US009 127024B2

(12) United States Patent (10) Patent No.: US 9,127.024 B2 Chellappan et al. (45) Date of Patent: Sep. 8, 2015

(54) BORON-CONTAINING DIACYLHYDRAZINES 5,514,578 A 5/1996 Hogness et al. 5,530,021 A 6/1996 Yanagi et al. (71) Applicant: Intron Corporation, Blacksburg, VA 5,599,9045,530,028 A 2f19976/1996 LidlertEvans et al. ( ) 5,641,652 A 6/1997 Oro et al. 5,668,175 A 9, 1997 Evans et al. (72) Inventors: Sheela K. Chellappan, Clarksburg, MD 5,710,004 A 1/1998 Evans et al. (US); Robert E. Hormann, Melrose 5,723,329 A 3/1998 Mangelsdorf et al. Park, PA (US); Inna Shulman 5,880,333. A 3/1999 Goffet al. L s PA S s 5,919,667 A 7/1999 Gage et al. anghorne, PA (US) 5,945,400 A 8/1999 Scherman et al. 5.948,406 A 9, 1999 Stavinski et al. (73) Assignee: Intrexon Corporation, Blacksburg, VA 5,981, 196 A 11/1999 Stavinski et al. (US) 5,989,863. A 1 1/1999 Tang et al. 6,013,836 A 1/2000 Hsu et al. (*) Notice: Subject to any disclaimer, the term of this 6,025,483. A 2/2000 Yanofsky patent is extended or adjusted under 35 (Continued) U.S.C. 154(b) by 0 days. FOREIGN PATENT DOCUMENTS (21) Appl. No.: 14/212.526 CA 2 103 110 C 5, 1994 (22) Filed: Mar 14, 2014 CN 1245638 A 3, 2000 (Continued) (65) Prior Publication Data US 2014/0274954A1 Sep. 18, 2014 OTHER PUBLICATIONS Baker, Chem Soc Rev, 2011, 40, 4279-4285.* Related U.S. Application Data (Continued) (60) Provisional application No. 61/792,412, filed on Mar. 15, 2013. Primary Examiner — D M Seaman (51) Int. Cl. in C07F 5/04 (2006.01) Giro ". or Firm — Sterne, Kessler, C07F 5/02 (2006.01) u u YW (52) U.S. Cl. CPC. C07F5/04 (2013.01); C07F 5/025 (2013.01); (57) ABSTRACT C07F 5/027 (2013.01) (58) Field of Classification Search The present disclosure provides boron-containing diacylhy CPC ...... A01B 12/006; C07F 5/04; C07F 5/025; drazines having Formula I: CO7F 5/027 USPC ...... 54.6/159 See application file for complete search history. I R2 (56) References Cited O 's- U.S. PATENT DOCUMENTS ls N R5 4 1. 4,631,211 A 12/1986 Houghten R N 4,814,349 A 3, 1989 Addor et al. O 4,859,609 A 8, 1989 Dullet al. 4,906,280 A 3, 1990 Sandler et al. 4,950,666 A 8, 1990 Peake et al. 4.954,655 A 9/1990 Kelly and the pharmaceutically acceptable salts and Solvates 4,981,784. A 1/1991 Evans et al. thereof, wherein R,R,R,R, and Rare defined as set 4,985,461 A 1/1991 Hsu et al. forth in the specification. The present disclosure also 38492. A 38. t s al provides the use of boron-containing diacylhydrazines 5.075471. A 12, 1991 Michelottietal. is ecdysone receptor-based inducible gene expression 5,117,057 A 5, 1992 Hsu et al. systems. Thus, the present disclosure is useful for appli 5,171,671. A 12/1992 Evans et al. cations such as gene therapy, treatment of disease, large 5,225,443 A 7/1993 Murphy et al. 5,283,173 A 2f1994 Fields et al. Scale production of proteins and antibodies, cell-based 5,344,958 A 9, 1994 Lidlert et al. Screening assays, functional genomics, proteomics, 5,354,762 A 8. 1994 Hsu et al. 1 metabolomics, and regulation of traits in transgenic 5,358,9665,378,726 A 10/19941/1995 James,Yanagi Jr.et al.et al. E. where control of gene expression levels is 5,424,333. A 6/1995 Wing S18). 5,429,952 A 7, 1995 Garner et al. 5,459,127 A 10/1995 Felgner et al. 5,482.962 A 1/1996 Hormann 38 Claims, 7 Drawing Sheets US 9,127.024 B2 Page 2

(56) References Cited JP 62-263150 A 11, 1987 JP 2-207066 A 8, 1990 U.S. PATENT DOCUMENTS JP 3-141245 A 6, 1991 JP 3-145447. A 6, 1991 6,096,787 A 8, 2000 Evans et al. JP 4-089471 A 3, 1992 6,107,286 A 8/2000 Byket al. JP 4-178380 A 6, 1992 6,117,639 A 9/2000 Germann et al. JP 4-235.177 A 8, 1992 6,147.282 A 1 1/2000 Goffet al. JP 5-39252 A 2, 1993 6.245,531 B1 6/2001 Hogness et al. JP 6-172342 A 6, 1994 6,258,603 B1 7/2001 Carlson et al. JP 6-184076 A 7, 1994 6,265,173 B1 7/2001 Evans et al. JP 8-231528 A 9, 1996 6,281,330 B1 8/2001 Evans et al. JP 8-231529 A 9, 1996 6,300,488 B1 10/2001 Gage et al. JP 9-10O262 A 4f1997 6,326,403 B1 12/2001 Holzemann et al. JP 2000-26423. A 1, 2000 6,333,318 B1* 12/2001 Evans et al...... 514,171 WO WO 89.12690 A1 12, 1989 6,379,945 B1 4/2002 Jepson et al. WO WO9428O28 A1 12, 1994 6,458,926 B1 10/2002 Evans et al. WO WO95/18863 A1 T 1995 6,723,531 B2 * 4/2004 Evans et al...... 435/69.1 WO WO95/21931 A1 8/1995 6,756,491 B2 6/2004 Evans et al. WO WO96, 17823 A1 6, 1996 6,875,569 B2 4/2005 Gage et al. WO WO96,25508 A1 8/1996 6,939,711 B2 9/2005 Goffet al. WO WO96,27673 A1 9, 1996 7,038,022 B1 5/2006 Evans et al. WO WO96,37609 A1 11, 1996 7,045,315 B2 5/2006 Evans et al. WO WO97,381.17 A1 10, 1997 7.057,015 B1 6/2006 Gage et al. WO WO99,02683 A1 1/1999 7,091,038 B2 8/2006 Palli et al. WO WO99/10510 A2, 3, 1999 7,119,077 B1 10/2006 Evans et al. WO WO99,36520 A1 T 1999 7,304,161 B2 12/2007 Hormann et al. WO WO99,581.55 A1 11, 1999 7,456,315 B2 11/2008 Hormann et al. WO WOO1/36447 A2 5, 2001 7,563,928 B2 7/2009 Hormann et al. WO WOO1? 62780 A1 8/2001 7.851,220 B2 12/2010 Hormann et al. WO WOO1,70816 A2 9, 2001 8,076,517 B2 * 12/2011 Hormann et al...... 56.4/310 WO WOO2,29075 A2 4, 2002 8,524,948 B2 9/2013 Hormann et al. WO WO 02/066612 A2 8, 2002 2002/01 10861 A1 8/2002 Dhadialla et al. WO WO 02/066613 A2 8, 2002 2002/01 19521 A1 8, 2002 Palli et al. WO WO 02/066614 A2 8, 2002 2002/0177564 A1 11, 2002 Evans et al. WO WO 02/0666.15 A2 8, 2002 2003/0010253 A1 1/2003 Oki et al. WO WOO3,105849 A1 12/2003 2003/0203360 A1 10, 2003 Weinstein et al. WO WO 2004.005478 A2 1/2004 2004/0033600 A1 2, 2004 Palli et al. WO WO 2004/072254 A2 8, 2004 2004/0096942 A1 5/2004 Kapitskaya et al. WO WO 2004/078924 A2 9, 2004 2004/O197861 A1 10, 2004 Palli WO WO 2005/017126 A2 2/2005 2004/0235097 A1 11/2004 Zhang et al. WO WO 2005,108617 A2 11/2005 9. WO WO 2006/083253 A1 8, 2006 2005/0209283 A1 9, 2005 Hormann et al. 2005/0266457 A1 12, 2005 Palli et al. OTHER PUBLICATIONS 2006, O100416 A1 5, 2006 Palli et al. 2007, 0161086 A1 7, 2007 Palli et al. Antoniewski, C. et al., “The Ecdysone Response Enhancer of the 39. A. 3. EA s al Fbp I Gene of Drosophila melanogaster Is a Direct Target for the 2008. O194521 A1 8/2008 Hormann et al. EcriUSP Nuclear Receptor.” Mol. Cell. Biol. 14:4465-4474, Ameri 2008/0214627 A1 9, 2008 Hormann et al. can Society for Microbiology (1994). 2012/0116090 A1 5/2012 Hormann et al. Ashburner, M. et al., “Temporal Control of Puffing Activity in 2012/0316066 A1 12/2012 Hormann et al. Polytene Chromosomes.” Cold Spring Harb. Symp. Quant. Biol. 2013.0035487 A1 2/2013 Hormann et al. 38:655-662, Cold Spring Harbor Laboratory Press (1974). 2014/0045903 A1 2/2014 Hormann et al. Belshaw, P.J. et al., “Rational Design of Orthogonal Receptor-Ligand Combinations.” Angew. Chem. Int. Ed. Engl. 34:2129-2132, VCH FOREIGN PATENT DOCUMENTS Verlagsgesellschaft mbH. Weinheim (1995). Cao, S. et al., “N'-tert-Butyl-N'-aroyl-N-(alkoxycarbonylmethyl)-N- S. 1 o 'gl: ki Se: aroylhydrazines, a novel nonsteroidal ecdysone agonist: Syntheses, EP O 228564 B1 7, 1987 insecticidal activity, conformational, and crystal structure analysis.” EP O 232 O75 A1 8, 1987 Can. J. Chem. 79:272-278, NRC Canada (2001). EP O 234944 A1 9, 1987 Cao, S. et al., “Synthesis of N-Tert-butyl-N,N'- EP O 236 618 A2 9, 1987 aroyl(aryloxyacetyl)hydrazine.” Huadong Ligong Daxue Xuebao EP O 245950 A2 11, 1987 27:316-319, Huodeng Shifan Daxue Chubanshe, China (2001). EP O 253 468 A2 1, 1988 Carlson, G.R. et al., “The chemical and biological properties of EP O 347339 854216 A2B1 11,12, 1989 methoxyfenozide, a new insecticidal ecdysteroid agonist.”d Pest EP O 361 645 A2 4f1990 Manag. Sci. 57:115-119, Society of Chemical Industry (2001). EP O 395 581 A1 10, 1990 Cherbas, L. et al., “Identification of Ecdysone response elements by EP O 286 746 B1 2, 1991 analysis of the Drosophila Eip28/29 gene.” Genes & Develop. 5:120 EP O 461 809 A1 12, 1991 131, Cold Spring Harbor Laboratory Press (1991). EP O 496342 B1 7, 1992 Cho, W.-L. et al., “Mosquito Ecdysteroid Receptor: Analysis of the E. 99. S. A. 68; cDNA and Expression During Vitellogenesis.” Insect Biochem. EP O 965. 644 A2 12, 1999 Molec. Biol. 25:19-27, Elsevier Science Ltd. (1995). EP O984 009 A1 3, 2000 Christopherson, K.S. et al., “Ecdysteroid-dependent regulation of EP 1266 015 B1 12/2002 genes in mammalian cells by a Drosophila ecdysone receptor and GB 2231,268 A 11, 1990 chimeric transactivators.” PNAS 89:6314-6318, National Academy JP 62-209053 A 9, 1987 of Sciences (1992). US 9,127.024 B2 Page 3

(56) References Cited Leid, M. et al., “Purification, Cloning, and RXRIdentity of the HeLa Cell Factor with Which RAR or TR Heterodimerizes to Bind Target OTHER PUBLICATIONS Sequences Efficiently.” Cell 68:377-395, Cell Press (1992). Leonhardt, S.A. et al., "Agonist and Antagonists Induce Chung, A.C.-K. et al., “Cloning of crustacean ecdysteroid receptor Homodimerization and Mixed Ligand Heterodimerization of Human and retinoid-X receptor gene homologs and elevation of retinoid-X Progesterone Receptors in Vivo by a Mammalian Two-Hybrid receptor mRNA by retinoic acid.” Mol. Cell. Endocrinol. 139:209 Assay.” Mol. Endocrinol. 12:1914-1930. The Endocrine Society 227, Elsevier Science Ireland Ltd. (1998). (1998). D'Avino, P.P. et al., “The moulting hormone ecdysone is able to Licitra, E.J. and Liu, J.O., "A three-hybrid system for detecting small recognize target elements composed of direct repeats.” Mol. Cell. ligand-protein receptor interactions.” PNAS 93:12817-12821, Endocrinol. 113: 1-9, Elsevier Science Ireland Ltd. (1995). National Academy of Sciences (1996). Dhadialla, T.S. et al., “New Insecticides With Ecdysteroidal and Martinez, A. et al., “Creation of ecdysone receptor chimeras in plants Juvenile Hormone Activity.” Annu. Rev. Entomol. 43:545-569, for controlled regulation of gene expression.” Mol. Gen. Genet. Annual Reviews Inc. (1998). 261:546-552, Springer-Verlag, Germany (1999). Evans, R.M.. “The Steroid and Thyroid Hormone Receptor Metzger, D. et al., “The human oestrogen receptor functions in Superfamily.” Science 240:889-895, American Association for the yeast.” Nature 334:31-36, Nature Publishing Group (1988). Advancement of Science (1988). Morrison, D.A. et al., “Isolation of Transformation-Deficient Fujiwara, H. et al., “Cloning of an Ecdysone Receptor Homolog from Streptococcus pneumoniae Mutants Defective in Control of Compe Manduca sexta and the Developmental Profile of Its mRNA in tence. Using Insertion-Duplication Mutagenesis with the Erythromy Wings.” Insect Biochem. Molec. Biol. 25:845-856, Elsevier Science cin Resistance Determinant of pAMB1. J. Bacteriol. 159:870-876, Ltd. (1995). American Society for Microbiology (1984). Godowski, P.J. et al., “Signal Transduction and Transcriptional Regu Mouillet J.-F. et al., “Cloning of two putative ecdysteroid receptor lation by Glucocorticoid Receptor—LexAFusion Proteins.” Science isoforms from Tenebrio molitor and their developmental expression 241:812-816, American Association for the Advancement of Science in the epidermis during metamorphosis.” Eur: J. Biochem. 248:856 (1988). 863, FEBS (1997). Guo, X. et al., “Isolation of a Functional Ecdysteroid Receptor Nakagawa, Y. et al., “Quantitative Structure-Activity Relationships Homologue from the Ixodid Tick Amblyomma americanum (L.).” and Designed Synthesis of Larvicidal N,N'-Dibenzoyl-N-tert Insect Biochem. Molec. Biol. 27.945-962, Elsevier Science Ltd. butylhydrazines against Chilo suppressalis," Pestic. Sci. 44:102-105, (1998). SCI (1995). Hannan, G.N. and Hill, R.J., “Cloning and Characterization of Nakagawa, Y. et al., “Quantitative Structure—Activity Studies of LcEdR: A Functional Ecdysone Receptor from the Sheep Blowfly Insect Growth Regulators. XI. Stimulation and Inhibition of Lucilia cuprina,' Insect Biochem. Molec. Biol. 27:479-488. Elsevier N-Acetylglucosamine Incorporation in a Cultured Integument Sys Science Ltd. (1997). tem by Substituted N-tert-Butyl-N,N'-dibenzoylhydrazines.” Pestic. Hayward, D.C. et al., “The structure of the USP/RXR of Xenos pecki Sci. 43:339-345, SCI (1995). indicates that Strepsiptera are not closely related to Diptera.” Dev. Nakagawa, Y. et al., “Quantitative structure—activity studies of Genes Evol. 215:213-219, Springer-Verlag (2005). insect growth regulators: XIX. Effects of substituents on the aromatic Heberlein, U. et al., “Characterization of Drosophila Transcription moiety of dibenzoylhydrazines on larvicidal activity against the beet Factors That Activate the Tandem Promoters of the Alcohol armyworm Spodoptera exigua," Pest Manag. Sci. 58:131-138, pub Dehydrogenase Gene.” Cell 41.965-977, MIT (1985). lished online by EarlyView in Wiley InterScience (2001). Holt, J.R. et al., “Functional Expression of Exogenous Proteins in Nakagawa, Y. et al., “Quantitative structure—activity studies of Mammalian Sensory Hair Cells Infected With Adenoviral Vectors.”.J. insect growth regulators: XVI. Substituent effects of Neurophysiol. 81: 1881-1888, American Physiological Society dibenzoylhydrazines on the insecticidal activity to Colorado potato (1999). beetle Leptinotarsa decemlineata," Pestic. Sci. 55:909-918, Society Hoppe, U.C. et al., “Adenovirus-Mediated Inducible Gene Expres of Chemical Industry (1999). sion in Vivo by a Hybrid Ecdysone Receptor.” Mol. Ther: 1:159-164. Nakagawa, Y. et al., “Quantitative structure—activity studies of The American Society of Gene Therapy (2000). insect growth regulators: XVIII. Effects of Substituents on the aro Imhof, M.O. et al., “Cloning of a Chironomus tentans cDNA Encod ing a Protein (cEcRH) Homologous to the Drosophila melanogaster matic moiety of dibenzoylhydrazines on larvicidal activity against Ecdysteroid Receptor (dEcR).” Insect Biochem. Molec. Biol. 23:115 the Colorado potato beetle Leptinotarsa decemlineata," Pest Manag. 124, Pergamon Press Ltd. (1993). Sci. 57858-865, SCI (2001). International Search Report and the Witten Opinion of the Interna Neuberger, M.S. et al., “Recombinant antibodies possessing novel tional Searching Authority for International Appl. No. PCT/US2014/ effector functions.” Nature 312:604-608, Nature Publishing Group 028768, mailed Jul. 8, 2014, United States Patent and Trademark (1984). Office, Alexandria, VA. Nie, K.-S. et al., “New Insect Growth Regulators—Central Kakizawa, T. et al., “Ligand-dependent Heterodimerization of Thy Tebufenozide.” Nongyaoxue Xuebao 40:42-43, Gai Kan Bianjibu, roid Hormone Receptor and Retinoid X Receptor.” J. Biol. Chem. Beijing (2001). 272:23799-23804. The American Society for Biochemistry and No, D. et al., “Ecdysone-inducible gene expression in mammalian Molecular Biology, Inc. (1997). cells and transgenic mice.” PNAS93:3346-3351, National Academy Koelle, M.R. et al., “The Drosophila EcR Gene Encodes an Ecdysone of Sciences (1996). Receptor, a New Member of the Steroid Receptor Superfamily.” Cell Oikawa, N. et al., “Quantitative Structure—Activity Analysis of Lar 67:59-77, Cell Press (1991). vicidal 1-(Substituted benzoyl)-2-benzoyl-1-tert-butylhydrazines Kothapalli, R. et al., “Cloning and Developmental Expression of the against Chilo suppressalis," Pestic. Sci. 41: 139-147, SCI (1994). Ecdysone Receptor Gene From the Spruce Budworm, Choristoneura Peet, D.J. et al., “Engineering novel specificities for ligand-activated fumiferana," Dev. Genet. 17:319-330, Wiley-Liss, Inc. (1995). transcription in the nuclear hormone receptor RXR.” Chem. & Biol. Kumar, M.B. et al., “A single point mutation in ecdysone receptor 5:13-21. Current Biology Ltd. (1998). leads to increased ligand specificity: Implications for gene Switch Perera, S.C. et al., “An Analysis of Ecdysone Receptor Domains applications.” PNAS 99:14710-14715, National Academy of Sci Required for Heterodimerization With Ultraspiracle.” Arch. Insect ences (2002). Biochem. Physiol. 41:61-70, Wiley-Liss, Inc. (1999). Le, D.P. et al., “RH-2485: A New Selective Insecticide for Caterpillar Perera, S.C. et al., “Studies on two ecdysone receptor isoforms of the Control.” Brighton Crop Protection Conference—Pests and Diseases spruce budworm, Choristoneura fumiferana," Mol. Cell. Endocrinol. 2:481-486, British Crop Protection Council (1996). 152:73-84, Elsevier Science Ireland Ltd. (1999). US 9,127.024 B2 Page 4

(56) References Cited Verras, M. et al., “Cloning and characterization of CcEcR. An ecdysone receptor homolog from the Mediterranean fruit fly OTHER PUBLICATIONS Ceratitis capitata," Eur: J. Biochem. 265:798-808, FEBS (1999). Wheelock, C.E. et al., “High-throughput screening of ecdysone Pierce, A.C. and Jorgensen, W.L., “Computational Binding Studies agonists using a reporter gene assay followed by 3-D QSAR analysis of Orthogonal Cyclosporin-Cyclophilin Pairs.” Angew. Chem. Int. of the molting hormonal activity.” Bioorg. Med Chem. 14:1143 Ed. Engl. 36:1466-1469, VCH Verlagsgesellschaft mbH. Weinheim 1159, Elsevier Ltd. (2006). (1997). Wilson, J.M. et al., “Hepatocyte-directed Gene Transfer in Vivo Riddiford, L.M. et al., “Ecdysone Receptors and Their Biological Leads to Transient Improvement of Hypercholesterolemia in Low Actions.” Vitamins and Hormones 60:1-73, Academic Press (2001). Density Lipoprotein Receptor-deficient Rabbits.” J. Biol. Chem. Saleh, D.S. et al., “Cloning and characterization of an ecclysone 267:963-967. The American Society for Biochemistry and Molecular receptor cDNA from Locusta migratoria," Mol. Cell. Endocrinol. Biology, Inc. (1992). 143:91-99, Elsevier Science Ireland Ltd. (1998). Wing, K.D., “RH5849, a Nonsteroidal Ecdysone Agonist: Effects on Sawada, Y. et al., “Synthesis and Insecticidal Activity of 3,5- a Drosophila Cell Line.” Science 241:467-469. The American Asso Dimethylbenzoyl Moiety Modified Analogues of N-tert-Butyl-N'-(4- ciation for the Advancement of Science (1988). ethylbenzoyl)-3,5-dimethylbenzohydrazide.” J. Pesticide Sci. Yao, T.-P. et al., “Drosophila ultraspiracle Modulates Ecdysone 27:365-373, Pesticide Science Society of Japan, Tokyo (2002). Receptor Function via Heterodimer Formation.” Cell 71:63-72, Cell Sawada, Y. et al., “Synthesis and insecticidal activity of Press (1992). benzoheterocyclic analogues of N'-benzoyl-N-(tert Yao, T.-P. et al., “Functional ecdysone receptor is the product of EcR butyl)benzohydrazide: Part 2. Introdution of substituents on the ben and Ultraspiracle genes.” Nature 366:476-479. Nature Publishing Zene rings of the benzoheteroycle moiety.” Pest Manag. Sci. 59:36 Group (1993). 48, published online by EarlyView in Wiley InterScience (2002). Zhang, X.-N. et al., “Innovation Hydrazines insect growth regulator Sawada, Y. et al., “Synthesis and insecticidal activity of JS118 the synthesis and biological activity. Synthesis and Study of benzoheterocyclic analogues of N'-benzoyl-N-(tert Ait of New Diacylhydrazines IGRs JS118.” Pesticides 42:18-20 butyl)benzohydrazide: Part3. Modification of N-tert-butylhydrazine (2003). moiety.” Pest Manag. Sci. 59:49-57, published online by EarlyView Zou X.-J. et al., “Synthesis and Crystal Structure of N-tert-butyl-N'- in Wiley InterScience (2002). (2,4-dichlorobenzoyl)-N-1-(4-chlorophenyl)-1,4-dihydro-6- Sawada, Y. et al., “Synthesis and insecticidal activity of methylpyridazine-4-oxo-3-carbonyl hydrazine.” Jiegou Huaxue benzoheterocyclic analogues of N'-benzoyl-N-tert 20:344-348, Zhingguoke Xue Yuan, Fujian Wu Zhijie gouyanjiu Suo, butyl)benzohydrazide: Part 1. Design of benzoheterocyclic ana China (2001). logues.” Pest Manag. Sci. 59:25-35, published online by EarlyView Zou, X.-J. and Jin G.-Y., “Synthesis of N-tert-butyl-N'(N)-(1-aryl in Wiley InterScience (2003). 1,4-dihydro-6-methylpyridazine-4-oxo-3-carbonyl)-N (N)-(substi Suhr, S.T. et al., “High level transactivation by a modified Bombyx tuted) benzoylhydrazine.” Indian J. Chem. 42B:2608-2611, Council ecdysone receptor in mammaliancells without exogenous retinoid X of Scientific & Industrial Research, New Delhi (2003). receptor.” PNAS 95:7999-8004, National Academy of Sciences Chan, T. et al., Gene Therapy of Cancer: Translational Approaches (1998). from Preclinical Studies to Clinical Implementation 363-376 Swevers, L. et al., “The Silkmoth Homolog of the Drosophila (Edmund C. Lattime & Stanton L. Gerson eds... 3" ed. 2014) Elsevier Ecdysone Receptor (B1 Isoform): Cloning and Analysis of Expres Inc. sion During Follicular Cell Differentiation.” Insect Biochem. Molec. Del Vecchio, M. et al., “Interleukin-12: Biological Properties and Biol. 25:857-866, Elsevier Science Ltd. (1995). Clinical Application.” Clin. Cancer Res. 13:4677-4685, American Tice, C.M. et al., Optimization of O-Acylaminoketone Ecdysone Association for Cancer Research (2007). Agonists for Control of Gene Expression, Biorg. Med. Chem. Letts. 13:1883-1886, Elsevier Science Ltd. (2003). * cited by examiner

U.S. Patent Sep. 8, 2015 Sheet 2 of 7 US 9,127.024 B2

Fig. 2A

GCTGAGCTATGCCTAATCAAGTCACGGTAACTATGACTCTCTTAAGGTAGCCAAATGGCG CCACGAAAGGAGGTCGTGAAATGGATAAAAAAATACAGCGTTTTTCATGTACAACTATAC TAGTTGTAGTGCCAAATAATGCTTTTAAAACTTAAAAATATCAGATAACAGCTTGGTGG CACCCATTGTGTTCACAGGAGATACAGCTTATCTGTACTGATATAATGACATGCTGCA CTCGGTGTGAAAGGGCATCTAGTAGGCTATGGCAGGGCCTGCCGCCCCGAC GTTGGCTGC GAGCCCTGGGCCTTCACCCGAACTTGGGGGGTGGGGTGGGGAAAAGGAAGAAACGCGGGC GTATTGGCCCCAATGGGGTCTCGGTGGGGTATCGACAGAGTGCCAGCCCTGGGACCGAAC CCCGCGTTTATGAACAAACGACCCAACACCGTGCGTTTTATTCTGTCTTTTTATTGCCGT CATAGCGCGGGTTCCTTCCGGTATTGTCTCCTTCCGTGTTTCATCAGAAAAACTCGTCCA GCAGGCGGTAGAAAGCGATGCGCTGAGAATCTGGTGCAGCGATGCCGTACAGAACCAGGA AGCGGTCAGCC CATICGCCGCCCAGTTCT CAGCGATGTCGCGGGTAGCCAGAGCGATGT CCTGGTAGCGGTCAGCAACGCCCAGACGACCACAGTCGATGAAGCCAGAGAAGCGGCCGT TTCAA CCATGATGTTCGGCAGGCAAGCGCGCCGTGGGTAACAACCAGGTCTTCGCCG CTGGCATACGAGCTTCAGGCGAGCGAACAGTTCAGCCGGAGCCAGGCCCTGGGTTCTT CGTCCAGGTCGTCCTGGTCAACCAGGCCAGCTTCCATGCGGGTGCGAGCGCGTTCGATGC GGTGTTTAGCCTGGTGGTCGAACGGACAAGTAGCCGGGTCCAGGGTGTGCAGGCGGCGCA TAGCGTCAGCCATGATAGAAACTTTTTCAGCCGGAGCCAGGTGAGAAGACAGCAGATCCT GGCCCGGAACTTCGCCCAGCAGCAGCCAGTCGCGGCCAGCTTCGGTAACAACGTCCAGAA CAGCAGCGCACGGAA CGCCGGTGGTAGCCAGCCAAGACAGGCGAGCAGCTTCGTCTTGCA GTTCGTTCAGAGCGCCAGACAGGTCGGTTTTAACGAACAGAACCGGGCGGCCCTGAGCAG ACAGGCGGAAAACAGCAGCGTCAGAGCAGCCGATGGTTTGTTGGCCCAGTCGTAACCAA ACAGACGTTCAACCCAAGCAGCCGGAGAGCCAGCGTGCAGGCCGTCCTGTTCGATCATGG TGGCCCCCCCCCCCCCCGGAATAGCTCTGAGGCCGAGCCACCTTCGGCCTCTCCATAAA AAAAAAAATTAGTCAGCCATGGGGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGG GATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCTTGCTTT GCAT ACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACAC CTGGTTGCTGACTAATTGAGATG CTTGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACCATGC ATTCAACTATCCCAA CGAGGGATTCGAAGGACGATAC CTACGTTAGACTTAACTATAACG GTCCTAAGGTAGCGACCACTTAGACGTGTGAAACCCTAGGGCCGCACAGGCCCGCCGAC GATCCGAGCGTGGCCATCGTGGCCCACCTA AGTGGTCCAGGAACGGCGTGGGCTCGTTTA. AACCGTACCATTAGGGAAAGTACCCACTTATGTGGGCGATCGCTA ATTAAGGCCGGCCG CCGCAATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCCAT AGTACTAACATACGCTCTCCATCAAAACAAAACGAAACAAAACAAACTAGCAAAATAGGC TCTCCCCACTCCAA CTCCAGGTCCCAGAACATTTCTCTATCCAAATCCAGGGGTACCCC GTGATGACGGTGAAAACCTCCAATTG CGGAGTACTGTCCTCCGAGCGGAGTACTGTCCT CCGAGCGGAGACGTCCCCGAGCGGAGACGTCCCCGAGCGGAGACGCCCCG AGCGGAGTACTGTCCTCCGAGCGGAGAGTCCCCGGGGACCTAGAGGGTATATAATGGG IGCCTTAGCTGGGTGTGACCTCATCTTCCTGTACGCCCCTGCAGGGGCGCGCCACGCGT CCGCGGGCTAGCGCCACC ATGGAAGATGCCAAAAACATTAAGAAGGGCCCAGCGCCATT CTACCCACCGAAGACGGGACCGCGGCGAGCAGCGCACAAAGCCAGAAGCGCTACGC CCGGGCCCGGCACCACGCCACCGACGCACAATCGAGGGGACAACCACGC CGAGACCGAGATGAGCGCGGCGGCAGAAGCAGAAGCGCTATGGGCGAAAC

6x GalRE

U.S. Patent Sep. 8, 2015 Sheet 4 of 7 US 9,127.024 B2

Fig. 2C

TCCGTCCCGGTTCTTCTTTGTCGATCCCTCTGATCCT CACTTGCT CAG TAGCGGCCTCCT GGGCTGGGTACGTGCGCTCGGGGTTGGCGAGTGTGTTTT GTGAAGTTTTTTAGGCACCTT TTGAAATGTAATCATTTGGGTCA, ATATGTAATTTTCACGTCTTAGACTAGTAAATTGTCCG CTAAATTCTGGCCGTTTTTGGCTTTTTT GTTAGACGCCGCGGGGGGGGGGGGGGGGCTAG CGCCACC ATGGGCCCCAAGAAGAAAAGGAAGGTGGCCCCCCCCACCGACGTGAGCCTGG GCGACGAGCGCACCGGACGGCGAGGACGGGCCATGGCCCACGCCGACGCCCGGACG ACCGACCGGACAGCGGGCGACGGCGACAGCCCCGGCCCCGGCCACCCCCCACG ACAGCGCCCCCACGGCGCCCGGACAGGCCGACCGAGCGAGCAGAGCACCG ACGCCCTGGGCATCGACGAGTACGGCGGC GAATTC (GAGATGCCCGTGGACAGGATTC GGAGGCCGAACCGCCGGGAGCAGAAAAGCGACCAGGGCGGGAGGGCCCCGGCGGAA CCGGCGGCAGCGGCAGCAGCCCCAACGACCCCGGACCAACACGCCAGGCCGCCGACA AGCAGCTGCACCCGGGGAGGGGCCAAGAGGATCCCCACCAGCAGCCGCCCC GGACGACCAGGGACCGCGAGGGCCGGAGGAACGAGCGCGACGCCAGCCA GCCACAGGAGCACGACGGAGGGACGGCACCGCTGGCCACCGGCCTGCACGTCCAA GGAACAGCGCCCACAGCGCCGGAGGGGCGCCACCGACAGGGGCTGACCGAGCGG GAGCAAGAGAGGGACATGAGGATGGACAAGACCGAGCTGGGCGCCTGAGGGCCATCA TCCGCAACCCCGAGGGAGGGGCCGAAAAGCGCCCAGGAGGGGAGCGCGAGGG AGAAGGGACGCCGCCCGGAGGAGACACCAGGACCACCCACCCCGACGAGCCCGGCA GACGCCAAGCGCGCGAGGCGCCCAGCCGAGGAGCACGGCCTGAAGGCCTGG AGCACCGTCCCAGGCGACGGCGACGGCCCACGACACCCCGAGGAGA TGCTGGAGAGCCCCAGCGACAGCTGA GCATGCCCCCCTCTCCCTCCCCCCCCCCTAAC CTTACTCCCCCAAGCCCCTTCCAATAACCCCCCTCTCCGTTTCTCTATATCTTATTTTCC ACCATATTGCCGTCTTTTGGCAA TGTGAGGGCCCGGAAACCTGGCCCTGICTTCTTGACG AGCATTCCTAGGGGICTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGIG AAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGC AGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAA GATACACCTG CAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAA AGAGTCAAATGGCTCTCCTCAAGCGTATTCA ACAAGGGGCTGAAGGATGCCCAGAAGGTA CCCCATTGTATGGGATCTGATCTGGGGCCTCGGT GCACAGCTTACATGTGTTTAGICG AGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACAC GATCCATATGGCCACC ATGAAGCTGCTGAGCAGCATCGAGCAGGCTTGCGACATCTGCA GGCTGAAGAAGCTGAAGTGCAGCAAGGAGAAGCCCAAGEGCGCCAAGGCCTGAAGAACA ACGGGAGGCAGATACAGCCCCAAGACCAAGAGGAGCCCCCGACCAGGGCCCACCTGA CCGAGGGGAGAGCAGGCGGAGAGGCGGAGCAGCGCCGCGAICCCCCAGGG AGGACCGGACAGACCGAAGAGGACAGCCGCAAGACACAAGGCCCGCGACCG GCCGCGGCAGGACAACGGAACAAGGACGCCGIGACCGACAGGCGGCCAGCGGG AGACCGACAGCCCCGACCCGAGGCAGCACAGGACAGCGCCACCAGCAGCAGCGAGG AGAGCAGCAACAAGGGCCAGAGGCAGCTGACCGTGAGCCCCGAGTTTCCCGGG ATCA GGCCCGAGGCGTGGGCCCGAGACCCAGGCGCCATGAAAAGGAAGGAGAAGAAGGCCC AGAAGGAGAAGGACAAGCTGCCCGGAGCACCACCACCGTCGATGACCACAGCCCCCCA

VP16 IRXR Gal4DBD U.S. Patent Sep. 8, 2015 Sheet 5 Of 7 US 9,127.024 B2

Fig. 2 D

CAGCAGGCGAGCCCCCCCCCCCCGAGGCCGCCAGGACACGAGGCGTCCCCAGG CCTGAGCGACAAGCTGCTGGTGACCAACAGGCAGAAGAACATCCCCCAGCTGACCGCCA ACCAGCAGCCGACGCCAGGCGACGGACAGGACGGCACGAGCAGCCCAGCG ACGAGGACCTGAAAAGGACACCCAGACCGGCAGCAGGCCGACGACGAGAACGAGGAGA GCGACACCCCCCAGGCAGATCACCGAGAGACCACCGACCGGCAGCGACGGG AGCGCCAAGGGCCGCCCGGACGCCAAGACAGCCAGCCCGACCAGACACCCGC GAAGGCGCAGCAGCGAGGGAGAGCGAGGGGGCCAGGAGGACGACGCCGCCA GCGACAGCACCGICGCCAACAACCAGGCACACCAGGGACAACACAGGAAGGCG GCAGGCCGAGGGACGAGGACCCCGCACCGCAGAGTAGACAGCAGGCCC GGACAACACCACTACGCCCGCGACCGCCGGGGACCAGCGACAGGCCCGGCC GGAGCAGCCCCAGCGGGGAGGAGACCAGAGGACACCGAACACCCGAGGAC ACACCGAACCAGCGAGCGGCAGCGCCAGGAGCAGCGIGACACGGCAAGACCGA GCACCGAGCGAGCTGAGGACCCGGGAAGCAGAACAGCAAATGGATCAGCCGA AGCGAAGAACAGGAAGCGCCCCCCCCGGAGGAGAGGGACGGGCCGACAGA GCCACACCCAGCCCCCCCCCATCCTGGAGAGCCCCACCAACCTGTGAATCGATTAGAC ATGATAAGATACATTGATGAGTTTGGACAA ACCACAACTAGAATGCAGTGAAAAAAATGC TTAATTTGTGAAATTTGTGATGCTATTGCTTAATTTGTAACCATTATAAGCTCCAATAAA CAAGTTAATAAAACATTTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGG TTTTTTAAAGCAAGTAAAAC CTCTACAAATGGGTATCT AGAGCTCTCCAAAATTAATA CCCATTCGCGTCCCAAATCATTACCCTGTTATCCCTACGCCTAGCCTTAGGGTTCACATC TATGTCGGGTGCGGAGAAAGAGGTAATGAAATGG CAATAACAGGCTAGA ACCAGCTAACG TTAGGAGCATAGATTGGGGCATTCCGGAACTATAAATTGCGTTGCGCT CACTGCCCGCTT TCCAGTCGGGAAACCT(TCGTCCCAGCTCCAAAATGAATCGGCCAACGCGCGGGGAGAG. (CGGTTTGCGTATTGGGCGCGCTTCCGCTTCCTCGCT CACTGACTCGCGCGCTCGGTCG TTCGGCTGCGGCGAGCGGTATCAGCCACT CAAAGGCGCTAATACGGTTATCCACAGAAT CAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTA AAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCAT CACAAAA ATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTC CCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATAC CTGT CCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCA CTTCCC, TCTACGTCCTTCGCTCCAAGCTCCGCTCTCTCCACCAACCCCCCGTTCACCCCG ACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTAT CGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTA CAGAGTTCTGAAGTGGTGGCCTAACTACGGCTACACAGAAGAACAGTATTTGGTATCT GCGCTCTGCTGAAGCCAGTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAAC AAACCACCGCTGGTAGCGGGGTTTTTTTGTTGCAAGCAGCAGATTACGCGCAGAAAAA AAGGATCCAAGAAGATCCITTGATCTTTTCTACGGGGICTGACGCTCAGTGGAACGAAA ACTCACGTAAGGGATTTTGGTCATGAGATTATCAAAAAGGAICTTCACC TAGAICCTTT TAAATTAAAAATCAAGTTTTAAATCAATCTAAAGTATATATCAGTAAACTTGGTCTGACA TGCGCAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTT CATCCATAGTTGCCTGACTCCCCGTCG T G TAGATAACTACGATACGGGAGGGCTTACCAT CTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCT CACCGGCTCCAGATTTATCAG

