected. added fibroblasts detected and of scattered on few absence axonal-like a the resting out only with extend cells and that processes, Schwann region with largely central processes the was in evaluation concentrated comparisons. The Lm211 with 2006). supported and al., Lm111 with et conducted (Gawlik function lta a prahdaoe35n Fg AEKL.In 5A-E,K,L). (Fig. nM 3.5 above approached the a in however, was rLm111; levels added with plateau low increased at and myelination. laminin occurred DNA of absence nuclei] undergoing DAPI-stained induce nuclei to switch into 5-ethynyl-2 synthesis of incorporated the to ratio (EdU) through segmented deoxyuridine at the medium extending by starting and [estimated DRGs Proliferation ascorbate-containing addition the viral of to IV medium of type with the time to to along the binding added laminins promote were to Various collagen) nM, 1987). (28 al., nidogen-1 induces recombinant et also increased presumably (Eldridge that of collagen laminin consequence IV peak type a stable is of ascorbate that induction secretion not of ascorbate (data revealed addition addition The ascorbate of shown). after Lm111 developed time myelination that the added and about S6A). occurred with Fig. proliferation material experiments (supplementary ascorbate Pilot of addition after h utrdDGepat oss fnuoa elbodies cell neuronal of consist explants DRG cultured The a sbnt rmtetm fvrsifcint i days six to infection virus of time the from -subunit) a Nd(1 salne rti htbnst m tthe at Lms to binds that protein linker a is (F1) LNNd a a B dsrgya ( -dystroglycan L oyeiaindomain. polymerization 1LN ceai iga fLmc1 of diagram Schematic ) ( A a fcl-ufc glycolipid cell-surface of Map ) C eobnn laminins Recombinant ) a G binding, DG) a (the 2 9 - Journal of Cell Science otne oices vrthe over p increase a to reached continued and levels low at Although increased rLm111. depende nM (upper 14 both proliferation and proliferation 0 and for with myelination stained treated panels) and (lower labeled myelination DRGs and panels) the of views magnification ( induced myelination nM; MBP/NFL+gfp; 28 of and EdU/D 14 of (ratio 7, proliferation 3.5, of (0, evaluation rLm111 of concentrations different the adeno- an with laminin-deficient rendered cwn elahso n nernbinding integrin and adhesion cell Schwann examined S6B). range Fig. material the supplementary over 5F-J,K,M; increasing area; rLm111 (Fig. with exogenous lengths/DRG increase of to segment concentrations found myelinated was total neurofilament-200) MBP/ NFL, by of ratio or segmented the NFL+gfp, by (measured myelination contrast, i.5 aii-eedn cwn elpoieainadmeiainin myelination and proliferation cultures. cell DRG Schwann Laminin-dependent 5. Fig. a bearing and rLm211 or adhesion required rLm111 was cell 6B). (Fig. concentration Lm Schwann rLm111 coat to supported higher compared a also however, rLm211 adhesion rLm111 spreading; support not all. nidogen-1. did 2006) at al., with et (rLm (Nishiuchi domains observed binding LG integrin three was and first the domains), adhesion lacking 6). LG (Fig. poor cell-adhesive the only cultures for contains collagen- observed were and (which DRG spreading rLm111 miniagrin and on adhesion from spread weaker Additional and examined IV. isolated to, were adhered cells cells components Schwann BM Schwann other and with with cells laminins Schwann to DRG-derived of respect attributes adhesion cell The h aeo L11 h LGtgcnerdwae idn to binding weaker conferred tag FLAG the in rLm111, that, and of tag case FLAG C-terminal the a possesses laminin that either when revealed rLm111 to rLm211 integrins soluble and of Binding counterparts. normal their c LGtgehbtdrdcdcl deincmae to compared adhesion cell reduced exhibited tag FLAG 1 LAMC1 F - J M tdy6 h orsodn lt o rlfrto ( proliferation for plots corresponding The 6. day at ) -fl r hw (average shown are ) neo /fl neo ulcnetainrange. concentration full Rs sltdfo 1. rgatfmlsand females pregnant E13.5 from isolated DRGs, a 7X2 aeub 8n,whe nM, 28 by lateau P;AE tdy0admeiain(ratio myelination and 0 day at A-E) API; r eobns viru recombinase cre nlmnnconcentra laminin on d b a usatal reduced substantially was 1 6 ..o - Rs.( DRGs). 3-5 of s.d. Da L13 eurdfor required 1LG1-3) esmyelination reas ,wr rae with treated were s, A-J in proliferation tion, olwdby followed ) K )Higher L )and triangles). a ointegrin to and idn fiiywr eetdfrFA-agdlmnn o integrins for laminins of FLAG-tagged reductions for tenfold detected to were Five- affinity (D,E). binding rLm111 and modified (C), correspondingly rLm211 to FLAG-tagged and wild-type to ( to integrin-ectodomain-dimers laminins. required FLAG-tagged were for adhesion concentrations similar coat achieve and Higher circles) triangles). (open (open rLm111F rLm211F FLAG-tagged corresponding and triangles) oe eaos,admnarn(A pnsurs.Dt r average are Data squares). open n (mA, rLm miniagrin diamonds), and collagen-IV (open hexagons), circles), rNd1 (open and (closed triangles), laminins rLm111 inverted with to open coated Adhesion (Col-IV, wells (A) plastic substrates. to BM adhesion other for evaluated and culture i.6 cwn elahso obsmn ebaecmoet and components membrane basement to binding. adhesion integrin cell Schwann 6. Fig. integrin togyt h aii oldci n neat ihcell bearing with rLm111 with treated interacts nearly were was DRGs Myelination when and absent myelination. and completely of coil degree dystroglycan slight a coiled sulfatides, generated laminin through sulfated- the surfaces rLm LG2 to an with strongly containing DRGs Incubation also myelination. of of prevented and domains activity, LG domains glucuronate-binding three LG proximal laminin the (rLm were of rLm111 Deletion DRGs domains. However, were LG when that to rLm211. poorly rLm211F bind and to with reduced found rLm111F degree, FLAG-tagged considerably with lesser rLm111 incubated was wild-type somewhat nM a myelination be 28 to to with found and, treatment was virus-induced following Myelination the in 7). extensive examined (Fig. was DRGs BM laminin-deficient a form and myelination miniagrin. binds that 5 7 b h blt fteercmiatlmnn oinduce to laminins recombinant these of ability The .()Ahso fclst L11(lsdcrls n L21(closed rLm211 and circles) (closed rLm111 to cells of Adhesion (B) 4. X oe netdtriangles), inverted (open 1X2 a 6 b .