EcRVY' U.S. Patent Sep. 8, 2015 Sheet 6 of 7 US 9,127.024 B2

Fig. 2E

CAATAAACCAGCCAGCCGGAAGCGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCT CCATCCAGTCTATAACGTTGCCGGGAAGCTAGAGTAAG TAGTTCGCCAGTTAATAGT TGCGGAGCGTTGT, GCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGG CTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCA AAAAAGCGGTTAGCTCCTTCGGTCCTCCGATGGTTGTCAGAAGTAAGTTGGCCGCAGTGT TATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGAT GCTTTTCTGTGACTGGTGAGTATTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGAC CGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTAA AAGTGCTCATCATGGGAAGCGTTCTTCGGGGCGAAAA CTCTCA AGGATCTTACCGC GT TGAGATCCAGTTCGATGTAACCCACACGAGCACCCAACTGATCTTCAGCATCTTTTACTT TCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAA GGGCGACACGGAAAGTGAATACT CATAC CTTCCTTT CAATATTATTGAAGCAT ATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAA TAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGAGGTCTAAGAAACCATTATTA. TCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCTTCTCGCGCGTTCG GTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGATACGGT CACAGCTTGTCTGT AAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTC GGGGCTGGCTTAA (SEQ ID NO: 1) U.S. Patent US 9,127.024 B2

US 9,127,024 B2 1. 2 BORON-CONTAINING DACYLHYDRAZINES high levels required for induction or repression. For similar reasons, utility of Such systems in animals is limited. FIELD OF THE INVENTION Immunosuppressive molecules such as FK506, rapamycin and cyclosporine A can bind to immunophilins FKBP12, This invention is in the fields of biotechnology, genetic cyclophilin, etc. Using this information, a general strategy engineering, gene expression, and medicinal chemistry. The has been devised to bring together any two proteins simply by invention provides novel boron-containing diacylhydrazines placing FK506 on each of the two proteins or by placing and the use of these compounds in nuclear receptor-based FK506 on one and cyclosporine A on another one. A synthetic inducible gene expression systems. homodimer of FK506 (FK1012) or a compound resulted from 10 fusion of FK506-cyclosporine (FKCSA) can then be used to BACKGROUND induce dimerization of these molecules (Spencer et al., Sci ence 262:1019-24 (1993); Belshaw et al., Proc Natl Acad Sci In the field of genetic engineering, precise control of gene USA 93:4604-7 (1996)). Gal4 DNA binding domain fused to expression is a valuable tool for studying, manipulating, and FKBP12 and VP16 activator domainfused to cyclophilin, and controlling development and other physiological processes. 15 FKCSA compound were used to show heterodimerization and Gene expression is a complex biological process involving a activation of a reporter gene under the control of a promoter number of specific protein-protein interactions. In order for containing GalA binding sites. Unfortunately, this system gene expression to be triggered. Such that it produces the includes immunosuppressants that can have unwanted side RNA necessary as the first step in protein synthesis, a tran effects and therefore, limits its use for various mammalian Scriptional activator must be brought into proximity of a gene Switch applications. promoter that controls gene transcription. Typically, the tran Higher eukaryotic transcription activation systems such as Scriptional activator itself is associated with a protein that has steroid hormone receptor systems have also been employed. at least one DNA binding domain that binds to DNA binding Steroid hormone receptors are members of the nuclear recep sites present in the promoter regions of genes. Thus, for gene tor superfamily and are found in vertebrate and invertebrate expression to occur, a protein comprising a DNA binding 25 cells. Unfortunately, use of steroidal compounds that activate domain and a transactivation domain located at an appropri the receptors for the regulation of gene expression, particu ate distance from the DNA binding domain must be brought larly in plants and mammals, is limited due to their involve into the correct position in the promoter region of the gene. ment in many other natural biological pathways in Such The traditional transgenic approach utilizes a cell-type spe organisms. In order to overcome Such difficulties, an alterna cific promoter to drive the expression of a designed transgene. 30 tive system has been developed using insect ecdysone recep A DNA construct containing the transgene is first incorpo tors (EcR). rated into a host genome. When triggered by a transcriptional Growth, molting, and development in insects are regulated activator, expression of the transgene occurs in a given cell by the ecdysone steroid hormone (molting hormone) and the type. juvenile hormones (Dhadialla et al., Annu. Rev. Entomol. 43: Another means to regulate expression of foreign genes in 35 545-569 (1998)). The molecular target for ecdysone in insects cells is through inducible promoters. Examples of the use of consists of at least ecdysone receptor (EcR) and ultraspiracle such inducible promoters include the PR1-a promoter, protein (USP). EcR is a member of the nuclear steroid recep prokaryotic repressor-operator Systems, immunosuppres tor super family that is characterized by signature DNA and sive-immunophilin systems, and higher eukaryotic transcrip ligand binding domains, and an activation domain (Koelle et tion activation systems such as steroid hormone receptor sys 40 al., Cell, 67:59-77 (1991)). EcR receptors are responsive to a tems and are described below. number of Steroidal compounds such as ponasterone A and The PR1-a promoter from tobacco is induced during the muristerone A. Non-steroidal compounds with ecdysteroid systemic acquired resistance response following pathogen agonist activity have been described, including the commer attack. The use of PR1-a may be limited because it often cially available insecticides tebufenozide and methoxy responds to endogenous materials and external factors such as 45 fenozide that are marketed by Rohm and Haas Company (see pathogens, UV-B radiation, and pollutants. Gene regulation WO 96/27673 and U.S. Pat. No. 5,530,028). Both analogs systems based on promoters induced by heat shock, inter have exceptional safety profiles in other organisms. feron and heavy metals have been described (Wurn et al., The insect ecdysone receptor (EcR) heterodimerizes with Proc. Natl. Acad. Sci. USA83:5414-5418 (1986); Arnheiteret Ultraspiracle (USP), the insect homologue of the mammalian al., Cell 62:51-61 (1990); Filmus et al., Nucleic Acids 50 retinoid X receptor (RXR), and binds ecdysteroids and ecdys Research 20:27550-27560 (1992)). However, these systems one receptor response elements to activate transcription of have limitations due to their effect on expression of non-target ecdysone responsive genes. The EcR/USP/ligand complexes genes. These systems are also leaky. play important roles during insect development and reproduc Prokaryotic repressor-operator systems utilize bacterial tion. The EcR has five modular domains, A/B (transactiva repressor proteins and the unique operator DNA sequences to 55 tion), C (DNA binding, heterodimerization), D (Hinge, het which they bind. Both the tetracycline ("Tet’) and lactose erodimerization), E (ligand binding, heterodimerization and (“Lac') repressor-operator systems from the bacterium transactivation) and F (transactivation) domains. Some of Escherichia coli have been used in plants and animals to these domains such as A/B, C and Eretain their function when control gene expression. In the Tet system, tetracycline binds they are fused to other proteins. to the TetR repressor protein, resulting in a conformational 60 Tightly regulated inducible gene expression systems or change that releases the repressor protein from the operator 'gene Switches' are useful for various applications such as which as a result allows transcription to occur. In the Lac gene therapy, large scale production of proteins in cells, cell system, a lac operon is activated in response to the presence of based high throughput screening assays, functional genomics lactose, or synthetic analogs such as isopropyl-b-D-thioga and regulation of traits in transgenic plants and animals. lactoside. Unfortunately, the use of such systems is restricted 65 The first version of an EcR-based gene switch used Droso by unstable chemistry of the ligands, i.e. tetracycline and phila melanogaster EcR (DmEcR) and Mus musculus RXR lactose, their toxicity, their natural presence, or the relatively (MmRXR) and showed that these receptors in the presence of US 9,127,024 B2 3 4 steroid, ponasterone A, transactivate reporter genes in mam ing them on two different proteins results in greatly reduced malian cell lines and transgenic mice (Christopherson et al., background activity in the absence of a ligand and signifi Proc. Natl. Acad. Sci. U.S.A. 89:6314-6318 (1992); No et al., cantly increased activity overbackground in the presence of a Proc. Natl. Acad. Sci. U.S.A. 93:3346-3351 (1996)). Later, ligand (see WO 01/70816 A1). This two-hybrid system is a Suhr et al., Proc. Natl. Acad. Sci. 95:7999-8004 (1998) significantly improved inducible gene expression modulation showed that non-steroidal ecdysone agonist, tebufenozide, system compared to the two systems disclosed inapplications induced high level of transactivation of reporter genes in WO 97/38117 and WO 99/02683. The two-hybrid system mammalian cells through Bombyx mori EcR (BmEcR) in the exploits the ability of a pair of interacting proteins to bring the absence of exogenous heterodimer partner. transcription activation domain into a more favorable position WO 97/38117 and WO99/581.55 disclose methods for 10 modulating the expression of an exogenous gene in which a relative to the DNA binding domain such that when the DNA DNA construct comprising the exogenous gene and an ecdys binding domain binds to the DNA binding site on the gene, one response element is activated by a second DNA construct the transactivation domain more effectively activates the pro comprising an ecdysone receptor that, in the presence of a moter (see, for example, U.S. Pat. No. 5.283,173). Briefly, the ligand therefore, and optionally in the presence of a receptor 15 two-hybrid gene expression system comprises two gene capable of acting as a silent partner, binds to the ecdysone expression cassettes; the first encoding a DNA binding response element to induce gene expression. The ecdysone domain fused to a nuclear receptor polypeptide, and the sec receptor of choice was isolated from Drosophila melano ond encoding a transactivation domain fused to a different gaster. Typically, such systems require the presence of the nuclear receptor polypeptide. In the presence of ligand, the silent partner, preferably retinoid X receptor (RXR), in order interaction of the first polypeptide with the second polypep to provide optimum activation. In mammalian cells, insect tide effectively tethers the DNA binding domain to the trans ecdysone receptor (EcR) heterodimerizes with retinoid X activation domain. Since the DNA binding and transactiva receptor (RXR) and regulates expression of target genes in a tion domains reside on two different molecules, the ligand dependent manner. WO 99/02683 discloses that the background activity in the absence of ligand is greatly ecdysone receptor isolated from the silk moth Bombyx mori is 25 reduced. functional in mammalian systems without the need for an A two-hybrid system also provides improved sensitivity to exogenous dimer partner. non-steroidal ligands for example, diacylhydrazines, when U.S. Pat. No. 6,265,173 B1 discloses that various members compared to steroidal ligands for example, ponasterone A of the steroid/thyroid superfamily of receptors can combine (“PonA') or muristerone A (“MurA). That is, when com with Drosophila melanogaster ultraspiracle receptor (USP) 30 pared to steroids, the non-steroidal ligands provide higher or fragments thereof comprising at least the dimerization activity at a lower concentration. Furthermore, the two-hy domain of USP for use in a gene expression system. U.S. Pat. brid system avoids some side effects due to overexpression of No. 5,880.333 discloses a Drosophila melanogaster EcRand RXR that often occur when unmodified RXR is used as a ultraspiracle (USP) heterodimer system used in plants in heterodimer receptor partner. In one two-hybrid system, which the transactivation domain and the DNA binding 35 native DNA binding and transactivation domains of EcR or domain are positioned on two different hybrid proteins. RXR are eliminated and as a result, these hybrid molecules Unfortunately, these USP-based systems are constitutive in have less chance of interacting with other steroid hormone animal cells and therefore, are not effective for regulating receptors present in the cell resulting in reduced side effects. reporter gene expression. Additional gene Switch systems include those described in In each of these cases, the transactivation domain and the 40 the following patents and patent applications: U.S. Pat. No. DNA binding domain (either as native EcR as in WO 7,091,038: WO2004078924; EP1266015; US20010044151: 99/02683 or as modified EcR as in WO 97/38117) were US20020110861; US200201 19521; US20040033600; incorporated into a single molecule and the other het US20040197861; US20040235097; US20060020146; erodimeric partners, either USP or RXR, were used in their US2004.0049437; US20040096942; US20050228016: native state. 45 US20050266457; US20060100416: WO2001/70816; Drawbacks of the above described EcR-based gene regu WO2002/29075; WO2002/066612; WO2002/066613; lation systems include a considerable background activity in WO2002/066614; WO2002/066615; WO2005/108617; U.S. the absence of ligands and non-applicability of these systems Pat. No. 6,258,603; US20050209283; US20050228016: for use in both plants and animals (see U.S. Pat. No. 5,880, US20060020146; EPO965644; U.S. Pat. No. 7,304,162; and 333). Therefore, a need exists in the art for improved EcR 50 U.S. Pat. No. 7,304,161. based systems to precisely modulate the expression of exog With the improvement in ecdysone receptor-based gene enous genes in both plants and animals. Such improved regulation systems, there has been an increase in their use for systems would be useful for applications such as gene various applications. Diacylhydrazine (“DAH) compounds, therapy, large-scale production of proteins and antibodies, and their application as ligands in ecdysone receptor-based cell-based high throughput screening assays, functional 55 gene regulation systems are disclosed U.S. Pat. Nos. 8.076, genomics and regulation of traits in transgenic animals. For 517: 7.456,315; 7,304,161; and 6.258,603, and patents cited certain applications such as gene therapy, it may be desirable therein. However, a need exists for DAHs with improved to have an inducible gene expression system that responds physiochemical and/or pharmacological properties. well to synthetic non-steroid ligands and, at the same time, is insensitive to the natural steroids. Thus, improved systems 60 BRIEF SUMMARY OF THE FIGURES that are simple, compact, and dependent on ligands that are relatively inexpensive, readily available, and of low toxicity FIG. 1 is a vector map for the RheoSwitch(RVector (RS-1). to the host would prove useful for regulating biological sys FIGS. 2A-2E set forth the nucleic acid sequence (SEQ ID temS. NO: 1) for the vector map of FIG. 1. The nucleic acid It has been shown that an ecdysone receptor-based induc 65 sequence set forth in brackets represent the following vector ible gene expression system in which the transactivation and sequence components: 6xGalRE', fluct, VP16, DNA binding domains are separated from each other by plac RXR, Gal4 DBD and EcRVY. US 9,127,024 B2 5 6 FIG. 3 is a bar graph showing the expression of luciferase wherein: in mouse grastroc muscle by injection of Ad-RTS-flUC via R" and Rare each independently selected from the group IM on the right and left gastroc muscle and oral administra consisting of hydrogen, optionally Substituted alkyl, and tion of Cpd. Nos. 13, 59, 67, 85, and 86 at 100 mg/kg body weight. haloalkyl; or R" and R taken together with the carbon atom to which BRIEF SUMMARY OF THE INVENTION they are attached form a 4- to 8-membered cycloalkyl: R is selected from the group consisting of hydrogen, In one aspect, the present disclosure provides boron-con optionally substituted alkyl, haloalkyl, optionally substituted taining diacylhydrazine compounds represented by Formulae 10 cycloalkyl, optionally Substituted alkenyl, optionally Substi I-XI, I-A, II-A, X-A, or XI-A, below, and the pharmaceuti tuted aryl, and optionally substituted heteroaryl; cally acceptable salts and solvates thereof, collectively R" is selected from the group consisting of: referred to herein as “Compounds of the Disclosure.” Com pounds of the Disclosure contain at least one boron atom in their structure. 15 4 In another aspect, the present disclosure provides compo R6a R-1 sitions comprising a Compound of the Disclosure and one or R7a more excipients. In a further aspect, the composition is a B pharmaceutically acceptable composition. } Sé, In another aspect, the present disclosure provides Com pounds of the Disclosure for use as ligands in ecdysone recep S-N-2a tor-based inducible gene expression systems. An advantage R7b R-2 of the present disclosure is that it provides a means to regulate R7e gene expression and to tailor expression levels to Suit the 25 user's requirements. R-X S4 In another aspect, the present disclosure provides methods of regulating gene expression of a gene of interest in an S-N-ea isolated host cell, comprising contacting the host cell with a R7d 4 Compound of the Disclosure, or composition thereof. 30 R6c R-3 In another aspect, the present disclosure provides methods R7e of regulating gene expression of a gene of interest in a non B human organism, comprising contacting the non-human 1. ^S organism with a Compound of the Disclosure, or composition "Sr. thereof. 35 NS 2a In another aspect, the present disclosure provides methods Rif of treating a disease, disorder, injury, or condition in a subject, R-44. comprising administering to the Subject a Compound of the Rig Disclosure, or composition thereof. 40 B In another aspect, the present disclosure provides a Com x51 Sé, pound of the Disclosure, or composition thereof, for use in treating a disease, disorder, injury, or condition. e In another aspect, the present disclosure provides a Com Róf s 2. pound of the Disclosure, or composition thereof, for use in the 45 R-5 manufacture of a medicament for treating a disease, disorder, injury, or condition. R10b In another aspect, the present disclosure provides a method of controlling insects, comprising contacting said insects or -f N s their habitat with an insecticidally effective amount of a Com 50 Yux pound of the Disclosure, or composition thereof. R10c R10d R-6 DETAILED DESCRIPTION OF THE INVENTION R10b 55 In one embodiment, Compounds of the Disclosure are -f S1. s compounds having Formula I: ye Río N

2 60 R4-7

O R10d 's- -f N s N R5 N1 1. H 65 Naxa N O R10c US 9,127,024 B2 7 8 -continued R" is selected from the group consisting of hydroxy, alkyl, R-8 and alkoxy; or R6a R forms a hydroxy acid adductor an amino acid adduct; R7a R’ and Rare each independently selected from the group - B aS consisting of hydrogen, halo, nitro, cyano, hydroxy, amino, optionally Substituted alkyl, haloalkyl, hydroxyalkyl, alkoxy, Y C s and alkylthio; S-S4 R is selected from the group consisting of hydrogen and R-9 alkyl: O 10 R7a' R" is selected from the group consisting of hydroxy, alkyl, as and alkoxy; or HN and R" forms a hydroxy acid adduct or an amino acid adduct; 7 R is selected from the group consisting of hydrogen, alkyl, amino, and hydroxy: *N 2. 15 X is selected from the group consisting of —O— and b N(R) ; R-10 R’ and R'' are each independently selected from the group consisting of hydrogen, halo, nitro, cyano, hydroxy, R7a' B t amino, optionally substituted alkyl, haloalkyl, hydroxyalkyl, alkoxy, and alkylthio; R" is selected from the group consisting of hydrogen and X61 DC} s alkyl: es 2. X is selected from the group consisting of —O— and R6m N(R') : 25 X is selected from the group consisting of —O— and N(R') : X' is selected from the group consisting of —O— and R" is selected from the group consisting of hydrogen and N(R) ; alkyl: Y is (CRR) ; R" is selected from the group consisting of hydrogen and Z' is selected from the group consisting of —O— and 30 alkyl: —N(R)-, or Z is absent: R" is selected from the group consisting of hydrogen and R" is selected from the group consisting of hydroxy, alkyl, alkyl: and alkoxy; or R" is selected from the group consisting of hydrogen and R" forms a hydroxy acid adductor an amino acid adduct; (CRIR 1), B(R12)(R12); and R" and R' are each independently selected from the 35 R', R', and R'' are each independently selected from group consisting of hydrogen, halo, nitro, cyano, hydroxy, the group consisting of hydrogen, halo, nitro, cyano, hydroxy, amino, optionally substituted alkyl, haloalkyl, hydroxyalkyl, amino, N(H)CHO. —N(H)CN, optionally substituted alkoxy, and alkylthio; alkyl, haloalkyl, hydroxyalkyl, arylalkyl, optionally Substi R'' and R'' are each independently selected from the tuted cycloalkyl, optionally Substituted alkenyl, optionally group consisting of hydrogen, halo, nitro, cyano, hydroxy, 40 Substituted alkynyl, optionally Substituted aryl, optionally amino, optionally substituted alkyl, haloalkyl, hydroxyalkyl, substituted heteroaryl, optionally substituted heterocycle, alkoxy, and alkylthio; alkoxy, aryloxy, arylalkyloxy, alkylthio, heteroalkyl, car R" and R are each independently selected from the boxamido, sulfonamido, COR', -SOR'7, N(R') group consisting of hydrogen and alkyl; COR, N(R')SOR or N(R')C—N(R)-amino; or R” and R” are each independently selected from the 45 R" is selected from the group consisting of hydrogen, group consisting of hydrogen and alkyl; halo, nitro, cyano, hydroxy, —N(H)CHO. —N(H)CN, amino, optionally substituted alkyl, haloalkyl, hydroxyalkyl, m is 1, 2, 3, or 4: arylalkyl, optionally Substituted cycloalkyl, optionally Sub X is selected from the group consisting of —O— and stituted alkenyl, optionally substituted alkynyl, optionally N(R) ; 50 substituted aryl, optionally substituted heteroaryl, optionally Y? is (CRR) ; Substituted heterocycle, alkoxy, aryloxy, arylalkyloxy, alky Z is selected from the group consisting of —O— and lthio, heteroalkyl, carboxamido, sulfonamido, —COR', —N(R)-, or Z is absent: SOR7, N(R)COR, N(R)SOR20 or N(R) R” is selected from the group consisting of hydroxy, alkyl, C=N(R)-amino; and/or and alkoxy; or 55 R' forms a hydroxy acid adductor an amino acid adduct; R" and R' taken together with two adjacent carbon R" and R'' are each independently selected from the atoms form a fused optionally Substituted cycloalkyl, option group consisting of hydrogen, halo, nitro, cyano, hydroxy, ally substituted heterocyclo, or optionally substituted het amino, optionally substituted alkyl, haloalkyl, hydroxyalkyl, eroaryl group; e.g., R-5 is: alkoxy, and alkylthio; 60 R and R are each independently selected from the group consisting of hydrogen and alkyl; R’ and R* are each independently selected from the group consisting of hydrogen and alkyl; n is 1, 2, 3, or 4, 65 X is selected from the group consisting of —O— and CYC N(R) ; US 9,127,024 B2 9 10 -continued R'' and R'' are each independently selected from the group consisting of hydrogen and alkyl; O R* and R'' are selected from the group consisting of hydroxy and alkoxy; or s s 5 R° and R' taken together form a linkage O O(CR'R'').O ; or H –B(R')(R') forms a fluoride adduct: N O R'' and R' are each independently selected from the group consisting of hydrogen and C alkyl; C \ C s 10 o is 0, 1, 2, 3, 4, or 5: O N p is 2, 3, or 4: H R is R-3, R-4, R-8, R-9, or R-10; or R is selected from the group consisting of O { O 15 R-1 O R6e Ri B e.g., R-6 is 2O } sa s s S-S-x CH3 Rii RS-2 O O R6g X R7k N N 25 n1 nS 2 2 ). O N O N S-N-x R7 O N N 30 R5-3 R10f 2 2 O N N X^n H Re-f s N N O N 35 R10gAux R10h R-4 O N N N N H R14a 1 s and 40 O N N NeaR 145 RS-5 ( 2 or 2 N O N N R15a 1s 45 e.g., R-7 is: NealR 155 X is selected from the group consisting of —O— and N(R) ; O O 50 Y is (CRR) ; NN, NN, NN. Z is selected from the group consisting of —O— and 2 2 2 - N(R)-, or Z is absent: O N O N N R is selected from the group consisting of hydroxy and alkyl; or O 55 R forms a hydroxy acid adductor an amino acid adduct; NN, NN, RandR are each independently selected from the group consisting of hydrogen, halo, nitro, cyano, hydroxy, amino, N N e O N2 optionally Substituted alkyl, haloalkyl, hydroxyalkyl, alkoxy, H 60 and alkylthio; RandR are eachindependently selected from the group consisting of hydrogen and alkyl, K n N or n N: RandR are each independently selected from the group consisting of hydrogen and alkyl, O e e 65 q is 1, 2, 3, or 4, X is selected from the group consisting of —O— and N(R') : US 9,127,024 B2 11 12 Y is (CR&R) ; R'' and R'' are each independently selected from the Z is selected from the group consisting of —O— and group consisting of hydrogen and alkyl; - N(R) , or Z is absent: R'' and R'' are selected from the group consisting of R’ is selected from the group consisting of hydroxy and hydroxy and alkoxy; or alkyl; or 5 R'' and R' taken together form a linkage R" forms a hydroxy acid adduct or an amino acid adduct O(CR'R''),O ; or R" and R'' are each independently selected from the group –B(R')(R') forms a fluoride adduct: consisting of hydrogen, halo, nitro, cyano, hydroxy, amino, R" and R'' are each independently selected from the optionally substituted alkyl, haloalkyl, hydroxyalkyl, alkoxy, group consisting of hydrogen and C alkyl: and alkylthio; 10 s is 0, 1, 2, 3, 4, or 5: t is 2, 3, or 4: RandR are each independently selected from the group R'' and R'' are each independently selected from the consisting of hydrogen and alkyl; group consisting of hydrogen, halo, nitro, cyano, hydroxy, R’s and R” are each independently selected from the amino, N(H)CHO. —N(H)CN, optionally substituted group consisting of hydrogen and alkyl; 15 alkyl, haloalkyl, hydroxyalkyl, arylalkyl, optionally Substi r is 1, 2, 3, or 4: tuted cycloalkyl, optionally Substituted alkenyl, optionally R" is selected from the group consisting of hydrogen and Substituted alkynyl, optionally Substituted aryl, optionally (CRR1), B(R12)(R12); and substituted heteroaryl, optionally substituted heterocycle, R''. R', and R'' are independently selected from the alkoxy, aryloxy, arylalkyloxy, alkylthio, carboxamido, Sul group consisting of hydrogen, halo, nitro, cyano, hydroxy, fonamido, COR', SOR'7, N(R')COR, N(R') amino, N(H)CHO. —N(H)CN, optionally substituted SOR or N(R')C=N(R)-amino; alkyl, haloalkyl, hydroxyalkyl, arylalkyl, optionally Substi R'' and R'' are each independently selected from the tuted cycloalkyl, optionally Substituted alkenyl, optionally group consisting of hydrogen, halo, nitro, cyano, hydroxy, Substituted alkynyl, optionally Substituted aryl, optionally amino, N(H)CHO. —N(H)CN, optionally substituted substituted heteroaryl, optionally substituted heterocycle, 25 alkyl, haloalkyl, hydroxyalkyl, arylalkyl, optionally Substi alkoxy, aryloxy, arylalkyloxy, alkylthio, carboxamido, Sul tuted cycloalkyl, optionally Substituted alkenyl, optionally fonamido, COR', SOR'7, N(R')COR', N(R') Substituted alkynyl, optionally Substituted aryl, optionally SOR or N(R')C—N(R)-amino; or substituted heteroaryl, optionally substituted heterocycle, R' is selected from the group consisting of hydrogen, alkoxy, aryloxy, arylalkyloxy, alkylthio, carboxamido, Sul halo, nitro, cyano, hydroxy, amino, N(H)CHO, N(H) 30 fonamido, COR', SOR'7, N(R')COR, N(R') CN, optionally substituted alkyl, haloalkyl, hydroxyalkyl, SOR or N(R')C=N(R)-amino; arylalkyl, optionally substituted cycloalkyl, optionally sub R" is selected from the group consisting of hydrogen, stituted alkenyl, optionally Substituted alkynyl, optionally hydroxy, haloalkyl, hydroxyalkyl, arylalkyl, optionally Sub substituted aryl, optionally substituted heteroaryl, optionally stituted alkyl, optionally Substituted cycloalkyl, optionally Substituted heterocycle, alkoxy, aryloxy, arylalkyloxy, alky 35 Substituted alkenyl, optionally Substituted alkynyl, optionally lthio, carboxamido, sulfonamido, —COR'; SO.R'': Substituted heterocycle, optionally Substituted aryl, option N(R')COR'; N(R')SOR or N(R')C N(R)- ally substituted heteroaryl, alkoxy, aryloxy, and arylalkyloxy; amino; and R'' is selected from the group consisting of haloalkyl, R" and R' taken together with two adjacent carbon hydroxyalkyl, arylalkyl, optionally Substituted alkyl, option atoms form a fused optionally Substituted cycloalkyl, option 40 ally substituted cycloalkyl, optionally substituted alkenyl, ally substituted heterocyclo, or optionally substituted het optionally substituted alkynyl, optionally substituted hetero eroaryl group; e.g., R-3 is: cycle, optionally Substituted aryl, and optionally Substituted heteroaryl; R" is selected from the group consisting of hydrogen, CH3 45 haloalkyl, hydroxyalkyl, arylalkyl, optionally substituted alkyl, optionally substituted cycloalkyl, optionally Substi tuted alkenyl, optionally substituted alkynyl, optionally Sub stituted heterocycle, optionally Substituted aryl, and option OsO ally substituted heteroaryl; OO 50 R" is selected from the group consisting of hydrogen, haloalkyl, hydroxyalkyl, arylalkyl, optionally substituted alkyl, optionally substituted cycloalkyl, optionally Substi tuted alkenyl, optionally substituted alkynyl, optionally Sub stituted heterocycle, optionally substituted aryl, optionally 55 Substituted heteroaryl, alkoxy, aryloxy, arylalkyloxy, and amino; R’ is selected from the group consisting of haloalkyl, hydroxyalkyl, arylalkyl, optionally Substituted alkyl, option ally substituted cycloalkyl, optionally substituted alkenyl, O NsO 60 optionally substituted alkynyl, optionally substituted hetero cycle, optionally substituted aryl, optionally substituted het eroaryl, and amino; R’ is selected from the group consisting of hydrogen, O alkyl, aryl, cyano, and nitro, 65 with the provisos: a) when R is R-5, R-6, or R-7 and R is R-3, then one of R' or R' is not hydrogen; or US 9,127,024 B2 13 14 b) when R is R-5, R-6, or R-7 and R is R-4 or R-5, lthio, heteroalkyl, carboxamido, sulfonamido, —COR', then R' is not hydrogen, SOR7, N(R)COR, N(R)SOR20 or N(R) and the pharmaceutically acceptable salts and Solvates C=N(R)-amino; and/or thereof. R'' and R' taken together with two adjacent carbon In another embodiment, Compounds of the Disclosure are atoms form a fused optionally Substituted cycloalkyl, option compounds having Formula I-A: ally substituted heterocyclo, or optionally substituted het eroaryl group. In another embodiment, Compounds of the Disclosure are I-A compounds having Formula I, and the pharmaceutically R2 10 acceptable salts and solvates thereof, wherein R is selected from the group consisting of R-1, R-2, R-3, R-4, and O R-5; and R. R. R. and Rare as defined in connection with 's- 5 --- R Formula I. H In another embodiment, Compounds of the Disclosure are 15 compounds having Formula I-A, and the pharmaceutically O acceptable salts and solvates thereof, wherein R“ is selected from the group consisting of R-11, R-12, and R-13, and R', and the pharmaceutically acceptable salts and Solvates R. R. and Rare as defined in connection with Formula I. thereof, wherein: In another embodiment, Compounds of the Disclosure are R. R. R. and Rare as defined in connection with For compounds having Formula I-A, and the pharmaceutically mula I, and R“ is selected from the group consisting of R-1, acceptable salts and solvates thereof, wherein R“ is selected R-2, R-3, R-4, R-8, R-9, R-10, from the group consisting of R-11, R-12, and R-13, R is selected from the group consisting of R-3, R-4, and R-5: R", R, and Rare as defined in connection with Formula I. R-11 25 In another embodiment, Compounds of the Disclosure are compounds having Formula I, and the pharmaceutically acceptable salts and solvates thereof, wherein R is R-2: R is selected from the group consisting of R-3, R-4, and R-5; R" is hydrogen; and R', R, and Rare as defined in con 30 nection with Formula I. In another embodiment, Compounds of the Disclosure are R-12 compounds having Formula I, and the pharmaceutically acceptable salts and solvates thereof, wherein R is R-2: R is selected from the group consisting of R-3, R-4, and R-5; Xs and 35 R' is hydrogen; and R', R, and Rare as defined in con R10a nection with Formula I. 52" In another embodiment, Compounds of the Disclosure are R10; compounds having Formula I, and the pharmaceutically R-13 acceptable salts and solvates thereof, wherein R is R-3; R 40 is selected from the group consisting of R-3, R-4, and R-5; R10k R" is hydrogen; and R', R, and Rare as defined in con As nection with Formula I. R10a In another embodiment, Compounds of the Disclosure are NexN compounds having Formula I, and the pharmaceutically R10; 45 acceptable salts and solvates thereof, wherein R is R-4; R is selected from the group consisting of R-3, R-4, and R-5; wherein: R' is hydrogen; and R', R, and Rare as defined in con R-1, R-2, R-3, R-4, R-8, R-9, R-10, and R'' are as nection with Formula I. defined in connection with Formula I; and In another embodiment, Compounds of the Disclosure are R", R', and R'' are each independently selected from 50 compounds having Formula I, and the pharmaceutically the group consisting of hydrogen, halo, nitro, cyano, hydroxy, acceptable salts and solvates thereof, wherein R is R-5; R amino, N(H)CHO. —N(H)CN, optionally substituted is selected from the group consisting of R-3, R-4, and R-5; alkyl, haloalkyl, alkoxyalkyl, hydroxyalkyl, arylalkyl, R10a is (CR'R' 1), B(R'2)(R'2); and R", R°, and R optionally substituted cycloalkyl, optionally substituted alk are as defined in connection with Formula I. enyl, optionally Substituted alkynyl, optionally Substituted 55 In another embodiment, Compounds of the Disclosure are aryl, optionally substituted heteroaryl, optionally substituted compounds having Formula I, and the pharmaceutically heterocycle, alkoxy, aryloxy, arylalkyloxy, alkylthio, het acceptable salts and solvates thereof, wherein R is R-5; R eroalkyl, carboxamido, sulfonamido, —COR', -SO.R'', is R-3: R1Oe is (CR1 Rild B(R'2)(R'2); and R", R°, N(R)COR, N(R)SOR20 or N(R)C N(R)- and Rare as defined in connection with Formula I. amino; or 60 In another embodiment, Compounds of the Disclosure are R" is selected from the group consisting of hydrogen, compounds having Formula I, and the pharmaceutically halo, nitro, cyano, hydroxy, —N(H)CHO. —N(H)CN, acceptable salts and solvates thereof, wherein R is R-6; R amino, optionally substituted alkyl, haloalkyl, hydroxyalkyl, is selected from the group consisting of R-3, R-4, and R-5; arylalkyl, optionally Substituted cycloalkyl, optionally Sub R10a is (CR'R' 1), B(R'2)(R'2); and R", R°, and R stituted alkenyl, optionally Substituted alkynyl, optionally 65 are as defined in connection with Formula I. substituted aryl, optionally substituted heteroaryl, optionally In another embodiment, Compounds of the Disclosure are Substituted heterocycle, alkoxy, aryloxy, arylalkyloxy, alky compounds having Formula I, and the pharmaceutically US 9,127,024 B2 15 16 acceptable salts and solvates thereof, wherein R is R-7: R is selected from the group consisting of R-3, R-4, and R-5; II-A Ro is (CR' ('R''), B(R'2)(R'2); and R, R2, and R. are as defined in connection with Formula I. In another embodiment, Compounds of the Disclosure are compounds having Formula I, and the pharmaceutically X^n 1. acceptable salts and solvates thereof, wherein R is R-8: R (HO)B- ci- N is selected from the group consisting of R-3, R-4, and R-5; A4 O and R is (CR'R''), B(R')(R'); and R', R, and 10 R10; Rare as defined in connection with Formula I. In another embodiment, Compounds of the Disclosure are wherein R is selected from the group consisting of R-3, compounds having Formula I, and the pharmaceutically R-4, and R-5; R', R. R. R-3, R-4, R-5, and o are as acceptable salts and solvates thereof, wherein R is R-9; R defined in connection with Formula I, and R'" and R'' areas is selected from the group consisting of R-3, R-4, and R-5; 15 defined in connection with Formula I-A, and the pharmaceu and R' is hydrogen; and R', R, and Rare as defined in tically acceptable salts and solvates thereof. In a further connection with Formula I. embodiment, o is 0. In further embodiment, R'' and R' are In another embodiment, Compounds of the Disclosure are each independently selected from the group consisting of compounds having Formula I-A, and the pharmaceutically hydrogen, alkyl, halo, and alkoxyalkyl. In a further embodi acceptable salts and solvates thereof, wherein R* is R-11; ment, at least one of R' or R' is alkoxyalkyl. In a further R is selected from the group consisting of R-3, R-4, and embodiment, R is 3,5-dimethylphenyl. R-5; R' is hydrogen; and R', R, and Rare as defined in In another embodiment, Compounds of the Disclosure are connection with Formula I. compounds having Formula III: In another embodiment, Compounds of the Disclosure are 25 compounds having Formula I-A, and the pharmaceutically III acceptable salts and solvates thereof, wherein R* is R-12; R is selected from the group consisting of R-3, R-4, and R R3 R-5; R' is hydrogen; and R', R, and Rare as defined in 30 O 2 y connection with Formula I. --(CH)-BOH), In another embodiment, Compounds of the Disclosure are An -N N compounds having Formula I-A, and the pharmaceutically H acceptable salts and solvates thereof, wherein R* is R-13; R is selected from the group consisting of R-3, R-4, and 35 R-5; R' is hydrogen; and R', R, and Rare as defined in connection with Formula I. Wherein R. R. R. R', R', R', R. R's and s are as In another embodiment, Compounds of the Disclosure are defined in connection with Formula I, and the pharmaceuti compounds having Formula II: cally acceptable salts and solvates thereof. In a further 40 embodiment, s is 0. In a further embodiment, R', R', and R" are independently selected from the group consisting of hydrogen, halogen, hydroxy, C alkyl, Chaloalkyl, Ca alkoxy, and Chaloalkoxy; or II 45 R" is selected from the group consisting of hydrogen, R2 halogen, hydroxy, Calkyl, Chaloalkyl, Calkoxy, and R R3 Chaloalkoxy; and O R" and R' taken together with two adjacent carbon N R5 atoms form a fused optionally Substituted cycloalkyl, option \ N N1 50 ally substituted heterocyclo, or optionally substituted het (HO):B-(CH), it H eroaryl group. y 2 O In another embodiment, Compounds of the Disclosure are R10c compounds having Formula IV:

55 wherein R is selected from the group consisting of R-3, IV R2 R-4, and R-5; and R', R, R, R-3, R-4, R-5, R', R', R R3 and o are as defined in connection with Formula I, and the R7a O N pharmaceutically acceptable salts and Solvates thereof. In a R6a == 5 further embodiment, o is 0. In further embodiment, R'' and 60 R" are each independently selected from the group consist VB '''H ing of hydrogen, halogen, hydroxy, Calkyl, Chaloalkyl, ( \ A O V Calkoxy, and Chaloalkoxy. Inafurther embodiment, R Y-Z is 3,5-dimethylphenyl. 65 In another embodiment, Compounds of the Disclosure are wherein R is selected from the group consisting of R-3, compounds having Formula II-A: R-4 and R-5; R' is hydrogen; R is hydroxy; and R', R, US 9,127,024 B2 17 18 R. R', X, Y, and Z' are as defined in connection with X' is N(H)-. In a further embodiment, R* and R' are Formula I, and the pharmaceutically acceptable salts and selected from the group consisting of hydrogen and methyl. solvates thereof. In a further embodiment, R' is selected In a further embodiment, Z is absent and m is 1, 2, or 3. In a from the group consisting of hydrogen, halogen, and alkyl. In further embodiment, Z is absent and m is 1. In a further a further embodiment, Z is absent. In a further embodiment, embodiment, R is 3,5-dimethylphenyl. Z' is O—. In a further embodiment, Z' is N(H)—. In a In another embodiment, Compounds of the Disclosure are further embodiment, X" is O—. In a further embodiment, compounds having Formula VII: X' is N(H)-. In a further embodiment, R and R are selected from the group consisting of hydrogen and methyl. In a further embodiment, Z' is absent and m is 1, 2, or 3. In a 10 VII R2 further embodiment, Z' is absent and m is 1. In a further R! R3 embodiment, R is 3,5-dimethylphenyl. R7e O N In another embodiment, Compounds of the Disclosure are 5 compounds having Formula V: 15 H } 2 Ner r'sh O V R6-B R2 R R3 Yy-Z R6a R7a B N R5 wherein R is selected from the group consisting of R-3, X11 N1 H R-4 and R-5; R is hydroxy: R' is hydrogen, and R', R, Y O R. R. X, Y, and Z are as defined in connection with NZ 25 Formula I, and the pharmaceutically acceptable salts and solvates thereof. In a further embodiment, R is selected wherein R is selected from the group consisting of R-3, from the group consisting of hydrogen, halogen, and alkyl. In R-4 and R-5; R' is hydrogen; R is hydroxy; and R', R, a further embodiment, Z is absent. In a further embodiment, Z is —O—. In a further embodiment, Z is N(H)—. In a R. R', X, Y, and Z' are as defined in connection with 30 Formula I, and the pharmaceutically acceptable salts and further embodiment, X is O—. In a further embodiment, solvates thereof. In a further embodiment, R' is selected X is N(H)-. In a further embodiment, R and Rare from the group consisting of hydrogen, halogen, and alkyl. In selected from the group consisting of hydrogen and methyl. a further embodiment, Z' is absent. In a further embodiment, In a further embodiment, Z is absent and n is 1, 2, or 3. In a Z' is O—. In a further embodiment, Z' is N(H)—. In a 35 further embodiment, Z is absent and n is 1. In a further further embodiment, X" is O—. In a further embodiment, embodiment, R is 3,5-dimethylphenyl. X' is N(H)-. In a further embodiment, R and R are In another embodiment, Compounds of the Disclosure are selected from the group consisting of hydrogen and methyl. compounds having Formula VIII: In a further embodiment, Z' is absent and m is 1, 2, or 3. In a 40 further embodiment, Z' is absent and m is 1. In a further VIII embodiment, R is 3,5-dimethylphenyl. R2 In another embodiment, Compounds of the Disclosure are R! R3 compounds having Formula VI: R7e O 45 R8 X2 N R5 n B1 N1 H VI Y2 O R2 n Z2 R! R3 R7a O 50 wherein R is selected from the group consisting of R-3, Z N R5 R-4 and R-5; R is hydroxy: R' is hydrogen, and R', R, Y NH Y r R. R. X, Y, and Z are as defined in connection with X O Formula I, and the pharmaceutically acceptable salts and 55 solvates thereof. In a further embodiment, R is selected from the group consisting of hydrogen, halogen, and alkyl. In a further embodiment, Z is absent. In a further embodiment, wherein R is selected from the group consisting of R-3, Z is —O—. In a further embodiment, Z is N(H)—. In a R-4 and R-5; R' is hydrogen; R is hydroxy; and R', R, further embodiment, X is O—. In a further embodiment, R. R', X, Y and Z' are as defined in connection with 60 X is N(H)-. In a further embodiment, R and Rare Formula I, and the pharmaceutically acceptable salts and selected from the group consisting of hydrogen and methyl. solvates thereof. In a further embodiment, R' is selected In a further embodiment, Z is absent and n is 1, 2, or 3. In a from the group consisting of hydrogen, halogen, and alkyl. In further embodiment, Z is absent and n is 1. In a further a further embodiment, Z is absent. In a further embodiment, 65 embodiment, R is 3,5-dimethylphenyl. Z' is O—. In a further embodiment, Z' is N(H)—. In a In another embodiment, Compounds of the Disclosure are further embodiment, X" is O—. In a further embodiment, compounds having Formula IX: US 9,127,024 B2 20 -continued OH R7a OH R7a IX R2 R R3 1. RS R7e O f 2 5 N N 17 N -N R S S H OH R7a OH R7a B O R8 l R651 Yx2 10 N1 O1 wherein R is selected from the group consisting of R-3, R8f1s, R8f1s, R-4 and R-5; Rishydroxy: R' hydrogen, and R',R,R, R7a R7a R7, X, Y, and Z areas defined in connection with Formula I, and the pharmaceutically acceptable salts and Solvates 15 thereof. In a further embodiment, R’ is selected from the group consisting of hydrogen, halogen, and alkyl. In a further O N embodiment, Z is absent. In a further embodiment, Z is r —O—. In a further embodiment, Z is N(H)—. In a further OH OH embodiment, X is —O—. In a further embodiment, X is pi R7a R7a —N(H)-. In a further embodiment, R* and Rare selected from the group consisting of hydrogen and methyl. In a fur O-B ther embodiment, Z is absent and n is 1, 2, or 3. In a further embodiment, Z is absent and n is 1. Inafurther embodiment, 25 R is 3,5-dimethylphenyl. In another embodiment, Compounds of the Disclosure are s compounds having Formula I, wherein R is selected from the R8a pi R7a HO group consisting of 30 N \ N R7a R7a HO HO V V B B M M 35 O O

R7a R7a HO 40 OH OH B O R8 - N R is selected from the group consisting of R-3, R-4, and B R-5; R' is hydrogen; and R', R, and Rare as defined in / 45 connection with Formula I, and the pharmaceutically accept HO able salts and solvates thereof. In a further embodiment, R' R7a is selected from the group consisting of hydrogen, halogen, hydroxy, C. alkyl, C. haloalkyl, C. alkoxy, and Ca M haloalkoxy; R is selected from the group consisting of HO-B 50 hydrogen and C. alkyl; and R is selected from the group R8 - Mcy B consisting of hydrogen, C alkyl, hydroxy, and —NH2. M In another embodiment, Compounds of the Disclosure are H compounds having Formula I, wherein: R is R-5; 55 R' is hydrogen; R', R', and R'' are independently selected from the group consisting of hydrogen, halogen, amino, cyano, cy —N(H)CHO. —N(H)CN, hydroxy, C alkyl, Ca NB haloalkyl, Calkoxy, and Chaloalkoxy; or 60 R" is selected from the group consisting of hydrogen, halogen, hydroxy, amino, cyano, N(H)CHO. —N(H)CN, C. alkyl, Chaloalkyl, Calkoxy, and Chaloalkoxy. and R" and R' taken together with two adjacent carbon 65 atoms form a fused optionally Substituted cycloalkyl, option ally substituted heterocyclo, or optionally substituted het eroaryl group; US 9,127,024 B2 21 22 R is selected from the group consisting of: R is:

(HO),B-H NuxR10; 10 R is R-3; R' is hydrogen; and R", R. R. and R-3 are as defined in connection with Formula I, and the pharmaceutically acceptable salts and 15 solvates thereof. In another embodiment, R'' and R's are eachalkyland R" is hydrogen. In another embodiment, R' and R'' are each independently selected from the group consisting of hydrogen, halogen, hydroxy, Calkyl, alkoxy R" is selected from the group consisting of hydrogen, alkyl, Chaloalkyl, C. alkoxy, and Chaloalkoxy. In halogen, hydroxy, Calkyl, Chaloalkyl, Calkoxy, and another embodiment, R" and R'' are each independently Chaloalkoxy; and selected from the group consisting of hydrogen, halogen, and R", R, and Rareas defined in connection with Formula I, alkoxyalkyl. In another embodiment, at least one of R' or and the pharmaceutically acceptable salts and Solvates R' is alkoxyalkyl. thereof. In another embodiment, Compounds of the Disclosure are In another embodiment, Compounds of the Disclosure are 25 compounds having Formula I, wherein: compounds having Formula I, wherein: R is: R" is selected from the group consisting of:

30 R10b HO R7a \ N Y (HO),B-HNea o/ RI Oc s s 35 R7a R7a OH O R" is selected from the group consisting of hydrogen, V s ( and halogen, hydroxy, Calkyl, Chaloalkyl, Calkoxy, and 40 B O Chaloalkoxy: / B R is selected from the group consisting of R-3, R-4, and HO OH R-5; and OH R7a R' is hydrogen. In another embodiment, Compounds of the Disclosure are O-B 45 compounds having any one of Formulae I-IX, wherein R' is optionally substituted C, alkyl; R is selected from the group consisting of hydrogen and optionally substituted C. S. alkyl; R is optionally substituted C. alkyl; and RandR are as defined in connection with Formula I, and the pharma 50 ceutically acceptable salts and Solvates thereof. R is selected from the group consisting of R-3, R-4, and In another embodiment, Compounds of the Disclosure are R-5; compounds having Formula I-A or II-A, wherein R' is R" is hydrogen; and optionally substituted C, alkyl; R is selected from the R. R. and Rareas defined in connection with Formula I, group consisting of hydrogen and optionally substituted C. and the pharmaceutically acceptable salts and Solvates 55 alkyl; and R is optionally substituted C, alkyl, and the thereof. pharmaceutically acceptable salts and Solvates thereof. In another embodiment, Compounds of the Disclosure are In another embodiment, Compounds of the Disclosure are compounds having Formula I-A, wherein: compounds having any one of Formulae I-IX, wherein R' is R is R-11; selected from the group consisting of methyl, ethyl, n-propyl. R is selected from the group consisting of R-3, R-4, and 60 and n-butyl; R is selected from the group consisting of RS-5; hydrogen and methyl; and R and Rare as defined in con R" is hydrogen; and nection with Formula I, and the pharmaceutically acceptable R. R. R, R-3, R-4, and R-5 are as defined in connec salts and solvates thereof. In a further embodiment, R is tion with Formula I, and the pharmaceutically acceptable selected from the group consisting of methyl and tert-butyl. In salts and solvates thereof. 65 a further embodiment, R is hydrogen and R is tert-butyl. In another embodiment, Compounds of the Disclosure are In another embodiment, Compounds of the Disclosure are compounds having Formula I-A, wherein: compounds having Formula I-A or II-A, wherein R' is US 9,127,024 B2 23 24 selected from the group consisting of methyl, ethyl, n-propyl. atom bearing R', R, and R is an asymmetric carbon atom and n-butyl; and R is selected from the group consisting of and the absolute configuration of said asymmetric carbon hydrogen and methyl, and the pharmaceutically acceptable atom is R, i.e., the compound is enantiomerically enriched in salts and solvates thereof. In a further embodiment, R is the R isomer, and the pharmaceutically acceptable salts and selected from the group consisting of methyl and tert-butyl. In solvates thereof. In a further embodiment, Compounds of the a further embodiment, R is hydrogen and R is tert-butyl. Disclosure are compounds having Formula I-A or II-A. In another embodiment, Compounds of the Disclosure are wherein the enantiomeric excess of the R isomer is at least compounds having any one of Formulae I-IX, wherein R' is about 60%, e.g., at least about 65%, at least about 70%, at optionally substituted C. alkyl; R is hydrogen; R is least about 75%, at least about 80%, at least about 85%, at selected from the group consisting of optionally Substituted 10 phenyl, optionally substituted pyridyl, and optionally Substi least about 90%, at least about 91%, at least about 92%, at tuted pyrimidinyl; and Rand Rare as defined in connection least about 93%, at least about 94%, at least about 95%, at with Formula I, and the pharmaceutically acceptable salts and least about 96%, at least about 97%, at least about 98%, or at least about 99%. In a further embodiment, the enantiomeric solvates thereof. In a further embodiment, R is selected from excess of the R isomer is at least about 90%. In a further the group consisting of optionally Substituted pyridyl and 15 optionally substituted pyrimidinyl. embodiment, the enantiomeric excess of the R isomer is at In another embodiment, Compounds of the Disclosure are least about 95%. In a further embodiment, the enantiomeric compounds having Formula I-A or II-A, wherein R' is excess of the R isomer is at least about 98%. In a further optionally substituted C, alkyl; R is hydrogen; and R is embodiment, the enantiomeric excess of the R isomer is at selected from the group consisting of optionally Substituted least about 98%. phenyl, optionally substituted pyridyl, and optionally Substi In another embodiment, Compounds of the Disclosure are tuted pyrimidinyl, and the pharmaceutically acceptable salts compounds having any one of Formulae I-IX, wherein the and solvates thereof. In a further embodiment, R is selected carbon atom bearing R', R, and R is an asymmetric carbon from the group consisting of optionally Substituted pyridyl atom and the absolute configuration of said asymmetric car and optionally Substituted pyrimidinyl. 25 bon atom is S, i.e., the compound is enantiomerically In another embodiment, Compounds of the Disclosure are compounds having anyone of Formulae I-IX, wherein R', R, enriched in the Sisomer, and the pharmaceutically acceptable and R are each methyl; and R and R are as defined in salts and solvates thereof. In a further embodiment, Com connection with Formula I, and the pharmaceutically accept pounds of the Disclosure are compounds having any one of able salts and solvates thereof. 30 Formulae I-IX, wherein the enantiomeric excess of the S In another embodiment, Compounds of the Disclosure are isomer is at least about 60%, e.g., at least about 65%, at least compounds having Formula I-A or II-A, wherein R', R, and about 70%, at least about 75%, at least about 80%, at least Rare each methyl, and the pharmaceutically acceptable salts about 85%, at least about 90%, at least about 91%, at least and solvates thereof. about 92%, at least about 93%, at least about 94%, at least In another embodiment, Compounds of the Disclosure are 35 about 95%, at least about 96%, at least about 97%, at least compounds having any one of Formulae I-IX, wherein the about 98%, or at least about 99%. In a further embodiment, compound does not exhibit optical activity, i.e., the com the enantiomeric excess of the Sisomer is at least about 90%. pound is achiral or racemic, or a pharmaceutically acceptable In a further embodiment, the enantiomeric excess of the S salt or solvate thereof. isomer is at least about 95%. In a further embodiment, the In another embodiment, Compounds of the Disclosure are 40 enantiomeric excess of the S isomer is at least about 98%. In compounds having Formula I-A or II-A, wherein the com a further embodiment, the enantiomeric excess of the S iso pound does not exhibit optical activity, i.e., the compound is mer is at least about 99%. achiral or racemic, or a pharmaceutically acceptable Salt or solvate thereof. In another embodiment, Compounds of the Disclosure are In another embodiment, Compounds of the Disclosure are 45 compounds having Formula I-A or II-A, wherein the carbon compounds having any one of Formulae I-IX, wherein the atom bearing R', R, and R is an asymmetric carbon atom carbon atom bearing R', R, and R is an asymmetric carbon and the absolute configuration of said asymmetric carbon atom and the absolute configuration of said asymmetric car atom is S, i.e., the compound is enantiomerically enriched in bon atom is R, i.e., the compound is enantiomerically the S isomer, and the pharmaceutically acceptable salts and enriched in the R isomer, and the pharmaceutically accept 50 solvates thereof. In a further embodiment, Compounds of the able salts and solvates thereof. In a further embodiment, Disclosure are compounds having Formula I-A or II-A. Compounds of the Disclosure are compounds having any one wherein the enantiomeric excess of the S isomer is at least of Formulae I-IX, wherein the enantiomeric excess of the R about 60%, e.g., at least about 65%, at least about 70%, at isomer is at least about 60%, e.g., at least about 65%, at least least about 75%, at least about 80%, at least about 85%, at about 70%, at least about 75%, at least about 80%, at least 55 least about 90%, at least about 91%, at least about 92%, at about 85%, at least about 90%, at least about 91%, at least least about 93%, at least about 94%, at least about 95%, at about 92%, at least about 93%, at least about 94%, at least least about 96%, at least about 97%, at least about 98%, or at about 95%, at least about 96%, at least about 97%, at least least about 99%. In a further embodiment, the enantiomeric about 98%, or at least about 99%. In a further embodiment, excess of the S isomer is at least about 90%. In a further the enantiomeric excess of the Risomer is at least about 90%. 60 embodiment, the enantiomeric excess of the S isomer is at In a further embodiment, the enantiomeric excess of the R isomer is at least about 95%. In a further embodiment, the least about 95%. In a further embodiment, the enantiomeric enantiomeric excess of the Risomer is at least about 98%. In excess of the S isomer is at least about 98%. In a further embodiment, the enantiomeric excess of the S isomer is at a further embodiment, the enantiomeric excess of the Riso least about 99%. mer is at least about 98%. 65 In another embodiment, Compounds of the Disclosure are In another embodiment, Compounds of the Disclosure are compounds having Formula I-A or II-A, wherein the carbon compounds having Formula X: US 9,127,024 B2 25 26 In another embodiment, Compounds of the Disclosure are compounds having Formula XI: R R3 O N XI - N R 5 H r O

10 wherein R' does not equal R, and R', R. R. and Rare as defined in connection with Formula I, and the pharmaceuti cally acceptable salts and solvates thereof. In a further embodiment, the enantiomeric excess of a compound having wherein R' does not equal R, and R', R. R. and Rare as Formula X, in a mixture of compounds having Formulae X 15 defined in connection with Formula I, and the pharmaceuti and XI, is at least about 60%, e.g., at least about 65%, at least cally acceptable salts and solvates thereof. In a further embodiment, the enantiomeric excess of a compound having about 70%, at least about 75%, at least about 80%, at least Formula XI, in a mixture of compounds having Formulae X about 85%, at least about 90%, at least about 91%, at least and XI, is at least about 60%, e.g., at least about 65%, at least about 92%, at least about 93%, at least about 94%, at least about 70%, at least about 75%, at least about 80%, at least about 95%, at least about 96%, at least about 97%, at least about 85%, at least about 90%, at least about 91%, at least about 98%, or at least about 99%. In a further embodiment, about 92%, at least about 93%, at least about 94%, at least the enantiomeric excess of a compound having Formula X is about 95%, at least about 96%, at least about 97%, at least at least about 90%. Inafurther embodiment, the enantiomeric 25 about 98%, or at least about 99%. In a further embodiment, excess of a compound having Formula X is at least about the enantiomeric excess of a compound having Formula XI is 95%. In a further embodiment, the enantiomeric excess of a at least about 90%. Inafurther embodiment, the enantiomeric compound having Formula X is at least about 98%. In a excess of a compound having Formula XI is at least about further embodiment, the enantiomeric excess of a compound 95%. In a further embodiment, the enantiomeric excess of a 30 compound having Formula XI is at least about 98%. In a having Formula X is at least about 99%. further embodiment, the enantiomeric excess of a compound In another embodiment, Compounds of the Disclosure are having Formula XI is at least about 99%. compounds having Formula X-A: In another embodiment, Compounds of the Disclosure are 35 compounds having Formula XI-A:

X-A H XI-A O 'N R3 40 H N R5 O l N Y R, l H N R5 O . N Y H 45 O wherein R' does not equal R, and R', R, and R are as defined in connection with Formula I, and R“ is as defined in wherein R' does not equal R, and R', R, and R are as connection with Formula I-A, and the pharmaceutically defined in connection with Formula and R" is as defined in acceptable salts and solvates thereof. In a further embodi 50 connection with Formula I-A, and the pharmaceutically ment, the enantiomeric excess of a compound having For acceptable salts and solvates thereof. In a further embodi mula X-A, in a mixture of compounds having Formulae X-A ment, the enantiomeric excess of a compound having For and XI-A, is at least about 60%, e.g., at least about 65%, at mula XI-A, in a mixture of compounds having Formulae X-A least about 70%, at least about 75%, at least about 80%, at 55 and XI-A, is at least about 60%, e.g., at least about 65%, at least about 85%, at least about 90%, at least about 91%, at least about 70%, at least about 75%, at least about 80%, at least about 92%, at least about 93%, at least about 94%, at least about 85%, at least about 90%, at least about 91%, at least about 95%, at least about 96%, at least about 97%, at least about 92%, at least about 93%, at least about 94%, at least about 98%, or at least about 99%. In a further embodi least about 95%, at least about 96%, at least about 97%, at 60 least about 98%, or at least about 99%. In a further embodi ment, the enantiomeric excess of a compound having For ment, the enantiomeric excess of a compound having For mula X-A is at least about 90%. In a further embodiment, the mula XI-A is at least about 90%. Inafurther embodiment, the enantiomeric excess of a compound having Formula X-A is at enantiomeric excess of a compound having Formula XI-A is least about 95%. In a further embodiment, the enantiomeric at least about 95%. Inafurther embodiment, the enantiomeric excess of a compound having Formula X-A is at least about 65 excess of a compound having Formula XI-A is at least about 98%. In a further embodiment, the enantiomeric excess of a 98%. In a further embodiment, the enantiomeric excess of a compound having Formula X-A is at least about 99%. compound having Formula XI-A is at least about 99%. US 9,127,024 B2 27 28 In another embodiment, Compounds of the Disclosure are thereof. In a further embodiment, R' is selected from the compounds having Formula X or XI, wherein: group consisting of hydrogen, halogen, hydroxy, C alkyl, R" is selected from the group consisting of: Chaloalkyl, Calkoxy, and Chaloalkoxy. In a further embodiment, R'' and R'' are each independently selected from the group consisting of hydrogen, halogen, hydroxy, C. alkyl, Chaloalkyl, Calkoxy, and Chaloalkoxy. R10b HO R7a In a further embodiment, R is R-3. In a further embodiment, \ N Y. R', R', and R" are each independently selected from the 1. group consisting of hydrogen, halogen, hydroxy, C alkyl, to o/ 10 Chaloalkyl, Calkoxy, and Chaloalkoxy. In a further 2. Oc s s embodiment, R' is selected from the group consisting of ethyl R7a R7a and n-propyl and R is tert-butyl. In a further embodiment, R' O is tert-butyl and R is optionally substituted phenyl. In a further embodiment, R is 3,5-dimethylphenyl. O s ( and 15 In another embodiment, Compounds of the Disclosure are Y O compounds having Formula X-A or XI-A, wherein: Ho -B R" is selected from the group consisting of: As (HO),B-HNué S. R10; 25 R is selected from the group consisting of R-3, R-4, and R is selected from the group consisting of R-3, R-4, and R-5; RS-5; R" is hydrogen; and R" is hydrogen; and R. R. and Rareas defined in connection with Formula I, 30 R", R. R. R-3, R-4, and R-5 areas defined in connec and the pharmaceutically acceptable salts and Solvates tion with Formula I, and the pharmaceutically acceptable thereof. In a further embodiment, R' is selected from the salts and solvates thereof. In a further embodiment, R'' and group consisting of hydrogen, halogen, hydroxy, C. alkyl, R'' are each independently selected from the group consist Chaloalkyl, Calkoxy, and Chaloalkoxy. In a further ing of hydrogen, halogen, hydroxy, C alkyl, alkoxyalkyl, embodiment, R'' and R'' are each independently selected 35 Chaloalkyl, Calkoxy, and Chaloalkoxy. In a further from the group consisting of hydrogen, halogen, hydroxy, embodiment, R is R-3. In a further embodiment, R', R', C. alkyl, Chaloalkyl, Calkoxy, and Chaloalkoxy. and R" are each independently selected from the group Inafurther embodiment, R is R-3. In a further embodiment, consisting of hydrogen, halogen, hydroxy, C. alkyl, Ca R". R', and R" are each independently selected from the haloalkyl, C. alkoxy, and C. haloalkoxy. In a further group consisting of hydrogen, halogen, hydroxy, C alkyl, 40 embodiment, R' is selected from the group consisting of ethyl Chaloalkyl, Calkoxy, and Chaloalkoxy. In a further and n-propylandR is tert-butyl. Inafurther embodiment, R' embodiment, R' is selected from the group consisting of ethyl is tert-butyl and R is optionally substituted phenyl. In a and n-propyland R is tert-butyl. In a further embodiment, R' further embodiment, at least one of R" or R' is alkoxyalkyl. is tert-butyl and R is optionally substituted phenyl. In a In a further embodiment, R is 3,5-dimethylphenyl. further embodiment, R is 3,5-dimethylphenyl. 45 In another embodiment, Compounds of the Disclosure are In another embodiment, Compounds of the Disclosure are compounds having any one of Formulae I-XI, and the phar compounds having Formula X or XI, wherein: maceutically acceptable salts and Solvates thereof, wherein R is: R" is R-1 or R-8: R' forms a hydroxy acid adduct, and R', R. R. and Rare as defined in connection with Formula I, 50 and the pharmaceutically acceptable salts and Solvates thereof. In another embodiment, Compounds of the Disclosure are compounds having any one of Formulae I-XI, and the phar maceutically acceptable salts and Solvates thereof, wherein 55 R" is R-2: R' forms a hydroxy acid adduct; and R', R. R. and Rare as defined in connection with Formula I, and the pharmaceutically acceptable salts and Solvates thereof. OH In another embodiment, Compounds of the Disclosure are compounds having any one of Formulae I-XI, and the phar R is selected from the group consisting of R-3, R-4, and 60 maceutically acceptable salts and Solvates thereof, wherein RS-5; R is R-3; R forms a hydroxy acid adduct, and R', R. R. R" is selected from the group consisting of hydrogen, and Rare as defined in connection with Formula I, and the halogen, and C alkyl, Chaloalkyl, Calkoxy, and Ca pharmaceutically acceptable salts and Solvates thereof. haloalkoxy, and In another embodiment, Compounds of the Disclosure are R" is hydrogen; and 65 compounds having any one of Formulae I-XI, and the phar R. R. and Rareas defined in connection with Formula I, maceutically acceptable salts and Solvates thereof, wherein and the pharmaceutically acceptable salts and Solvates R" is R-4; R' forms a hydroxy acid adduct, and R', R. R. US 9,127,024 B2 29 30 and Rare as defined in connection with Formula I, and the XI-A, and the pharmaceutically acceptable salts and Solvates pharmaceutically acceptable salts and Solvates thereof. thereof, wherein R* is R-11, R-12, or R-12: R is In another embodiment, Compounds of the Disclosure are (CRR (), B(R12c)(R12); B(R12)(R12) forms a compounds having any one of Formulae I-XI, and the phar fluoride adduct; and R', R. R. and R are as defined in maceutically acceptable salts and Solvates thereof, wherein connection with Formula I, and the pharmaceutically accept R is R-1; R forms a hydroxy acid adduct, and R', R. R. able salts and solvates thereof. and R are as defined in connection with Formula I, and the pharmaceutically acceptable salts and Solvates thereof. In another embodiment, Compounds of the Disclosure are In another embodiment, Compounds of the Disclosure are compounds having the formula: compounds having any one of Formulae I-XI, and the phar 10 maceutically acceptable salts and Solvates thereof, wherein R is R-2: Rs forms a hydroxy acid adduct, and R', R. R. and Rare as defined in connection with Formula I, and the pharmaceutically acceptable salts and Solvates thereof. In another embodiment, Compounds of the Disclosure are 15 compounds having any one of Formulae I-XI, and the phar maceutically acceptable salts and Solvates thereof, wherein R" is R-1 or R-8: R' forms an amino acid adduct, and R', R. R. and Rare as defined in connection with Formula I, and the pharmaceutically acceptable salts and Solvates thereof. In another embodiment, Compounds of the Disclosure are compounds having any one of Formulae I-XI, and the phar maceutically acceptable salts and Solvates thereof, wherein O R" is R-2: R' forms an amino acid adduct; and R', R. R. 25 and Rare as defined in connection with Formula I, and the N O pharmaceutically acceptable salts and Solvates thereof. In another embodiment, Compounds of the Disclosure are H compounds having any one of Formulae I-XI, and the phar maceutically acceptable salts and Solvates thereof, wherein 30 R" is R-3; R forms an amino acid adduct, and R', R. R. B and Rare as defined in connection with Formula I, and the HO1NOH pharmaceutically acceptable salts and Solvates thereof. In another embodiment, Compounds of the Disclosure are compounds having any one of Formulae I-XI, and the phar 35 maceutically acceptable salts and Solvates thereof, wherein O N R" is R-4; R' forms an amino acid adduct, and R', R. R. and Rare as defined in connection with Formula I, and the pharmaceutically acceptable salts and Solvates thereof. In another embodiment, Compounds of the Disclosure are 40 compounds having any one of Formulae I-XI, and the phar maceutically acceptable salts and Solvates thereof, wherein R is R-1; R forms an amino acid adduct, and R', R. R. and Rare as defined in connection with Formula I, and the pharmaceutically acceptable salts and Solvates thereof. 45 In another embodiment, Compounds of the Disclosure are compounds having any one of Formulae I-XI, and the phar maceutically acceptable salts and Solvates thereof, wherein R is R-2: R's forms an amino acid adduct, and R', R. R. and Rare as defined in connection with Formula I, and the 50 pharmaceutically acceptable salts and Solvates thereof. In another embodiment, Compounds of the Disclosure are compounds having any one of Formulae I-XI, and the phar maceutically acceptable salts and Solvates thereof, wherein R is R-5, R-6, or R-7; R is (CR'R''), B(R'2) 55 (R'); B(R')(R') forms a fluoride adduct; and R', R, R, and Rare as defined in connection with Formula I, and the pharmaceutically acceptable salts and Solvates thereof. In another embodiment, Compounds of the Disclosure are compounds having any one of Formulae I-XI, and the phar 60 maceutically acceptable salts and Solvates thereof, wherein R is R-5, R-6, or R-7; Roe is (CR'R'''), B(R'2) (R'); B(R')(R') forms a fluoride adduct; and R', R, R, and Rare as defined in connection with Formula I, and the pharmaceutically acceptable salts and Solvates thereof. 65 In another embodiment, Compounds of the Disclosure are compounds having any one of Formulae IA, II-A, X-A, or US 9,127,024 B2 31 32 -continued -continued N Nl-k O N

F 10 B 1 n HO O H aYY aSai Y

N 15 N O Y YX Y. Y.O 1. N HO n B / HO YYYYY-Y

F H A, 25 O

N O N Y H HO n B 30 M HO HHHOOO nnn NNN NHNHN OOO 35 HHH FOFOFO O N O N O NA. k HO HO 40 n C N1 B F n B OH YalYa.1 Yaa1 CD 45 k O 50 NA. HO n B F C OH 2 55

60

65

US 9,127,024 B2 37 38 -continued -continued H w O w N1 N O H

10 On No B-0 O

15

HN-N OH

O O OH

25

30

35

40

45

50

55

65

US 9,127,024 B2 41 42 -continued -continued H 4, O

Y N O N H

10

15 N1 N O H

HO-B F O

H

O 25 N1 NH H

HO-B F

30 O

H O N-N

35 O R 40 BNOH

45

50

55

60

65 US 9,127,024 B2 43 44 -continued -continued

N O N HO

O C \/B

15 O Nl-k O N Y HO CO

25 |

N O N HO 30 CO Y.1.IY YN. Y.