()Mnarn(A,cnann Gcl-deindmis bound domains, cell-adhesion LG containing (mA), Miniagrin (F) 1. a a 6 3 b b coe circles), (closed 1 .Furthermore, 1. Da ( aii-eedn ylnto 4613 myelination Laminin-dependent A , L13,esnilfritgi idn to binding integrin for essential 1LG1-3), B cwn el sltdfo Rswr xaddin expanded were DRGs from isolated cells Schwann ) Da b nern htnral idt laminin to bind normally that integrins 1 L13culdt iigi (binds miniagrin to coupled 1LG1-3 a 6 a a b 7 3 oe diamonds), (open 1 b b X oe squares), (open 1X1 a on ob h integrin the be to found was 1 C-F) a v idn fsoluble of Binding a b a 3 oe circles), (open 1 5 b b Da integrin) 1 (open 1 1LG1-3 6 a s.d., 7 b 1 Journal of Cell Science eut nadces npoieainwieasneof absence while to proliferation proliferation 7D). of in (Fig. induction levels (laminin-free) decrease modification laminin baseline integrin-reducing reduces a the polymerization in of rLm presence results and that and rLm211F revealed comparisons with Finally, collagen BMs, as assembled. rLm211F multi-component had IV of ECMs, that well laminin appears just type it as not and Thus cell 7C). (exogenous) (Fig. Schwann perlecan subunits derived laminin endogenously of accumulation to unable myelination (rLm111NS) laminin DRG nidogen. a that to with found bind slightly, was albeit it reduced, Finally, was 2009). al., et (McKee sulfatides, [ to interaction binds cell of locus potential secondary a lacks rLm with 2007). al., et (Harrison binding dystroglycan, heparin mediates that and domains sulfatide LG4-5 distal the of deletion a 4614 rti htbnst h ioe-idn ou n rvdsthe provides and locus rLm nidogen-binding the missing to critically by binds restored that that observation significantly the protein be by provided could was is role myelination alone evidence polymerization Furthermore, key polymerization myelination. a prevent of for to ablation own McKee its that on 2009; confirming sufficient al., 2007), et al., (McKee et polymerization with only rLm associated with lost critical observed myelinationwas the of reduction that comparable a presumed However, binding. sulfatide was rLm our the it in in and domains, adhesion activities 2005), cell LG al., Schwann of to et contribution absence (Li a detect assembly to heparan BM inability a not of but dependency sulfatide, earlier a sulfate that revealed Given cells 2007)]. Schwann al., with et studies McKee 2009; al., et McKee 1995; diino L11t h Rsldt increased to led DRGs the to rLm111 of Addition DRGs of treatment following absent nearly was Myelination Db L-E htlcsthe lacks that 1LN-LEa Da ora fCl cec 2 (19) 125 Science Cell of Journal L-4,almnnual oplmrz n that and polymerize to unable laminin a 1LN-L4b, Da a a L oant rLm to domain 1LN 1 NLbwr oyeiainadpossibly and polymerization were LN-L4b b 1/ Db a 2 L-E,woedltddmisare domains deleted whose 1LN-LEa, b ,adhprn(oont-yee al., et (Colognato-Pyke heparin and 1, b L ahrta the than rather 1LN Da Da NLbwt rLm111 with LN-L4b L-4 btntto not (but 1LN-L4b a Nd fusion a LNNd, a a L domain) 1LN L domain 1LN nohrsuis euto fslaiebnigatvt nL4and LG–integrin LG4 in of activity sulfatide-binding assembly of reduction BM 2006; reduction affect studies, since al., to other found in et been However, not Nishiuchi has 1993). dystroglycan 2007; or binding al., al., (LG2) et et Harrison glucuronate Sung 1995; sulphated al., and/or et (Hall (LG1-3) binding (LG4), LG1-3 integrin binding dystroglycan distal (LG4), of binding reduction the sulfatide to attributed cell-surface of be might deletion decreases in These resulted BM. contrast, domains, decreased LG1-3 the In of deletion rLm211F especially BM. and or domains, reduce rLm111F rLm111 with not of Treatment to did proliferation. function corresponds and of a nM peak 7 as the by increase reached was of to plateau coverage A found BMs concentration. of was extent The cells nM. Schwann the 28 for at laminins noted wild-type were of plasma two coverage discontinuities on BM BM coverage Near-complete by cell lengths. BM characterized variable added noted incomplete Schwann of was but concentration cells substantial Schwann lowest with nM), the (3.5 their At contact in rLm111 them. naked near in were or membranes but either cells surfaces. Schwann of their appearance, to on absence BMs adjacent the lacked were In cells Axons Schwann S6E-I). the Fig. laminin, material added supplementary microscopy 8; electron (Fig. by examined was laminins with treated DRGs ultrastructure DRG 02 ie l,20;Sioe l,20) Mwsrsoe with restored Lm was BM myelination. 2003). of restoration al., partial al., et a et Saito only (Feltri with 2002; deletions miniagrin al., LG1-3 et and Li LG4-5 2002; account for may reductions LG2 BM in for activity sulfated-glucuronyl-binding of loss eue Mcl oeae Mwsicesd(u o onormal to not (but increased when was levels) BM coverage. cell BM reduced Lm hw hta bec fL oan assafiueof failure a causes requires domains polymer the LN that and of an assembly BM absence and an polymerization that shown aiislcigsotamsget (Lm segments short-arm lacking Laminins a Db Db N a LN, L-E)with 1LN-LEa) L-E.Peiu nlsswt oiidrm1 has rLm111 modified with analysis Previous 1LN-LEa. b Nada and LN a Ndwsaddt Lm to added was LNNd aeie(oaddlmnn eesfralconcentrations. all for levels laminin) added above (no proliferation baseline loss prevented whereas completely proliferation polymerization reduced of tag FLAG the of Presence wild with compared plot) lower rlfrto nrsos orLm to response in proliferation circles wild- (closed with rLm211 compared plot) type upper squares, (closed rLm211F to (average proliferation ( subunits, collagen-IV. laminin and for perlecan immunostained and sectioned were the ( doma either LG of distal Deletion or nidogen. proximal bind to unable laminin with significant, statistically raigrLm by treating increased substantially was Myelination myelination. the either LN-containing of of segments deletion through and polymerization of laminins, ablation FLAG-tagged in C-terminal reductions with showing treated DRGs) DRGs of number indicated the for s.d. (green). NFL and ( (red) MBP for immunostained nidogen, and wit cultured DRGs deficient oiiain flaminins. of in modifications myelination DRG 7. Fig. C B lto ylnto rtoo B/F+f;average MBP/NFL+gfp; of (ratio myelination of Plot ) aii-eiin Rstetdwt 8n rLm111 nM 28 with treated DRGs Laminin-deficient ) c a Ndmi MKee l,20;McKee 2009; al., et (McKee domain LN L and 1LN Da NLbwith LN-L4b b L oyeiaindomains polymerization 1LN 6 a P 1or 5 .. Rscniin nresponse in DRGs/condition) 5 s.d., .)ls fmeiainwsseen was myelination of loss 0.1) D ,adcmaio fcell of comparison and ), ( 8n eobnn laminins recombinant nM 28 h n bae myelination. ablated ins Da A oprsno cwn cell Schwann of Comparison ) b a uui eliminated subunit 1 epnet functional to response opst mgso Lm- of images Composite ) Nd ata btnot (but partial A LNNd. tp L11(lsdcircles). (closed rLm111 -type Da L-4,btntto not but 1LN-L4b, NLb(lsdsquares, (closed LN-L4b Da 1LN-L4b, 6 Journal of Cell Science Lm Thus 2007). al., et xrsinrslsi M ihrdcdlvl fstructural of levels sorting axonal reduced cell Schwann a with and dense) BMs laminin- less (hence of in components reduction partial results a expression that reveals study The to similar Discussion distribution domains. a LG lacking with laminin type and wild naked laminin the of non-polymerizing fraction to two higher compared the considerably axons between a lay had examined rLm211F 1:1 in extremes. conditions and other treated segmented DRGs mostly All were of complexes. with rLm111 axons wild-type The nM treated bundles. 