35

N O

HO 40

O /Yp C D CN D 45 O

N O N 1. 50 HO H N B / 'N / 55

NON O 60 N 1 CD3 HO H N B / 65 'N /

US 9,127,024 B2 49 50 TABLE A-continued Cpd No. Structure Name

95 H O spirobenzoc1,2Oxaborole-1,2'- -- F O 1.3.2 oxazaborollidine-6-carbohydrazide r).ON -N O M N O H

For the purpose of the present disclosure, the term “alkyl exemplary cycloalkyl groups include cyclopropyl, cyclobu as used by itselfor as part of another group refers to a straight tyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, nor or branched-chain aliphatic hydrocarbon containing one to bornyl, decalin, adamantyl, cyclohexenyl, and the like. twelve carbon atoms (i.e., C. alkyl) or the number of car For the purpose of the present disclosure, the term “option bon atoms designated (i.e., a C alkyl such as methyl, a C ally substituted cycloalkyl as used by itself or as part of alkyl Such as ethyl, a C alkyl such as propyl or isopropyl. another group means that the cycloalkyl as defined above is etc.). In one embodiment, the alkyl group is chosen from a either unsubstituted or substituted with one, two, or three straight chain Co alkyl group. In another embodiment, the 25 Substituents independently chosen from halo, nitro, cyano, alkyl group is chosen from a branched chain Co alkyl hydroxy, amino, alkylamino, dialkylamino, haloalkyl, group. In another embodiment, the alkyl group is chosen from hydroxyalkyl, alkoxy, haloalkoxy, aryloxy, aralkyloxy, alky a straight chain C alkyl group. In another embodiment, the lthio, carboxamido, Sulfonamido, alkylcarbonyl, arylcarbo alkyl group is chosen from a branched chain C- alkyl group. nyl, alkylsulfonyl, arylsulfonyl, ureido, guanidino, carboxy, In another embodiment, the alkyl group is chosen from a 30 carboxyalkyl, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, het straight chain C alkyl group. In another embodiment, the eroaryl, heterocyclo, alkoxyalkyl, (amino)alkyl, hydroxy alkyl group is chosen from a branched chain Calkyl group. alkylamino, (alkylamino)alkyl, (dialkylamino)alkyl, (cyano) In another embodiment, the alkyl group is chosen from a alkyl, (carboxamido)alkyl, mercaptoalkyl, (heterocyclo) straight or branched chain C alkyl group. In another alkyl, and (heteroaryl)alkyl. In one embodiment, the embodiment, the alkyl group is partially or completely deu 35 optionally substituted cycloalkyl is substituted with two sub terated, i.e., one or more hydrogen atoms of the alkyl group stituents. In another embodiment, the optionally substituted are replaced with deuterium atoms. Non-limiting exemplary cycloalkyl is substituted with one substituent. Co alkyl groups include methyl (including -CDs), ethyl, For the purpose of the present disclosure, the term propyl, isopropyl, butyl, sec-butyl, tert-butyl, iso-butyl, “cycloalkenyl' as used by itselfor part of another group refers 3-pentyl, hexyl, heptyl, octyl, nonyl, decyl, and the like. Non 40 to a partially unsaturated cycloalkyl group as defined above. limiting exemplary C alkyl groups include methyl, ethyl, In one embodiment, the cycloalkenyl has one carbon-to-car propyl, isopropyl, butyl, Sec-butyl, tert-butyl, and iso-butyl. bon double bond. In another embodiment, the cycloalkenyl For the purpose of the present disclosure, the term “option group is chosen from a Cas cycloalkenyl group. Exemplary ally substituted alkyl as used by itself or as part of another cycloalkenyl groups include cyclopentenyl, cyclohexenyl group means that the alkyl as defined above is either unsub 45 and the like. stituted or substituted with one, two, or three substituents For the purpose of the present disclosure, the term “option independently chosen from nitro, haloalkoxy, aryloxy, ally substituted cycloalkenyl as used by itself or as part of aralkyloxy, alkylthio. Sulfonamido, alkylcarbonyl, arylcarbo another group means that the cycloalkenyl as defined above is nyl, alkylsulfonyl, arylsulfonyl, ureido, guanidino, carboxy, either unsubstituted or substituted with one, two, or three carboxyalkyl, cycloalkyl, and the like. In one embodiment, 50 Substituents independently chosen from halo, nitro, cyano, the optionally substituted alkyl is substituted with two sub hydroxy, amino, alkylamino, dialkylamino, haloalkyl, mono stituents. In another embodiment, the optionally substituted hydroxyalkyl, dihydroxyalkyl, alkoxy, haloalkoxy, aryloxy, alkyl is substituted with one substituent. Non-limiting exem aralkyloxy, alkylthio, carboxamido, Sulfonamido, alkylcar plary optionally Substituted alkyl groups include bonyl, arylcarbonyl, alkylsulfonyl, arylsulfonyl, ureido, —CHCHNO, —CHCH-COH, -CHCHSOCH, 55 guanidino, carboxy, carboxyalkyl, alkyl, cycloalkyl, alkenyl, —CH-CHCOPh, —CHCH, and the like. alkynyl, aryl, heteroaryl, heterocyclo, alkoxyalkyl, (amino) For the purpose of the present disclosure, the term alkyl, hydroxyalkylamino, (alkylamino)alkyl, (dialky “cycloalkyl as used by itselfor as part of another group refers lamino)alkyl, (cyano)alkyl, (carboxamido)alkyl, mercap to saturated and partially unsaturated (containing one or two toalkyl, (heterocyclo)alkyl, and (heteroaryl)alkyl. In one double bonds) cyclic aliphatic hydrocarbons containing one 60 embodiment, the optionally substituted cycloalkenyl is sub to three rings having from three to twelve carbon atoms (i.e., stituted with two substituents. In another embodiment, the C-2 cycloalkyl) or the number of carbons designated. In one optionally substituted cycloalkenyl is substituted with one embodiment, the cycloalkyl group has two rings. In one substituent. In another embodiment, the cycloalkenyl is embodiment, the cycloalkyl group has one ring. In another unsubstituted. embodiment, the cycloalkyl group is chosen from a Cls 65 For the purpose of the present disclosure, the term “alk cycloalkyl group. In another embodiment, the cycloalkyl enyl as used by itself or as part of another group refers to an group is chosen from a C cycloalkyl group. Non-limiting alkyl group as defined above containing one, two or three US 9,127,024 B2 51 52 carbon-to-carbon double bonds. In one embodiment, the alk cycloalkyl, optionally substituted alkenyl or optionally Sub enyl group is chosen from a C- alkenyl group. In another stituted alkynyl attached to a terminal oxygen atom. In one embodiment, the alkenyl group is chosen from a C- alkenyl embodiment, the alkoxy group is chosen from a C alkoxy group. Non-limiting exemplary alkenyl groups include ethe group. In another embodiment, the alkoxy group is chosen nyl, propenyl, isopropenyl, butenyl, sec-butenyl, pentenyl, from a C alkyl attached to a terminal oxygen atom, e.g., and hexenyl. methoxy, ethoxy, and tert-butoxy. For the purpose of the present disclosure, the term “option For the purpose of the present disclosure, the term “alky ally substituted alkenyl as used herein by itself or as part of lthio’ as used by itself or as part of another group refers to a another group means the alkenyl as defined above is either sulfur atom substituted by an optionally substituted alkyl unsubstituted or substituted with one, two or three substitu 10 group. In one embodiment, the alkylthio group is chosen from ents independently chosen from halo, nitro, cyano, hydroxy, a C alkylthio group. Non-limiting exemplary alkylthio amino, alkylamino, dialkylamino, haloalkyl, hydroxyalkyl, groups include —SCH, and —SCHCH. alkoxy, haloalkoxy, aryloxy, aralkyloxy, alkylthio, carboxa For the purpose of the present disclosure, the term “alkoxy mido, Sulfonamido, alkylcarbonyl, arylcarbonyl, alkylsulfo alkyl as used by itself or as part of another group refers to an nyl, arylsulfonyl, ureido, guanidino, carboxy, carboxyalkyl, 15 alkyl group Substituted with an alkoxy group. Non-limiting alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, or hetero exemplary alkoxyalkyl groups include methoxymethyl, cyclo. methoxyethyl, methoxypropyl, methoxybutyl, ethoxym For the purpose of the present disclosure, the term “alky ethyl, ethoxyethyl, ethoxypropyl, ethoxybutyl, propoxym nyl' as used by itself or as part of another group refers to an ethyl, iso-propoxymethyl, propoxyethyl, propoxypropyl. alkyl group as defined above containing one to three carbon butoxymethyl, tert-butoxymethyl, isobutoxymethyl, sec-bu to-carbon triple bonds. In one embodiment, the alkynyl has toxymethyl, and pentyloxymethyl. one carbon-to-carbon triple bond. In one embodiment, the For the purpose of the present disclosure, the term alkynyl group is chosen from a C- alkynyl group. In another “haloalkoxy” as used by itself or as part of another group embodiment, the alkynyl group is chosen from a C- alkynyl refers to a haloalkyl attached to a terminal oxygen atom. group. Non-limiting exemplary alkynyl groups include ethy 25 Non-limiting exemplary haloalkoxy groups include fluo nyl, propynyl, butynyl, 2-butynyl, pentynyl, and hexynyl romethoxy, difluoromethoxy, trifluoromethoxy, and 2.2.2-tri groups. fluoroethoxy. For the purpose of the present disclosure, the term “option For the purpose of the present disclosure, the term “het ally substituted alkynyl as used herein by itself or as part of eroalkyl as used by itself or part of another group refers to a another group means the alkynyl as defined above is either 30 stable straight or branched chain hydrocarbon radical con unsubstituted or substituted with one, two or three substitu taining 1 to 10 carbon atoms and at least two heteroatoms, ents independently chosen from halo, nitro, cyano, hydroxy, which can be the same or different, selected from O, N, or S, amino, alkylamino, dialkylamino, haloalkyl, hydroxyalkyl, wherein: 1) the nitrogen atom(s) and Sulfur atom(s) can alkoxy, haloalkoxy, aryloxy, aralkyloxy, alkylthio, carboxa optionally be oxidized; and/or 2) the nitrogen atom(s) can mido, Sulfonamido, alkylcarbonyl, arylcarbonyl, alkylsulfo 35 optionally be quaternized. The heteroatoms can be placed at nyl, arylsulfonyl, ureido, guanidino, carboxy, carboxyalkyl, any interior position of the heteroalkyl group or at a position alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, or hetero at which the heteroalkyl group is attached to the remainder of cyclo. the molecule. In one embodiment, the heteroalkyl group con For the purpose of the present disclosure, the term tains two oxygenatoms. Non-limiting exemplary heteroalkyl “haloalkyl as used by itself or as part of another group refers 40 groups include —CHOCHCHOCH, to an alkyl group Substituted by one or more fluorine, chlo –OCHCHOCH2CHOCH, -CH-NHCHCHOCH, rine, bromine and/or iodine atoms. In one embodiment, the –OCHCH-NH. NHCHCHN(H)CH, and alkyl group is substituted by one, two, or three fluorine and/or –OCHCHOCH. chlorine atoms. In another embodiment, the haloalkyl group For the purpose of the present disclosure, the term “arylas is chosen from a Chaloalkyl group. Non-limiting exem 45 used by itself or as part of another group refers to a monocy plary haloalkyl groups include fluoromethyl, difluoromethyl, clic or bicyclic aromatic ring system having from six to four trifluoromethyl, pentafluoroethyl, 1,1-difluoroethyl, 2,2-dif teen carbonatoms (i.e., C-Caryl). Non-limiting exemplary luoroethyl, 2.2.2-trifluoroethyl, 3,3,3-trifluoropropyl, 4.4.4- aryl groups include phenyl (abbreviated as “Ph'), naphthyl, trifluorobutyl, and trichloromethyl groups. phenanthryl, anthracyl, indenyl, aZulenyl, biphenyl, biphe For the purpose of the present disclosure, the term 50 nylenyl, and fluorenyl groups. In one embodiment, the aryl “hydroxyalkyl as used by itself or as part of another group group is chosen from phenyl or naphthyl. In one embodiment, refers to an alkyl group Substituted with one or more, e.g., the aryl group is phenyl. one, two, or three, hydroxy groups. In one embodiment, the For the purpose of the present disclosure, the term “option hydroxyalkyl group is a monohydroxyalkyl group, i.e., Sub ally substituted aryl” as used herein by itself or as part of stituted with one hydroxy group. In another embodiment, the 55 another group means that the aryl as defined above is either hydroxyalkyl group is a dihydroxyalkyl group, i.e., Substi unsubstituted or substituted with one to five substituents inde tuted with two hydroxy groups. In another embodiment, the pendently chosen from halo, nitro, cyano, hydroxy, amino, hydroxyalkyl group is chosen from a Ca hydroxyalkyl alkylamino, dialkylamino, haloalkyl, hydroxyalkyl, alkoxy, group. Non-limiting exemplary hydroxyalkyl groups include haloalkoxy, aryloxy, heteroaryloxy, aralkyloxy, alkylthio. hydroxymethyl, hydroxyethyl, hydroxypropyl and hydroxy 60 carboxamido, Sulfonamido, alkylcarbonyl, arylcarbonyl, butyl groups, such as 1-hydroxyethyl, 2-hydroxyethyl, 1.2- alkylsulfonyl, arylsulfonyl, ureido, guanidino, carboxy, car dihydroxyethyl, 2-hydroxypropyl, 3-hydroxypropyl, 3-hy boxyalkyl, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, het droxybutyl, 4-hydroxybutyl, 2-hydroxy-1-methylpropyl, and eroaryl, heterocyclo, alkoxyalkyl, (amino)alkyl, hydroxy 1,3-dihydroxyprop-2-yl. alkylamino, (alkylamino)alkyl, (dialkylamino)alkyl, (cyano) For the purpose of the present disclosure, the term 65 alkyl, (carboxamido)alkyl, mercaptoalkyl, (heterocyclo) “alkoxy” as used by itself or as part of another group refers to alkyl, (cycloalkylamino)alkyl, (C-C haloalkoxy)alkyl, or an optionally substituted alkyl, optionally substituted (heteroaryl)alkyl. In one embodiment, the optionally substi US 9,127,024 B2 53 54 tuted aryl is an optionally substituted phenyl. In one embodi din-4-yl, and pyrimidin-5-yl), thiazolyl (e.g., thiazol-2-yl, ment, the optionally substituted phenyl has four substituents. thiazol-4-yl, and thiazol-5-yl), isothiazolyl (e.g., isothiazol In another embodiment, the optionally substituted phenyl has 3-yl, isothiazol-4-yl, and isothiazol-5-yl), oxazolyl (e.g., three substituents. In another embodiment, the optionally oxazol-2-yl, oxazol-4-yl, and oxazol-5-yl) and isoxazolyl substituted phenyl has two substituents. In another embodi (e.g., isoxazol-3-yl, isoxazol-4-yl, and isoxazol-5-yl). The ment, the optionally Substituted phenyl has one Substituent. term "heteroaryl' is also meant to include possible N-oxides. Non-limiting exemplary Substituted aryl groups include Exemplary N-oxides include pyridyl N-oxide and the like. 2-methylphenyl, 2-methoxyphenyl, 2-fluorophenyl, 2-chlo For the purpose of the present disclosure, the term “option rophenyl, 2-bromophenyl, 3-methylphenyl, 3-methoxyphe ally substituted heteroaryl as used by itself or as part of nyl, 3-fluorophenyl, 3-chlorophenyl, 4-methylphenyl, 4-eth 10 another group means that the heteroaryl as defined above is ylphenyl, 4-methoxyphenyl, 4-fluorophenyl, 4-chlorophenyl, either unsubstituted or substituted with one to four substitu 2,6-di-fluorophenyl, 2,6-di-chlorophenyl, 2-methyl, 3-meth ents, e.g., one or two Substituents, independently chosen from oxyphenyl, 2-ethyl 3-methoxyphenyl, 3,4-di-methoxyphe halo, nitro, cyano, hydroxy, amino, alkylamino, dialky nyl, 3,5-di-fluorophenyl 3,5-di-methylphenyl, 3.5- lamino, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, ary dimethoxy, 4-methylphenyl, 2-fluoro-3-chlorophenyl, and 15 loxy, aralkyloxy, alkylthio, carboxamido, Sulfonamido, alky 3-chloro-4-fluorophenyl. The term optionally substituted aryl lcarbonyl, arylcarbonyl, alkylsulfonyl, arylsulfonyl, ureido, is meant to include groups having fused optionally Substi guanidino, carboxy, carboxyalkyl, alkyl, cycloalkyl, alkenyl, tuted cycloalkyl and fused optionally substituted heterocyclo alkynyl, aryl, heteroaryl, heterocyclo, alkoxyalkyl, (amino) rings. Examples include: alkyl, hydroxyalkylamino, (alkylamino)alkyl, (dialky lamino)alkyl, (cyano)alkyl, (carboxamido)alkyl, mercap toalkyl, (heterocyclo)alkyl, and (heteroaryl)alkyl. In one embodiment, the optionally substituted heteroaryl has one substituent. In one embodiment, the optionally substituted is 25 an optionally substituted pyridyl, i.e., 2-, 3-, or 4-pyridyl. Any COOCO available carbon or nitrogen atom can be substituted. In another embodiment, the optionally substituted heteroaryl is For the purpose of the present disclosure, the term “ary an optionally Substituted indole. loxy” as used by itself or as part of another group refers to an For the purpose of the present disclosure, the term "hetero optionally Substituted aryl attached to a terminal oxygen 30 cycle' or "heterocyclo” as used by itself or as part of another atom. A non-limiting exemplary aryloxy group is PhO—. group refers to saturated and partially unsaturated (e.g., con For the purpose of the present disclosure, the term “het taining one or two double bonds) cyclic groups containing eroaryloxy” as used by itselforas part of another group refers one, two, or three rings having from three to fourteen ring to an optionally substituted heteroaryl attached to a terminal members (i.e., a 3- to 14-membered heterocyclo) and at least OXygen atom. 35 one heteroatom. Each heteroatom is independently selected For the purpose of the present disclosure, the term “aralky from the group consisting of oxygen, Sulfur, including Sul loxy' or “arylalkyloxy” as used by itself or as part of another foxide and Sulfone, and/or nitrogen atoms, which can be group refers to anaralkyl group attached to a terminal oxygen quaternized. The term "heterocyclo' is meant to include atom. A non-limiting exemplary aralkyloxy group is cyclic ureido groups such as 2-imidazolidinone and cyclic PhCHO 40 amide groups such as B-lactam, Y-lactam, Ö-lactam and e-lac For the purpose of the present disclosure, the term “het tam. The term "heterocyclo' is also meant to include groups eroaryl' or "heteroaromatic' refers to monocyclic and bicy having fused optionally Substituted aryl groups, e.g., indoli clic aromatic ring systems having 5 to 14 ring atoms (i.e., nyl. In one embodiment, the heterocyclogroup is chosen from Cs-C heteroaryl) and 1, 2, 3, or 4 heteroatoms indepen a 5- or 6-membered cyclic group containing one ring and one dently chosen from oxygen, nitrogen and Sulfur. In one 45 or two oxygen and/or nitrogenatoms. The heterocyclo can be embodiment, the heteroaryl has three heteroatoms. In another optionally linked to the rest of the molecule through a carbon embodiment, the heteroaryl has two heteroatoms. In another or nitrogen atom. Non-limiting exemplary heterocyclo embodiment, the heteroaryl has one heteroatom. In one groups include 2-oxopyrrolidin-3-yl, 2-imidazolidinone, pip embodiment, the heteroaryl is a C. heteroaryl. In another eridinyl, morpholinyl, piperazinyl, pyrrolidinyl, and indoli embodiment, the heteroaryl is a Cheteroaryl. Non-limiting 50 nyl. exemplary heteroaryl groups include thienyl, benzobthie For the purpose of the present disclosure, the term “option nyl, naphtho2,3-bithienyl, thianthrenyl, furyl, benzofuryl, ally substituted heterocyclo” as used herein by itself or part of pyranyl, isobenzofuranyl, benzooxazonyl, chromenyl, Xan another group means the heterocyclo as defined above is thenyl, 2H-pyrrolyl pyrrolyl, imidazolyl, pyrazolyl, pyridyl, either unsubstituted or substituted with one to four substitu pyrazinyl, pyrimidinyl, pyridazinyl, isoindolyl. 3H-indolyl, 55 ents independently selected from halo, nitro, cyano, hydroxy, indolyl, indazolyl, purinyl, isoquinolyl, quinolyl, phthalazi amino, alkylamino, dialkylamino, haloalkyl, hydroxyalkyl, nyl, naphthyridinyl, cinnolinyl, quinazolinyl, pteridinyl, alkoxy, haloalkoxy, aryloxy, aralkyloxy, alkylthio, carboxa 4aH-carbazolyl, carbazolyl, B-carbolinyl, phenanthridinyl, mido, Sulfonamido, alkylcarbonyl, arylcarbonyl, alkylsulfo acridinyl, pyrimidinyl, phenanthrolinyl, phenazinyl, thiaz nyl, arylsulfonyl, ureido, guanidino, carboxy, carboxyalkyl, olyl, isothiazolyl, phenothiazolyl, isoxazolyl, furazanyl, and 60 alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocy phenoxazinyl. In one embodiment, the heteroaryl is chosen clo, alkoxyalkyl, (amino)alkyl, hydroxyalkylamino, (alky from thienyl (e.g., thien-2-yland thien-3-yl), furyl (e.g., 2-fu lamino)alkyl, (dialkylamino)alkyl, (cyano)alkyl, (carboxa ryland 3-furyl), pyrrolyl (e.g., 1H-pyrrol-2-yland 1H-pyrrol mido)alkyl, mercaptoalkyl, (heterocyclo)alkyl, (heteroaryl) 3-yl), imidazolyl (e.g., 2H-imidazol-2-yl and 2H-imidazol alkyl, and the like. Substitution may occur on any available 4-yl), pyrazolyl (e.g., 1H-pyrazol-3-yl, 1 H-pyrazol-4-yl, and 65 carbon or nitrogen atom, and may form a spirocycle. 1H-pyrazol-5-yl), pyridyl (e.g., pyridin-2-yl, pyridin-3-yl, For the purpose of the present disclosure, the term "amino” and pyridin-4-yl), pyrimidinyl (e.g., pyrimidin-2-yl, pyrimi as used by itself or as part of another group refers to —NH2. US 9,127,024 B2 55 56 For the purpose of the present disclosure, the term “alky from a 3- to 8-membered heterocyclo group. Non-limiting lamino” as used by itselfor as part of another group refers to exemplary sulfonamido groups include —SONH, -SON NHR’, wherein R is alkyl. (H)CH, and -SON(H)Ph. For the purpose of the present disclosure, the term “dialky For the purpose of the present disclosure, the term “alkyl lamino” as used by itselfor as part of another group refers to carbonyl as used by itselfor as part of another group refers to —NR'R'', wherein RandR are each independently a carbonyl group, i.e., —C(=O)—, Substituted by an alkyl alkyl or R'' and R are taken together to form a 3- to group. A non-limiting exemplary alkylcarbonyl group is 8-membered optionally substituted heterocyclo. - COCH. For the purpose of the present disclosure, the term For the purpose of the present disclosure, the term “aryl “hydroxyalkylamino” as used by itself or as part of another 10 carbonyl as used by itselfor as part of another group refers to group refers to NHR, wherein R is hydroxyalkyl. a carbonyl group, i.e., —C(=O)—, Substituted by an option For the purpose of the present disclosure, the term ally substituted aryl group. A non-limiting exemplary aryl “cycloalkylamino” as used by itself or as part of another carbonyl group is COPh. group refers to NR'R' wherein R is optionally sub 15 For the purpose of the present disclosure, the term “alkyl stituted cycloalkyl and R’ is hydrogen or alkyl. sulfonyl as used by itself or as part of another group refers to For the purpose of the present disclosure, the term “(ami a Sulfonyl group, i.e., -SO. , Substituted by any of the no)alkyl as used by itself or as part of another group refers to above-mentioned optionally Substituted alkyl groups. A non an alkyl group Substituted with an amino group. Non-limiting limiting exemplary alkylsulfonyl group is —SOCH. exemplary amino alkyl groups include —CH2CHNH2, For the purpose of the present disclosure, the term “aryl —CHCHCH-NH. —CHCHCHCH-NH and the like. sulfonyl as used by itself or as part of another group refers to For the purpose of the present disclosure, the term “(alky a Sulfonyl group, i.e., -SO. , Substituted by any of the lamino)alkyl as used by itself or as part of another group above-mentioned optionally substituted aryl groups. A non refers to an alkyl group Substituted with an alkylamino group. limiting exemplary arylsulfonyl group is —SOPh. A non-limiting exemplary (alkylamino)alkyl group is 25 For the purpose of the present disclosure, the term “mer —CHCHN(H)CH. captoalkyl as used by itselfor as part of another group refers For the purpose of the present disclosure, the term “(di to any of the above-mentioned alkyl groups substituted by a alkylamino)alkyl as used by itselfor as part of another group —SH group. refers to an alkyl group Substituted by a dialkylamino group. For the purpose of the present disclosure, the term “car A non-limiting exemplary (dialkylamino)alkyl group is 30 boxy” as used by itself or as part of another group refers to a radical of the formula—COOH. —CHCHN(CH). For the purpose of the present disclosure, the term "car For the purpose of the present disclosure, the term “(cy boxyalkyl as used by itself or as part of another group refers cloalkylamino)alkyl as used by itself or as part of another to any of the above-mentioned alkyl groups Substituted with a group refers to an alkyl group Substituted by a cycloalky 35 —COOH. A non-limiting exemplary carboxyalkyl group is lamino group. Non-limiting exemplary (cycloalkylamino) -CHCO.H. alkyl groups include —CHN(H)cyclopropyl, —CHN(H) For the purpose of the present disclosure, the term “alkoxy cyclobutyl, and —CHN(H)cyclohexyl. carbonyl as used by itselfor as part of another group refers to For the purpose of the present disclosure, the term “(cyano) a carbonyl group, i.e., —C(=O)—, Substituted by an alkoxy alkyl as used by itselfor as part of another group refers to an 40 group. Non-limiting exemplary alkoxycarbonyl groups are alkyl group Substituted with one or more cyano, e.g., —CN. —COMe and —COEt. groups. Non-limiting exemplary (cyano)alkyl groups include For the purpose of the present disclosure, the term —CHCHCN, - CHCHCHCN, and “aralkyl as used by itself or as part of another group refers to —CHCHCHCHCN. an alkyl group Substituted with one, two, or three optionally For the purpose of the present disclosure, the term “car 45 Substituted aryl groups. In one embodiment, the aralkyl group boxamido” as used by itself or as part of another group refers is a C alkyl Substituted with one optionally Substituted aryl to a radical of formula C(=O)NR'R'', wherein R group. Non-limiting exemplary aralkyl groups include ben and Rare each independently hydrogen, optionally substi Zyl, phenethyl, —CHPh, and —CH(4-F-Ph). tuted alkyl, optionally substituted aryl, or optionally substi For the purpose of the present disclosure, the term “ureido' tuted heteroaryl, or R* and R' taken together with the 50 as used by itself or as part of another group refers to a radical nitrogen to which they are attached from a 3- to 8-membered of the formula NR C(=O) NR'R' wherein R’ heterocyclo group. In one embodiment, R* and R' are is hydrogen, alkyl, or optionally substituted aryl, andR'' and each independently hydrogen or optionally Substituted alkyl. R" are each independently hydrogen, alkyl, or optionally Non-limiting exemplary carboxamido groups include substituted aryl, or R'' and R' taken together with the CONH CONCH)CH, CON(CH), and CON(H)Ph. 55 nitrogen to which they are attached form a 4- to 8-membered For the purpose of the present disclosure, the term “(car heterocyclo group. Non-limiting exemplary ureido groups boxamido)alkyl as used by itself or as part of another group include - NH C(C=O) NH and - NH C(C=O)— refers to an alkyl group Substituted with a carboxamido NHCH group. Non-limiting exemplary (carboxamido)alkyl groups For the purpose of the present disclosure, the term “guani include -CHCONH –C(H)CH CONH, and 60 dino’ as used by itself or as part of another group refers to a -CHCON(H)CH. radical of the formula NR3. C(-NR) NRR, For the purpose of the present disclosure, the term “sul wherein R, R, and Rare each independently hydro fonamido” as used by itself or as part of another group refers gen, alkyl, or optionally substituted aryl, andR is hydrogen, to a radical of the formula -SONR'R'', wherein R' alkyl, cyano, alkylsulfonyl, alkylcarbonyl, carboxamido, or and R'' are each independently hydrogen, optionally substi 65 Sulfonamido. Non-limiting exemplary guanidino groups tuted alkyl, or optionally substituted aryl, or R'' and R' include - NH C(C=NH) NH, -NH C(C—NCN)— taken together with the nitrogen to which they are attached NH, -NH C(C—NH) NHCH and the like. US 9,127,024 B2 57 58 For the purpose of the present disclosure, the term “(het -continued erocyclo)alkyl as used by itself or as part of another group R6d R6d refers to an alkyl group substituted with one, two, or three Rig Rig optionally Substituted heterocyclo groups. In one embodi HN1 B Sé, HN1 B ment, the (heterocyclo)alkyl is a C alkyl substituted with 5 one optionally Substituted heterocyclo group. DC - O For the purpose of the present disclosure, the term “(het HN N 2. HN N 2. eroaryl)alkyl as used by itself or as part of another group R-4 R-4 refers to an alkyl group substituted with one, two, or three 10 optionally substituted heteroaryl groups. In one embodiment, the (heteroaryl)alkyl group is a Calkyl Substituted with one The following tautomers of R-6 and R-4 of Formula I are optionally substituted heteroaryl group. encompassed by the present disclosure: For the purpose of the present disclosure, the term “alkyl carbonylamino” as used by itself or as part of another group 15 refers to an alkylcarbonyl group attached to an amino A non-limiting exemplary alkylcarbonylamino group is —NH COCH, The present disclosure encompasses any of the Com pounds of the Disclosure being isotopically-labelled (i.e., ()-- (- radiolabeled) by having one or more atoms replaced by an R-6 R-6 atom having a different atomic mass or mass number. Examples of isotopes that can be incorporated into the dis closed compounds include isotopes of hydrogen, carbon, 25 iy , iy , nitrogen, oxygen, phosphorous, fluorine and chlorine, Such as ( W ( W *H (or deuterium (D)), H, C, C, C, N, O, ''O, P, NR HN P, S, F and C1, respectively, e.g., H, ''C, and ''C. In OH one embodiment, provided is a composition wherein Substan R-4 R-4 tially all of the atoms at a position within the Compound of the 30 Disclosure are replaced by an atom having a different atomic mass or mass number. In another embodiment, provided is a As used herein, the term “stereoisomers' is a general term composition wherein a portion of the atoms at a position for all isomers of individual molecules that differ only in the within the Compound of the disclosure are replaced, i.e., the orientation of their atoms in space. It includes enantiomers 35 and isomers of compounds with more than one chiral center Compound of the Disclosure is enriched at a position with an that are not mirror images of one another (diastereomers). atom having a different atomic mass or mass number. Isoto The term "chiral center” or “asymmetric carbon atom’ pically-labelled Compounds of the Disclosure can be pre refers to a carbon atom to which four different groups are pared by methods known in the art. attached. Compounds of the Disclosure may contain one or more 40 The terms “enantiomer' and “enantiomeric' refer to a mol asymmetric centers and may thus give rise to enantiomers, ecule that cannot be Superimposed on its mirror image and diastereomers, and other stereoisomeric forms. The present hence is optically active wherein the enantiomer rotates the disclosure is meant to encompass the use of all such possible plane of polarized light in one direction and its mirror image forms, as well as their racemic and resolved forms and mix compound rotates the plane of polarized light in the opposite tures thereof. The individual enantiomers can be separated 45 direction. according to methods known in the art in view of the present The term “racemic’ refers to a mixture of equal parts of disclosure. When the compounds described herein contain enantiomers and which mixture is optically inactive. olefinic double bonds or other centers of geometric asymme The term “absolute configuration” refers to the spatial try, and unless specified otherwise, it is intended that they arrangement of the atoms of a chiral molecular entity (or 50 group) and its stereochemical description, e.g., R or S. include both E and Z geometric isomers. All tautomers are The Stereochemical terms and conventions used in the intended to be encompassed by the present disclosure as well. specification are meant to be consistent with those described For example, the following tautomers of R-5 of Formula I in Pure & Appl. Chem. 68:2193 (1996), unless otherwise are encompassed by the present disclosure: indicated. 55 The term “enantiomeric excess' or “ee' refers to a measure for how much of one enantiomer is present compared to the other. For a mixture of R and S enantiomers, the percent enantiomeric excess is defined as R-S*100, where R and S R6d R6d are the respective mole or weight fractions of enantiomers in 60 a mixture such that R+S-1. With knowledge of the optical a? rotation of a chiral Substance, the percentenantiomeric excess HN1 S^ HN1 ^ is defined (C/C) 100, where C. is the optical rotation of the mixture of enantiomers and C. is the opti HO N 2. O N 2. cal rotation of the pure enantiomer. Determination of enan 65 tiomeric excess is possible using a variety of analytical tech R-4 R-4 niques, including NMR spectroscopy, chiral column chromatography or optical polarimetry. US 9,127,024 B2 59 60

The terms “enantiomerically pure' or “enantiopure” refer -continued to a sample of a chiral Substance all of whose molecules (within the limits of detection) have the same chirality sense. The terms “enantiomerically enriched or “enantioen riched refer to a sample of a chiral substance whose enan tiomeric ratio is greater than 50:50. Enantiomerically enriched compounds may be enantiomerically pure. The present disclosure encompasses the preparation and use of salts of the Compounds of the Disclosure, including 10 non-toxic pharmaceutically acceptable salts. Examples of OH pharmaceutically acceptable addition salts include inorganic HO N. and organic acid addition salts and basic salts. The pharma ceutically acceptable salts include, but are not limited to, metal salts such as Sodium salt, potassium salt, cesium salt 15 The present disclosure encompasses the preparation and and the like; alkaline earth metals such as calcium salt, mag use of solvates of Compounds of the Disclosure. Solvates nesium salt and the like; organic amine salts such as triethy typically do not significantly alter the physiological activity lamine salt, pyridine salt, picoline salt, ethanolamine salt, or toxicity of the compounds, and as such may function as triethanolamine salt, dicyclohexylamine salt, N,N'-dibenzyl pharmacological equivalents. The term "solvate as used ethylenediamine salt and the like; inorganic acid salts such as herein is a combination, physical association and/or Solvation hydrochloride, hydrobromide, phosphate, sulphate and the of a compound of the present disclosure with a solvent mol like; organic acid salts such as citrate, lactate, tartrate, male ecule Such as, e.g. a disolvate, monosolvate or hemisolvate, ate, fumarate, mandelate, acetate, dichloroacetate, trifluoro where the ratio of solvent molecule to compound of the acetate, oxalate, formate and the like; Sulfonates Such as 25 present disclosure is about 2:1, about 1:1 or about 1:2, respec methanesulfonate, benzenesulfonate, p-toluenesulfonate and tively. This physical association involves varying degrees of the like; and amino acid salts such as arginate, asparginate, ionic and covalent bonding, including hydrogen bonding. In glutamate and the like. certain instances, the Solvate can be isolated. Such as when Acid addition salts can be formed by mixing a solution of one or more solvent molecules are incorporated into the crys the particular Compound of the Disclosure with a solution of 30 tal lattice of a crystalline solid. Thus, “solvate” encompasses a pharmaceutically acceptable non-toxic acid Such as hydro both solution-phase and isolatable solvates. Compounds of chloric acid, fumaric acid, maleic acid, Succinic acid, acetic the Disclosure can be present as solvated forms with a phar acid, citric acid, tartaric acid, carbonic acid, phosphoric acid, maceutically acceptable solvent. Such as water, methanol, oxalic acid, dichloroacetic acid, or the like. Basic salts can be ethanol, and the like, and it is intended that the disclosure formed by mixing a solution of the compound of the present includes both solvated and unsolvated forms of Compounds disclosure with a solution of a pharmaceutically acceptable of the Disclosure. One type of solvate is a hydrate. A non-toxic base Such as Sodium hydroxide, potassium hydrox “hydrate' relates to a particular subgroup of solvates where the solvent molecule is water. Solvates typically can function ide, choline hydroxide, Sodium carbonate and the like. as pharmacological equivalents. Preparation of Solvates is The term “pharmaceutically acceptable salt' is meant to 40 known in the art. See, for example, M. Caira et al., J. Phar include boronic acid salts having the general formula: maceut. Sci., 93(3):601-611 (2004), which describes the preparation of solvates of fluconazole with ethyl acetate and with water. Similar preparation of solvates, hemisolvates, HO O oH M. hydrates, and the like are described by E. C. van Tonder et al., N/ 45 AAPS Pharm. Sci. Tech., 5(1):Article 12 (2004), and A. L. Bingham et al., Chem. Commun. 603-604 (2001). A typical, S. non-limiting, process of preparing a Solvate would involve dissolving a Compound of the Disclosure in a desired solvent 50 (organic, water, or a mixture thereof) at temperatures above wherein M is H" or a monovalent cation. By way of example, 20° C. to about 25°C., then cooling the solution at a rate Compound 53 (see below) is converted to a pharmaceutically Sufficient to form crystals, and isolating the crystals by known acceptable salt by reaction with NaOH according to the fol methods, e.g., filtration. Analytical techniques such as infra lowing scheme: red spectroscopy can be used to confirm the presence of the 55 solvent in a crystal of the solvate. The term “fluoride adduct as used herein refers to the condensation product of a boronic acid having the general formula RB(OH), and KHF. The general structure of a fluo ride adduct is: 60

Nen BF GE)

65 wherein M is a monovalent cation. For example, the fluoride adduct of group R-5 of Formula I, wherein R' is B(OH) is: US 9,127,024 B2 61 62 3-bromophenylglycine, 4-bromophenylglycine, 4-chlo rophenylglycine, 4-methoxyphenylglycine, 4-ethoxyphe R10b nylglycine, 4-hydroxyphenylglycine, 3-hydroxyphenylgly G y N cine, 3,4-dihydroxyphenylglycine, 3,5- GE) FB-t dihydroxyphenylglycine, 2,5-dihydrophenylglycine, 2-fluorophenylglycine, 3-fluorophenylglycine, 4-fluorophe Áe R10d nylglycine, 2,3-difluorophenylglycine, 2,4-difluorophenylg R-5 fluoride adduct lycine, 2,5-difluorophenylglycine, 2,6-difluorophenylgly cine, 3,4-difluorophenylglycine, 3,5-difluorophenylglycine, 10 2-(trifluoromethyl)phenylglycine, 3-(trifluoromethyl)phe The term “hydroxy acid adduct as used herein refers to the nylglycine, 4-(trifluoromethyl)phenylglycine, 2-(2-thienyl) condensation product of a boronic acid having the general glycine, 2-(3-thienyl)glycine, 2-(2-furyl)glycine, 3-pyridylg formula (R)(RO)B—OH and a hydroxy acid having formula lycine, 4-fluorophenylalanine, 4-chlorophenylalanine, HOOC C(R)(R") OH. R' and R" are each independently 2-bromophenylalanine, 3-bromophenylalanine, 4-bro selected from hydrogen, carboxy, optionally Substituted 15 mophenylalanine, 2-naphthylalanine, 3-(2-quinoyl)alanine, alkyl, aralkyl, aminoalkyl, haloalkyl, cyano, (cyano)alkyl, 3-(9-anthracenyl)alanine, 2-amino-3-phenylbutanoic acid, (carboxamido)alkyl, (carboxy)alkyl or hydroxyalkyl, and the 3-chlorophenylalanine, 3-(2-thienyl)alanine, 3-(3-thienyl) like. R' and R" taken together with the carbon atom to which alanine, 3-phenylserine, 3-(2-pyridyl)serine, 3-(3-pyridyl) they are attached form a cycloalkyl or heterocyclo group. serine, 3-(4-pyridyl)serine, 3-(2-thienyl)serine, 3-(2-furyl) Non-limiting exemplary R/R" groups include hydrogen, serine, 3-(2-thiazolyl)alanine, 3-(4-thiazolyl)alanine, 3-(1.2, —CH, -OH, -CH(CH), —CH(CH)(Et), —CHPh. 4-triazol-1-yl)-alanine, 3-(1,2,4-triazol-3-yl)-alanine, hexafluorovaline, 4,4,4-trifluorovaline, 3-fluorovaline, 5.5.5- —CHCH-SCH, - CH-COH, - CHCH-COH, trifluoroleucine, 2-amino-4,4,4-trifluorobutyric acid, 3-chlo —(CH), NH, CHOH, -CH(CH)OH, -CHPh-OH, 25 —CH-imidazole, —CH2SH, —CHC(O)NH2, roalanine, 3-fluoroalanine, 2-amino-3-fluorobutyric acid, —CHCHC(O)NH, -CHCH , —CHCHCH , 3-fluoronorleucine, 4.4.4-trifluorothreonine, L-allylglycine, —CH2CH2CHCH , —CH2CH2CH2CH2CH2—, and tert-Leucine, propargylglycine, vinylglycine, S-methylcys —CHCHOCH2CH2—. In one embodiment, R' is selected teine, cyclopentylglycine, cyclohexylglycine, 3-hydroxynor from the group consisting of —CHPh, —COH, 30 Valine, 4-azaleucine, 3-hydroxyleucine, 2-amino-3-hydroxy 3-methylbutanoic acid, 4-thiaisoleucine, acivicin, ibotenic —CH-COH, and —CHCONH. The general structure of a acid, quisqalic acid, 2-indanylglycine, 2-aminoisobutyric hydroxy acid adduct is: acid, 2-cyclobutyl-2-phenylglycine, 2-isopropyl-2-phenylg lycine, 2-methylvaline, 2,2-diphenylglycine, 1-amino-1-cy 35 clopropanecarboxylic acid, 1-amino-1-cyclopentanecar 2-O R boxylic acid, 1-amino-1-cyclohexanecarboxylic acid, 1. MGE) 3-amino-4,4,4-trifluorobutyric acid, 3-phenylisoserine, O R" 3-amino-2-hydroxy-5-methylhexanoic acid, 3-amino-2-hy droxy-4-phenylbutyric acid, 3-amino-3-(4-bromophenyl) 40 propionic acid, 3-amino-3-(4-chlorophenyl)propionic acid, 3-amino-3-(4-methoxyphenyl)propionic acid, 3-amino-3-(4- wherein M is a monovalent cation. For example, the hydroxy fluorophenyl)propionic acid, 3-amino-3-(2-fluorophenyl) acid adduct of group R-1 of Formula I is: propionic acid, 3-amino-3-(4-nitrophenyl)propionic acid, 45 and 3-amino-3-(1-naphthyl)propionic acid. These non-natu O R R" ral amino acids are commercial available from the following commercial Suppliers including Aldrich, Sigma, Fluka, Lan caster, ICN, TCI, Advanced ChemTech, Oakwood Products, O G) O f GE / R Indofine Chemical Company, NSC Technology, PCR M y Y B S% 50 Research Chemicals, Bachem, Acros Organics, Celgene, Bionet Research, Tyger Scientific, Tocris, Research Plus, Ash Stevens, Kanto, Chiroscience, and Peninsula Lab. The fol n-Sea lowing amino acids can be synthesized according to literature 55 procedures: 3,3,3-trifluoroalanine (Sakai, T.; et al. Tetrahe R-1 hydroxy acid adduct dron 1996, 52, 233) and 3.3-difluoroalanine (DOrchymont, H. Synthesis 1993, 10,961). Other N-protecting groups that The term "amino acid adduct as used herein refers to the can be used in the place of Zinclude Acetyl (Ac), tert-butoxy condensation product of a boronic acid having the general carbonyl (Boc), methoxycarbonyl. or ethoxycarbonyl. Non formula (R)(RO)B—OH and a natural or unnatural. D- or L-, 60 limiting exemplary R"/R" groups include hydrogen, CH, amino acid, including f-amino acids, e.g., an amino acid OH, —CH(CH), —CH(CH)(Et), —CHPh. having formula HOOC C(R") (R") NH. Suitable - CHCH-SCH, -CHCOH, - CHCH-COH, unnatural amino acids include, without limitation, the enan —(CH)NH, CHOH, -CH(CH)OH, -CHPh-OH, tiomeric and racemic forms of 2-methylvaline, 2-methylala 65 —CH-imidazole, —CHSH, —CHC(O)NH, and nine, (2-i-propyl)-3-alanine, phenylglycine, 4-methylphe —CH2CHC(O)NH2. The general structure of a hydroxy acid nylglycine, 4-isopropylphenylglycine, adduct is: US 9,127,024 B2 63 64 In another embodiment, the excipient comprises Labra filR), Labrasol R, GelucireR), LabrafacR), LauroglycolTM 90, SSR R GE) PeceolTM, Transcutol R, Compritol(R), Geloil.R., GeleolTM, or o1 M Precirol R, or a mixture thereof. O R" In another embodiment, the excipient comprises capmul, Captex(R), or Acconon(R), or a mixture thereof. O In another embodiment, the excipient comprises DYNAC ERINR, DYNACETR, DYNASAN, GALENOL(R), IMWI wherein M' is H" or a monovalent cation. By way of example, TOR (Glyceryl Monooleate, Stearate, Caprylate), ISOFOL(R) the amino acid adduct of group R-1 of Formula I is: 10 (long chain alcohols), LIPDXOL(R) (Macrogol), MASSA ESTARINUM (Hydrogenated Coco-Glycerides), MIG LYOL (Caprylic/Capric Triglyceride), NACOL(R), Nafol (al O R' R' cohols), SOFTIGENR), SOFTISANR), WITEPSOL (Hydro genated Coco-Glycerides), or WITOCANR) (Hydrogenated 15 Coco-Gly), or a mixture thereof. O, e NH In another embodiment, the excipient comprises MG) SC Y hypromellose acetate Succinate. In another embodiment, the excipient comprises Solu plus R (polyvinylcaprolactam-polyvinyl acetate-polyethyl S-N-2a ene glycol graft copolymer. Compositions may contain from 0.01% to 99% by weight R-1 amino acid adduct of a Compound of the Disclosure, e.g., about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about The term "monovalent cation' as used herein refers to 8%, about 9%, or about 10%, about 15%, about 20%, about inorganic cations such as, but not limited to, alkaline metal 25 25%, about 30%, about 35%, about 40%, about 45%, about ions, e.g., Na' and K", as well as organic cations such as, but 50%, about 55%, about 60%, about 65%, about 70%, about not limited to, ammonium and Substituted ammonium ions, 75%, about 80%, about 85%, about 90%, or about 95%. The e.g., NH, NHMe", NHMe", NHMe" and NMe". amount in any particular composition will depend upon the As used herein, the term “micronization” refers to a pro effective dose, that is, the dose required to elicit the desired cess or method by which the size of a population of particles 30 level of gene expression. is reduced, typically to the micron Scale. In another aspect, the present disclosure provides micron As used herein, the term “micron' or “um” refer to ized Compounds of the Disclosure, and compositions thereof. “micrometer” which is 1x10 meter. In one embodiment, the average particle size distribution of In another aspect, the present disclosure provides compo the micronized form of a Compound of the Disclosure is sitions comprising a Compound of the Disclosure and one or 35 about 20 um or less, e.g., about 19 um, about 18 um, about 17 more excipients. In one embodiment, the excipient comprises um, about 16 Jum, about 15 um, about 14 um, about 13 um, dimethylsulfoxide or acetone. In one embodiment, the com about 12 um, or about 11 um, or less. In another embodiment, position comprises a pharmaceutically acceptable excipient, the average particle size distribution is about 10 um or less, to provide a “pharmaceutically acceptable composition. In e.g., about 9 um, about 8 um, about 7um, about 6 Lim, or about another embodiment, the composition comprises micronized 40 5um, or less. In another embodiment, the average particle Compounds of the Disclosure. In another embodiment, the size distribution is about 5um or less, e.g., about 4 um, about pharmaceutically acceptable excipient comprises Miglyol 3um, about 2 um, or about 1 lum, or less. In another embodi 812, phospholipon 90G, or tocopheryl polyethylene glycol ment, the average particle size distribution is about 1 um or 1000 succinate, or a mixture thereof. In another embodiment, less, e.g., about 0.9 um, about 0.8 um, about 0.7 um, about 0.6 the pharmaceutically acceptable excipient consists essen 45 um, about 0.5um, about 0.4 um, about 0.3 um, about 0.2 um, tially of Miglyol 812, phospholipon 90G, and tocopheryl about 0.1 um, about 0.09 um, about 0.08 um, about 0.07 um, polyethylene glycol 1000 succinate. In another embodiment, about 0.06 um, about 0.05um, about 0.04 um, about 0.03 um, the pharmaceutically acceptable excipient comprises Labra about 0.02 um, or about 0.01 um or less. SolR). In another embodiment, the pharmaceutically accept In another aspect, the present disclosure provides methods able excipient comprises Sorbitan monolaurate, hydroxypro 50 of making a composition, comprising admixing a Compound pylmethylcellulose acetate Succinate, Sodium taurocholate, of the Disclosure, or a micronized Compound of the Disclo EthocelTM or palmitoyl-oleoyl-phosphatidylcholine, or a Sure, with one or more excipients. In one embodiment, the mixture thereof. In another embodiment, the pharmaceuti excipient is a pharmaceutically acceptable excipient. cally acceptable excipient comprises hydrogenated Soy leci In another aspect, the present disclosure provides methods thin. Compound of the Disclosure can be admixed with one or 55 of regulating gene expression of a gene of interest in a host more excipients using method well known to those of ordi cell, comprising contacting the host cell with a Compound of nary skill in the art. the Disclosure, or a composition thereof. In one embodiment, In another embodiment, the excipient comprises ethanol, the host cell comprises a polynucleotide encoding a gene isopropanol, propylene glycol, benzyl alcohol, glycerin, Sor Switch comprising a ligand binding domain that binds a Com bitol. Sucrose, carbopol, maltodextrin, lycasin (maltitol), 60 pound of the Disclosure, wherein the level of expression of Sodium benzoate, sodium saccharide, lutrol E. F. methyl para the gene of interest is increased, relative to the level of expres ben, propyl paraben, citric acid, capryol 90, Tween 80 sion of the gene of interest in the absence of a Compound of (polysorbate 80), Kollidon R CL-M, polyoxyl Stearate, the Disclosure. In another embodiment, the host cell is an hydroxypropyl methyl cellulose, Cremophor R. RH 40, Cre isolated host cell. In certain other embodiments, an isolated mophor REL, sodium carboxymetyhl cellulose (CMC), guar 65 host cell is genetically modified ex-Vivo (e.g., transformed, gum, Xanthan gum, polyethylene glycol, or polyvinyl pyrroli transfected or infected) with a polynucleotide construct done, or a mixture thereof. encoding a gene Switch comprising a ligand binding domain US 9,127,024 B2 65 66 that binds a Compound of the Disclosure. In another embodi encoding a gene Switch that comprises a ligand binding ment, the ex-Vivo genetically modified host cell is adminis domain that binds a Compound of the Disclosure. In one tered to a Subject. In certain embodiments, the expression of embodiment, a host cell within a non-human organism com a gene of interest is under the control of the gene Switch prises a polynucleotide encoding a gene Switch that com comprising a ligand binding domain that binds a Compound prises a ligand binding domain that binds a Compound of the of the Disclosure. In another embodiment, the host cell is in a Disclosure. In another embodiment, the Subject is human. In Subject, e.g., an animal, e.g., a human. For example, one or another embodiment, the disease, disorder, injury, or condi more cells (host cells) in a subject may be genetically modi tion is selected from the group consisting of cancer, meta fied in-vivo by administering a viral vector to the subject (or bolic-related disorder, kidney disease, anemia, autoimmune a select population of host cells thereof), wherein the viral 10 disorder, ocular disorder, blood disorder, neurological disor vector comprises a polynucleotide encoding a gene Switch der, lung disorder, rheumatologic disorder, and infectious comprising a ligand binding domain that binds a Compound disease. In another embodiment, the disease, disorder, injury, of the Disclosure. In yet other embodiments, the host cell is an or condition is selected from the group consisting of cancer, autologous host cell obtained from a mammalian Subject, metabolic-related disorder, kidney disease, anemia, autoim wherein the autologous host cell is genetically modified with 15 mune disorder, ocular disorder, blood disorder, neurological a polynucleotide construct encoding a gene Switch compris disorder, pulmonary (lung) disorder, rheumatologic disorder, ing a ligand binding domain that binds a Compound of the cardiac disorder, hepatic (liver) disorder and infectious dis Disclosure. In another embodiment, the host cell is an allo ease. In another embodiment, the disease, disorder, injury, or geneic stem cell or immune cell, wherein the allogenic host condition is selected from the group consisting of cardiac cell is genetically modified with a polynucleotide construct disorder and hepatic (liver) disorder. In another embodiment, encoding a gene Switch comprising a ligand binding domain the disease, disorder, injury, or condition is cancer. In another that binds a Compound of the Disclosure. In another embodi embodiment, the cancer is melanoma. In another embodi ment, a Compound of the Disclosure is administered to a ment, the gene Switch comprises an ecdysone receptor (EcR) Subject as a pharmaceutically acceptable composition. In ligand binding domain. In another embodiment, the gene another embodiment, the gene Switch comprises an ecdysone 25 Switch further comprises a second ligand binding domain that receptor (EcR) ligand binding domain that binds a Compound dimerizes with a first ligand binding domain (for example, an of the Disclosure. In another embodiment, the gene switch EcR ligand binding domain) that binds a Compound of the further comprises a second ligand binding domain that dimer Disclosure. In one embodiment, an EcR ligand binding izes with a first ligand binding domain (for example, an EcR domain comprises one or more amino acid Substitutions com ligand binding domain) that binds a Compound of the Dis 30 pared to the corresponding wild-type EcR polypeptide closure. In one embodiment, an EcR ligand binding domain sequence. In another embodiment, the second ligand binding comprises one or more amino acid substitutions compared to domain is a wild-type insect USP (Ultraspiracle protein). In the corresponding wild-type EcR polypeptide sequence. In another embodiment, the second ligand binding domain is a another embodiment, the second ligand binding domain is a retinoic X receptor ligand binding domain. In another retinoic X receptor ligand binding domain. In another 35 embodiment, the retinoic X receptor (RXR) ligand binding embodiment, the second ligand binding domain is a wild-type domain is a chimeric retinoic X receptor ligand binding insect USP (Ultraspiracle protein). In another embodiment, domain. In another embodiment, the chimeric ligand binding the retinoic X receptor (RXR) ligand binding domain is a domain is a mammalian RXR/invertebrate USP chimera. In chimeric retinoic X receptor ligand binding domain. In another embodiment, the host cell further comprises a poly another embodiment, the chimeric ligand binding domain is 40 nucleotide encoding a peptide, protein, or polypeptide whose an mammalian RXR/invertebrate USP chimera. In another expression is regulated by the gene Switch. In another embodiment, the host cell further comprises a polynucleotide embodiment, the gene Switch regulates the expression of a encoding a peptide, protein or polypeptide whose expression polynucleotide encoding IL-12 or a subunit thereof (See, for is regulated by the gene Switch. example, US 2011/0268766). In another aspect, the present disclosure provides methods 45 In another embodiment, the present disclosure provides a of treating a disease, disorder, injury, or condition in a subject, Compound of the Disclosure, or a composition thereof, for comprising administering to the Subject a Compound of the use in treating a disease, disorder, injury, or condition in a Disclosure, or a composition thereof. In one embodiment, a Subject. vector (or two or more vectors) comprises a polynucleotide In another embodiment, the present disclosure provides a (or polynucleotides) encoding a gene Switch that comprises a 50 Compound of the Disclosure, or a composition thereof, for ligand binding domain that binds a Compound of the Disclo use in the manufacture of a medicament for treating a disease, Sure. In one embodiment, the vector (or vectors) may be a disorder, injury, or condition in a Subject. DNA or RNA vector. In one embodiment, the vector (or In another aspect, the present disclosure provides kits com vectors) may be a plasmid or viral vector (for example, an prising a Compound of the Disclosure, or kits comprising a adenovirus vector oranadeno-associated viral vector). In one 55 composition of a Compound of the Disclosure and one or embodiment, a vector (or vectors) comprising a polynucle more excipients. In one embodiment, the kit further com otide (or polynucleotides) encoding a gene Switch that com prises instructions for administering a Compound of the Dis prises a ligand binding domain that binds a Compound of the closure to an isolated host cellor a subject. In another embodi Disclosure is administered to a subject to treat a disease, ment, the kit further comprises the RHEOSWITCH THERAPEUTIC disorder, injury, or condition in the Subject. In one embodi 60 SYSTEMR (see, for example, the Instruction Manual for ment, following administration of a Compound of the Dis “RHEOSWITCHR) Mammalian Inducible Expression System.” closure, a gene-of-interest (GOI) is expressed in Vivo in a New England BioLabs(R Inc., Version 1.3, November 2007: Subject from a vector (or vectors) comprising a polynucle Karzenowski, D. et al., BioTechiques 39:191-196 (2005): otide (or polynucleotides) encoding a GOI and comprising a Dai, X. et al., Protein Expr: Purif. 42:236-245 (2005); Patti, S. gene Switch that comprises a ligand binding domain that 65 R. et al., Eur: J. Biochem. 270: 1308-1515 (2003); Dhadialla, binds a Compound of the Disclosure. In one embodiment, a T. S. et al., Annual Rev. Entomol. 43:545-569 (1998); Kumar, host cell within the subject comprises a polynucleotide M. B., et al., J. Biol. Chem. 279:27211-27218 (2004); Verhae US 9,127,024 B2 67 68 gent, M. and Christopoulos, T. K., Annal. Chem. 74:4378 and/or weeds to be treated. Those skilled in the art will rec 4385 (2002); Katalam, A. K., et al., Molecular Therapy ognize that mixtures of pesticides may provide advantages 13:S103 (2006); and Karzenowski, D. et al., Molecular Such as a broader spectrum of activity than one pesticide used Therapy 13:S194 (2006)) alone. Examples of pesticides which can be combined in Compounds of the Disclosure may be administered to a compositions with Compounds of the Disclosure include fun Subject in conjunction with other pharmaceutically active gicides, herbicides, insecticides, miticides, and microbicides. compounds. It will be understood by those skilled in the art In other agricultural embodiments, Compounds of the Dis that pharmaceutically active compounds to be used in com closure may be used to control the expression of one or more bination the Compound of the Disclosure will be selected in genes of interest (GOIs). Exemplary GOIs include any order to avoid adverse effects on the recipient or undesirable 10 desired trait, whether the trait is an agronomic trait, input trait, interactions between the compounds. Examples of other Such as herbicide- or insecticide-resistance, nutritionally-de pharmaceutically active compounds which may be used in sirable GOIs for the end consumer (animal or human), as well combination a Compound of the Disclosure, for example, as desired GOIs for efficient processing of the plant product. AIDS chemotherapeutic agents, amino acid derivatives, anal Thus, in certain embodiments, a plant cell, a plant tissue, a gesics, anesthetics, anorectal products, antacids and antiflatu 15 whole plant and the like, is genetically modified with a poly lents, antibiotics, anticoagulants, antidotes, antifibrinolytic nucleotide encoding a gene Switch, wherein the expression of agents, antihistamines, anti-inflammatory agents, antine one or more GOIs are under the control of the gene switch. oplastics, antiparasitics, antiprotozoals, antipyretics, antisep Likewise, in certain embodiments, a fungal cell, a bacterial tics, antispasmodics and anticholinergics, antivirals, appetite cell or a yeast cell is genetically modified with a polynucle Suppressants, arthritis medications, biological response otide encoding a gene Switch, wherein the expression of one modifiers, bone metabolism regulators, bowel evacuants, car or more GOIs are under the control of the gene switch. diovascular agents, central nervous system stimulants, cere Ecdysone receptors in insects are naturally responsive to bral metabolic enhancers, cerumenolytics, cholinesterase the ecdysone steroid hormone (molting hormone) and other inhibitors, cold and cough preparations, colony stimulating steroidal compounds such as ponasterone A and muristerone factors, contraceptives, cytoprotective agents, dental prepa 25 A. (Graham et al., Insect Biochemistry and Molecular Biol rations, deodorants, dermatologicals, detoxifying agents, dia ogy 37:611-626 (2007); Dinan and Hormann, “Ecdysteroid betes agents, diagnostics, diarrhea medications, dopamine Agonists and Antagonists. Comprehensive Molecular Insect receptoragonists, electrolytes, enzymes and digestants, ergot Science, 1st ed.: 197-242, (2005)). Diacylhydrazines having preparations, fertility agents, fiber Supplements, antifungal ecdysone receptor agonist activity have been described as agents, galactorrhea inhibitors, gastric acid secretion inhibi 30 insecticides. (See U.S. Pat. No. 5,530,028). tors, gastrointestinal prokinetic agents, gonadotropin inhibi In another aspect, the present disclosure provides a method tors, hair growth stimulants, hematinics, hemorrheologic of controlling, e.g., reducing or preventing the spread of, or agents, hemostatics, histamine H receptor antagonists, hor killing, insects comprising contacting the insects or their mones, hyperglycemic agents, hypolipidemics, immunosup habitat with an insecticidally effective amount of a Com pressants, laxatives, leprostatics, leukapheresis adjuncts, 35 pound of the Disclosure, or a composition thereof. In another lung Surfactants, migraine preparations, mucolytics, muscle embodiment, Compounds of the Disclosure, or a composition relaxant antagonists, muscle relaxants, narcotic antagonists, thereof, are insecticidally active against: nasal sprays, nausea medications nucleoside analogues, (1) insects from the order of the lepidopterans (Lepi nutritional Supplements, osteoporosis preparations, oxyto doptera), for example, Agrotis ypsilon, Agrotis segetum, Ala cics, parasympatholytics, parasympathomimetics, Parkin 40 bama argillacea, Anficarsia gemmatalis, Argyresthia conju Sonism drugs, Penicillin adjuvants, phospholipids, platelet gella, Autographa gamma, Bupalus piniarius, CaCOecia inhibitors, porphyria agents, prostaglandin analogues, pros murinana, Capua reticulana, Chematobia brumata, Choris taglandins, proton pump inhibitors, pruritus medications psy toneura filmiferana, Choristoneura Occidentalis, Cirphis uni chotropics, quinolones, respiratory stimulants, saliva stimu puncta, Cydia pomonella, Dendrolimus pini, Diaphania initi lants, salt Substitutes, Sclerosing agents, skin wound 45 dalls, Dlatraea grandiosella, Earias insulana, Elasmopalpus preparations, Smoking cessation aids, Sulfonamides, sym lignosellus, Eupoecilia ambiguella, Evetria bouliana, Feltia patholytics, thrombolytics, Tourette's syndrome agents, subterranea, Galleria mellonella, Grapholitha finebrana, tremor preparations, tuberculosis preparations, uricoSuric Grapholitha molesta, Hellothis armigera, Hellothis vire agents, urinary tract agents, uterine contractants, uterine scens, Heliothis zea, Hellula undalis, Hibernia defoliaria, relaxants, vaginal preparations, Vertigo agents, vitamin D 50 Hyphantria cunea, Hyponomeuta malinellus, Keiferia lyco analogs, vitamins, and medical imaging contrast media. In persicella, Lambdina fiscellaria, Laphygma exigua, Leucop Some cases a Compound of the Disclosure may be useful as an tera coffeella, Leucoptera scitella, Lithocolletis blancardella, adjunct to drug therapy, for example, to “turn off a gene that Lobesia botrana, Loxostege Sticticalis, Lymantria dispar, produces an enzyme that metabolizes a particular drug. Lymantria monacha, Lyonetia clerkella, Malacosoma neus For agricultural applications, Compounds of the Disclo 55 tria, Mamestra brassicae, Orgvia pseudotsugata, Ostrinia Sure, or compositions thereof, may be used to control the nubilalls, Panolls flammea, Pectinophora gossypiella, expression of pesticidal proteins such as Bacillus thuringien Peridroma saucia, Phalera bucephala, Phthorinaea Oper sis (Bt) toxin. Such expression may be tissue or plant specific. culella, Phyllocnistis citrella, Pieris brassicae, Plathypena In addition, particularly when control of plant pests is also scabra, Plutella xylostella, Pseudoplusia includens, Rhya needed, one or more pesticides may be combined with Com 60 cionia frustrana, Scrobipalpula absoluta, Sitotroga cere pound of the Disclosure, or compositions thereof, thereby alella, Sparganothis pilleriana, Spodoptera frugiperda, providing additional advantages and effectiveness, including Spodoptera littoralls, Spodoptera litura, Thaumatopoea fewer total applications, than if the pesticides are applied pityocampa, Tortrix viridana, Trichoplusia ni and Zeiraphera separately. When mixtures with pesticides are employed, the Canadensis, relative proportions of each component in the composition 65 (2) beetles (Coleoptera), for example, Agrilus sinuatus, will depend upon the relative efficacy and the desired appli Agriotes lineatus, Agriotes obscurus, Amphimallus solstitia cation rate of each pesticide with respect to the crops, pests, lis, Anisandrus dispar, Anthonomus grandis, Anthononus US 9,127,024 B2 69 70 pomorum, Aphthona euphoridae, Althous haemorrhoidals, quadrata, Solubea insularis, Thyanta perditor; Acyrthosi Atomaria linearis, Blastophagus piniperda, Blitophaga phon Onobrychis, Adelges laricis, Aphidula masturti, Aphis undata, Bruchus rufimanus, Bruchus pisorum, Bruchus len fabae, Aphis forbesi, Aphis pomi, Aphis gossypii, Aphis gros tis, Byctiscus betulae, Cassida nebulosa, Cerotoma trifur sulariae, Aphis Schneideri, Aphis spiraecola, Aphis Sambuci, cata, Cetonia aurata, Ceuthorrhynchus assimilis, Ceuthor 5 Acyrthosiphon pisum, Aulacofihum Solani, Bemisia argenti rhynchus mapi, Chaetocnema tibialis, Conoderus folii, Brachycaudus Cardui, Brachycaudus helichrysi, vespertinus, Crioceris asparagi, Ctenicera ssp., Diabrotica Brachycaudus persicae, Brachycaudus prunicola, Brevico longicornis, Diabrotica semipunctata, Diabrotica 12-punc ryne brassicae, Capifiophorus horni, Cerosipha gossypii, tata Diabrotica speciosa, Diabrotica virgifera, Epillachna Chaetosiphon fragaefolii, Cryptomyzus ribis, Dreyfusia nor varivestis, Epitrix hirtpennis, Eutinobothrus brasilensis, 10 dmannianae, Dreyfusia piceae, Dysaphis radicola, Dysaula Hylobius abietis, Hypera brunneipennis, Hypera postica, Ips corthum pseudosolani, Dysaphis plantaginea, Dysaphis pyri, typographus, Lema bilineata, Lema melanopus, Leptinotarsa Empoasca fabae, Hyalopterus pruni, Hyperomyzus lactucae, decemlineata, Limonius Californicus, Lissorhoptrus Oryzo Macrosiphum avenae, Macrosiphum euphorbiae, Macrosi philus, Melanotus communis, Melligethes aeneus, Melolontha phon rosae, Megoura viciae, Melanaphis pyrarius, Metopol hippocastani, Melolontha melolontha, Oulema Oryzae, Otio 15 Ophium dirhodium, Myzus persicae, Myzus ascalonicus, rrhynchus sulcatus, Otiorrhynchus ovatus, Phaedon cochle Myzus cerasi, Myzus varians, Nasonovia ribis-nigri, Nilapar ariae, Phyllobius pyri, Phyllotreta chrysocephala, Phyllo vata lugens, Pemphigus bursarius, Perkinsiella saccharicida, phaga sp., Phyllopertha horticola, Phyllotreta memorum, Phorodon humuli, Psylla mall, Psylla pini, Rhopalomyzus Phyllotreta Striolata, Popillia japonica, Sitona lineatus and ascalonicus, Rhopalosiphum maidis, Rhopalosiphum padi, Sitophilus granaria, Rhopalosiphum inserfilm, Sappaphis mala, Sappaphis mali, (3) flies, mosquitoes (Diptera), for example, Aedes aegypti, Schizaphis graminum, Schizoneura lanuginosa, Sitobion Aedes albopictus, Aedes vexans, Anastrepha ludens, Anoph avenae, Trialeurodes vaporariorum, Toxoptera aurantiand, eles maculipennis, Anopheles crucians, Anopheles albi Viteus vitifoli, Cimex lectularius, Cimex hemipterus, Redu manus, Anopheles gambiae, Anopheles freeborni, Anopheles vius senilis, Triatoma spp., and Arilus critatus, leucosphyrus, Anopheles minimus, Anopheles quadrimacu 25 (8) ants, bees, wasps, sawflies (Hymenoptera), for latus, Caliphora vicina, Ceratitis capitata, Chrysomya bez example, Athalia rosae, Atta cephalotes, Atta capiguara, Atta Ziana, Chrysomya hominivorax, Chrysomya macellaria, cephalotes, Afia laevigata, Atta robusta, Atta sexdens, Atta Chrysops discails, Chrysops silacea, Chrysops allanticus, texana, Crematogaster spp., Hoplocampa minuta, Hoplo Cochliomyla hominivorax, Contarinia sorghicola Cordylo campa testudinea, Monomorium pharaonis, Solenopsis bia anthropophaga, Culicoides firens, Culex pipiens, Culex 30 geminata, Solenopsis invicta, Solenopsis richteri, Solenopsis nigripalpus, Culex quinquefasciatus, Culex tarsalis, Culiseta xyloni, Pogonomyrmex barbatus, Pogonomyrmex Californi inornata, Culiseta melanura, Dacus cucurbitae, Dacus cus, Pheidole megacephala, Dasy mutila Occidentalis, Bom Oleae, Dasineura brassicae, Delia antique, Delia coarctata, bus spp. Vespula squamosa, Paravespula vulgaris, Delia platura, Della radicum, Dermatobia hominis, Fannia Paravespula pennsylvanica, Paravespula germanica, Doli canicularis, Geomyza Tripunctata, Gasterophilus intestina 35 chovespula maculata, Vespa crabro, Polistes rubiginosa, lis, Glossina morsifians, Glossina palpalis, Glossina fusci Camponotus floridanus, and Linepithema humile, pes, Glossina tachinoides, Haematobia irritans, Haplodiplo (9) crickets, grasshoppers, locusts (Orthoptera), for sis equestris, Hippelates spp., Hvlemyia platura, Hypoderma example, Acheta domestica, Gryllotalpa gryllotalpa, Locusta lineata, Leptoconops torrens, Liriomyza sativae, Liriomyza migratoria, Melanoplus bivittatus, Melanoplus femurru trifolii, Lucilia caprina, Lucilia cuprina, Lucilla sericata, 40 brum, Melanoplus mexicanus, Melanoplus sanguinipes, Mel Lycoria pectoralis, Mansonia titillanus, Mayetiola destruc anoplus spretus, Nomadacris Septemfasciata, Schistocerca tor, Musca domestica, Muscina Stabulans, Oestrus ovis, americans, Schistocerca gregaria, Dociostaurus marocca Oponyza forum, Oscinella frit, Pegomya hysocyani, Phorbia nus, Tachycines asynamorus, Oedaleus Senegalensis, Zonoz antiqua, Phorbia brassicae, Phorbia coarctata, Phlebotomus erus variegatus, Hieroglyphus daganensis, Kraussaria angu argentipes, Psorophora columbiae, Psila rosae, Psorophora 45 lifera, Calliptamus itallicus, Chortoicetes terminifera, and discolor, Prosimullum mixtum, Rhagoletis cerasi, Rhagoletis Locustana pardalina, pomonella, Sarcophaga haemorrhoidalis, Sarcophaga sp., (10) Arachnoidea, Such as arachnids (Acarina), for Simulium vittatum, Stomoxys calcitrans, Tabanus bovinus, example, of the families Argasidae. Ixodidae and Sarcop Tabanus atratus, Tabanus lineola, and Tabanus similis, tidae, such as Amblyomma americanum, Amblyomma varie Tipula oleracea, and Tip ulapaludosa. 50 gatum, Amblyomma maculatum, Argas persicus, Boophilus (4) thrips (Thysanoptera), for example, Dichromothrips annulatus, Boophilus decoloratus, Boophilus microplus, corbetti, Dichromothrips ssp., Frankliniella fisca, Dermacentor Silvarum, Dermacentor andersoni, Dermacen Franklniella occidentalls, Frankliniella tritici, Scirtothrips tor variabllis, Hvalomma truncatum, Ixodes ricinus, Ixodes citri, Thrips Olyzae, Thrips palmi and Thrips tabaci, rubicundus, Ixodes scapularis, Ixodes holocyclus, Ixodes (5) termites (Isoptera), for example, Calotermes flavicollis, 55 pacificus, Ornithodorus moubata, Ornithodorus hermsi, Leucotermes flavipes, Heterotermes aureus, Reticultermes Ornithodorus turicata, Ornithonyssus bacoti, Otobius meg flavipes, Retfeull termes virginicus, Reticultermes lucifigus, nini, Dermanyssus gallinae, Psoroptes ovis, Rhipicephalus Termes natalensis, and Coptotermes formosanus, sanguineus, Rhipicephalus appendiculatus, Rhipicephalus (6) cockroaches (Blattaria-Blattodea), for example, Blat evertsi, Sarcoptes scabiei, and Eriophyidae spp. Such as Acu tella germanica, Blattella asahinae, Periplaneta americana, 60 lus Schlechtendali, Phylocoptrata oleivOra and Eriophyes Periplaneta japonica, Periplaneta brunnea, Periplaneta Sheldoni, Tarsonemidae spp. Such as Phytonemus pallidus filigginosa, Periplaneta australasiae, and Blatta Orientalis, and Polyphagotarisonemus latus, Tenuipalpidae spp. Such as (7) true bugs (Hemiptera), for example, Acrosternum Brevipalpus phoenicis, Tetranychidae spp. Such as Tetrany hilare, Blissus leucopterus, Cyrtopeltis notatus, Dysdercus chus cinnabarinus, Tetranychus kanzawai, Tetranychus paci cingulatus, Dysdercus intermedius, Eurygaster integriceps, 65 ficus, Tetranychus tellarius and Tetranychus urticae, Panony Euschistus impictivenfris, Leptoglossus phyllopus, Lygus chus ulmi, Panonychus citri, and Oligonychus pratensis, Illneolaris, Lygus pratensis, Nezara viriduia, Piesma Araneida, e.g., Lafrodectus mactans, and Loxosceles reclusa, US 9,127,024 B2 71 72 (11) fleas (Siphonaptera), for example, Ctenocephalides about 75%, at least about 80%, at least about 85%, at least felis, Ctenocephalides canis, Xenopsylla cheopis, Pulex about 90%, at least about 95%, or at least about 100%. irrifians, Tunga penefians, and Nosopsyllus fasciatus, As used herein, the term “insecticidally effective amount (12) silverfish, firebrat (Thysanura), for example, Lepisma refers to the amount of a Compound of the Disclosure suffi saccharins and Thermobia domestics. cient to control, e.g., reduce or prevent the spread of, or kill, (13) centipedes (Chilopoda), for example, Scutigera insects. For example, an insecticidally effect amount will coleoptrata, refer to the amount of a Compound of the Disclosure that (14) millipedes (Diplopoda), for example, Narceus spp., induces premature molting and death in an insect. (15) Earwigs (Dermaptera), for example, forifcula auricu The terms “a” and “an refer to one or more than one. 10 The term “about as used herein, includes the recited num laria; and/or ber +10%. Thus, “about 10” means 9 to 11. (16) lice (Phthiraptera), for example, Pediculus humanus As used herein, the term “excipient” refers to any ingredi capitis, Pediculus humanus corporis, Pthirus pubis, Hae ent in a composition other than the Compound of the Disclo matopinus eurysternus, Haematopinus suis, Linognathus Sure. An excipient is typically an inert Substance added to a vituli, Bovicola bovis, Menopon gallinae, Menacanthus stra 15 composition to facilitate processing, handling, administra mineus and Solenopotes capillatus. tion, etc., of Compound of the Disclosure. Useful excipients In another embodiment, Compounds of the Disclosure, or include, but are not limited to, adjuvants, antiadherents, bind compositions thereof, are insecticidally active against insects ers, carriers, disintegrants, fillers, flavors, colors, diluents, of the order Diptera, Hemiptera, and/or Lepidoptera. In lubricants, glidants, preservatives, sorbents, solvents, Surfac another embodiment, Compounds of the Disclosure, or a tants, and Sweeteners. composition thereof, are insecticidally active against insects Conventional pharmaceutical excipients are well known to of the order Lepidoptera. In another embodiment, Compound those of skill in the art. In particular, one of skill in the art will of the Disclosures, or a composition thereof, are insecticid recognize that a wide variety of pharmaceutically acceptable ally active against insects of the order Hemiptera. excipients can be used in admixture with Compounds of the Compounds of the Disclosure, or compositions thereof, 25 Disclosure, including those listed in the Handbook of Phar can be applied to plant foliage as aqueous sprays by methods maceutical Excipients, Pharmaceutical Press 4th Ed. (2003), commonly employed, such as conventional high-liter hydrau and Remington. The Science and Practice of Pharmacy, Lip lic sprays, low-liter sprays, air-blast, and aerial sprays. The pincott Williams & Wilkins, 21st ed. (2005). In one embodi dilution and rate of application will depend upon the type of ment, the composition comprises one or more of the follow equipment employed, the method and frequency of applica 30 ing excipients: water, Labrasol, Lauroglycol 90, Phosal 53 tion desired, and the ligand application rate. It may be desir MCT, Miglyol, Cremophor R EL, polysorbate 80, Crillet 1 able to include additional adjuvants in the spray tank. Such HP. Isopropyl myristate, Oleic acid, and/or PEG 400 NF. In adjuvants include Surfactants, dispersants, spreaders, Stick another embodiment, the composition comprises a lipid. ers, antifoam agents, emulsifiers, and other similar materials Pharmaceutically acceptable carriers include fillers such as described in McCutcheon's Emulsifiers and Detergents, 35 saccharides, for example, trehalose, lactose or Sucrose, man McCutcheon's Emulsifiers and Detergents/Functional Mate nitol or Sorbitol, cellulose preparations and/or calcium phos rials, and McCutcheon's Functional Materials, all published phates, for example tricalcium phosphate or calcium hydro annually by McCutcheon Division of MC Publishing Com gen phosphate, as well as binders such as starch paste, using, pany (New Jersey). Compounds of the Disclosure, or com for example, maize starch, wheat starch, rice starch, potato positions thereof, can also be mixed with fertilizers or fertil 40 starch, gelatin, tragacanth, methyl cellulose, hydroxypropyl izing materials before their application. Compounds of the methylcellulose, sodium carboxymethylcellulose, and/or Disclosure, or compositions thereof, and Solid fertilizing polyvinyl pyrrolidone. If desired, disintegrating agents may material can also be admixed in mixing or blending equip be added such as the above-mentioned starches and also ment, or they can be incorporated with fertilizers in granular carboxymethyl-Starch, cross-linked polyvinyl pyrrolidone, formulations. Any relative proportion offertilizer can be used 45 agar, oralginic acid or a salt thereof. Such as sodium alginate. which is suitable for the crops and weeds to be treated. Com Auxiliaries are flow-regulating