28 large cell with not non- Schwann in with often DRGs contact and and in (some surfaces) of naked LG4-5, all high axons nearly were and laminin The without low laminin. laminin, laminin-111 absent polymerizing rLm211F, for 1993) and rLm111, axonal Webster, bundling of degree of (see the degree gauge sorting to the cells to Schwann respect within segmentation with S6E-I) Fig. 1991). material al., et (Fox BM for endoneurial polymerization than functional critical a of less maintaining is bridging collagen affinity coverage. IV high type of of to reduction laminin mediation slight nidogen that only suggests with This BMs in (Lm resulted mutation binding point a bearing b L oanmsigi Lm in missing domain 1LN xnlesetmn a loeaie (supplementary examined also was ensheathment Axonal Da L-4 oeal oyeiain u al opoiethe provide to fails but polymerization, enable to 1LN-L4b a Ndpoie h missing the provides LNNd c N0S htaltsnidogen-1 ablates that 1N802S) Db L-E.Fnly laminin Finally, 1LN-LEa. a Ndmi to domain LN c 1-subunit ept eea euto flmnnsbnttranscription. subunit mild, laminin latter of the muscle muscle, reduction and and phenotypic general Nerve nerve that a in to despite unusual restricted Meijer, was were and state changes (Svaren hypomorphic noted can The that were 2008). In Oct6) hypomyelination proliferation. (cJun, to factors cell contribute transcription Schwann of of increases reduction addition, without but defect, essethg xrsino c6 Jn n o2adlow and Sox2 the and Furthermore, cJun, bundles. Oct6, inactive axon of be naked expression scattered may near high state and persistent what differentiation to indeterminate leaving adjacent of and cells sorting, coupling, radial Schwann defective the of face normal the breaking of unusual in preservation is proliferation a was cell It there Schwann 2007). hypomorph al., laminin the the et upon in (Benninger that dependent GTPases both Schwann small with of of and numbers activity axons individual sufficient wrap of latter to availability cells the insure proliferation, to cell peripheral needed Schwann selective by accompanied of normally cause a humans. in be myopathy and The could neuropathy either mouse. transcription in decrease dy2J gene regulatory the in reduction a transcriptional that resulting general to suggests a severe, from comparable resulting particularly defect Lm levels selective was the at nerve Lm particular amyelination as in subunits same in phenotype the with subunits, The joining of capable laminin is that other subunit of increases uigprpea ev eeomn,aoa otn is sorting axonal development, nerve peripheral During aiisbaigdmi modifications. domain bearing laminins concentration laminin ( as increased. BM increasing reveals rLm111 ratio; membrane (BM/plasma surfaces average cell on coverage BM xn eenkd(A) fe nsalbnls nteabsence the in all bundles, Nearly small (E). in rLm211 often nM (nAx), rLm111 28 naked nM and were 7 (D) axons (B), rLm111 rLm111 nM nM 28 with 3.5 (C), maintained (A), DRG laminin laminins. added indicated no the with treated were ultrastructure. DRG 8. Fig. atrss n lsammrn wiearwed) ( gaps arrowheads). (arrows), (white membrane BM plasma show and to (asterisks) concentrations. images higher magnified at are prominent Insets more and was laminins, wrapping myelinated recombinant myelin or with (eAx) treatment enveloped following were (mAx) Axons laminin. added of aii-eedn ylnto 4615 myelination Laminin-dependent 6 c ..fr81 mgs fe ramn fDG with DRGs of treatment after images) 8-12 for s.d. G -uui eiinylce compensatory lacked deficiency 1-subunit lto MP ai o Rstetdwt the with treated DRGs for ratio BM/PM of Plot ) ( A-E aii-eiin DRGs Laminin-deficient ) LAMC1 or F LAMB1 ltof Plot ) c c 1. 3 Journal of Cell Science eeduo otiuinfrthe for The contribution partially proliferation. a (especially to found cell upon was depend proliferation Schwann in increase achieving than for of laminin-induced important myelination to more concentration is corresponding vivo, efficient the concentration, in expression laminin on laminin high high which dependent and in cell was laminin comparison ensheathment Schwann axonal myelination on The proliferation, accumulation axonal BM cell and of DRGs. Schwann myelination extent surfaces, of the laminin-deficient examination that an revealed in to led a proliferation functions reduced required and are these possibility activities This for laminin-domain-specific myelination. with what for BM of sufficient not question was but there BMs might proliferation which components) in for state structural the intermediate (continuous of an all represent density for BM intensity reduced mouse the immunostaining that thought Yu was 2005; hypomorphic It al., 2005). et (Yang al., nerve et peripheral in states deficient subunit Mcmoet aal fpoiigShancl integrin- with cell domains occur Schwann LG1-3 laminin can to providing binding integrin several While of ligands. among binding only capable are components 2004; however, al., Laminins, BM et 2006). (Engler al., itself et scaffold Engler the as of well properties as structural and the composition depend ligand can from activation arising functional 2005). contributions that al., upon proposed et further (Li been function and has cell dystroglycan It in be integrin, changes induce cell to to to receptors other presented found are 2011). an recently ligands al., multiple et property to (Du turnover a and possibly activity rigidity, integrin and in BM involved receptor–ligands and laminins of reduced component to alteration part in BM latter due The one other indirect laminins. an of be activity may effect polymerization the upon depend with Oct6, the that either overexpressing from 2007). to differs al., et similar mice (Ryu was conditions both transgenic detected in present Oct6 hypomyelination in of The 2008). level reported Meijer, and expression cell (Svaren Schwann the high cells of laminin-deficient myelinating maturation the the to in in population deficit seen a as reflect may MPZ nerves and Krox20 of expression 4616 m1,adwal ihL41,and Lm411), with weakly and Lm111, olgn( collagen si gemn ihmeiaindfcetpeoyeo Lm of phenotype myelination-deficient with agreement the in of is absence the 2002). in al., endoneurium et (Feltri in consistent vivo is BM in and integrin 2002), of al., presence et (Li the vitro with in assembly signaling BM of of mediators not as and primarily the serve to integrins support that further hypothesis adds also on It myelination. to components contributor major strongly BM finding integrin The of direct 2007). that accumulation al., suggests et of (McKee cells efficiency Schwann isolated the without study, previous of a in loss seen as or ultrastructure, BM apparent to in without change poorly reduced bind substantially was that myelination laminin integrins, recombinant Employing cells Schwann laminins. are of to exposure upon endogenously, (Yurchenco, BM endoneurial the expressed well into recruited components, as Non-laminin ligands 2011). integrin-binding relevant provide a ( null uui ern eeino G- Gwi ta. 2010). al., et (Gawlik LG4-5 of deletion a bearing subunit 1 M aebe rpsdt c ssgaigpafrsi which in platforms signaling as act to proposed been have BMs hypomorph the of proliferation cell Schwann normal The h ylnto euto eutn rmtedlto fLG4-5 of deletion the from resulting reduction myelination The dy3K ora fCl cec 2 (19) 125 Science Cell of Journal a os olwn rngncepeso ftelaminin the of expression transgenic following mouse ) a 1 7 b b 1, and 1 a a 7 2 b b L11 m1,Lm511), Lm211, (Lm111, 1 ) elcn( perlecan 1), a 6 LAMC1 b )i h Gdmisadsubstantially and domains LG the in 1) b idn olmnnL oan sa is domains LG laminin to binding 1 ulo igeadcombined and single or null a 2 b )adarn( agrin and 1) b a -nernbnigsite 1-integrin-binding 3 b L51,tp IV type (Lm511), 1 a 6 b (Lm511, 1 a 3 b )can 1) a a 2- - copne hsmgtrfettelwrafnt fmnarnfor miniagrin that of myelination affinity lower in integrin the increase reflect partial might The this 2001). accompanied al., al., et et McKee Moll 1998; al., 2009; et (Gesemann sulfatides to firmly and attaches dystroglycan that the protein binding a by miniagrin, restored non-neural was to coverage laminin BM 2005). al., et Saito 1995; a Nsicie l,20) n/ralwraudneof abundance lower a and/or 2006)] to compared al., et (Nishiuchi 4 i o upr rlfrto bv otetetlvl.The levels. no-treatment above to proliferation failed support Lm wild-type not and non-polymerizing did nM levels) contrast, L4b 28 wild-type In to nM myelination. 3.5 compared support below one-half (slightly about laminin to Schwann laminin-deficient on surfaces BM cell reduced of laminins non-polymerizing Treatment with DRGs myelination. and proliferation hsdsrpi os rssfo ni-rm eeinwti the the within deletion of in-frame Lm an Lm from defect The arises mouse 1978). myelination dystrophic this Swenarchuk, the and of (Montgomery explain help severity may myelination for the role polymerization a of finding uui akn h Lm the al., lacking et Salmivirta a 2001; subunit al., of and et G2 Knock-in Ries its 1991; through through 2002). al., IV coil et collagen (Fox coiled to domains and laminin G3 domain the G3 to C-terminal binds its that with glycoprotein be to neuropathy. LN- likely of the is loss for binding, than heparin responsible rather and polymerization, sulfatide, of integrin, of loss dependent loss that selective time first a rLm the with (i.e. laminin myelination. activity a for polymerization that required finding be the of may Furthermore, ligands the that in and proteins decrease ligands a with laminin-binding LG a causes integrin-binding reduction (McKee associated of This primarily cells availability BM. been in the Schwann here, is has and, isolated 2007) in activity al., myelination et density the laminin in of of reduction Loss polymerization one. of structural 1995). al., role et Sunada 1999; The Yurchenco, and (Colognato Lm211 of n hti xrse yShancls(ale l,19;Hl tal., et Hall 1997; al., et (Hall that cells Lm Schwann to is by expressed binds is possibility that that to and This One epitope binding earlier laminin HNK1 2005). of (the in myelination. loss al., glucuronate a sulfated et from appreciated and arises Li assembly not BM 2002; of BM reduction al., was integrin et reduce of assembly (Li loss studies BM to predicted to found a contribution with was LG1-3, binding, laminin of Deletion ir oes eel htmeiainmr hnShancell of Schwann degree than the more upon myelination depends that proliferation reveals models, vitro of study myelination. of this nidogen-binding reduction critical in peak the to Analysis bearing Lm prior laminin 2002). with death al., treated neonatal DRGs et early (Willem and myelination embryonic in resulted n nernbnigtruhlmnnL oansubstantially domain proliferation. LG and myelination laminin to myelin through contribution sorting, binding polymerization axonal laminin integrin promote both and which to in proliferation fashion and integrated wrapping must an laminins in of act that binding demonstrated integrin-receptor also and It scaffold-forming BMs. endoneurial within concentration 7 aii oyeiainwsfudt otiuet both to contribute to found was polymerization Laminin ioe- sasrcuefrigrte hnreceptor-binding than rather structure-forming a is Nidogen-1 ncnlso,tesuy hog oprsno os n in and mouse of comparison through study, the conclusion, In b a c (. n Mdsoito osat respectively constants dissociation nM 1 and [(9.5 1 N0 uainwti oanLb eutdi slight a in resulted LEb3 domain within mutation 1N802 Ndmi,dsaiiigi n euigpolymerization reducing and it destabilizing domain, LN 2 a 3 b 2 MK,ti td)rltv oL11for Lm111 to relative study) this Kd, nM (21 1 a 6 b 1/ a 7 b nShancells. Schwann in 1 LAMC1 c Lb ioe-idn domain nidogen-binding 1LEb3 eecdn o laminin a for coding gene Db L-E)dmntae for demonstrates 1LN-LEa) c -aii expression/ 1-laminin a uui of subunit 2 dy2J Da a 1LG2) mouse a 1LN- a 6 3 b b c a 1/ 1 1 - Journal of Cell Science ‘l)isrin n ihartie ptemPGK upstream retained a with and insertions (‘fl’) knockout conditional of Generation mice modified Genetically Methods and Materials u,Ot/cp rx2,mei rti eo(P) 7-T,neuregulin-1, p75-NTR, (MPZ), zero protein myelin integrin subunits, Krox-20, laminin Oct6/Scip, quantify reaction to chain Jun, RNeasy out polymerase an carried transcriptase by was reverse provide Real-time (qRT-PCR) reagents (Qiagen). with Kit tissues Mini from Plus stabilized and isolated was RNA analysis PCR real-time Quantitative pregnant or pups injecting by measured 10 was with nerve i.p. mice in proliferation cell Schwann Proliferation liquid in frozen IN), Elkhart, (Tissue-Tek, OCT at stored in and embedded nitrogen, were Tissues microscopy and antibodies Tissues, w backgrounds. two rott(ec M15)at 1850) CM (Leica cryostat Yrhnoe l,19) Lm 1997), al., Lm et Lm antibodies: (Yurchenco these Millipore), of more dilution, or ice. one on with min 30 treated or RT at min 15 for paraformaldehyde yFTsqecsadlctdusra fteLx net.Hmzgu mice Homozygous inserts. LoxP the of upstream the with located mated were and PGK sequences the FRT delete to by order in Laboratories) (Jackson recombinase lobe w eeain no129SvEvTac. into generations two bred also lx-9 y-ojgt,adcutrtie ihDP.EUDP aiswere ratios EdU:DAPI analysis. DAPI. segmentation Click-iT by with with estimated counterstained reacted and 1 X-100, dye-conjugate, EdU/ Triton Alexa-594 0.1% of with with count cultures permeabilized synthesis, by paraformaldehyde, DNA incubated determined The cell Schwann was nuclei. DRG were synthesis measure detect To to DNA (b). nuclei DAPI undergoing incorporation DAPI-staining with kit cells EdU imaging counterstained of 594 2010). Fluor and al., fraction Alexa CA) EdU et Click-iT Carlsbad, (Zeng the with later (Invitrogen, sections hours frozen in three detected nerve was sciatic or harvest in maintained were (designated mice state These homozygous 2003). Strickland, a and (Chen previously described o akdanocset ntefoe ee(h e astermie ntenull the Primer tails. in from remained extracted cassette DNA 5 neo using (the PCR set gene by floxed performed the was Genotyping in allele). cassette neo a lacked now iewr hnmtdwith mated then were mice create to mice Sox2-cre female with 93] Lm 1993)]. fl GATTTTCAAAGAAGCAGAGTGTG-3 TAACC-3 WlimBukn ontt eia col,ndgn1rbi polyclonal, rabbit Lm nidogen-1 Medicine), School), of Medical School Downstate 10 Lm University Brunken, University), Sciences Washington (William Health Miner, Oregon Sasaki, (Jeffrey Takako by (provided 1:1000 eobndall t06k.Tefoe leelcignowsdtce ihprimers with detected was neo lacking (5 allele floxed P1-12c The kb. 0.6 at allele recombined GATTGG-3 GH,B hrign553) integrin- 555734), integrin- Pharmingen (Millipore/Upstate), BD 1:100 (GoH3, mAb, 0.5 IgM polyclonal, mouse rabbit collagen type-IV 1997), CAAGTGGTTCTT-3 n ylnbscpoen(B) 10 (MBP), protein Abcam), basic antibody, myelin chicken (NFL, and 1:1000 neurofilament-200, Millipore/Upstate), eecnutdacrigt ntttoa n ainlgieie ne protocols under guidelines IACUC. institutional national the and by institutional approved to according conducted were 9 nirtIGscnayatbde 110 oeua rbs.MPwas MBP Probes). Molecular (1:100, Fluor Alexa antibodies and IgG secondary Alexa anti-mouse with IgG 488 Fluor detected anti-rat Alexa were IgG, 1:1000 594 anti-rabbit antibodies antibody, goat monoclonal Bound 647 IgG Fluor MA1-90188). rat Scientific, anti-Thy1.2 with (Thermo detected were fibroblasts meddi aafn etoswr tie ihHmtxlnadEsnor 2011). al., Eosin et and Jersey). (Yang New previously Hematoxylin of described Institute with Cancer stained Service, Analytical were (Tissue Sections trichrome Masson’s paraffin. in embedded (Invitrogen/ SlowFade 2 Probes). with with Probes Molecular mounted stained (Molecular were were 488 slides Coverslips anti-chicken nuclei, diamidino-2-phenylindole). with of detection detected For NFL a11039). and 647 anti-rat detected neo olwn vrih lcig(%ga eu,05 S,PS ldswere slides PBS) BSA, 0.5% serum, goat (5% blocking overnight Following nietimnfursec n lcrnmcocp eepromdas performed were microscopy electron and and (NBF) immunofluorescence formalin Indirect neutral-buffered 10% in overnight fixed were Tissues m / /l(ie l,20) elcnrbi oylnl 2 polyclonal, rabbit perlecan 2002), al., et (Li g/ml 2 9 -CCTGGCGATCCCTGAACATGTCC-3 fsrn.N ifrnei ev rmsl hntp a bevdfrthe for observed was phenotype muscle or nerve in difference No offspring. 