agents and lubricants, for pounds of the Disclosure, or compositions thereof, will com example, silica, talc, Stearic acid or salts thereof. Such as monly comprise from 5% to 50% of the fertilizing composi magnesium Stearate or calcium Stearate, and/or polyethylene tion. These compositions provide fertilizing materials which glycol. In one embodiment, dragee cores are provided with promote the rapid growth of desired plants, and at the same 50 Suitable coatings which, if desired, are resistant to gastric time control gene expression. juices. For this purpose, concentrated saccharide solutions As used herein, the term “therapeutically effective may be used, which may optionally contain gum arabic, talc, amount,” refers to the amount of a Compound of the Disclo polyvinyl pyrrolidone, polyethylene glycol and/or titanium Sure Sufficient to treat one or more symptoms of a disease, dioxide, lacquer Solutions and Suitable organic solvents or condition, injury, or disorder, or prevent advancement of dis 55 Solvent mixtures. In order to produce coatings resistant to ease, condition, injury, or disorder, or cause regression of the gastric juices, solutions of Suitable cellulose preparations disease, condition, injury, or disorder. For example, with Such as acetylcellulose phthalate or hydroxypropylmethyl respect to the treatment of cancer, in one embodiment, a cellulose phthalate, are used. Dye stuffs or pigments may be therapeutically effective amount will refer to the amount of a added to the tablets or dragee coatings, for example, for Compound of the Disclosure that decreases the rate of tumor 60 identification or in order to characterize combinations of growth, decreases tumor mass, decreases the number of active compound doses. metastases, increases time to tumor progression, or increases Pharmaceutical preparations which can be used orally survival time by at least about 5%, at least about 10%, at least include push-fit capsules made of gelatin, as well as Soft, about 15%, at least about 20%, at least about 25%, at least sealed capsules made of gelatin and a plasticizer Such as about 30%, at least about 35%, at least about 40%, at least 65 glycerol or Sorbitol. The push-fit capsules can contain the about 45%, at least about 50%, at least about 55%, at least active compounds in the form of granules or nanoparticles about 60%, at least about 65%, at least about 70%, at least which may optionally be mixed with fillers such as lactose, US 9,127,024 B2 73 74 binders such as starches, and/or lubricants such as talc or As used herein, the term 'gene of interest' is any gene that magnesium Stearate and, optionally, stabilizers. In one one wishes to express that encodes a peptide, protein, or embodiment, the is dissolved or Suspended in Suitable liquids, polypeptide. Such as fatty oils, or liquid paraffin, optionally with Stabiliz As used herein, the term “gene expression” refers to the CS. transcription of DNA to messenger RNA (mRNA), and/or the Fatty oils may comprise mono-, di- or triglycerides. translation of mRNA to amino acid sequence. Mono-, di- and triglycerides include those that are derived As used herein, the term “regulating gene expression' from Co. Cs Co., C2, C14, C6, C1s, Co and C22 acids. refers to increasing the level of gene expression in response to Exemplary diglycerides include, in particular, diolein, contact of a Compound of the Disclosure with the ligand dipalmitolein, and mixed caprylin-caprin diglycerides. Pre 10 binding domain that binds a Compound of the Disclosure, relative to the level of gene expression in the absence of ferred triglycerides include vegetable oils, fish oils, animal contacting the ligand binding domain that binds a Compound fats, hydrogenated vegetable oils, partially hydrogenated of the Disclosure. Vegetable oils, synthetic triglycerides, modified triglycerides, As used herein, the term “gene switch” refers to peptide, fractionated triglycerides, medium and long-chain triglycer 15 protein, or polypeptide complex that functions to (a) bind a ides, structured triglycerides, and mixtures thereof. Exem Compound of the Disclosure, i.e., the ligand, and (b) regulate plary triglycerides include: almond oil; babassu oil; borage the transcription of a gene of interest in a ligand-dependent oil; blackcurrant seed oil; canola oil; castor oil; coconut oil; fashion. Gene Switches are useful for various applications corn oil; cottonseed oil; evening primrose oil; grapeseed oil; Such as gene therapy, production of proteins in cells, cell groundnut oil; mustard seed oil, olive oil; palm oil; palm based high throughput Screening assays, functional genom kernel oil; peanut oil; rapeseed oil; Safflower oil; Sesame oil; ics, and regulation of traits in transgenic plants and animals. shark liver oil; soybean oil; Sunflower oil; hydrogenated cas In one embodiment, the polynucleotide encoding a gene tor oil; hydrogenated coconut oil; hydrogenated palm oil; Switch is a recombinant polynucleotide, i.e., a polynucle hydrogenated soybean oil; hydrogenated vegetable oil; otide, that has been engineered, by molecular biological hydrogenated cottonseed and castor oil; partially hydroge 25 manipulation, to encode the gene Switch. In another embodi nated Soybean oil; partially soy and cottonseed oil; glyceryl ment, the recombinant polynucleotide is a synthetic poly tricaproate; glyceryl tricaprylate; glyceryl tricaprate; glyc nucleotide. See, e.g., US Pat. Appl. Pub. Nos. 2012/0322148, eryl triundecanoate; glyceryl trilaurate; glyceryl trioleate; 2012/0185954, and 2011/0059530. glyceryl trilinoleate; glyceryl trilinolenate; glyceryl tricapry As used herein, the term “gene' refers to a polynucleotide late/caprate; glyceryl tricaprylate/caprate/laurate; glyceryl 30 comprising nucleotides that encode a functional molecule, tricaprylate/caprate/linoleate; and glyceryl tricaprylate/ca including functional molecules produced by transcription prate/stearate. only (e.g., a bioactive RNA species) or by transcription and In one embodiment, the triglyceride is the medium chain translation (e.g. a polypeptide). The term "gene' encom triglyceride available under the trade name LABRAFACCC. passes cDNA and genomic DNA nucleic acids. “Gene' also Other triglycerides include neutral oils, e.g., neutral plant 35 refers to a nucleic acid fragment that expresses a specific oils, in particular fractionated coconut oils such as known and RNA, protein or polypeptide, including regulatory sequences commercially available under the trade name MIGLYOL, preceding (5' non-coding sequences) and following (3' non including the products: MIGLYOL 810; MIGLYOL 812: coding sequences) the coding sequence. “Native gene' refers MIGLYOL 818; and CAPTEXR355. Other triglycerides are to a gene as found in nature with its own regulatory caprylic-capric acid triglycerides Such as known and com 40 sequences. “Chimeric gene' refers to any gene that is not a mercially available under the trade name MYRITOL, includ native gene, comprising regulatory and/or coding sequences ing the product MYRITOL 813. Further triglycerides of this that are not found together in nature. Accordingly, a chimeric class are CAPMULMCT, CAPTEX(R) 200, CAPTEXOR 300, gene may comprise regulatory sequences and coding CAPTEXR 800, NEOBEE M5 and MAZOL 1400. sequences that are derived from different sources, or regula Pharmaceutical compositions comprising triglycerides 45 tory sequences and coding sequences derived from the same may further comprise lipophilic and/or hydrophilic Surfac Source, but arranged in a manner different than that found in tants which may form clear Solutions upon dissolution with nature. A chimeric gene may comprise coding sequences an aqueous solvent. One Such surfactant is tocopheryl poly derived from different sources and/or regulatory sequences ethylene glycol 1000 succinate (vitamin ETPGS). Examples derived from different sources. “Endogenous gene’ refers to of such compositions are described in U.S. Pat. No. 6,267, 50 a native gene in its natural location in the genome of an 985. organism. A “foreign' gene or "heterologous' or “exog In another embodiment, the pharmaceutically acceptable enous gene refers to a gene not normally found in the host carrier comprises LABRASOL (Gattefosse SA), which is organism, but that is introduced into the host organism by PEG-8 caprylic/capric glycerides. In another embodiment, gene transfer. Foreign genes can comprise native genes the pharmaceutically acceptable carrier comprises PL90G, 55 inserted into a non-native organism, or chimeric genes. A vitamin ETPGS, and Miglyol 812N. “transgene' is a gene that has been introduced into the As used herein, the term “treat,” “treating, or “treatment” genome by a transformation procedure. is meant to encompass administering to a Subject a Com In one embodiment, Compounds of the Disclosure are pound of the Disclosure, or a composition thereof, for the administered to an isolated host cell or a subject as a compo purposes of amelioration or cure of a disease, disorder, injury, 60 sition. In another embodiment, Compounds of the Disclosure or condition, including preemptive treatment. are administered to an isolated host cell or a subject as a As used herein, the term “subject” refers to an insect, plant, pharmaceutically acceptable composition. algae, or animal, e.g., human or Veterinary animal, e.g., cow, As used herein, the term “dimerizes with the ligand binding sheep, pig, horse, dog, or cat. In one embodiment, a host cell domain that binds a Compound of the Disclosure” refers to a of the Subject comprises a polynucleotide encoding a gene 65 selective protein-protein interaction. Switch that comprises a ligand binding domain that binds a In one embodiment, the gene switch efficacy or “ECs” of Compound of the Disclosure. a Compound of the Disclosure is about 20 uM or less, about US 9,127,024 B2 75 76 10 uM or less, about 5uM or less, about 3 LM or less, about host cell is in an animal Subject. In another embodiment, the 2 uM or less, about 1 um or less, about 500 nM or less, about host cell is in a plant Subject. In another embodiment, the host 300 nM or less, about 200 nMorless, or about 100 nMorless, cell is in an algae Subject. e.g., about 75 nM about 50 nM, about 25 nM, about 15 nM, In one embodiment, Compounds of the Disclosure, or about 10 nM, about 9 nM, about 8 nM, about 7 nM, about 6 compositions thereof, are administered to a subject. In one nM, about 5 nM, about 4 nM, about 3 nM, about 2 nM, about embodiment, Compounds of the Disclosure, or compositions 1 nM, about 0.5 nM, or less in a cellular gene switch assay. thereof, are administered to a subject orally. In another Examples of in vitro assays for measuring gene Switch-regu embodiment, Compounds of the Disclosure, or compositions lated gene expression are well known to those of ordinary thereof, are administered to a subject parenterally. In another skill in the art. See, for example, Karzenowski et al., BioTech 10 embodiment, Compounds of the Disclosure, or compositions niques 39:191-200 (2005). thereof, are administered Subcutaneously, intramuscularly, As used herein, the “ECs” is the “half maximal effective intravenously, intraperitoneally or intratumorally. concentration, which refers to the concentration of a Com In addition to or together with the above modes of admin pound of the Disclosure that induces a gene Switch-regulated istration, Compounds of the Disclosure, or compositions change in expression of a polynucleotide encoding an gene of 15 thereof, can be added to food consumed by a subject. In one interest that is halfway between the baseline level of expres embodiment, Compounds of the Disclosure, or compositions sion and the maximum level of expression after a specified thereof, are combined, blended, or admixed with food mate exposure time. rial to provide a “food product.” The term “food material' is As used herein, the term “ligand binding domain that binds used in its broadest possible sense, and includes any form, a Compound of the Disclosure' refers to an amino acid e.g., Solid, emulsion, liquid, ofingestible materials consumed sequence that selectively binds a Compound of the Disclo by an animal, e.g., a human. Food products may be formu sure. In the methods disclosed herein, a Compound of the lated so the Subject takes in an appropriate quantity of a Disclosure binds to a ligand binding domain, e.g., an ecdys Compound of the Disclosure, or composition thereof, with its one receptor ligand binding domain, that is part of a ligand diet. In another embodiment, a Compound of the Disclosure, dependent transcriptional activation complex that regulates 25 or composition thereof, is formulated as a premix for addition the expression of a polynucleotide sequence that encodes a to food material. In one embodiment, the food product or gene of interest. Hence, the expression of the gene of interest premix comprises a Compound of the Disclosure, or compo is regulated in a ligand (Compound of the Disclosure) depen sition thereof, and one or more lipids. dent fashion. In one embodiment, the ligand binding domain in the gene In one embodiment, the ligand binding domain that binds a 30 switch that binds a Compound of the Disclosure is a Group H Compound of the Disclosure, e.g., an ecdysone receptor nuclear receptor ligand binding domain, or a mutant thereof, ligand binding domain, dimerizes with another ligand bind that binds a Compound of the Disclosure. In another embodi ing domain, e.g., a retinoid X receptor ligand binding domain, ment, the Group H nuclear receptor ligand binding domain is to form a protein-protein complex. selected from the group consisting of an ecdysone receptor In one embodiment, the expression of the gene of interestis 35 ligand binding domain, a ubiquitous receptor ligand binding regulated by a Compound of the Disclosure in an on/off domain, an orphan receptor-1 ligand binding domain, an fashion that is independent of the concentration or dosage of NER-1 ligand binding domain, a receptor-interacting pro the Compound of the Disclosure. In another embodiment, the tein-15 ligand binding domain, a liver X receptor-3 ligand expression of the gene of interest is regulated by a Compound binding domain, a steroid hormone receptor-like protein of the Disclosure in a concentration (or dosage)-dependent 40 ligand binding domain, a liver X receptor ligand binding fashion, i.e., there is a dose-response relationship between the domain, a liver X receptor ligand binding domain, a farnesoid concentration (or dosage) of a Compound of the Disclosure X receptor ligand binding domain, a receptor-interacting pro and the level of gene expression of the gene of interest. See, tein-14 ligand binding domain, and a farnesol receptor ligand e.g., US 2009/0123441. binding domain ligand binding domain, or a mutant thereof, The term “operably linked’ refers to the association of 45 that binds a Compound of the Disclosure. polynucleotide sequences on a single polynucleotide so that In another embodiment, the Group H nuclear receptor the function of one is affected by the other. For example, a ligand binding domain is anecdysone receptor ligand binding promoter is operably linked with a coding sequence when it is domain, or a mutant thereof, that binds a Compound of the capable of affecting the expression of that coding sequence Disclosure. In another embodiment, the ecdysone receptor (i.e., that the coding sequence is under the transcriptional 50 ligand binding domain is selected from the group consisting control of the promoter). Coding sequences can be operably of an Arthropod ecdysone receptor ligand binding domain a linked to regulatory sequences in sense or antisense orienta Lepidopteran ecdysone receptor ligand binding domain, a tion. Dipteran ecdysone receptor ligand binding domain, an In one embodiment, the host cell is an isolated host cell. In Orthopteran ecdysone receptor ligand binding domain, a one embodiment, an "isolated host cell refers to a cell that is 55 Homopteran ecdysone receptor ligand binding domain and a not present in a Subject. In one embodiment, an "isolated Hemipteran ecdysone receptor ligand binding domain, a host cell refers to one or more host cells in a cell culture spruce budworm Choristoneura filmiferana ecdysone recep apparatus or in a cell culture preparation. tor ligand binding domain, a beetle Tenebrio molitor ecdys In one embodiment, the host cell is within a subject, and the one receptor ligand binding domain, a Manduca sexta ecdys host cell is contacted by a Compound of the Disclosure by 60 one receptor ligand binding domain, a Heliothies virescens administering the Compound of the Disclosure, or a compo ecdysone receptor ligand binding domain, a midge Chirono sition thereof, to the subject. In another embodiment, the host mus tentans ecdysone receptor ligand binding domain, a silk cell is contacted with a Compound of the Disclosure, or a moth Bombyx mori ecdysone receptor ligand binding composition thereof, in vitro. In another embodiment, the domain, a squinting bush brown Bicyclus any nana ecdysone host cell is contacted with a Compound of the Disclosure, or 65 receptor ligand binding domain, a buckeye Junonia coenia a composition thereof, ex vivo. In another embodiment, the ecdysone receptor ligand binding domain, a fruit fly Droso host cell is in a human Subject. In another embodiment, the phila melanogaster ecdysone receptor ligand binding US 9,127,024 B2 77 78 domain, a mosquito Aedes aegypti ecdysone receptor ligand In one embodiment, the retinoid receptor ligand binding binding domain, a blowfly Lucilia capitata ecdysone receptor domain is a vertebrate retinoid X receptor ligand binding ligand binding domain, a blowfly Lucilia cuprina ecdysone domain, an invertebrate retinoid X receptor ligand binding receptor ligand binding domain, a blowfly Caliphora vicinia domain, an ultraspiracle protein ligand binding domain, or a ecdysone receptor ligand binding domain, a Mediterranean 5 chimeric retinoid X receptor ligand binding domain. fruit fly Ceratitis capitata ecdysone receptor ligand binding In one embodiment, the chimeric retinoid X receptor domain, a locust Locusta migratoria ecdysone receptor ligand binding domain comprises two polypeptide fragments, ligand binding domain, an aphid Myzus persicae ecdysone wherein the first polypeptide fragment is from a vertebrate receptor ligand binding domain, a fiddler crab Celuca pugi retinoid X receptor ligand binding domain, an invertebrate 10 retinoid X receptor ligand binding domain, oran ultraspiracle lator ecdysone receptor ligand binding domain, an ixodid tick protein ligand binding domain, and the second polypeptide Amblyomma americanum ecdysone receptor ligand binding fragment is from a different vertebrate retinoid X receptor domain, a whitefly Bamecia argentifoli ecdysone receptor ligand binding domain, a different invertebrate retinoid X ligand binding domain, a leafhopper Nephotetix cincticeps receptor ligand binding domain, or a different ultraspiracle ecdysone receptor ligand binding domain, or a mutant 15 protein ligand binding domain. thereof, that binds a Compound of the Disclosure. In another In another embodiment, the chimeric retinoid X receptor embodiment, the ecdysone receptor ligand binding domain is ligand binding domain is one that is disclosed in U.S. Pat. No. a spruce budworm Choristoneura filmiferana ecdysone 7,531,326. receptor ligand binding domain, for which the amino acid In another embodiment, the first polypeptide fragment of sequence is set forth in U.S. Patent Publication No. 2006/ the chimeric retinoid X receptor ligand binding domain com O100416A1. prises helices 1-6, helices 1-7, helices 1-8, helices 1-9, helices In another embodiment, the ecdysone receptor ligand bind 1-10, helices 1-11, or helices 1-12 of a first species of retinoid ing domain is a mutant of the spruce budworm Choristoneura X receptor, and the second polypeptide fragment of the chi filmiferana ecdysone receptor ligand binding domain that meric retinoid X receptor ligand binding domain comprises binds a Compound of the Disclosure. 25 helices 7-12, helices 8-12, helices 9-12, helices 10-12, helices Suitable ecdysone receptor ligand binding domains 11-12, helix 12, or F domain of a second species of retinoid X include those disclosed, for example, in U.S. Pat. Nos. 7.935, receptor, respectively. 510; 7,919,269; 7,563,879; and in U.S. Patent Publication In another embodiment, the first polypeptide fragment of No. 2006/01 00416A1. the chimeric retinoid X receptor ligand binding domain com In one embodiment, the gene Switch comprises a ligand 30 prises helices 1-6 of a first species RXR according to the binding domain that dimerizes with the ligand binding disclosure, and the second polypeptide fragment of the chi domain that binds a Compound of the Disclosure. In one meric retinoid X receptor ligand binding domain comprises embodiment, the ligand binding domain that dimerizes with helices 7-12 of a second species of retinoid X receptor. the ligand binding domain that binds a Compound of the In another embodiment, the first polypeptide fragment of Disclosure is a Group B nuclear receptor ligand binding 35 the chimeric retinoid X receptor ligand binding domain com domain. In another embodiment, the Group B nuclear recep prises helices 1-7 of a first species retinoid X receptor accord tor ligand binding domain is selected from the group consist ing to the disclosure, and the second polypeptide fragment of ing of a retinoid X receptor ligand binding domain, an H-2 the chimeric retinoid X receptor ligand binding domain com region II binding protein ligand binding domain, a nuclear prises helices 8-12 of a second species retinoid X receptor. receptor co-regulator-1 ligand binding domain, an ultraspi 40 In another embodiment, the first polypeptide fragment of racle protein ligand binding domain, a 2C1 nuclear receptor the chimeric retinoid X receptor ligand binding domain com ligand binding domain, and a chorion factor 1 ligand binding prises helices 1-8 of a first species of retinoid X receptor, and domain. In another embodiment, a ligand binding domain the second polypeptide fragment of the chimeric retinoid X that dimerizes with the ligand binding domain that binds a receptor ligand binding domain comprises helices 9-12 of a Compound of the Disclosure is not an ecdysone receptor 45 second species of retinoid X receptor. ligand binding domain. In another embodiment, the first polypeptide fragment of In one embodiment, the ligand binding domain that dimer the chimeric retinoid X receptor ligand binding domain com izes with the ligand binding domain that binds a Compound of prises helices 1-9 of a first species of retinoid X receptor, and the Disclosure is a retinoic X receptor ligand binding domain. the second polypeptide fragment of the chimeric retinoid X In another embodiment, the retinoic X receptor ligand bind 50 receptor ligand binding domain comprises helices 10-12 of a ing domain is a vertebrate retinoic X receptor ligand binding second species of retinoid X receptor. domain. In another embodiment, the retinoic X receptor In another embodiment, the first polypeptide fragment of ligand binding domain is a Homo sapiens retinoic X receptor the chimeric retinoid X receptor ligand binding domain com ligand binding domain. In another embodiment, the retinoic prises helices 1-10 of a first species of retinoid X receptor, and X receptor ligand binding domain is a retinoic X receptor C. 55 the second polypeptide fragment of the chimeric retinoid X isoform. In another embodiment, the retinoic X receptor receptor ligand binding domain comprises helices 11-12 of a ligand binding domain is a retinoic X receptor f3 isoform. In second species of retinoid X receptor. another embodiment, the retinoic X receptor ligand binding In another embodiment, the first polypeptide fragment of domain is a retinoic X receptor Y isoform. the chimeric retinoid X receptor ligand binding domain com In another embodiment, the retinoic X receptor ligand 60 prises helices 1-11 of a first species of retinoid X receptor, and binding domain is an invertebrate retinoic X receptor ligand the second polypeptide fragment of the chimeric retinoid X binding domain. In another embodiment, the invertebrate receptor ligand binding domain comprises helix 12 of a sec retinoic X receptor ligand binding domain is a Locusta migra ond species of retinoid X receptor. toria retinoic X receptor ligand binding domain. In another preferred embodiment, the first polypeptide In another embodiment, the invertebrate retinoic X recep 65 fragment of the chimeric retinoid X receptor ligand binding tor ligand binding domain is a non-Lepidopteran, non domain comprises helices 1-12 of a first species of retinoid X Dipteran retinoic X receptor ligand binding domain. receptor, and the second polypeptide fragment of the chi US 9,127,024 B2 79 80 meric retinoid X receptor ligand binding domain comprises polynucleotide sequences that are contained in one or more an F domain of a second species of retinoid X receptor. separate polynucleotide sequences, then the one or more In one embodiment, the first polypeptide fragment in the separate polynucleotide sequences is operably linked to one chimeric retinoid X receptor ligand binding domain is human or more separate promoters. In another embodiment, the one retinoid X receptor sequence, and the second polypeptide 5 or more separate polynucleotide sequences are operably fragment in the chimeric retinoid X receptor ligand binding linked to one or more separate enhancer elements. In another domain is invertebrate retinoid X receptor sequence. In embodiment, the promoter(s) and/or the enhancer(s) are con another embodiment, the invertebrate retinoid X receptor stitutively active. In another embodiment, the promoter(s) sequence is Locusta migratoria retinoid X receptor sequence. and/or the enhancer(s) are tissue specific promoters and/or In another embodiment, the first polypeptide fragment of 10 enhancers. the chimeric retinoid X receptor ligand binding domain com In one embodiment, the gene Switch comprises a DNA prises helices 1-8 of a human retinoid X receptor, and the binding domain, an ecdysone receptor ligand binding second polypeptide fragment of the chimeric retinoid X domain, a ligand binding domain that dimerizes with the receptor ligand binding domain comprises helices 9-12 of ecdysone receptor ligand binding domain, and a transactiva Locusta migratoria retinoid X receptor. 15 tion domain. In one embodiment, the gene Switch further comprises a In another embodiment, the gene switch comprises a DNA DNA binding domain (“DBD”). In another embodiment, the binding domain, an ecdysone receptor ligand binding DBD is selected from the group consisting of a GAL4 DBD, domain, a retinoid X receptor ligand binding domain, and a a Lex ADBD, a transcription factor DBD, a steroid/thyroid transactivation domain. hormone nuclear receptor superfamily member DBD, a bac In another embodiment, the gene switch comprises a DNA terial Lacz DBD, and a yeast DBD. binding domain, an ecdysone receptor ligand binding In one embodiment, the gene Switch further comprises a domain, a chimeric vertebrate/invertebrate retinoid X recep transactivation domain (“TD). In another embodiment, the tor ligand binding domain, and a transactivation domain. transactivation domain is selected from the group consisting In another embodiment, the gene Switch comprises a first of a VP16 TD, a GAL.4 TD, an NF-kBTD, a BP64 TD, and a 25 polypeptide comprising a DNA binding domain (DBD) and a B42 acidic TD. first ligand binding domain (LBD) and comprises a second In one embodiment, a DNA binding domain, the ligand polypeptide comprising a transactivation domain (TAD) and binding domain that binds a Compound of the Disclosure, a a second LBD. In one embodiment, the first LBD is an EcR ligand binding domain that dimerizes with the ligand binding ligand binding domain. In one embodiment the first LBD is an domain that binds a Compound of the Disclosure, and a 30 RXR, a USP, a chimeric LBD, or a chimeric RXR/USPLBD. transactivation domain are encoded by polynucleotide In one embodiment, the second LBD is an EcRligand binding sequences that are contained in the same polynucleotide. domain. In one embodiment the second LBD is an RXR, a In another embodiment, a DNA binding domain, a ligand USP, a chimeric LBD, or a chimeric RXR/USPLBD. In one binding domain that binds a Compound of the Disclosure, a embodiment, the DBD is a Gal4 DNA binding domain. In one ligand binding domain that dimerizes with the ligand binding 35 embodiment, the TAD is a VP16 transactivation domain. In domain that binds a Compound of the Disclosure, and a one embodiment, the gene Switch comprises a first polypep transactivation domain are encoded by polynucleotide tide comprising a Gal4 DNA binding domain and an EcR sequences that are contained in one or more separate poly ligand binding domain (LBD) and comprises a second nucleotide sequences. polypeptide comprising a VP16 transactivation domain and In another embodiment, a DNA binding domain, a ligand 40 chimeric RXR/USP ligand binding domain. In one embodi binding domain that binds a Compound of the Disclosure, a ment, the EcR ligand binding domain comprises one or more ligand binding domain that dimerizes with the ligand binding amino acid Substitutions compared to the corresponding domain that binds a Compound of the Disclosure, and a wild-type EcR polypeptide sequence. transactivation domain are encoded by polynucleotide In another embodiment, the gene Switch comprises a sequences that are contained in two separate polynucleotide 45 GAL4 DNA binding domain, a Choristoneura filmiferana Sequences. ecdysone receptor ligand binding domain that is engineered In another embodiment, a DNA binding domain and a to contain the mutations V1071 and Y127E of the Choristo ligand binding domain that binds a Compound of the Disclo neura filmifrana ecdysone receptor sequence set forth in U.S. Sure are encoded by polynucleotide sequences that are con Patent Publication No. 2006/0100416 A1, a chimeric Homo tained in a first polynucleotide sequence, and aligand binding 50 sapiens/Locusta migratoria retinoid X receptor ligand bind domain that dimerizes with the ligand binding domain that ing, and a VP16 transactivation domain. binds a Compound of the Disclosure and a transactivation The term “V107 I’means that the valineamino acid residue domain are encoded by polynucleotide sequences that are at position 107 in the Choristoneura filmifrana ecdysone contained in a second polynucleotide sequence. receptor sequence set forth in U.S. Patent Publication No. In another embodiment, a DNA binding domain and a 55 2006/0100416 A1 is changed to isoleucine. The term ligand binding domain that dimerizes with the ligand binding “Y127E” means that the tyrosine amino acid residue at posi domain that binds a Compound of the Disclosure are encoded tion 127 in the Choristoneura filmifrana ecdysone receptor by polynucleotide sequences that are contained in a first poly sequence set forth in U.S. Patent Publication No. 2006/ nucleotide sequence, and a ligand binding domain that binds 01.00416A1 is changed to glutamate. a Compound of the Disclosure and a transactivation domain 60 In another embodiment, the host cell further comprises a are encoded by polynucleotide sequences that are contained polynucleotide encoding a peptide, protein or polypeptide in a second polynucleotide sequence. whose expression is regulated by the gene Switch. A promoter In embodiments in which one or more of the DNA binding that binds the gene switch complex is operably linked to the domain, a ligand binding domain that binds a Compound of polynucleotide encoding a peptide, protein or polypeptide the Disclosure, a ligand binding domain that dimerizes with 65 whose expression is regulated by the gene Switch. the ligand binding domain that binds a Compound of the In another embodiment, the polynucleotide encoding a Disclosure, and a transactivation domain are encoded by peptide, protein or polypeptide whose expression is regulated US 9,127,024 B2 81 82 by the gene Switch is contained in the same polynucleotide as Rhodococcus cell, a Streptomyces cell, an Escherichia cell, a a polynucleotide that encodes one or more of a DNA binding Pseudomonas cell, a Methylomonas cell, a Methylobacter domain, the ligand binding domain that binds a Compound of cell, a Alcaligenes cell, a Synechocystis cell, a Anabaena cell, the Disclosure, a ligand binding domain that dimerizes with a Thiobacillus cell, a Methanobacterium cell and a Klebsiella the ligand binding domain that binds a Compound of the cell. Disclosure, and a transactivation domain. Such constructs are In another embodiment, the host cell is selected from the disclosed, for example, in U.S. Patent Publication No. 2009/ group consisting of an apple cell, an Arabidopsis cell, a bajra O123441. cell, a banana cell, a barley cell, a bean cell, a beet cell, a In another embodiment, the polynucleotide encoding a blackgram cell, a chickpea cell, a chili cell, a cucumber cell, peptide, protein or polypeptide whose expression is regulated 10 an eggplant cell, a favabean cell, a maize cell, a melon cell, a by the gene switch is contained in a different polynucleotide millet cell, a mungbean cell, an oat cell, an okra cell, a Pani than a polynucleotide that encodes one or more of a DNA cum cell, a papaya cell, a peanut cell, a peacell, a pepper cell, binding domain, the ligand binding domain that binds a Com a pigeonpeacell, a pineapple cell, a Phaseolus cell, a potato pound of the Disclosure, a ligand binding domain that dimer cell, a pumpkin cell, a rice cell, a Sorghum cell, a soybean cell, izes with the ligand binding domain that binds a Compound of 15 a squash cell, a Sugarcane cell, a Sugarbeet cell, a Sunflower the Disclosure, and a transactivation domain. cell, a Sweet potato cell, a tea cell, a tomato cell, a tobacco In one embodiment, the gene Switch is more sensitive to a cell, a watermelon cell, a mushroom cell, and a wheat cell. Compound of the Disclosure than to a steroid hormone. In In another embodiment, the host cell is selected from the another embodiment, the gene Switch is more sensitive to a group consisting of a hamster cell, a mouse cell, a rat cell, a Compound of the Disclosure 1 than to another diacylhydra rabbit cell, a cat cell, a dog cell, a bovine cell, a goat cell, a Zine compound. cow cell, a pig cell, a horse cell, a sheep cell, a monkey cell, The sensitivity of a gene switch to a Compound of the a chimpanzee cell, and a human cell. Disclosure, relative to another ligand, can readily be deter Host cell transformation is well known in the art and may mined in an in vitro assay, for example, an in vitro assay that beachieved by a variety of methods including but not limited employs a reporter gene, such as firefly luciferase. Examples 25 to electroporation, viral infection, plasmid (or vector) trans of Such in vitro assays are well known to those of ordinary fection, non-viral vector mediated transfection, Agrobacte skill in the art. See, for example, Karzenowski et al., BioTech rium-mediated transformation, particle bombardment, and niques 39:191-200 (2005). the like. Expression of desired gene products involves cultur In one embodiment, the polynucleotide encoding the gene ing the transformed host cells under Suitable conditions and Switch is contained in a vector. In one embodiment, the vector 30 inducing expression of the transformed gene. Culture condi selected from the group consisting of a plasmid, an expres tions and gene expression protocols in prokaryotic and sion vector, a replicon, a phage vector, a cosmid, a viral eukaryotic cells are well known in the art. Cells may be vector, a liposome, an electrically charged lipid (e.g., a cyto harvested and the gene products isolated according to proto fectin), a DNA-protein complex, and a biopolymer. cols specific for the gene product. In another embodiment, the vector is a retroviral vector. In 35 In addition, a host cell may be chosen which modulates the another embodiment, the vector is selected from the group expression of the inserted polynucleotide, or modifies and consisting of an adeno-associated viral vector, a pox viral processes the polypeptide product in the specific fashion vector, a baculoviral vector, a vaccinia viral vector, a herpes desired. Different host cells have characteristic and specific simplex viral vector, an Epstein-Barr viral vector, an aden mechanisms for the translational and post-translational pro Oviral vector, a geminiviral vector, and a caulimo viral vector. 40 cessing and modification (e.g., glycosylation, cleavage (e.g., In one embodiment, the host cell is a prokaryotic host cell. of signal sequence)) of proteins. Appropriate cell lines or host In another embodiment, the host cell is a eukaryotic host cell. systems can be chosen to ensure the desired modification and In other embodiments, the host cell is an immune cell (e.g., a processing of the foreign protein expressed. For example, T-cell, a B-cell, a Natural Killer cell and the like) or a stem cell expression in a bacterial system can be used to produce a (e.g., a mesenchymal stem cell (MSC), an endometrial 45 non-glycosylated core protein product. However, a polypep derived stem cell, an endometrial regenerative cell and the tide expressed in bacteria may not be properly folded. Expres like). sion in yeast can produce a glycosylated product. Expression In another embodiment, the host cell is a vertebrate host in eukaryotic cells can increase the likelihood of “native' cell. In another embodiment, the host cell is an invertebrate glycosylation and folding of a heterologous protein. More host cell. 50 over, expression in mammalian cells can provide a tool for In another embodiment, the host cell is selected from the reconstituting, or constituting, the polypeptide's activity. Fur group consisting of a bacterial cell, a fungal cell, a yeast cell, thermore, different vector/host expression systems may a nematode cell, an insect cell, a fish cell, a plant cell, an avian affect processing reactions, such as proteolytic cleavages, to cell, an algae cell, an animal cell, and a mammalian cell. a different extent. In another embodiment, the host cell is selected from the 55 In one embodiment, the host cell comprises two or more group consisting of a Zebrafish cell, a chicken cell, a hamster orthogonal gene Switches. Two or more individually operable cell, a mouse cell, a rat cell, a rabbit cell, a cat cell, a dog cell, gene regulation systems are said to be "orthogonal” when (a) a bovine cell, a goat cell, a cow cell, a pig cell, a horse cell, a modulation of each of the given gene Switches by its respec sheep cell, a simian cell, a monkey cell, a chimpanzee cell, tive ligand results in a measurable change in the magnitude of and a human cell. 60 expression of the gene that is regulated by that gene Switch, In another embodiment, the host cell is selected from the and (b) the change is statistically significantly different than group consisting of an Aspergillus cell, a Trichoderma cell, a the change in expression of all other gene Switches that are in Saccharomyces cell, a Pichia cell, a Candida cell, a the host cell. In one embodiment, regulation of each individu Hansenula cell. ally operable gene Switch system effects a change in gene In another embodiment, the host cell is selected from the 65 expression at least 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, group consisting of a Synechocystis cell, a Synechococcus 20-fold, 50-fold, 70-fold, 100-fold, 200-fold, 300 fold, 400 cell, a Salmonella cell, a Bacillus cell, a Acinetobacter cell, a fold or 500-fold greater than all of the other operable gene US 9,127,024 B2 83 84 Switches in the host cell. Non-limiting examples of orthogo In another embodiment, a Compound of the Disclosure, or nal gene switch systems are set forth in U.S. Patent Publica composition thereof, is administered to a subject to treat tion No. US 2002/011 0861 A1. anemia in the Subject. In one embodiment, the anemia is In another embodiment, a Compound of the Disclosure, or anemia associated with kidney disease, for example, renal composition thereof, is administered to a Subject to treat failure or chronic renal failure. In another embodiment, the cancer in the Subject, for example, a cancer selected from the anemia is associated with cancer therapy with, for example, group consisting of myelodysplasia, breast cancer, prostate one or more chemotherapeutic agents. In another embodi cancer, lymphoma, skin cancer, pancreatic cancer, colon can ment, the anemia is associated with advanced age. In another cer, melanoma, malignant melanoma, ovarian cancer, brain embodiment, the anemia is associated with impaired lung 10 function. In another embodiment, the anemia is associated cancer, primary brain carcinoma, headneck cancer, glioma, with myelodisplasia. In another embodiment, the anemia is glioblastoma, liver cancer, bladder cancer, non-Small cell associated with radiation therapy. In another embodiment, the lung cancer, head or neck carcinoma, breast carcinoma, ova anemia is associated with a critical illness. In another embodi rian carcinoma, lung carcinoma, Small-cell lung carcinoma, ment, the anemia is associated with cardiac disease. In Wilms tumor, cervical carcinoma, testicular carcinoma, 15 another embodiment, the anemia is not a cardiac disease. bladder carcinoma, pancreatic carcinoma, stomach carci Nonlimiting types of "cardiac disease are congestive heart noma, colon carcinoma, prostatic carcinoma, genitourinary failure, hypoxia, ischemic heart disease, hypertensive heart carcinoma, thyroid carcinoma, esophageal carcinoma, disease, coronary artery disease, peripheral vascular disease myeloma, multiple myeloma, adrenal carcinoma, renal cell and ischemic cardiac events, e.g., myocardial infarction, carcinoma, endometrial carcinoma, adrenal cortex carci heart attack, heart failure, arrhythmia, myocardial rupture, noma, malignant pancreatic insulinoma, malignant carcinoid pericarditis, cardiogenic shock, thrombosis, embolism, ath carcinoma, choriocarcinoma, mycosis fungoides, malignant erosclerosis, and arterial Stenosis. hypercalcemia, cervical hyperplasia, leukemia, acute lym In another embodiment, a Compound of the Disclosure, or phocytic leukemia, chronic lymphocytic leukemia, acute composition thereof, are administered to a Subject to treat an myelogenous leukemia, chronic myelogenous leukemia, 25 autoimmune disorder in the Subject, for example, an autoim chronic granulocytic leukemia, acute granulocytic leukemia, mune disorder selected from the group consisting of Achlo hairy cell leukemia, neuroblastoma, rhabdomyosarcoma, rhydra Autoimmune Active Chronic Hepatitis, Acute Dis Kaposi's sarcoma, polycythemia Vera, essential thrombocy seminated Encephalomyelitis, Acute hemorrhagic tosis, Hodgkin’s disease, non-Hodgkin’s lymphoma, Soft leukoencephalitis, Addison's Disease, gammaglobulinemia, tissue sarcoma, mesothelioma, osteogenic sarcoma, primary 30 Agammaglobulinemia, Alopecia greata, Amyotrophic Lat macroglobulinemia, and retinoblastoma, and the like. eral Sclerosis, Ankylosing Spondylitis, Anti-GBM/TBM In another embodiment, a Compound of the Disclosure, or Nephritis, Antiphospholipid syndrome, Antisynthetase syn composition thereof, is administered to a Subject to treat a drome, Arthritis, Atopicallergy, Atopic Dermatitis, Aplastic metabolic-related disorder in the subject, for example, a Anemia, Autoimmune cardiomyopathy, Autoimmune metabolic disorder selected from the group consisting of dys 35 hemolytic anemia, Autoimmune hepatitis, Autoimmune lipidemia, atherosclerosis, insulin resistance, diabetes (e.g., inner ear disease, Autoimmune lymphoproliferative Syn diabetes type I, diabetes type II, MODY, and gestational dia drome, Autoimmune peripheral neuropathy, Autoimmune betes), obesity, impaired glucose tolerance, atheromatous pancreatitis, Autoimmune polyendocrine syndrome Types I. disease, hypertension, heart disease (which includes, but is II, & III, Autoimmune progesterone dermatitis, Autoimmune not limited to, coronary heart disease, stroke, cardiac insuf 40 thrombocytopenic purpura, Autoimmune uveitis, Balo dis ficiency, coronary insufficiency, and high blood pressure), ease/Balo concentric sclerosis, Bechets Syndrome, Berger's hyperlipidemia, glucose intolerance, insulin resistance, disease, Bickerstaffs encephalitis, Blau syndrome, Bullous hyperglycemia, hyperinsulinemia, metabolic syndrome X (or Pemphigoid, Castleman's disease, Chronic Fatigue Immune syndrome X, or insulin resistance syndrome, or Reaven's Dysfunction Syndrome, chronic inflammatory demyelinat syndrome, or the metabolic cardiovascular risk syndrome), 45 ing polyneuropathy, Chronic recurrent multifocal ostomyeli hypertension, chronic fatigue, accelerated aging, degenera tis, Churg-Strauss syndrome, Cicatricial Pemphigoid, tive disease, endocrine deficiencies of aging, G1 gangliosi Coeliac Disease, Cogan syndrome, Cold agglutinin disease, dosis, Morquio-B disease, Krabbe's disease, Fabry's disease, Complement component 2 deficiency, Cranial arteritis, Gaucher's disease, Tay-Sachs disease, Sandhoff disease, CREST syndrome, Crohns Disease, Cushing's Syndrome, fucosidosis, disorders of carbohydrate metabolism (e.g., gly 50 Cutaneous leukocytoclastic angiitis, Dego's disease, Derma cogen storage disease), disorders of amino acid metabolism titis herpetiformis, Dermatomyositis, Diabetes mellitus type (e.g., phenylketonuria, maple syrup urine disease, glutaric 1. Diffuse cutaneous systemic Sclerosis, Dressler's Syn acidemia type 1), disorders of organic acid metabolism (e.g., drome, Discoid lupus erythematosus, eczema, Enthesitis-re alcaptonuria), disorders offatty acid oxidation and mitochon lated arthritis, Eosinophilic fasciitis, Epidermolysis bullosa drial metabolism (e.g., medium chain acyl dehydrogenase 55 acquisita, Erythema nodosum, Essential mixed cryoglobu deficiency), disorders of porphyrin metabolism (e.g., acute linemia, Evans syndrome, Fibrodysplasia ossificans pro intermittent porphyria), disorders of purine or pyrimidine gressiva, Fibromyositis, Fibrosing aveolitis, Gastritis, Gas metabolism (e.g., Lesch-Nyhan syndrome), disorders of ste trointestinal pemphigoid, Giant cell arteritis, Goodpasture's roid metabolism (e.g., congenital adrenal hyperplasia), dis syndrome, Graves’ disease, Guillain-Barré syndrome (GBS), orders of mitochondrial function (e.g., Kearns-Sayre Syn 60 Hashimoto's encephalitis, Hashimoto's thyroiditis, drome), and disorders of peroxisomal function (e.g., Hemolytic anaemia, Henoch-Schonlein purpura, Herpes ges Zellweger syndrome). tationis, Hughes syndrome (or Antiphospholipid syndrome), In another embodiment, a Compound of the Disclosure, or Hypogammaglobulinemia, Idiopathic Inflammatory Demy composition thereof, is administered to a Subject to treat elinating Diseases, Idiopathic pulmonary fibrosis, Idiopathic kidney disease in the Subject. In one embodiment, the kidney 65 thrombocytopenic purpura, IgA nephropathy (or Berger's disease is renal failure. In another embodiment, the kidney disease), Inclusion body myositis, ory demyelinating poly disease is chronic renal failure. neuopathy, Juvenile idiopathic arthritis, Juvenile rheumatoid US 9,127,024 B2 85 86 arthritis, Lambert-Eaton myasthenic syndrome, Leukocyto sis, polyarteritis nodosa, Wegener's granulomatosis, termpo clastic vasculitis, Lichen planus, Lichen Sclerosus, Linear ral arteritis, Adamantiades Bechcet disease, Sorgens, IgA disease (LAD), Lou Gehrig's Disease, Lupoid hepatitis, relapsing polychondritis and HLA-B27 associated spondyli Lupus erythematosus, Majeed syndrome, Méniere's disease, tis), sarcoidosis, Eales disease, acute retinal necrosis, Vogt Microscopic polyangiitis, Miller-Fisher syndrome, Mixed Koyanaki Harada syndrome, occular toxoplasmosis, radia Connective Tissue Disease, Mucha-Habermann disease, tion retinopathy, proliferative vitreoretinopathy, endoph MuckleWells syndrome, Multiple Myeloma, Myasthenia thalmitis, ocular glaucomas (for example, inflammatory glau gravis, Myositis, Narcolepsy, Neuromyelitis optica (also comas), optic neuritis, ischemic optic neuropathy (e.g., Devic's Disease), Occular cicatricial pemphigoid, Ord thy vectors composed of Allotopic NADH dehydrogenase Unit roiditis, Palindromic rheumatism, PANDAS (Pediatric 10 4), thyroid associated orbitopathy, orbital pseudotumor, pig Autoimmune Neuropsychiatric Disorders Associated with ment dispersion syndrome (pigmentary glaucoma), Scleritis, Streptococcus), Paraneoplastic cerebellar degeneration, episcleritis choroidopathies (for example, "White-dot syn Paraneoplastic cerebellar degeneration, Parry Romberg syn dromes including, but not limited to, acute multifocal poste drome, Parsonnage-Turner syndrome, Pars planitis, Pemphi rior placoid), retinopathies (for example, cystoid macular gus, Pemphigus Vulgaris, Pernicious anaemia, Perivenous 15 edema, central serous choroidopathy and presumed ocular encephalomyelitis, POEMS syndrome, Polyarteritis nodosa, histoplasmosis syndrome (e.g., vectors composed of Glial Polymyalgia rheumatica, Polymyositis, Primary biliary cir CellDerived Neurotropic Factor, Peripherin-2)), retinal vas rhosis, psoriasis, psoriatic arthritis, Pyoderma gangrenosum, cular disease (for example, diabetic retinopathy, Coats dis pure red cell aplasia, Rasmussen's encephalitis, Raynaud ease and retinal arterial macroaneurysm), retinal artery occlu phenomenon, Relapsing polychondritis, Reiter's syndrome, sions, retinal vein occlusions, retinopathy of prematurity, Retroperitoneal fibrosis, Rheumatoid arthritis, Rheumatoid retinitis pigmentosa (e.g., vectors composed of Retinal Pig fever, Schmidt syndrome, Schnitzler syndrome, Scleritis, ment Specific 65 kDa protein), familial exudative vitreoret Sjögren's syndrome, Spondyloarthropathy, Sticky blood Syn inopathy (FEVR), idiopathic polypoidal choroidal vascul drome, Still's Disease, Subacute bacterial endocarditis opathy, epiretinal macular membranes and cataracts. (SBE), Susac’s syndrome, Sweet syndrome, Sydenham Cho 25 In another embodiment, a Compound of the Disclosure, or rea, Sympathetic ophthalmia, Takayasu's arteritis, Temporal composition thereof, is administered to a Subject to treat an arteritis, Tolosa-Hunt syndrome, Transverse Myelitis, Ulcer ocular disorder in the subject, wherein the ocular disorder is ative Colitis, Undifferentiated connective tissue disease, selected from the group consisting of glaucoma, wet and dry Undifferentiated spondyloarthropathy, vasculitis, Wegener's age-related macular degeneration, diabetic retinopathy, and granulomatosis, Wilson's syndrome, and Wiskott-Aldrich 30 macular oedema. syndrome. In another embodiment, a Compound of the Disclosure, or In another embodiment, a Compound of the Disclosure, or composition thereof, is administered to a subject to treat a composition thereof, is administered to a subject to treat an blood disorder in the subject, for example, a blood disorder ocular disorder in the Subject, for example, an ocular disorder selected from the group consisting of a blood disorder selected from the group consisting of glaucoma including 35 selected from the group consisting of anemia, bleeding and Open Angle Glaucoma (e.g., Primary Open Angle Glaucoma, clotting disorders (e.g., disseminated intravascular coagula Pigmentary Glaucoma, and Exfoliative Glaucoma, Low Ten tion (DIC), hemophilia, Henoch-Schonlien Purpura, heredi sion Glaucoma), Angle Closure Glaucoma (also known clini tary hemorrhagic telangiectasia, thrombocytopenia (ITP, cally as closed angle glaucoma, narrow angle glaucoma, TTP), thrombophilia, Von Willebrand’s disease), leukemias pupillary block glaucoma, and ciliary block glaucoma) (e.g., 40 (e.g., acute lymphocytic leukemia, acute myelocytic leuke Acute Angle Closure Glaucoma and Chronic Angle Closure mia, chronic lymphocytic leukemia, chronic myelocytic leu Glaucoma), Aniridic Glaucoma, Congenital Glaucoma, Juve kemia), lymphomas (e.g., Hodgkin lymphoma, non-Hodgkin nile Glaucoma, Lens-Induced Glaucoma, Neovascular Glau lymphoma), myeloproliferative disorders (e.g., myelofibro coma (e.g., using vectors composed of Vascular Endothelial sis, Polycythemia Vera, thrombocythemia), plasma cell dis Growth Factor (VEGF) decoy, Pigment Derived Growth Fac 45 orders (e.g., macroglobulinemia, monoclonal gammopathies tor (PDGF). Endostatin, Angiostatin, or Angiopoetin-1), of undetermined significance, multiple lyeloma), spleen dis Post-Traumatic Glaucoma, Steroid-Induced Glaucoma, orders, white blood cell disorders (e.g., basophilic disorder, Sturge-Weber Syndrome Glaucoma, and Uveitis-Induced eosinophilic disorder, lymphocytopenia, monocyte disorders, Glaucoma, diabetic retinopathy (e.g., using vectors com neutropenia, neutrophillic leukocytosis), thrombosis, deep posed of VEGF decoy, PDGF, Endostatin, Angiostatin, or 50 vein thrombosis (DVT), hemochromatosis, menorrhagia, Angiopoetin-1), macular degeneration (e.g., vectors com sickle cell disease, and thalassemia. posed of VEGF decoy, PDGF, Endostatin, Angiostatin, In another embodiment, a Compound of the Disclosure, or Angiopoetin-1, ATP Binding Casette Subfamily A Member composition thereof, is administered to a subject to treat a 4), macular degeneration (e.g., using vectors composed of neurological disorder in the Subject, for example, a neurologi VEGF decoy, PDGF, Endostatin, Angiostatin, Angiopoetin 55 cal disorder selected from the group consisting of Gaucher 1, ATP Binding Casette Subfamily A Member 4), choroidal disease, Parkinson's disease, Alzheimer's disease, amyo neovascularization, (e.g., using vectors composed of VEGF trophic lateral sclerosis (ALS), multiple sclerosis (MS), Hun decoy, PDGF. Endostatin, Angiostatin, or Angiopoetin-1), tington's disease, Fredrich's ataxia, Mild Cognitive Impair vascular leak, and/or retinal edema, bacterial conjunctivitis, ment, Cerebral Amyloid Angiopathy, Parkinsonism Disease, fungal conjunctivitis, viral conjunctivitis, uveitis, keratic pre 60 Lewy Body Disease. Frontotemporal Dementia (FTD) Mul cipitates, macular edema (e.g., using vectors composed of tiple System Atrophy (MSA), Progressive Supranuclear VEGF decoy, PDGF, Endostatin, Angiostatin, or Angiopo Palsy, and movement disorders (including ataxia, cerebral etin-1), inflammation response after intra-ocular lens implan palsy, choreoathetosis, dystonia, Tourette’s syndrome, ker tation, uveitis syndromes (for example, chronic iridocyclitis nicterus) and tremor disorders, and leukodystrophies (includ or chronic endophthalmitis), retinal vasculitis (for example, 65 ing adrenoleukodystrophy, metachromatic leukodystrophy, as seen in rheumatoid arthritis, juvenile rheumatoid arthritis, Canavan disease, Alexander disease, Pelizaeus-Merzbacher systemic lupus erythymatosus, progressive systemic Sclero disease), neuronal ceroid lipofucsinoses, ataxiatelangectasia, US 9,127,024 B2 87 88 Rett Syndrome, alpha.-synucleinopathy (e.g., Lewy Body fever, Brucellosis, Burkholderia infection, Buruli ulcer, Cal Disease, Multiple System Atrophy, Hallervorden-Spatz dis civirus infection (Norovirus and Sapovirus), Candidiasis, ease, or Frontotemporal Dementia), Niemann-Pick Type C Cat-scratch disease, Cellulitis, Chagas Disease (American disease (NPCD), spinocerebellar ataxia Type 1, Type 2, and trypanosomiasis), Chancroid, Chickenpox, Chlamydia, Type 3, and dentatorubral pallidoluysian atrophy (DRLPA). 5 Cholera, Chromoblastomycosis, Clonorchiasis, Clostridium In another embodiment, a Compound of the Disclosure, or difficile, Coccidioidomycosis, Colorado tick fever (CTF), composition thereof, is administered to a Subject to treat a Common cold (Acute viral rhinopharyngitis; Acute coryza), lung disorder in the Subject, for example, a lung disorder Creutzfeldt-Jakob disease (CJD), Cryptococcosis, selected from the group consisting of asthma, atelectasis, Cryptosporidiosis, ous larva migrans (CLM), Dengue fever, bronchitis, COPD (chronic obstructive pulmonary disease), 10 Dientamoebiasis, Diphtheria, Diphyllobothriasis, Diphyllo emphysema, Lung cancer, mesothelioma, pneumonia, asbes bothriasis, Dracunculiasis, Ebola hemorrhagic fever, Echino tosis, Aspergilloma, Aspergillosis, Aspergillosis—acute coccosis, Ehrlichiosis, Enterobiasis (Pinworm infection), invasive, bronchiectasis, bronchiolitis obliterans organizing Enterococcus infection, Enterovirus infection, Epidemic pneumonia (BOOP), eosinophilic pneumonia, necrotizing typhus, Erythema infectiosum, EXanthem Subitum, Fasciol pneumonia, ral effusion, pneumoconiosis, pneumothorax, 15 opsiasis, Fasciolosis, Fatal familial insomnia (FFI), Filari pulmonary actinomycosis, monary alveolar proteinosis, pull asis, Fusobacterium infection, Gas gangrene (Clostridial monary anthrax, pulmonary arteriovenous malformation, myonecrosis), Geotrichosis, Gerstmann-Sträussler-Schei pulmonary fibrosis, pulmonary embolus, pulmonary histio nker syndrome (GSS), Giardiasis Glanders, Gnathostomia cytosis X (eosinophilic granuloma), pulmonary hyperten sis, Gonorrhea, Granuloma inguinale (Donovanosis), Group Sion, pulmonary edema, pulmonary hemorrhage, pulmonary A streptococcal infection, Group B Streptococcal infection, nocardiosis, pulmonary tuberculosis, pulmonary veno-occlu Haemophilus influenzae, Hand, foot and mouth disease sive disease, rheumatoid lung disease, sarcoidosis, radiation (HFMD), Hantavirus Pulmonary Syndrome (HPS) Helico fibrosis, hypersensitivity pneumonitis, acute respiratory dis bacter pylori infection, ic-uremic syndrome (HUS), Hemor tress syndrome (ARDS), infant respiratory distress syn rhagic fever with renal syndrome (HFRS), Hepatitis A, B, C, drome, idiopathic pulmonary fibrosis, idiopathic interstitial 25 D, E, Herpes simplex. Histoplasmosis, Hookworm infection, pneumonia, lymphangioleiomyomatosis, pulmonary Langer in bocavirus infection, Human ewingii ehrlichiosis, Human hans cell histiocytosis, pulmonary alveolar proteinosis, granulocytic anaplasmosis (HGA), Human granulocytic ana sinusitis, tonsillitis, otitis media, pharyngitis, laryngitis, Pul plasmosis (HGA), Human monocytic ehrlichiosis, Human monary hamartoma, pulmonary sequestration, congenital papillomavirus (HPV) infection, Human parainfluenza virus cystic adenomatoid malformation (CCAM), and cystic fibro 30 infection, Hymenolepiasis, Epstein-Barr Virus Infectious S1S. Mononucleosis (Mono), Influenza (flu), Isosporiasis, In another embodiment, a Compound of the Disclosure, or Kawasaki disease, Keratitis, Kingella kingae infection, Kuru, composition thereof, is administered to a Subject to treat a Lassa fever, Legionellosis (Legionnaires disease), Legionel rheumatologic disorder in the Subject, for example, a rheu losis (Pontiac fever), Leishmaniasis, Leprosy, Leptospirosis, matologic disorder selected from the group consisting of 35 Listeriosis, Lyme disease (Lyme borreliosis), Lymphatic systemic lupus erythematosus, dermatomyositis, Sclero filariasis (Elephantiasis), Lymphocytic choriomeningitis, derma, systemic necrotizing arteritis, cutaneous necrotizing Malaria, Marburg hemorrhagic fever (MHF), Measles, Venulitis, rheumatoid arthritis, Sjogren's Syndrome, Melioidosis (Whitmore's disease), Meningitis, Meningococ Raynaud's phenomenon, Reiter's syndrome, arthritis, psori cal disease, Metagonimiasis, Microsporidiosis, Molluscum atic arthritis, seronegative spondyloarthropathies, Sjogren's 40 contagiosum (MC), Mumps, Murine typhus (Endemic syndrome, systemic Sclerosis, dermatomyositis/polymyosi typhus), Mycoplasma pneumonia, Mycetoma, Myiasis, Neo tis, mixed connective tissue disease, and ankylosing natal conjunctivitis (Ophthalmia neonatorum), (New) Variant spondylitis. Creutzfeldt-Jakob disease (v0.JD, invoD), Nocardiosis, In another embodiment, a Compound of the Disclosure, or Onchocerciasis (River blindness), Paracoccidioidomycosis composition thereof, is administered a subject to treat an 45 (South American blastomycosis), Paragonimiasis, Pasteurel infectious disease in the Subject, for example, an infectious losis, Pediculosis capitis (Head lice), Pediculosis corporis disease selected from the group consisting of fungal diseases (Body lice), Pediculosis pubis (Pubic lice, Crab lice), Pelvic Such as dermatophytosis (e.g., trichophytosis, ringworm or inflammatory disease (PID), Pertussis (Whooping cough), tinea infections), athletes foot, paronychia, pityriasis versi Plague, Pneumococcal infection, Pneumocystis pneumonia color, erythrasma, intertrigo, fungal diaper rash, candida Vul 50 (PCP), Pneumonia, Poliomyelitis, Poliomyelitis, Prevotella Vitis, candida balanitis, otitis externa, candidiasis (cutaneous infection, mary amoebic meningoencephalitis (PAM), Pro and mucocutaneous), chronic mucocandidiasis (e.g., thrush gressive multifocal leukoencephalopathy, Psittacosis, Q and vaginal candidiasis), cryptococcosis, geotrichosis, tri fever, Rabies, Rat-bite fever, Respiratory syncytial virus chosporosis, aspergillosis, penicilliosis, fusariosis, Zygomy infection, Rhinosporidiosis, inovirus infection, Rickettsial cosis, sporotrichosis, chromomycosis, coccidioidomycosis, 55 infection, Rickettsialpox, Rift Valley fever (RVF), Rocky histoplasmosis, blastomycosis, paracoccidioidomycosis, mountain spotted fever (RMSF), Rotavirus infection, pseudallescheriosis, mycetoma, mycotic keratitis, otomyco Rubella, Salmonellosis, SARS (Severe Acute Respiratory sis, pneumocystosis, and fungemia, Acinetobacterinfections, Syndrome), Scabies, Schistosomiasis, Sepsis, Shigellosis Actinomycosis, African sleeping sickness, AIDS (Acquired (Bacillary dysentery), Shingles (Herpes Zoster), Smallpox immune deficiency syndrome), Amebiasis, Anaplasmosis, 60 (Variola), Sporotrichosis, Staphylococcal food poisoning, Anthrax, Arcanobacterium haemolyticum infection, Argen Staphylococcal infection, Strongyloidiasis, Syphilis, Taenia tine hemorrhagic fever, Ascariasis, Aspergillosis, atrovirus sis, tanus (Lockjaw), Tinea barbae (Barbers itch), Tinea capi infection, Babesiosis, Bacillus cereus infection, Bacterial tis (Ringworm of the Scalp), Tinea corporis (Ringworm of the pneumonia, Bacterial vaginosis (BV), Bacteroides infection, Body), Tinea cruris (Jockitch), Tinea manuum (Ringworm of Balantidiasis, Baylisascaris infection, BK virus infection, 65 the Hand), Tinea nigra, Tinea unguium (Onychomycosis), Black piedra, Blastocystis hominis infection, Borrelia infec Tinea versicolor (Pityriasis versicolor), Toxocariasis (Vis tion, Botulism (and Infant botulism), Brazilian hemorrhagic ceral Larva Migrans (VLM)), Toxoplasmosis, Trichinellosis, US 9,127,024 B2 89 90 Trichomoniasis, Trichuriasis (Whipworm infection), Tuber erythema chronicum migrans, Vibriosis, Colibacteriosis, culosis, Tularemia, Ureaplasma urealyticum infection, Ven colitoxemia, white scours, gut edema of Swine, enteric eZuelan equine encephalitis, Venezuelan hemorrhagic fever, paratyphosis, Staphylococcal alimentary toxicosis, staphylo viral pneumonia, West Nile Fever, White piedra (Tinea coccal gastroenteritis, Canine Corona Virus (CCV) or canine blanca), Yersinia pseudotuberculosis infection, Yersiniosis, parvovirus enteritis, feline infectious peritonitis virus, trans Yellow fever, and Zygomycosis. missible gastroenteritis (TGE) virus, Hagerman Redmouth In another embodiment, a Compound of the Disclosure, or Disease (ERMD), Infectious Hematopoietic necrosis (IHN), composition thereof, is administered to a Subject to treat porcine Actinobacillus (Haemophilus) pleuropneumonia, angioedema in the Subject. In another embodiment, the Hansen's disease, Streptotrichosis, Mycotic Dermatitis of angioedema is hereditary angioedema. 10 Sheep, Pseudoglanders, Whitmore's disease, Francis dis In another embodiment, a Compound of the Disclosure, or ease, deer-fly fever, rabbit fever, O'Hara disease, Streptoba composition thereof, is administered to a Subject treat a dis cillary fever, Haverhill fever, epidemic arthritic erythema, ease, condition or disorder selected from the group consisting Sodoku, Shipping or transport fever, hemorrhagic septicemia, of sepsis, hypercoagulability, pulmonary dysfunction, Ornithosis, Parrot Fever, Chlamydiosis, North American hypoxemia, hemorrhagic pancreaitis, myocardial infarction, 15 blastomycosis, Chicago disease, Gilchrist's disease, Cat lung transplantation, trauma, thermal injury and vascular leak Scratch Fever, Benign Lymphoreticulosis, Benign nonbacte in the subject. rial Lymphadenitis, Bacillary Angiomatosis, Bacillary Pelio In another embodiment, a Compound of the Disclosure, or sis Hepatis, Query fever, Balkan influenza, Balkan grippe, composition thereof, is administered to a Subject to treat a abattoir fever, Tick-borne fever, pneumorickettsiosis, Ameri disease, condition or disorder in which inhibition ofkallikrein can Tick Typhus, Tick-borne Typhus Fever, Vesicular Rick provides a therapeutically beneficial effect. Examples of such ettsiosis, Kew Gardens Spotted Fever, Flea-borne Typhus diseases, conditions or disorders include, but are not limited Fever, Endemic Typhus Fever, Urban Typhus, Ringworm, to, disease, conditions or disorders of the contact system. See Dermatophytosis, Tinea, Trichophytosis, Microsporosis, e.g., Shariat-Madar et al., Innate Immunity, Vol. 10, no. 1, Jock Itch, Athlete's Foot, Sporothrix schenckii, dimorphic 3-13 (2004) and Frick, et al., EMBO.J., (2006)25,5569-5578 25 fingus, Cryptococcosis and histoplasmosis, Benign Epider (2006). In another embodiment, a Compound of the Disclo mal Monkeypox, BEMP Herpesvirus simiae, Simian B Dis Sure, or composition thereof, is administered a Subject to treat ease, Venezuelan equine encephalitis, Tipe C lethargic a disease, condition or disorder selected from the group con encephalitis, Yellow fever, Black Vomit, hantavirus pulmo sisting of atherothrombosis, coronary artery disease, Alzhe nary syndrome, Korean Hemorrhagic Fever, Nephropathia imer's Disease, inflammatory bowel disease (for example, 30 Epidemica, Epidemic Hemorrhagic Fever, Hemorrhagic Crohn's Disease), vascular leak, acute respiratory distress Nephrosonephritis, lymphocytic choriomeningitis, Califor syndrome and bradykinin-mediated inflammation in the sub nia encephalitis/La Crosse encephalitis, African Hemor ject. rhagic Fever, Green or Vervet Monkey Disease, Hydrophobia, In another embodiment, a Compound of the Disclosure, or Lyssa, Infectious hepatitis, Epidemic hepatitis, Epidemic composition thereof, is administered to a Subject to treat a 35 jaundice, Rubeola, Morbilli, Swine and Equine Influenza, disease, condition or disorder in which inhibition of bradyki Fowl Plague, Newcastle disease, Piroplasmosis, toxoplasmo nin B2 receptor provides atherapeutically beneficial effect. In sis, African Sleeping Sickness, Gambian Trypanosomiasis, another embodiment, a Compound of the Disclosure, or com Rhodesian Trypanosomiasis, Chagas's Disease, Chagas position thereof, is administered to a subject treat a disease, MaZZa Disease, South American Trypanosomiasis, Entam condition or disorder selected from the group consisting of 40 oeba histolytica, Balantidial dysentery, cryptosporidiosis, glomerulosclerosis, Alzheimer's Disease, cerebral edema, giardiasis, Cutaneous leishmaniasis: Chiclero ulcer, espun vascular leak, acute respiratory distress syndrome, pain, dia, pianbols, uta, and buba (in the Americas); oriental Sore, inflammation, trauma, burns, shock, allergy, and cardiovas Aleppo boil (in the Old World); Bagdad boil, Delhi boil, cular disease in the Subject. Baum ulcer, Visceral leishmaniasis: kala-azar, Microsporidi In another embodiment, a Compound of the Disclosure, or 45 osis, Anisakiasis, Trichinosis, Angiostrongylosis, eosino composition thereof, is administered to a subject to treat an philic meningitis or meningoencephalitis (A. cantonensis), infectious disease in the Subject, for example, an infectious abdominal angiostrongylosis (A. Costaricensis), Uncinari disease selected from the group consisting of Bovine respi asis, Necatoriasis, Hookworm Disease, Capillariasis, Brugia ratory disease, Porcine respiratory disease, Avian influenza, sis, Toxocariasis, Oesophagostomiasis, Strongyloidiasis, Tri Avian infectious bronchitis, Bovine spongiform encephal 50 chostrongylosis, Ascaridiasis, Diphyllobothriasis, opathy, Canine leishmaniasis, Chronic wasting disease, Sparganosis, Hydatidosis, Hydatid Disease, Echinococcus human immune deficiency virus (HIV), hepatitis, hepatitis A, granulosis, Cystic hydatid disease, Tapeworm Infection, and hepatitis B, hepatitis C, Classical Swine fever, Echinococcus, Schistosoma. Enzootic pneumonia, FIP Foot-and-mouth disease, Jaag In another embodiment, a Compound of the Disclosure, or siekte, Maedi-Visna, Mastitis in animals, Microsporum canis, 55 composition thereof, is administered to a subject to treat Orf (animal disease), Peste des petits ruminants, Pox dis chronic renal disease, osteoarthritis, oncology, viral upper eases, Psittacine beak and feather disease, Rabies, Mediter respiratory infection, feline plasma cell Stomatitis, feline ranean fever (Brucellosis) or Bang's disease or undulant eosinophillic granulomas, feline leukemia virus infection, fever, Malta fever, contagious abortion, epizootic abortion, canine distemper infection, systemic fungal infections, car Salmonella food poisoning, enteric paratyphosis, Bacillary 60 diomyopathy, and mucopolysaccharidosis VII in the Subject. dysentery, Pseudotuberculosis, plague, pestilential fever, In the methods of the present disclosure, the gene switch Tuberculosis, Vibrios, Circling disease, Weil's disease (Lep regulates the expression of a polynucleotide encoding a pep to spirosis) or canicola fever, Hemorrhagic jaundice (Lep tide, protein, or polypeptide. In one embodiment, gene Switch to spira icterohaemorrhagiae), dairy worker fever (L. hardo), regulates the expression of a polynucleotide encoding a pep Relapsing fever, tick-borne relapsing fever, Spirochetal fever, 65 tide, protein, or polypeptide of therapeutic interest for the vagabond fever, famine fever, Lyme arthritis, Bannworth’s treatment of a disease, condition, or disorderina Subject, e.g., syndrome (lime disease), tick-borne meningopolyneuritis, a human. In another embodiment, the peptide, protein, or US 9,127,024 B2 91 92 polypeptide of interest is selected from the group consisting nase, MNR2, ATM, Ho-1, CON202, Ataxin-1, NR3B, NIPA of Her-2/neu (ERBB2/c-erbB-2), Osteocalcin, stromelysin 1, DEPP, adrenomedullin, csdA, Inf-20, EOPA, SERT FRP 1, prostate specific antigen, human Sodium-iodide symporter, 1, Serum amyloid A, BMP2, BMPR1A, ACLP, Resistin-like H19, IF-1, IGF-2, thymosin B15, T cell factor, cartilage molecule B, Dlg5, TRANCE, Matrilin-3, Synoviolin, HIV derived retinoic acid-sensitive protein, Prostasin, telomerase LTR, SHIVA, EBI 1, EBI 2, EBI 3, NM23, Eps8, Beta-10, catalytic Subunit, cyclin-A, midkine; c-erbB-2, prostate-spe Hair follicle growth factor, Corneodesmosin, GCR9, Bg, cific membrane antigen, p51, telomerase RNA, prostatic acid FGF23, BBSR, MIC-1, MIA-2, IL-17B, Formylglycine gen phosphatase, PCA3dd3, DF3/MUC1, hex II, cyclooxyge erating enzyme, LPLA2, CXCL1O, HFE2A, IL-1, IL-2, nase-2, super PSA, skip2, PRL-3, CA125/M17S2, IAI.3B, IL-3, IL-4, IL-5, IL-7, IL-8, IL-9, IL-10R DN or a subunit CRG-L2, TRPM4, RTVP, TARP telomere reverse tran 10 thereof, IL-15, IL-18, IL-21, IL-23, IL-24, IL-27, GM-CSF, Scriptase, A4 amyloid protein, amyloid B-protein precursor, IFN-alpha, IFN-gamma, IFN-alpha 1, IFN alpha 2., IL-15-R- precursor of the Alzheimer's Disease A4 amyloid protein, alpha, CCL3 (MIP-1a), CCLS (RANTES), CCL7 (MCP3), neuropeptide FF, endoplasmic reticulum stress elements, uro XCL1 (lymphotactin), CXCL1 (MGSA-alpha), CCR7, cortin II, tyrosine hydroxylase, complement factor 3; serum CCL19 (MIP-3b), CXCL9 (MIG), CXCL10 (IP-10), amyloid A3, tissue inhibitor of metalloproteinase-3 (TIMP 15 CXCL12 (SDF-1), CCL21 (6Ckine), OX40L, 4-1BBL, 3), p75 tumor necrosis factor receptor, tumor necrosis factor CD40, CD70, GITRL, LIGHT, b-Defensin, HMGB1, Flt3L, C, TRPM4, RTVP, TARP telomere reverse transcriptase, A4 IFN-beta, TNF-alpha, dnFADD, BCG, TGF-alpha, PD-L1 amyloid protein, amyloid B-protein precursor, precursor of RNAi, a PD-L1 antisense oligonucleotide, TGFbRII DN, the Alzheimer's Disease A4 amyloid protein, neuropeptide ICOS-L, S100, CD40L, p53, survivin, p53-survivin fusion, FF, endoplasmic reticulum stress elements, urocortin II, MAGE3, myelin basic protein, PSA and PSMA. tyrosine hydroxylase, complement factor 3; serum amyloid In another embodiment, the peptide, protein, or polypep A3, tissue inhibitor of metalloproteinase-3 (TIMP-3), p75 tide of interest is ciliary neurotrophic factor, vasohibin, IL-10, tumor necrosis factor receptor, tumor necrosis factor-O, per Erythro-poietin, VEGF trap, or PDGF. oxisome proliferator activated receptor/IIA-1 nonpancreatic In another embodiment, the peptide, protein, or polypep secreted phospholipase A2, SOCS-3, SR-BI, Ob, site-1 pro 25 tide of interest is a JUN-kinase inhibitor vasoinhibin, EPO, or tease, TIGR, VL30, excitatory amino acid transporter-2. CTNF. MDTS9, LIM, pyrroline 5-carboxylate reductase, SIM2, In another embodiment, the gene Switch regulates the Bax, Fas, bbc3, PINK-1, troponin T. myoD, Actin, smooth expression of a polynucleotide encoding an IL-12 or a subunit muscle 22C, Utrophin, Myostatin, Smooth muscle myosin thereof. In another embodiment, the IL-12 or subunit thereof heavy chain, cardiac ankyrin repeat protein, MLP, Smoothe 30 is human IL-12 or subunit thereof. lin, MYBPC3, To. 1 C-tubulin, intercellular adhesion mol In another embodiment, the gene Switch regulates the ecule-4 (ICAM-4), Y-aminobutyric acid type A receptor B1 expression of a polynucleotide encoding a C1 esterase inhibi Subunit, neuronal nicotinic acetylcholine receptor B2-sub tor (for example, a human C1 esterase inhibitor), a kallikrein unit, presenilin-1, calcium-calmodulin-dependent kinase IIC. inhibitor, or a bradykinin B2 receptor antagonist. CRF2C. receptor, nerve growth factor, GLP-2 receptor, type I 35 Examples of kallikrein inhibitors include, but are not lim transglutaminase, K14, Stearoyl-CoA desaturase, Megsin, ited to, ecallantide and those kallikrein inhibitors set forth Prolactin, GDF-9, PSP94, NRL, NGAL, long whey acidic U.S. Patent Publication Nos. 2010/0034.805, 2009/0264350, protein, mammary associated amyloid A, endothelin-1, Ser 2009/0234009, 2008/0221031, 2007/0213275, 2006/ glycin, platelet-endothelial cell adhesion molecule-1 (PE O26.4603 and 2005/OO89515. CAM-1), Tie receptor tyrosine kinase, KDR/flk-1, Endoglin, 40 Examples of bradykinin B2 receptor inhibitors include, but CCR5, CD11d, platelet glycoprotein Hb, preproendothelin are not limited to, helokinestatin and anti-bradykinin B2 1, interleukin-18 binding protein, CD34, Tec tyrosine kinase, receptor antibodies. The amino acid sequence ofhelokinesta MLH1, MSH2, MSH6, PMS1, APC, LEF-1, F2 receptor, tin is set forthin Kwok, H. F. et al., Peptides 29I65-72 (2008). TGF-B type II receptor, EYA4, PCA3, K2, PROST 03, Nonlimiting examples of anti-bradykinin B2 receptor anti PCAM-1, PCADM-1, PCA3dd3, PCAV, PAcP, ATB, CSA 45 bodies are set forth in Alla, S. A. et al., J. Biol. Chem. 271: 1, SYG972, Urb-ct?, BCU399, TBX2, Cyró1, DIAPH3, 1748-1755 (1996). BEHAB, IL-8, BLSA, BP1, DAP-kinase, HOXA9, ARP, In another embodiment, the gene Switch regulates the Nbk, CD43, B7-hcG, B6-hCG, B6e-hCG, B5-hCG, B8-hcG, expression of a polynucleotide encoding an IL-12 or a subunit B3-hCG, MTA1s, Old-35, Old-64, LAGE-1, CIF 150/ thereof for the treatment of cancer, e.g., melanoma, in a hTAFII150, P65 oncofetal protein, Telomerase, CYP1B1, 50 Subject, e.g., a human. 14-3-3o, NES1, CAR-1, HMGI, MAG, ELL2, Ephrin B2, In another embodiment, a polynucleotide encodes (a) a WAF1, CIF 130, C35, BMP2, BUB3, Polymerase kappa, gene Switch that comprises a GAL4 DNA binding domain, EAG1, EAG2. HMG I, HLTF, Barx2, Pp. 32r1, BMP4, the Choristoneura filmiferana ecdysone receptor ligand bind TS10q23.3, Nuclear spindle-associating protein, PFTAIRE, ing domain having the mutations V1071 and Y127E (relative SEMA3B, MOGp, Fortilin, IGFBP-3, Polyhomeotic 2, 55 to the Choristoneura filmifrana ecdysone receptor sequence PNQALRE, SCNSA, miR15, miR16, Headpin, PAOh1/ set forth in U.S. Patent Publication No. 2006/0100416A1), a SMO, Hippo, Mst2, PSMA-like, JAB1, NF-AT. P281NG5, chimeric RXR ligand binding domain consisting of helices MTG16, ErbB-2, HDAC9, GPBP, MG20, KLF6, ARTS1, 1-8 of Homo sapiens RXRand helices 9-12 of Locusta migra Dock 3, Annexin 8, MH15, DELTA-N p73, RapR6, StarD10, toria RXR, the VP16 transactivation domain, and (b) human Cizl, HLJ1, RapR7, A34, Sef, Killin, SGA-1M, TGFBType II 60 IL-12, and the gene switch encoded by the polynucleotide receptor, GCA-associated genes, PRV-1, Vezfl, MLP. VEGI, regulates the expression of human IL-12 when the ecdysone PRO256, AOP2, Remodelin, Phosphodiesterase 4D, Prostag receptor ligand binding domain in the gene Switch binds a landin receptor subtype EP3, CARP HOP, PLTP, UCP-2, Compound of the Disclosure. In a further embodiment, the FLJ11011, Codanin-1, Resistin, Archipelin, Neuronatin, polynucleotide is administered to a Subject having a cancer Ncb5 or, 7B2, PTHrP, PEX, KChIP1, SLIT-3, CX3CR1, 65 Such as melanoma. The polynucleotide may be administered SMAP-2, IC-RFX, E21G4, UCP2, Ob receptor, Ob, Dpl, intratumorally either in a pharmaceutically acceptable car NRG-1, Synapsin III, NRG1AG1, AL-2, Proline dehydroge rier, or contained by an immune cell Such as a dendritic cell. US 9,127,024 B2 93 94 In one embodiment, the polynucleotide is administered to a -continued subject followed by administration of a Compound of the Disclosure, or composition thereof. In another embodiment, a R administeredCompound of to thea subject Disclosure, followed or bycomposition administration thereof, of the is 5 1nS- y-R polynucleotide. For example, a Compound of the Disclosure, or composition thereof, may be administered to the Subject on 21 ---DIPEA day -1, 0, +1, +2, +3, +4, +5, +6, +7, or more, relative to the O BOP, HOBt day the polynucleotide is administered to the subject. 10 OMe In another embodiment, the gene Switch regulates the B expression of a polynucleotide encoding a transcription fac tor, e.g., GATA-1, friend of GATA (FOG-1), EKLF (a Krup pel-like transcription factor), p45/nuclear factor-erythroid 2 (NF-E2), stem cell leukemia (SCL) or T-cell acute lympho- 15 cytic leukemia-1, OCT4, or Sry-related high-mobility group box transcription factor (Sox6), or growth factor, e.g., IGFII, N1 bFGF, Flt3, stem cell factor (SCF), thrombopoietin (TPO), bone morphogenetic protein 4 (BMP4), recombinant human o vascular endothelial growth factor (VEGF-A165), interleu- 20 J 5 ls kin-3 (IL-3) interleukin-6 (IL-6), or interleukin-11 (IL-11), or \ / -e- erythropoietin, for use in regenerative medicine, e.g., differ- R2 entiation, trans-differentiation, reprogramming, self-re- O N1 N newal, or expansion of hematopoietic stem cells, haemato- H poietic progenitor cells, or induced pluripotent stem cells in 25 R3 the process of blood pharming, i.e., production of red blood D cells or other blood products, in a subject. General Synthetic Methods Compounds of the Disclosure are prepared using methods 30 known to those skilled in the artin view of this disclosure (see, R2 3 e.g., U.S. Pat. Nos. 8,076,517, 7.456,315, 7,304,161, and R R 6.258,603), and/or by the illustrative methods shown in the General Schemes below. 35 sl N R5