9 9 -CTCAGAGCTGGCTTCTCCATG-3 a 9 a sdt mlf 0 p rdc fSx r.Pie e 5 set Primer cre. Sox2 of product bps 300 a amplify to used was L15rbi oylnl 10 polyclonal, rabbit 2LG1-5 a sdt iulz a visualize to used was m LAMC1 /rmo 0m 5-ethynyl-2 mM 20 of l/gram LAMC1 9 iliga40b idtp rdc.Aia experiments Animal product. wild-type bp 400 a yielding ) 2 80 fl b neo +/ L-E abtplcoa ‘niE’ 1-2 [‘anti-E4’, polyclonal rabbit 1LN-LEa ˚ m LAMC1 .Tsu lcswr etoe (5 sectioned were blocks Tissue C. 2 d o r,wse,fxdi 3.7% in fixed washed, hrs, 3 for EdU M 2 /fl a iet generate to mice 20 neo L45plcoa,5 polyclonal, 1LG4-5 LAMC1 ˚ nocagdgassie n ie n3.5% in fixed and slides glass charged onto C iewr lobe ihmc xrsigFLP expressing mice with bred also were mice LAMC1 LAMC1 fl neo m /l(ilpr A36.DRG-derived MAB386). (Millipore g/ml /fl 9 fl LAMC1 n 5 and neo neo +/ ieb lnigo xn2with exon-2 of flanking by mice 2 m b /fl LAMC1 /l(hn ta. 97,Lm 1997), al., et (Cheng g/ml iet produce to mice a A,10 mAb, rat 1 mice. 9 m neo LAMC1 9 9 9 /l(Millipore), g/ml doyrdn EU olwdby followed (EdU) -deoxyuridine n 5 and n 16(5 P1-6 and ) -CCTACATTTTGAATGCAAG- naC7l6bcgon and background C57Bl/6 a in ) c lxdall t16k n a and kb 1.6 at allele floxed neo -uui A mue 1:400 (mouse, mAb 1-subunit LAMC1 fl 9 eeto astehsbeen has cassette selection neo -CTCTAGAGCCTCTGC- m a l+adfl/ and fl/+ /l(ucec tal., et (Yurchenco g/ml os A,5 mAb, mouse 6 /fl m neo m +/ /l(ade tal., et (Handler g/ml /lo AI(4 DAPI of g/ml 2 neo m 9 LAMC1 ae eemated were males Sox2-cre-negative -CATTTCCCCA- /l(MAB1997; g/ml m 2 b hc)wt a with thick) m asteflanked cassette a ,prea,c- perlecan, 1, -dystroglycan, fsrn that offspring c fl ,1:5000 3, neo +and /+ m m P-lox g/ml g/ml 9 a a -6- 5, 4, 9 - rb n G2b sn nAI70 TSqec eeto ytmas System Detection Sequence HT 7900 ABI 2011). an al., et using (Yang by previously described FGF2 and Erbb2 -0dy.Shanclswr asgdi cwn elmdu tadniyof density a at medium cell Schwann for in medium passaged growth were in 1.5 cells maintained and Schwann dish days. collagen-coated 7-10 single a in placed were osrc eurdoelpigPRuiiigpie ar PF n PR (5 ‘P2R’ and ‘P1F’ pairs deletion primer LG1-3 The utilizing fragment. kb PCR 9.4 overlapping a leaving required fragment construct kb 4.8 a removed plasmid 1984). Furthmayr, and (EHS) (Yurchenco Engelbreth-Holm-Swarm previously the described from purified as was tumor (Col-IV) collagen IV Type glycoproteins other and Recombinant vrapn mgs(4 images Overlapping analysis Image 2 with later days The medium. 20 and 3 ml acid 0.3 with treated of acetic addition along M by were 0.1 followed vapors) in adhere DRGs to collagen hydroxide allowed tail and ammonium rat medium/well, well mg/ml with culture 2 tissue with collagen-treated neutralized each Pa treated into of dishes, placed from were method (24-well DRGs dissection the two to by on One based 2008). isolated E13.5 were at (DRGs) embryos ganglia cultures root cell Schwann Dorsal and ganglia root Dorsal el sdt vlaecl deinwr on ocnan0.7 contain to found were The adhesion cells. Schwann cell fusiform (average evaluate the to unlike The used flat staining. and cells DAPI broad and were antibody cells Thy1.2 antibody-stained by determined were levels contamination iae note94k rget ognrt el xrsigL21wtota without Lm211 expressing cells generate Lm To stable fragment. tag, with kb digested epitope was 9.4 FLAG product PCR the (5 kb into P3R 3.6 The ligated and LG3. with of P1F downstream digested site using XhoI P1R, product and PCR P1F TCAACTCTGCATGGGCTCTTCTGCCAG-3 single primers a with with together sewn were Xho products kb 1.2 3 CTGCTGATCAGCCGGGCCCGGAAACACTGCACAGAGAACACGGGGAACTC- TGTGCAGTGTTTCCGGGCCCGGCTGATCAGCAG-3 described as GAAAGGTGCTGTGCAGGCTATCACG-3 purified and mutants deletion cells generate To 2007). HEK293 al., Lm et in the McKee of 2009; al., prepared et (McKee were previously (mA) miniagrin (rLm LN-LEa a domains with arm short (rLm subunit L4b through containing LN and 1-3 domains (rLm LG FLAG of deletion (rLm a with FLAG rLm111 (rLm111F), tag FLAG akrud emne mgswr hnue odtrievle o h u of sum the be for to minimizing values determine while DRGs to respectively used of then forms were a axonal group images identify or to Segmented the set background. myelinated were within of axons and number fluor myelin of maximum by for each non-specific parameters analysis subtract segmentation was for The to segmentation analyzed. first level established by baseline NFL-stained was The common (green) to A fluorescence (1) MBP IPLab. cells in with methods. Schwann images red photographed myelination several stained gfp-fluorescing DRG axons by and of myelinated axons images degree of The ratio these the image. determining from composite a estimated create was to joined and IPLab a hne vr asfrattlo as Rswr hnfxdfor fixed then were ice-cold DRGs with at days. min overnight 6 6 X-100 Triton for of 0.1% treated containing total buffer 4 (RT), medium blocking a paraformaldehyde by myelination for followed 3 3.5% methanol, Medium After with days with proteins. virus. 3 minutes replaced recombinant 15 as every different was time changed including medium and same was or acid, initial the with ascorbic at the containing nM), added (28 days, were nidogen-1 additional to laminins Recombinant and recombinant titer recombinase. viral without of optimal density-gradient determine expression CsCl to by used confirm purified was and al., fluorescence cells et GFP HEK293 (Grewal centrifugation]. in College generated Baylor virus Tan, with Tse-Hua 2001) by provided kindly [DNA adenovirus ihpi-ua Lm pCis-human with oa ocnrtos(ce ta. 07 ucec n hn,1993). Cheng, calculate and to Yurchenco masses 2007; molecular al., EHS- peptide et against following (McKee conditions) the concentrations (reducing molar using SDS-PAGE and by standards separated Lm111 Laminin were aliquots 2002). Coomassie-Blue-stained bands al., of whose et intensity (Smirnov from determined previously were described concentrations as a prepared was bearing (rLm211F) Laminin-211 conditions. 2002). al., et Smirnov 2007; al., et 9 ˚ .DG eete tie ihantibodies. with stained then were DRGs C. o slto fShanclsfrahso sas utpewl-yeDRGs wild-type multiple assays, adhesion for cells Schwann of isolation For eobnn lcpoen:rm1,rm1 ern a bearing rLm111 rLm111, glycoproteins: Recombinant rti a uiidwt Aafnt e SgaE7)a e h manufacture the per as E677) (Sigma gel affinity HA with purified was Protein 6 n 5 and n iae ote94k rget h G- eeinwsgenerated was deletion LG4-5 The fragment. kb 9.4 the to ligated and I 10 6 10m ihadue tpsae56frahso sas Fibroblast assays. adhesion for 5-6 passage at used and dish mm /100 c 6 9 N0Smtto ihu LG ioe- rd)adnon-neural and (rNd1) nidogen-1 FLAG, without mutation 1N802S a -GCTGATCAGCGGGTTTAAACGGGC-3 hi o oan G- n G-,an LG4-5, and LG1-3 domains for chain 1 ..o iemcocp ils oa f16 cells). 1762 of total fields, microscope five of s.d. Da Da L45,rm1 ihdlto of deletion with rLm111 1LG4-5), L13,rm1 ihadlto fL oan - without 4-5 domains LG of deletion a with rLm111 1LG1-3), aii-eedn ylnto 4617 myelination Laminin-dependent a N n cN31pr sdsrbdpeiul (McKee previously described as pcDNA3.1-puro and DNA 2 Da 6 NLb ihu LG L11wt eeinof deletion with rLm111 FLAG, without LN-L4b) betv)o muotie Rswr eoddin recorded were DRGs immunostained of objective) c 1/Lm b -xrsigHK9 el eetransfected were cells HEK293 1-expressing c -uui -emnlFA ptp tag epitope FLAG C-terminal 1-subunit Db 6 9 ¨iva L-E)wtotFA,rLm111 FLAG, without 1LN-LEa) n 5 and 9 10 n nlds2so oosadan and codons stop 2 includes and ) ¨la 7 F fcre-recombinase-GFP of PFU ie ta.(Pa al. et ¨inen 9 a 9 .Tegnrtd18k and kb 1.8 generated The ). -GAGTTCCCCGTGTTCTC- 9 domains arm short 1-subunit -GATGCGGCTCGAGTTA- Xho 9 n PF n PR (5 ‘P1R’ and ‘P2F’ and ) ieto h mouse the of digest I c -uutC-terminal 1-subunt 6 LAMC1 ¨iva .%fibroblasts 0.3% m ¨la fgrowth of l ie tal., et ¨inen fl Xho neo and I /fl b neo a 1- 9 9 1 - - Journal of Cell Science hn .L n tikad S. Strickland, and L. F. Z. C. Chen, Eldridge, and B. M. Bunge, L., P., Z. R. Chen, Bunge, G., Figlia, D., Zambroni, M., Chrostek- Ghidinelli, L., X., Bartesaghi, Wu, C., S., Berti, Krause, A., J. Pereira, T., Thurnherr, Y., Benninger, B. M. Bunge, and P. R. Bunge, D., M. Ard, References at http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.107995/-/DC1 number online available [grant material Supplementary months. 12 Association after release Dystrophy for PMC in Muscular Deposited Z.L.C.]. to the to MDA4066 NS038472 [grant and P.D.Y., Health to of S.S.]; Institutes R01-NS38469 National and the R37-DK36425 by numbers supported was study This Funding assays. integrin-binding and Medical design Johnson construct Wood for (Robert and Smirnov School) discussions Sergei useful and and Harrison pathology help David muscle for and University) nerve Sciences examining Health in (Oregon Patton Bruce thank We Acknowledgements in 4 proteins at BM overnight with 9.6) coated (pH were bicarbonate 3631) sodium (no. M dishes 0.15 polystyrene 96-well assays Costar integrin-binding along and each adhesion Cell of lengths BMs. contour containing tracing surfaces after cell Schwann determined multiple was from (v.4.0.15, calculated membrane were iVision areas, plasma axonal or of (2300-3000 distribution axonal Windows and multiple of areas ratio in myelin The and Excel. Scanalytics) axonal in and performed (v.3.7, calculations with IPLab Technologies) BioVision (blue). either nuclei in DAPI-stained total interest to (red) nuclei stained EdU of myelinated ratio of ends distribution whose The segments distinguished. (3) MBP-stained clearly sampling evaluated. be by could condition determined deviation was each by standard lengths this for delineated and segment average DRG for DRGs an the application as the of expressed area IPLab for and the structures the by stained divided with NFL/gfp were the pixels This and lengths summed linear structures DRG. The (MBP-stained) of a purpose. myelinated within accumulation linear contained the the to forms direct recording tracing used by myelinated by were was of accomplished method condition second lengths was per The the DRGs (2) of deviation. more standard measurement or and three average of an calculate average An intensities. pixel 4618 oul nern tdfeetcnetain o r tR nTi-ufrdsaline Tris-buffered the in RT with at subunit incubated hrs and of 2 hr), for (1 bonding concentrations Tween-20 different disulfide 0.1% at (20 integrins containing laminins for soluble BSA with 3% cysteines coated with were containing blocked wells integrins and Plastic tags of fragments. integrins epitope domains brief, In 6His extracellular 2006). al., et recombinant (Nishiuchi a previously with described as determined basically was into dishes a 1:10 in nm) at (492 added absorption was by Fluor. cells measured (Clontech) Spectra were Schwann WST-1 Tecan cells PBS. Adherent and medium. in washes cell BSA PBS Schwann heat-inactivated three 0.3% with with removed RT at cells/100 (30,000 hr 1 for blocked ihopeyeeimn ihasrac esrda 9 nm. 492 at measured manganese absorbance followed with mM dilution), o-phenylenediamine 1 (1 1:1000 with streptavidin containing coil, HRP-conjugated coiled 7.4) biotinylated with by (ACID/BASE pH incubated antibody were NaCl, wells anti-Velcro the mM rabbit washing, 90 After Tween-20. Tris-HCl, 0.1% sulfate, mM 50 (TBS: 7 lcrnmcorp esrmnswr efre ytaigsrcue of structures tracing by the performed determining were by measurements DRGs in micrograph manner Electron similar a in estimated was Proliferation nernbnigt eobnn aiisadmnarnimblzdi 96-well in immobilized miniagrin and laminins recombinant to binding Integrin b ifrnito,ao ylnto,adrgnrto nteprpea nerve. peripheral the in regeneration and Biol. myelination, axon differentiation, cells. Schwann by 305-328. production lamina basal and ensheathment L. M. cell 4037. Feltri, Schwann and and of L. dystroglycan regulation Wrabetz, the A., al. in Quattrini, et rac1 D. and development. Meijer, system cdc42 J., nervous for R. peripheral during Franklin, roles growth. biology A., distinct K. neurite and Nave, of Essential D., Herzog, promoters A., as Grashoff, matrix extracellular cell Neurocytol. Schwann J. and surface 1, a 163 3 b and 1 889-899. , ora fCl cec 2 (19) 125 Science Cell of Journal 16 a m v 539-555. , /el eealwdt deefr8 i.Ubudclswere cells Unbound min. 80 for adhere to allowed were l/well) b b 6 eefsdt ACID/BASE to fused were 1 nern nrda otn faxons. of sorting radial in integrins 1 anfcto)cossciniae.Tertoo BM/ of ratio The images. cross-section magnification) 20) aii am1i rtclfrShancell Schwann for critical is gamma1 Laminin (2003). m /l.Bnigwsdtce yincubating by detected was Binding g/ml). 18) oprsno h cwn cell Schwann the of Comparison (1987). 21) o-eudn ucinof function Non-redundant (2011). 18) ikg ewe axonal between Linkage (1986). a hlclppie ihFLAG/ with peptides -helical ˚ .Pae eewse and washed were Plates C. .Cl Biol. Cell J. m Development /l - r)i TBS, in hrs) 2-3 g/ml, nu e.Neurosci. Rev. Annu. 177 1051-1061. , 138 4025- , (2007). .Cell J. a 6 b 1, 9 , a . ag . og .adLe,J A. J. Loeb, and F. Song, J., Wang, Yurchenco, Z., and Ma, S. Lee, R., Patel, D., Harrison, K., K. McKee, P., Liquari, S., Li, ce,K . arsn . aiz,S n ucec,P D. P. Yurchenco, and S. Capizzi, D., Harrison, K., K. McKee, and D. Edgar, N., Smyth, R., Fassler, S., Carbonetto, D., Sekiguchi, Harrison, and S., S. Li, Futaki, S., Li, S., Ito, R., Kobayashi, and D. A., P. Nakamura, Yurchenco, H., M., Ido, J. Ervasti, C., A. Combs, A., S. Hussain, D., Harrison, nlr .J,Sn . wee,H .adDshr .E. D. Discher, and L. H. Sweeney, S., Sen, J., A. Engler, ade,M,Yrhno .D n oz,R V. R. Iozzo, and D. P. Yurchenco, M., Handler, M. Durbeej, and H. Elamaa, V., Carmignac, M., Akerlund, I., K. Gawlik, eti .L,GasPra . rvtl,S . oai . ilaac,B,Cassetti, B., Migliavacca, A., Nodari, C., S. Previtali, D., Porta, Graus L., M. Feltri, Discher, and M. Griffin, A., Hategan, C., Newman, L., Bacakova, A., Engler, P. R. Bunge, and B. M. Bunge, F., C. Eldridge, al . etmn,R,Tml . aga,L,Shiz .adSchachner, and B. Schmitz, L., Vaughan, R., Timpl, R., Deutzmann, H., Hall, E. M. Schachner, J. and Hewitt, T. and Vorherr, H., E. Hall, R. Bittner, J., P. Holzfeind, K., P. Grewal, A. M. Ruegg, and B. Schumacher, A., Brancaccio, M., Gesemann, Peterse Y., J. Li, I., K. Gawlik, lrde .F,Bne .B,Bne .P n od .M. P. Wood, and P. R. Bunge, B., M. Bunge, F., C. Eldridge, o,J . ae,U,Nsh,R,Amily . enad,D,Weean H., Wiedemann, D., Reinhardt, M., Aumailley, R., Nischt, U., Mayer, W., J. Fox, ees .N,Lwnok,M n atn .R. G. Martin, and M. Lewandoski, N., E. Meyers, u . hn . in,X,Zag . u . e . hn . eg .Q,Chien, Q., X. Feng, Q., Zhan, L., He, J., Xu, G., Zhang, X., Liang, X., Chen, J., Du, and S. Y. Cheng, S., Carbonetto, Y., Yamada, J., J. O’Rear, H., Colognato-Pyke, D. P. Yurchenco, and and H. P. B. Colognato, M. M. Bunge, Marinkovich, and E., B. R. M. Clark, Burgeson, F., M. Champliaud, S., Y. Cheng, ce,K . aiz,S n ucec,P D. P. Yurchenco, and S. Capizzi, K., K. McKee, nbe eetrsgaigi cwn el n fibroblasts. and cells Schwann 189. in signaling receptor enables D. P. 1279-1290. ewe ergln1adbandrvdnuorpi atrrqie o early for required factor neurotrophic differentiation. and brain-derived survival cell and Schwann neuregulin-1 between differentiation. cell stem embryonic in receptors its and laminin D. P. Yurchenco, laminins. by binding integrin in chains gamma Chem. laminin the of termini carboxyl K. alpha1LG4-5. E. Hohenester, elcndrn uieembryogenesis. murine during perlecan 242. 2690-2700. 20) odtoa irpino ea1itgi nShanclsimpedes cells Schwann in al. integrin et 1 A. Quattrini, beta A., of Messing, disruption F., L. Conditional Reichardt, (2002). A., Littlewood-Evans, A., specification. lineage cell stem directs J. Biophys. D. lamina. basal by formation myelin of Control II. 9 vitro: in cells Schwann eai-eitdadslaiemdae eladhesion. cell sulfatide-mediated and heparin-mediated carbohydrate HNK-1 M. in involved is that adhesion. domain cell G2 and laminin binding the of sequence peptide mouse. myodystrophy the in alpha-dystroglycan of glycosylation altered and glycosyltransferase 600-605. rescue mediated chain deficiency. alpha1 chain laminin alpha2 in laminin domains murine globular of laminin for roles Distinct neuropathy. peripheral deficient chain alpha2 laminin improves fao-eae cwn el nvto .Acri cdrgltsbsllamina basal regulates acid Ascorbic I. vitro. in formation. myelin cells and assembly Schwann axon-related of ihafnt idn rti fdsrgya nnnmsl tissue. non-muscle in dystroglycan of protein binding high-affinity type collagen to al. laminin et of binding J. mediates Engel, and domains T., IV. globular Krieg, three of R., consists Timpl, K., Mann, ehns fidcino tmcl ifrnito yEMelasticity. ECM by differentiation cell USA stem Sci. of Acad. induction of C. mechanism Yang, and S. laminin-1. of arm short alpha-chain the Chem. within sites integrin-recognition 1 beta polymers. D. form P. Yurchenco, to ability its in defective is 1327-1330. mice dy(2J) axons. dystrophic ensheathe they when only lamina basal appearing 31525-31532. D. P. Yurchenco, neatoswt axons. with interactions eisgnrtdb r-adFpmdae recombination. Flp-mediated and Cre- by generated series membrane basement to proteins laminin-binding assembly. synthetic of contributions adhesive assembly. membrane basement in 21437-21447. domains globular terminal 625-638. , 20) h eurmn fteguai cdrsdea h hr oiinfo the from position third the at residue acid glutamic the of requirement The (2007). 19) N- abhdaemdae elahso olmnn1i ifrn from different is laminin-1 to adhesion cell carbohydrate-mediated HNK-1 (1997). 20) usrt opinevru iaddniyi elo e responses. gel on cell in density ligand versus compliance Substrate (2004). MOJ. EMBO 20) aii-uftd idn ntae aeetmmrn sebyand assembly membrane basement initiates binding Laminin-sulfatide (2005). 282 270 a.Genet. Nat. .Bo.Chem. Biol. J. 11144-11154. , 9398-9406. , 86 10 617-628. , .Bo.Chem. Biol. J. 108 20) rsa tutr n elsraeacoaestso laminin of sites anchorage surface cell and structure Crystal (2007). 3137-3146. , 19) apn fntokfrig eai-idn,adapa1 alpha and heparin-binding, network-forming, of Mapping (1995). 21) nernatvto n nenlzto nsf C sa as ECM soft on internalization and activation Integrin (2011). 28 19) efasml flmnnisoforms. laminin of Self-assembly (1997). 20) arxasml,rglto,adsria ucin of functions survival and regulation, assembly, Matrix (2002). 9466-9471. , 151-154. , .Cl Biol. Cell J. 284 Glycobiology n .adDrej M. Durbeej, and A. ´n, 8984-8994. , 282 .Cl Biol. Cell J. 18) utrdShanclsasml normal- assemble cells Schwann Cultured (1989). 11573-11581. , 156 Cell 19) h aii lh2epesdby expressed alpha2 laminin The (1999). e.Dyn. Dev. 19) hrceiaino 1aioacid amino 21 a of Characterization (1995). 5 199-209. , 21) rtclpro faola signaling axoglial of period Critical (2011). 435-441. , .Neurosci. J. 126 LSONE PLoS 105 18) ifrnito faxon-related of Differentiation (1989). 19) eeomna xrsinof expression Developmental (1997). 677-689. , 1023-1034. , 210 19) nFf uatallelic mutant Fgf8 An (1998). 19) eobnn nidogen Recombinant (1991). 20) cfodfrigand Scaffold-forming (2009). 20) aii lh1chain alpha1 Laminin (2006). 130-145. , 31 5 u.J Biochem. J. Eur. e11549. , e.Biol. Dev. 9630-9640. , a.Genet. Nat. 20) arxelasticity Matrix (2006). 20) oeo laminin of Role (2007). .Cl Biol. Cell J. 18) Differentiation (1987). u.Ml Genet. Mol. Hum. .Bo.Chem. Biol. J. .Bo.Chem. Biol. J. .Bo.Chem. Biol. J. .Cl Biol. Cell J. 19) gi sa is Agrin (1998). 133 20) Mutant (2001). ur Biol. Curr. 18 393-404. , .Neurosci. J. rc Natl. Proc. 136-141. , 246 169 (2010). .Biol. J. .Biol. J. 233- , 179- , 157 273 272 282 15 9 , , , , , , Journal of Cell Science hno,M . atn .L,Hre,S .adMnr .H. J. Miner, and J. S. Harvey, L., B. Patton, B., M. Shannon, P. Ekblom, and R. Timpl, T., Sasaki, M., H. Olsson, F., Asou, J. Talts, and K., Y. Salmivirta, Toyama, S., Takayama, Y., Nakao, E., H., S. Saito, Ross-Barta, A., Messing, D., M. Henry, R., Barresi, A., S. Moore, F., Saito, y,E . ag .Y,L,N,Blh .H,Gsi,J . cmd,R .and E. R. Schmidt, A., J. Gustin, H., R. Baloh, N., Le, Y., J. Wang, J., E. Ryu, is . Go A., Ries, Gonc R., Baumann, Y., Benninger, A., J. Pereira, oai . rvtl,S . ai . ch,S,Cut .A,Clmel,C., Colombelli, A., F. Court, Pa S., Occhi, G., Dati, C., S. Previtali, A., Nodari, mt,N,Vtnee,H . ury . ee,M,Fi,C,Puso,M and M. Paulsson, C., Frie, M., Meyer, P., Murray, S., H. Vatansever, N., Smyth, ihuh,R,Tkg,J,Hysi . d,H,Yg,Y,Sne,N,Tui T., Tsuji, N., Sanzen, Y., Yagi, H., Ido, M., Hayashi, J., Takagi, R., Nishiuchi, L. Swenarchuk, and A. Montgomery, Lochmu G., Bezakova, S., Lin, P., Barzaghi, J., Moll, oai . aboi . utrn,A,Cut .A,DUs,A,Rcha A., Recchia, A., D’Urso, A., F. Court, A., Quattrini, D., Zambroni, A., Nodari, mro,S . cero,E . i . rat,J . rgvsn .and K. Tryggvason, M., J. Ervasti, S., Li, L., E. McDearmon, P., S. Smirnov, ¨iva uaini h os aii lh5gn assplcsi inydisease. kidney polycystic causes gene alpha5 laminin mouse the in mutation sodium and structure, nodal myelination, nerve al. et peripheral L. stabilization. D. in Sherman, channel A., dystroglycan K. of Sluka, A., role R. Williamson, D., R. Cohn, xrsini mroi n dl ise ugs opeetr ucin fthe of its functions and complementary cells suggest and tissues components adult nidogens. membrane and two basement embryonic to in nidogen-2 expression mouse of Binding Schwann nerve femoral on NCAM mice. and in epitope cells carbohydrate HNK-1 an of expression loss. axonal and hypomyelination J. Milbrandt, oan fmuendgn1adterbnigt aeetmmrn rtisand proteins membrane basement to binding their antibodies. and monoclonal nidogen-1 mouse of domains nernlne iaei eurdfrrda otn faosadShancell Schwann and axons of sorting system. radial nervous for peripheral Fa the required D., in remyelination is Meijer, kinase N., Integrin-linked Tricaud, T., Thurnherr, cocultures. M. cell A. Schwann Heape, and S. Peltonen, sheath. myelin the stabilize al. et to P. 6714-6719. cooperate K. dystroglycan Campbell, U., and Carro, integrin Del G., Dina, D., Zambroni, eut nebyncltaiydet alr feddr differentiation. endoderm of failure to due 144 lethality embryonic in results D. Edgar, a1i cwn el ognrt aillmla uigaoa otn and sorting axonal during lamellae radial generate to cells L. M. Schwann myelination. Feltri, in and L. Rac1 Wrabetz, L., V. Tybulewicz, using interactions laminin-integrin of integrins. alpha6beta4 Biol. survey and alpha7beta1 alpha6beta1, comprehensive alpha3beta1, recombinant a K. integrins: Sekiguchi, binding and M. Yamada, mice. dystrophic and normal in numbers dystrophy. muscular congenital for model A. mouse M. Ruegg, and U. aii- functions. laminin-2 D. P. Yurchenco, Nephrol. Soc. ¨la 151-160. , ie,S,Nsie,M,Hnae,H,Lhi . ags .M,Ploe,J., Peltonen, M., S. Kangas, O., Lahti, H., Honkanen, M., Nissinen, S., ¨inen, 25 189-197. , hig . o,J . ip,R n aai T. Sasaki, and R. Timpl, W., J. Fox, W., ¨hring, 19) bec fbsmn ebae fe agtn h AC gene LAMC1 the targeting after membranes basement of Absence (1999). .Cl Biol. Cell J. ersi Res. Neurosci. 17 x.Cl Res. Cell Exp. 1913-1922. , 20) iepeso fPuf eut nprpea nerve peripheral in results Pou3f1 of Misexpression (2007). 20) otiuin fteL oue n ui rcsigto processing furin and modules LG the of Contributions (2002). .Bo.Chem. Biol. J. Neuron 20) narnmngn ece ytohcsmtm na in symptoms dystrophic rescues minigene agrin An (2001). u.J Biochem. J. Eur. o.Cl.Neurosci. Cell. Mol. 177 53 1063-1075. , 279 38 314-322. , 747-758. , 20) ylnto nmuedra otganglion/ root dorsal mouse in Myelination (2008). 188-201. , .Neurosci. J. 20) iadbnigseiiiiso laminin- of specificities Ligand-binding (2006). 277 17) ute bevtoso ylntdaxon myelinated on observations Further (1978). 18928-18937. , .Nuo.Sci. Neurol. J. 268 5119-5128. , 37 slr . ue,U tal. et U. Suter, R., ¨ssler, 27 .Cl Biol. Cell J. 568-578. , 11552-11559. , Nature 20) ea nernactivates integrin Beta1 (2007). le,H,Egal . Mu E., Engvall, H., ¨ller, avs .F,Ozc F., A. ¸alves, 38 413 77-82. , 302-307. , 20) hypomorphic A (2006). 185 20) Recombinant (2001). 20) Alpha6beta4 (2008). 147-161. , 20) Specific (2005). .Neurosci. J. 20) Unique (2003). .Cl Biol. Cell J. ei,M., ¸elik, (2002). (2009). Matrix .Am. J. ¨ller, 28 , u .M,Flr,M . rbt,L,Srcln,S n hn .L. Z. Chen, and S. Strickland, L., Wrabetz, L., M. Feltri, M., W. Yu, ag .H,MKe .K,Ce,Z . enuh . tikad . et .and R. Zent, S., Strickland, G., Mernaugh, L., Z. Chen, K., K. McKee, H., D. Yang, M., T. Proctor, R., Rangwala, P., Y. Zhong, S., Y. Tarumi, J., Bierman, D., Yang, Timpl, E., Burghart, I., Jannetti, N., Smyth, W., Halfter, N., Miosge, M., Willem, P. K. Campbell, and Y. Yamada, A., Utani, M., S. Bernier, Y., Sunada, ucec,P D. S. Strickland, P. and J. Yurchenco, A. North, L., Z. Chen, M., W. Yu, ese,H . atn .adOCnel .F. M. O’Connell, and R. Martin, D., H. Webster, D. H. Webster, D. H. D. Webster, Meijer, and J. Svaren, eg . a,F,Jns .A,Lm .M,Gifn .A,Seie .I,Mintun, I., Y. Sheline, A., E. Griffin, M., M. Lim, A., L. Jones, F., Pan, C., Yamada, Zeng, D., Harrison, T., Mathus, H., Colognato, Y., J. Quan, J. D., O’Rear, P. and Y. Yurchenco, Yamada, D., M. Ward, U., Sung, D., P. Yurchenco, S. Y. Cheng, and D. P. Yurchenco, H. Furthmayr, and D. P. Yurchenco, ug . ’er .J n ucec,P D. P. Yurchenco, and J. J. O’Rear, U., Sung, cwn elseii baino aii am1cue ppoi n prevents and apoptosis causes gamma1 laminin of proliferation. ablation cell-specific Schwann embryonic D. P. Yurchenco, -8. and laminin-2 S. by L. myelination 655-666. Sherman, and defasciculation H., axon J. of Miner, control S., Takeda, Y., Miyagoe-Suzuki, development. lung and 2722. kidney with interferes chain gamma1 U. Mayer, and R. platforms. nepaeShanclsadaosbfr ylnto:aqatttv electron quantitative a myelination: before axons and study. microscopic cells Schwann interphase Company. Saunders W.B. Neuropathy responsible gene chain mice. dy2J 2 in alpha dysmyelination laminin and of dystrophy transcript muscular mutant for novel a of Identification o cwn elmorphogenesis. cell Schwann for exuiiesann sasniieadrlal ehdfrsuyn elproliferation H. system. cell studying nervous R. for adult method Mach, the reliable and and in sensitive a M. as staining D. deoxyuridine Holtzman, A., M. partners. gamma-chain and beta- its of USA secretion drives and J. J. O’Rear, and Y. omto n rwhi a cai nerves. sciatic rat in growth and formation cells. Schwann in transcription recombinant with sites cryptic and active glycoprotein. of hybrid identification and laminin: of arm long distal 1061. eobnn aii oanmdae ybatahso n eai binding. heparin and adhesion myoblast Chem. mediates Biol. domain G laminin Recombinant model. interaction three-arm A laminin. collagen. 94 10189-10194. , Biochemistry odSrn ab eset Biol. Perspect. Harb. Spring Cold c o.1(d .J yeadP .Toa) p 4-6.Philadelphia: 243-266. pp. Thomas), K. P. and Dyke J. P. (ed. 1 vol. , aii expression. laminin 1 268 .Neurosci. J. 17) h emtyo eihrlmei hah uigtheir during sheaths myelin peripheral of geometry The (1971). 8356-8365. , 19) eeomn fprpea ev ies In fibers. nerve peripheral of Development (1993). aii-eedn ylnto 4619 myelination Laminin-dependent 21) aeetmmrns elsaflig n signaling and scaffoldings cell membranes: Basement (2011). 21) ea olcigsse rwhadfnto eedupon depend function and growth system collecting Renal (2011). 20) pcfcalto ftendgnbnigst ntelaminin the in site nidogen-binding the of ablation Specific (2002). e.Biol. Dev. 19) h lh hi flmnn1i neednl secreted independently is laminin-1 of chain alpha The (1997). 23 .Cl Biol. Cell J. 1839-1850. , 25 4463-4472. , ri Res. Brain 20) h oeua ahnr fmei gene myelin of machinery molecular The (2008). 32 Glia 401-416. , .Cl Sci. Cell J. 19) efasml n acu-idn ie in sites calcium-binding and Self-assembly (1993). Development 56 18) efasml fbsmn membrane basement of Self-assembly (1984). 123 1541-1551. , 1319 .Bo.Chem. Biol. J. 1255-1268. , .Cl Biol. Cell J. 21-32. , 19) eladhprnbnigi the in binding heparin and Cell (1993). 3 122 a004911. , 21) vlaino 5-ethynyl-2 of Evaluation (2010). 138 929-936. , 17) h eainhp between relationships The (1973). 4535-4544. , 268 48 20) aii srequired is Laminin (2009). u.Ml Genet. Mol. Hum. 348-367. , 17286-17299. , Development rc al cd Sci. Acad. Natl. Proc. 20) Coordinate (2005). .Cl Biol. Cell J. Peripheral 129 4 (2005). (1995). (1993). 1055- , 2711- , 168 J. 9 - ,