RI HN1 o-BN R2 OH O OH R3 40 He- E DIPEA R4 BOP HOBt

General Scheme 3 R5 50

F F R R3 O

General Scheme 2 > NH 55 sa O

B-N- 1n O - NBSABN -e- 60 KOH 2 HCI O

OMe H A 65 F (wherein J is CH or N) (wherein J is CH or N) US 9,127,024 B2 95 96 -continued In General Scheme 3, a compound having Formula F is made to react with hydrazine having Formula C to give the acylhydrazine having Formula G. The acylhydrazine is made to react with an acid chloride to give the diacylhydrazine having Formula H. The bromo group of the compound having Formula H is converted to pinacolborane having Formula J then converted to a boronic acid which cyclizes to give dia cylhydrazines having Formula K.

10 General Scheme 4 R2 R! R3 O 15 R7e N O | -N-H

Pd(OAc)2, ligand Bpin-H, TEA, 40° C. H 25 X-S -N O -- O XssYS N NY

30 H R2 R R3 O

> -N 9 0.1% HCO.H 35 YSs NH He R5

HO V R5 1 B N-1N 2 2X HO Z R7d X2NH N

45 R2 R R3 O R7e N O 50 ---Ysa H R5 Z2 ex R7d X2 55 /

r OH O Compounds of the Disclosure having Formula I, wherein R" is R-1 (when J is CH) or R-8 (when J is N), can be 60 prepared as described in General Schemes 2 and 3. Briefly, in Compounds of the Disclosure having Formula I, wherein General Scheme 2, the pinacolborane compound of Formula R" is R-2, can be prepared as described in General Scheme 4. A is converted to the boroxole of Formula B, and the boroxole Briefly, the olefin of a diacylhydrazine having Formula L is is made to react with a hydrazine having Formula C to give the converted to the pinacolborane having Formula M. The pina acylhydrazine having Formula D. The acylhydrazine is made 65 colborane is converted the boronic acid having Formula N. to react with an acid chloride to give the diacylhydrazine and the compound having Formula N is cyclized to give having Formula E. compound O. US 9,127,024 B2 97 98

General Scheme 5

N : 2

CHO Br Br HO

Compounds of the Disclosure having Formula I, wherein R" is R-3, R is OH, and R'' and Rare hydrogen, can be prepared as described in General Scheme 5.

General Scheme 6

CN CN COH F F LITMP KOH H2SO4 He He Ho I, -78 C. CH3OH H I NO NO NO NO

HBpin Pd(OAc)2 P-ligand TEA60 C.

Bpin Bpin NO

US 9,127,024 B2 101 102 -continued General Scheme 8

Bin-N=C=N-COEt 21 -e- 21 -OH --HO Bpin 10 NH N O 2 C N1 P OH O ( 15

rts OH 21 B1 1. As per General Scheme 1 He 2. PCO N N N-1 Ph 2O OH

HN N-1 O-K N O General R2 25 21N, 1 OH. HeScheme 1 R R3 B O

30 us N NJ R5 HN e YoH 35

Compounds of the Disclosure having Formula I, wherein R" is R-4, R is OH, and R's and R'' are hydrogen, can be prepared as described in General Schemes 6, 7, and 8. 40

General Scheme 9 OH O ( 45 N 2 -OH tBOC Compounds of the Disclosure having Formula I, wherein N-0 R is R-9, and R'' and R'' are each hydrogen, can be prepared as described in General Scheme 9.

General Scheme 10

R2 2 R R3 R R R3 O O N OH HN NH HN Y N Y R-COCI DIPEA EtN BOP HOBt US 9,127,024 B2 103 104

-continued R2 R! R3 O y-s-s- NaIO HN / N NY COCl. a O-( o R5 THF/HO O-B V OH

Compounds of the Disclosure having Formula I, wherein -continued R is R-10, X is -O-, and R7 and R7 are each hydro O C gen, can be prepared as described in General Scheme 10. 15 O Compounds of the Disclosure having Formula I, wherein R' \ is R-10, X is N(R) , and R7 and R7 are each hydro BNOH gen, can also be prepared as described in General Scheme 7.

He TEA EXAMPLES

O N1 Example 1 H

Synthesis of N'-(tert-butyl)-N'-(3,5-dimethylben 25 Zoyl)-1-hydroxy-1,3-dihydrobenzoc 1.2 oxaborole 6-carbohydrazide (Cpd. No. 50) O N N1 N H 30 O

Br O- BN OH n-BuLi -e- 35 Cpd. No. 50 B(OMe)

O OH Step 1: Synthesis of 3-borono-4-methylbenzoic acid OH 40 B YOH MeOHVHSO4 OH -- OH Br B(OMe) B 45 n-BuLi NOH -e- O OH OH

O OH O OH O 50 SKC-01-126 B-N- O NBSABN -as KOH 3-Bromo-4-methylbenzoic acid (11.00 g, 51.2 mmol) was HCI 55 dissolved in anhydrous THF (150 ml) under argon in a 500 ml 3-necked round bottom flask fitted with two dropping funnels and argon inlet. The stirred solution was cooled to -78°C. and O o1 n-BuLi (1.6M in hexane, 60.7 ml, 97.0 mmol) was added drop O \ wise from a dropping funnel (during 1 h). After completion of B NOH 60 the addition, the solution was stirred at -78°C. for another 1 BOP, HOBt h. To this, B(OMe) (17.7 ml, 159.0 mmol) was added slowly -- from a second dropping funnel. The mixture was stirred 1 hat DIPEA, RNH-NH -78°C. and then warmed up to room temperature overnight. The solvent was evaporated under reduced pressure. The 65 crude product was dissolved in ether and poured into aqueous O OH HC1 (1N). The mixture was extracted with ether (3x150 ml), and the combined organic layers were washed with brine, US 9,127,024 B2 105 106 dried over anhydrous MgSO, filtered, and evaporated to p-TSOH.H2O (0.196 g, 1.03 mmol). The reaction mixture dryness. The crude product was purified using an ISCO sys was heated to reflux overnight for 2 days. Water was collected tem (220 g silica column, hexane/EtOAc gradient and later (~2 ml) and removed. After cooling, the reaction mixture DCM/MeOH gradient). The impurities washed offin hexane/ became solid. The crude product was purified using an ISCO EtOAc and the pure product eluted in MeOH/DCM (5:95) system (80 g silica column, hexane/EtOAc gradient) to give solvent mixture to give 3.3 g (33% yield) of pure SKC-01 126. "HNMR (400 MHz. Acetone-d) & 12.10(brs, 1H), 8.16 SKC-01-138. LCMS (M+H) 277. H NMR (400 MHz, (s, 1H), 7.90-7.63 (m, 1H), 7.11 (d. J=7.9 HZ, 1H), 2.42 (s, CDC1) & 8.32(d, J=1.9Hz, 1H), 7.87 (dd, J=8.0, 2.0 Hz, 1H), 3H). 7.12 (d. J=8.0 Hz, 1H), 3.79 (s.3H), 2.48 (s, 3H), 1.25 (s, 10 12H). Step 2: Synthesis of methyl 4-methyl-3-(4.4.5.5- tetramethyl-1,3,2-dioxaborolan-2-yl)benzoate Step 3: Synthesis of 1-hydroxy-1,3-dihydrobenzoc 1.2 oxaborole-6-carboxylic acid 15 OH B YOH 1. MeOHVHSO4. NC -e- B- O N y-O Crs AOCN N-Br -> 70° C. O OH SKC-01-126 25 O o1 O SKC-01-138

OH OH Br O B 30 NOH B- 1. KOH OH O He 2.HC

O o1 35 SKC-01-127 O o1 O \ BNOH 40 O B-N O OH 45 SKC-01-150

O o1 To a solution of SKC-01-138 (1.50 g, 5.43 mmol) in anhy SKC-01-138 50 drous CC1 (30 ml) was added N-bromosuccinimide (1.01 g, 5.70 mmol). To this stirred mixture, dicyclohexanecarboni To a stirred solution of SKC-01-126 (3.3 g, 18.3 mmol) in trile was added as a catalyst (0.07 g., 0.27 mmol) in four MeOH (100 ml) in a 250 ml round bottom flask fined with a portions during 1 h. The mixture was stirred at 70° C. over night. LCMS showed a major peak at 5.75 min with the reflux condenser and drying guard tube was added 3 ml con 55 centrated HSO. The mixture was refluxed overnight. After expected mass of the benzyl bromide. After cooling, the sol cooling to room temperature, the Solvent was evaporated in vent was evaporated in vacuo. The crude product was dis vacuum. Water was added and the product was extracted with solved in ether and filtered to remove any succinimide. The ethyl acetate. The combined organic layers were washed with filtrate was extracted with KOH (15% w/v in HO, 3x70ml). brine, dried over anhydrous MgSO filtered, and evaporated 60 The aqueous phase was stirred 1-2 h at room temperature to dryness to give the methyl ester SKC-01-127 as a white (“rt'). The solution was cooled at 0°C. and HCl (6N in HO, solid. Without further purification, the methyl ester (4.00 g, ~120 ml) was added slowly to reach pH-2. The white pre 20.6 mmol) was dissolved in dry toluene (100 ml) in a 250 ml cipitate was collected by filtration through a fritted glass round bottom flask fitted with a Dean-stark trap. To the stirred 65 funnel and air dried to afford the 5-carboxybenzoboroxole reaction mixture, 2,3-dimethylbutane-2,3-diol (3.66 g. 30.9 SKC-01-150 (0.800 g, 83% yield) as a white solid powder. H mmol) was added followed by catalytic amount of NMR (400 MHz, DMSO-d) & 12.91 (s, 1H), 9.35 (s, 1H), US 9,127,024 B2 107 108 8.38 (s, 1H), 8.04 (dd, J=8.0, 1.5 Hz, 1H), 7.52 (d. J=8.0 Hz, slowly to make it to pH 1-2. The mixture was extracted using 1H), 5.05 (s. 2H). ethyl acetate. The product stayed in aqueous fractions and was evaporated to dryness under vacuum. The solid KCl was Step 4: Synthesis of N'-(tert-butyl)-1-hydroxy-1,3- 5 removed from the product by washing it with 5% MeOH in dihydrobenzoc 1.2 oxaborole-6-carbohyrazide DCM and collecting the filtrate to get 95% pure product. This

O OH /

Y N1 \ /- / N HO -k NHoHCI2 V / ) N V 2 s -OH N1 N -PS- z / H N F-7 VF N O A. F F

SKC-01-150 YNH Nk B1 OH / O

SKC-02-011

To a stirred solution of SKC-01-150 (150 mg, 0.84 mmol) was further purified using an ISCO system after adsorbing the in anhydrous DMF (1.5 ml) were added BOP (373 mg, 0.84 product on neutral alumina (24 g neutral alumina column, mmol), HOBt (129 mg, 0.84 mmol) and DIPEA (0.294 ml, MeOH:DCM solvent mixture). The product eluted using 1.68 mmol) under argon at room temperature. The reaction 35 mixture was stirred for 5 min. To this was added tert-butyl -5% MeOH in DCM. The fractions were collected and dried hydrazine hydrochloride (105 mg, 0.84 mmol) and the reac to give (0.187 g. 89% yield) the pure boroxazole carbohy tion mixture was stirred at 40° C. for 1 h. LCMS showed drazide SKC-02-011. The viscous product was dissolved in complete conversion of the boroxozole carboxylic acid. The 40 water and small amount of THF, frozen and lyophilized to get reaction mixture was transferred to ascintillation vial, and the light yellow powder. "H NMR (400 MHz, MeOD) & 8.11 (s, DMF was removed using a Genevac. The sticky crude mix ture was dissolved in 15% aqueous KOH and ether. The 1H), 7.93 (dd, J=8.0, 1.7 Hz, 1H), 7.52 (dd, J=8.0, 0.7 Hz, reaction mixture was extracted with ether and washed three 1H), 5.16 (s. 2H), 1.19 (s, 10H). times with aqueous KOH. The aqueous fractions containing Using the procedure described above, the following reac the product were cooledon an ice bath and 6NHC1 was added tion was conducted to give SCK-02-021:

O OH /

-X/Y N1 P+V N O M F F -OH NH, HCI N \/ H B N NN F-R/V NF O N n / M F F N O N -e- SKC-01-150 pH OH N H2O B1 ) N MN O/ N )— M SKC-02-021 US 9,127,024 B2 109 110 For the above reaction, SKC-01-150 (170 mg, 0.96 mmol) -continued in anhydrous DM (1.7 ml), BOP (423 mg, 0.96 mmol), HOBt (146 mg, 0.96 mmol), DIPEA (0.834 ml, 4.78 mmol) and hydrazine hydrochloride (105 mg. 0.84 mmol) were com O N bined. The crude mixture was purified using an ISCO system N O (24 g neutral alumina, MeOH/DCM gradient). "H NMR (400 N1 MHz, MeOD) & 8.05 (s, 1H), 7.87 (d. J=7.8 Hz, 1H), 7.50 (d. H J–7.8 Hz, 1H), 5.12 (s, 1H), 2.51-2.44 (m. 1H), 1.76-1.59 (m, 1H), 1.51-1.27 (m, 1H), 1.11 (t, J=7.4 Hz, 3H), 1.02 (s, 9H). 10 With a slight modification to the procedure described O- B N above, the following reaction was conducted to give (R)- N'- OH (2,2-dimethylpentan-3-yl)-7-fluoro-1-hydroxy-1,3-dihy Cpd. No. 50 drobenzoc1.2 oxaborole-6-carbohydrazide:

15 To a solution of the acid chloride (0.061 g, 0.363 mmol) in anhydrous DCM (2 ml) in a 100 ml round bottom flask under argon was added the boroxazole carbohydrazide SKC-02 011 (0.090g, 0.363 mmol) followed by triethylamine (0.051 ml, 0.0363 mmol). The reaction mixture was stirred overnight OH at room temperature. LCMS showed several peaks together with the expected product. Purification by prep HPLC gave 20 mg (14%) of Cpd. No. 50. "HNMR(400 MHz, DMSO-d) & 10.63 (s, 1H), 7.89 (s, 1H), 7.54 (dd, J=8.0, 1.5 Hz, 1H), O- B 25 OH 7.42 (d.J=8.0Hz, 1H), 7.09 (s.2H), 6.91 (s, 1H), 4.99 (s.2H), 2.20 (s, 6H), 1.49 (s.9H). Cpd. No. 50 was also prepared using a one pot procedure with SKC-01-150 (100 mg, 0.56 mmol), BOP (249 mg, 0.56 30 mmol), HOBt (86 mg, 0.56 mmol), DIPEA (0.098 ml, 0.56 mmol). All the reagents except the hydrazide were mixed in a 100 ml round bottom flask and dissolved in anhydrous DMF (2 ml) and stirred under argon for 5 minat room temperature. To this, N-(tert-butyl)-3,5-dimethylhydrazide (124 mg. 0.56 mmol) was added, and the reaction mixture was heated at 75° C. overnight. LCMS showed two close peaks, one of the peaks showed the mass of the expected product (mwt. 380.24) in ES+ and ES-mode. The reaction mixture diluted with ether and extracted with 10% w/v aqueous KOH. LCMS of the aqueous fractions showed a single peak with the expected product mass. The aqueous layer was cooled to 0°C., treated with 6N HCL drop wise to make it acidic (pH 1-2), and extracted with ethyl acetate. The organic fractions were col lected, dried over anhydrous MgSO filtered and concen trated. The residue was purified using prep HPLC to get 20 mg (9%) of Cpd. No. 50. Using the procedure described above, the following reac tion was conducted to give Cpd. No. 51. Step 4: Synthesis of N'-(tert-butyl)-N'-(3,5-dimethyl benzoyl)-1-hydroxy-1,3-dihydrobenzoc 1.2 ox aborole-6-carbohydrazide (Cpd. No. 50) 55

O N O. Cl o, N 60 YNH O. Cl H 1N1 --CH2Cl2

Nk 1N1 HeCHCl2 N rt B-OH N rt A. B-OH 65 O A. O SKC-02-021 US 9,127,024 B2 111 112 -continued N'-(3,5-dimethylbenzoyl)-N'-((R)-2,2-dimethylpentan 3-yl)-7-fluoro-5'-oxo-3H-1 14-spirobenzoc1.2 ox aborole-1,2'-1.3.2 oxazaborolidine-6-carbohydrazide (Cpd. No. 95) was prepared from Cpd. No. 59 as follows:

H F O

O- B HQ B -N O O YoH M N O HN Cpd. No. 51 OH

The reaction was conducted using SKC-02-021 (70 mg. 0.24 mmol), 3,5-dimethyl benzoyl chloride (40.7 mg, 0.24 Cpd. No. 59 mmol) and triethylamine (0.101 ml, 0.72 mmol) in 2 ml dichloromethane. The crude reaction mixture was purified using preparative HPLC to give Cpd. No. 51. O H Using the procedure described above, the following reac N\,-- F O tion was conducted to give (R)-N'-(3,5-dimethylbenzoyl)- O-N i? Y N O M N N'-(2,2-dimethylpentan-3-yl)-7-fluoro-1-hydroxy-1,3-dihy O H drobenzoc1.2]oxaborole-6-carbohydrazide (Cpd. No. 59): 25

Cpd. No. 95 30 A solution of glycine (11.93 mg, 0.159 mmol) in 5.3 ml of dry toluene and 1 ml of dimethylsulfoxide was placed into a 25 ml flask equipped with a stirrer (R)- N'-(3,5-dimethyl 35 benzoyl)-N'-(2,2-dimethylpentan-3-yl)-7-fluoro-1-hydroxy 1,3-dihydrobenzoc 1.2 oxaborole-6-carbohydrazide (70 SKC-07-008 mg, 0.159 mmol) was added and the mixture was kept under reflux for 28 h. After removal of the toluene in vacuo, the solution of the product in DMSO was transferred unto a 15.5 40 g Teledyne ISCO C18 reverse phase column and eluted with 1a1n 0-100% CHCN HO (30 min). The desired fractions were pooled and lyophilized to give 19 mg (11.4% yield) of the spiro adduct as a white solid. "H NMR (400 MHz, DMSO) & CHCl2 45 10.43-10.18 (m. 1H-mixture of NH rotamers), 7.19-6.72 (m, 5H), 6.41-6.37 (t, 0.46H, partial rotamer) 498-4.76 (m, 2H), 4.43-4.21 (two d, 1H, CH), 3.56-3.52 (overlappings, 2H), 3.32 (s, DMSO-d6 water peak), 2.50 (DMSO-d6), 2.32 and 2.24 (s, 6H), 1.54-1.46 (m, 2H), 1.07-0.88 (m, 12H); MS H 50 (ESI) calcd for CHBFNOs (M+2H) 498. found 498. , O 'a. Using the procedure described above, the following reac tions were conducted to give (R)- N'-(3,5-dimethylben N1 N O Zoyl)-N'-(2,2-dimethylpentan-3-yl)-4-fluoro-1-hydroxy-1, H 3-dihydrobenzoc 1.2 oxaborole-5-carbohydrazide (Cpd. 55 No. 67): F

O- B N O OH Cpd. No. 59 60 o1 PdCl2(dppf), DCM, KOAc -- O O Cpd. No. 59: LCMS MH+=441. "H NMR (400 MHz, Br F N DMSO) & 10.37 (d. J=54.9 Hz, 1H), 9.39 (t, J=7.9 Hz, 1H), B-B 7.34-6.93 (m, 4H), 6.75 (td, J=13.6, 7.5 Hz, 1H), 5.16-4.87 6s o/ Yo (m. 2H), 4.54-4.17 (m, 1H), 3.17 (d. J=5.2 Hz, 1H), 1.79-141 SKC-07-062 (m. 2H), 1.10-0.93 (m. 12H). US 9,127,024 B2 114 -continued -continued O O O 1. NBS 5 Her o1 O NB F 9 NB F O O 10 SKC-09-031 O SKC-09-031

o1 7% aqs KOH 15 -e- HCI Mixed together methyl 4-bromo-2-fluoro-3-methylben O Zoate (2.6 g., 10.52 mmol), potassium acetate (3.61 g, 36.8 NB F mmol), and the dimer 4.4.4.4.5.5.5',5'-octamethyl-2-2'bis(1, O 3.2-dioxaborolane (4.01 g, 15.79 mmol) in anhydrous Diox Br 2O ane (90 mL) in a RB flask. The mixture was evacuated and R2 backfilled with argon three times and stirred at room tempera 3 ture. To this mixture, Pd(dppf)Cl. DCM was added and O R N evacuated and backfilled the mixture with argon three times NH and heated the mixture at 80°C. overnight. The dark colored O HN1 HCI 25 Her reaction mixture was cooled, filtered through a short pad of PyBOP, DIPEADMF celite and removed the solvent. Water and EtOAc were added HO- ' F and extracted the mixture. The organic fractions collected, O dried over anhy MgSO filtered and removed the solvent. RAJ-009-50-2 30 The crude mixture was adsorbed on silica and purified by R2 C O column chromatography to get the title compound SKC-09 R R3 031 (2.8 g., 90% yield). "H NMR (400 MHz, CDC1) & 7.81 O 7.60 (m, 1H), 7.54 (d. J=7.8 Hz, 1H), 3.92 (s.3H), 2.62-2.31 N1 NH 35 (m,3H), 1.36 (s, 12H). H

-e- 4-fluoro-1-hydroxy-1,3-dihydrobenzoc1.2ox HONB, F TEA aborole-5-carboxylic acid O 40 R2 R! R3 O

N O N1 45 H to- F O 50

Methyl 2-fluoro-3-methyl-4-(4.4.5.5,-tetramethyl-1, 3,2-dioxaborolan-2-yl)benzoate 55 SKC-09-031

O O PdCldppfl-DCM, KOAc 60 o1 O KOH O HCI V O NB F Br F B-B M N O O O 65 Br SKC-07-062 US 9,127,024 B2 115 -continued O O

OH OH H 1, PyBOP, HO-B F DIPEA V HO-NB F NH Hos O Y, HN TSOH SKC-07-066 10 SKC-07-066 RAJ-009-50-2 RAJ-009-50-2

H 4, To a solution of the above ester (2.00 g. 6.80 mmol) in O .. C O anhydrous CC (80 mL) in 200 mL RB flask fitted with a 15 NH reflux condenser was added NBS (1.20 g. 6.80 mmol) and N Y (E)-1,1'-(diazene-1,2-diyl)dicyclohexanecarbonitrile (0.166 H g, 0.68 mmol) and stirred the reaction mixture at 80° C. overnight under argon. The total amount of NBS (1.2 g) and HO- ' F Her the catalyst (0.166 g) was added in four portions during 1 h. O TEA LCMS showed one major peak at 4.59. Cooled the reaction SKC-07-068 mixture, removed the solvent on a rotavapor under vacuum. SKC-09-034 Suspended the solid in ether and filtered to remove the solid. H The filtrate was concentrated to remove the solvent; diluted 25 o, with water and extracted with EtOAc. The organic fractions O collected, dried over anhy MgSO, filtered and removed the N O N1 solvent on a rotavapor. LCMS (M-2) 374.60. H 7% aqueous KOH (-80 mL) was added to the crude inter 30 mediate and stirred at room temperature for 2 h. Extracted lost F with ether, the product went in the aqueous fraction (based on O LCMS), discarded the ether layer containing some impuri ties. Cooled the aqueous fractions and acidified slowly to pH Cpd. No. 67 3 with 6N HC1. A white precipitate formed, collected the 35 precipitate by filtration and dried under vacuum. LCMS 4-Fluoro-1-hydroxy-1,3-dihydrobenzoc 1.2 oxaborole showed a single peak at 2.55. LCMS (M+1) 197.17. H NMR 5-carboxylic acid (1.0g, 5.10 mmol), PyBOP (2.66 g, 5.10 (400 MHz, DMSO) & 13.34 (s, 1H), 9.58 (s, 1H), 8.00-7.69 mmol), DIEA (1.78 mL, 10.21 mmol) were mixed together in (m. 1H), 7.61 (d. J=7.5 Hz, 1H), 5.11 (s. 2H). 40 DMF (15 mL) and (R)-(2,2-dimethyl-pentan-3-yl)hydrazine General procedure for the two step coupling: In a scintil 4-methylbenzenesulfonate (1.54 g, 5.10 mmol) was added. lation vial mixed together 4-fluoro-1-hydroxy-1,3-dihy The reaction mixture was stirred at 40° C. for 1.5 h. LCMS drobenzoc1.2 oxaborole-5-carboxylic acid (1.0 equiv), showed single peak with the expected product mass. After the PyBOP (1.0 equiv), DIEA (2.0 equiv) in DMF and stirred at 45 general work up procedure, the crude mixture was finally 40° C. for 3 minutes under argon. To this mixture, the hydra purified using a Redisep C18 column (100 g column, 0.1% zine salt (1 equiv) was added and stirred the mixture at 40°C. formic acid in waterfacetonitrile solvent gradient) on ISCO to for 1-2 h. Reaction monitored by LCMS. Removed the sol isolate SKC-09-034 (0.820 g, 52% yield) as a colorless solid. vent using Genevac. Added 7% aq's KOH, stirred for 15 min 50 LCMS (M+1)308.81. "H NMR (400 MHz, DMSO) 89.77 (s, and extracted with ether. The aqueous fractions collected, 1H), 9.52 (s, 1H), 7.66-7.43 (m, 2H), 5.10 (s. 2H), 4.20-3.58 cooled and acidified to pH 3 with 6N HC1. Immediately (m. 1H), 1.56-1.53 (m, 1H), 1.31-1.22 (m, 1H), 1.05-0.86 (m, extracted with EtOAc, and collected the organic fractions, 12H). dried over anhy MgSO and removed the solvent. The crude Cpd. No. 67 was synthesized using the intermediate SKC mixture was finally purified using neutral alumina column 55 09-034 (0.600 g, 1.95 mmol), TEA (0.326 mL) in DCM (10 (MeOH/DCM solvent gradient) or using Redisep C18 col mL) and 3,5-dimethylbenzoyl chloride (0.328 g, 1.95 mmol) umn on ISCO (0.1% formic acid in waterfacetonitrile solvent at room temperature. The reaction was stopped after 35 min gradient). utes with 3 peaks (based on LCMS), one major peak with the 60 expected product mass (441.91, M+1). After purification In the 2" step, to a stirred solution of the above interme using Redisep C18 column (C18 100 g, 0.1% formic acid in diate (1.0 equiv) in DCM was added TEA (1.2 equiv) and the waterfacetonitrile solvent gradient), the final DAH was iso acid chloride (1.0 equiv) at room temperature under argon and lated as Cpd. No. 67 (0.575 g, 67% yield). H NMR (400 stirred the mixture for 35 minutes. Reaction monitored by MHz, DMSO) & 10.48 (d. J=48.2 Hz, 1H), 9.53 (s, 1H), 7.47 LCMS. Removed the solvent and purified the crude mixture 65 (d. J–7.3 Hz, 1H), 7.21-6.94 (m, 3H), 6.61 (t, J=6.3 Hz, 1H), using RediSep C18 column on ISCO (0.1% formic acid in 5.06 (s. 2H), 4.34 (dd, J-72.7, 10.2 Hz, 1H), 2.25 (s, 6H), waterfacetonitrile solvent gradient). 1.74-1.39 (m, 2H), 1.10-0.91 (m. 12H). US 9,127,024 B2 118 sample (SKC-07-069, 0.800 g, contains some DMF) was H used for the next step without further purification. 4. O C O N'-(tert-butyl)-N'-(3,5-dimethylbenzoyl)-4-fluoro-1- -NH 5 hydroxy-1,3-dihydrobenzoc1.2 oxaborole-5-car H TEA bohydrazide HONB F V DC CD3 O 10 SKC-07-068

H O , C O O N1 NH N O 15 H TEA N1 -e- H HONB, F to- F O O SKC-07-069 DC CD3 SKC-07-074

The above reaction was carried out using. SKC-07-068 25 (200 g, 0.65 mmol), TEA (0.109 mL, 0.779 mmol) and 3.5- O N bis(methyl-d)benzoyl chloride (0.136 g., 0.779 mmol) in N1 N O DCM (2 mL) at room temperature under argon, overnight. H LCMS showed a peak with the expected product mass of 447.14 (M-1), together with two additional peaks. The prod 30 HO-B F uct was isolated. O N'-(tert-butyl)-4-fluoro-1-hydroxy-1,3-dihydrobenzo Cpd. No. 65 c 1.2 oxaborole-5-carbohydrazide 35 To a stirred solution of the above synthesized monoB (SKC-7-069, 0.400g. 1.50 mmol) in DCM (3 mL) was added O TEA (0.210 mL, 1.50 mmol) and 3,5-dimethylbenzoyl chlo ride (0.253 g, 1.50 mmol) at room temperature under argon 40 overnight. LCMS showed several peaks, together with a sharp OH peak at 3.45 with the expected product mass of 399.09 (M-1). N- PyBOP, DIPEA Removed the solvent on a rotavapor and the crude mixture -- HON-B F -NH was purified using prep HPLC (0.1% formic acid in water/ V HN HCI 45 acetonitrile solvent gradient) to get 0.080 g of the product O Cpd. No. 65. LCMS: 399.09 (M+1). 'H NMR (400 MHz, SKC-07-066 DMSO) & 10.70 (s, 1H), 9.51 (s, 1H), 7.46 (d. J–7.3 Hz, 1H), 7.04 (d. J–7.2 Hz, 3H), 6.80-6.66 (m, 1H), 5.05 (s. 2H), 2.25 (s, 6H), 1.49 (s.9H). 50 NH N N'-(3,5-bis(methyl-d)benzoyl)-N'-(tert-butyl)-4- fluoro-1-hydroxy-1,3-dihydrobenzoc 1.2 ox aborole-5-carbohydrazide 55

SKC-07-069

Following the general procedure, mixed together 4-fluoro 60 N- C O 1-hydroxy-1,3-dihydrobenzoc1.2 oxaborole-5-carboxylic N NH acid (0.500 g, 2.55 mmol), PyBOP (1.34g, 2.55 mmol), H TEA DIEA (0.89 mL, 5.10 mmol) in DMF (6 mL) followed by the addition of tert-butyl hydrazine hydrochloride (0.318 g, 2.55 HO- B F CD mmol) and stirred the mixture at 40°C. for 1 h. LCMS showed 65 a main peak at 2.43 with the expected product mass of 267.01 SKC-07-069 (M+1). After the general work up procedure, the crude dry US 9,127,024 B2 119 120 -continued addition of (2,2-dimethyl-1-phenylpropyl)hydrazide hydro chloride (0.548 g) and stirred the mixture at 40°C. for 1.5 h. LCMS showed single peak with the expected product mass. After the general work up procedure, the crude mixture was O N finally purified using Redisep C18 column on ISCO (0.1% N1 N O formic acid in waterfacetonitrile solvent gradient) and iso H lated the title compound SKC-09-041 (0.400 g, 44% yield) as 10 a colorless solid. LCMS (M+1) 357.25. HO-NB F Y, DC CD3 Cpd. No. 66 N'-(2,2-dimethyl-1-phenylpropyl)-N'(3,5-dimethyl 15 benzoyl)-4-fluoro-1-hydroxy-1,3-dihydrobenzoc1, 2Oxaborole-5-carbohydrazide The title compound was synthesized using the monoB (SKC-07-069 crude, 0.400 g, 1.50 mmol), TEA (0.210 mL, 1.50 mmol) and 3,5-bis(methyl-d)benzoyl chloride (0.263 g, 1.50 mmol) in DCM (3 mL) at room temperature under argon, overnight. After purification by prep HPLC (0.1% formic acid in waterfacetonitrile solvent gradient), 0.148 g of the pure product Cpd. No. 66 was isolated. LCMS: 405.07 (M+1). H NMR (400 MHz, DMSO) & 10.70 (s, 1H), 9.51 (s, 1H), 7.46 25 O C O (d. J–7.3 Hz, 1H), 7.04 (dd, J=8.4, 1.6 Hz, 3H), 6.83-6.41 (m, NH TEA, N1 DCM, 1H), 5.05 (s. 2H), 2.54 (s, 1H), 1.48 (d. J–5.4 Hz, 9H). H rt -- N'-(2,2-dimethyl-1-phenylpropyl)-4-fluoro-1-hy 30 HONB, F V droxy-1,3-dihydrobenzoc1.2 oxaborole-5-carbo O hydrazide SKC-09-041

35

O

40 O OH PyBOP, N O DIPEA N1 HO-NB F -e- H V Y NH O HN HCI 45 HO-B F RAJ-009-50-2 O Cpd. No. 89

50 To a stirred solution of the above synthesized monoB (SKC-09-041, 0.200 g, 0.56 mmol) in DCM (5 mL) was O added TEA (0.094 mL, 0.67 mmol) and 3,5-dimethylbenzoyl chloride (0.095 g, 0.56 mmol) at room temperature under N1 NH 55 H argon for 35 minutes. LCMS showed several peaks, together with a small peak with the expected product mass and the HONB, F unreacted Starting material. Removed the solvent on a

O 60 rotavapor and the crude mixture was purified using a Redisep SKC-09-041 Column (C18, 13 g, 0.1% formic acid in waterfacetonitrile gradient) and isolated Cpd. No. 89 (0.070 g, 25% yield). Following the general procedure, mixed together 4-fluoro LCMS (M+1) 489.28. 'H NMR (400 MHz, DMSO) & 10.84

1-hydroxy-1,3-dihydrobenzoc1.2 oxaborole-5-carboxylic 65 (s, 1H), 9.50 (s, 1H), 7.58-7.00 (m, 9H), 6.58-6.45 (m. 1H), acid (0.500 g, 2.55 mmol), PyBOP (1.34g, 2.55 mmol), 5.69 (d. J–33.9 HZ, 1H), 5.06 (s. 2H), 2.23 (s, 6H), 1.08 (s, DIEA (0.89 mL, 5.10 mmol) in DMF (10 mL) followed by the 9H).

US 9,127,024 B2 123 124 -continued

OH

Cpd. No. 70

Step 1: Synthesis of methyl flask at room temperature under argon was added potassium 3-hydroxy-2-methylbenzoate carbonate (42.4g, 30.6 mmol). To this allyl bromide (39.3 g, 28.1 ml) was added, and the reaction mixture was stirred overnight at room temperature. After aqueous work up and O O O OH N extraction with ethyl acetate, the crude product was purified 25 using an ISCO system (silica gel column, hexane:EtOAc MeOH solvent mixture) to get the product as an oil (89% yield). H -e- H2SO4 NMR (400 MHz, CDC1) & 7.41 (dd, J–7.8, 0.9 Hz, 1H), 7.22-7.08 (m, 1H), 6.97 (d. J=7.9 Hz, 1H), 6.10-6.03 (m, 1H), COH OH SKC-01-045 30 5.43 (dq, J=17.3, 1.7 Hz, 1H), 5.29 (dq, J–10.6, 1.5 Hz, 1H), 4.55 (dt, J=5.0, 1.6 Hz, 2H), 3.89 (s.3H), 2.47 (s.3H). To a IL 3-necked round bottom flask equipped with a condenser and magnetic stirrer was added 3-Hhydroxy 2-me Step 3: Synthesis of methyl thylbenzoic acid (15.2g, 100 mmol) and anhydrous MeOH 35 4-allyl-3-hydroxy-2-methylbenzoate (400 ml). To this, 7 ml of conc. HSO was added and the mixture was refluxed overnight under argon. LCMS showed complete conversion to the product. The reaction mixture was O OS collected and the solvent was removed under vacuum. The 40 O O crude mixture was diluted with ethyl acetate. After aqueous N MW work up and extraction with ethyl acetate, the mixture was purified using an ISCO system (120 g silica gel column, OH hexane:ethyl acetate solvent mixture) to give the methylben 45 CCO Zoate derivative (major peak, eluted with ~12% EtOAc in 1-4 hexane) in 84% isolated yield. 'HNMR (400 MHz, CDC1) & 7.57 (dd, J–7.8, 1.0 Hz, 1H), 7.26 (t, J–7.9 Hz, 1H), 7.10 (dd, SKC-03-012 J=8.0, 0.9 HZ, 1H), 5.49 (s, 1H), 4.06 (s, 3H), 2.62 (s.3H). 50 Step 2: Synthesis of methyl 3-(allyloxy)-2-methylbenzoate Methyl 4-allyl-3-hydroxy-2-methylbenzoate (3.5g, 16.97 mmol) was dissolved in 1-methylpyrrolidine-2-one (4 ml) in 55 a microwave vial, closed with a cap and Subjected to micro O O wave irradiation (CEM discover) with stirring at 220° C. O O N N maximum pressure 300 psi, run time 5 min, hold time 50 min. B After cooling the crude mixture was directly loaded on a silica 21\-1 r 60 gel column (220g) and purified using ISCO system (hexane: K2CO3 O1n21 EtOAc solvent mixture, product eluted ~12% EtOAc in hex OH ane) to give 2.1 g (major peak, 60% yield) of the product SKC-01-004 SKC-03-012 as a light yellow solid. "H NMR (400 MHz, 65 CDC1) & 7.40 (d. J=8.0 Hz, 1H), 7.00 (d. J=8.1 Hz, 1H), To a stirred solution of methyl 3-hydroxy-2-methylben 6.04-5.95 (m, 1H), 5.21-5.16 (m,3H), 3.88 (s.3H), 3.44-3.43 Zoate (30 g, 180.0 mmol) in acetone in a 1 L round bottom (d. 2H), 2.47 (s.3H). US 9,127,024 B2 125 126 Step 4: Synthesis of was stirred overnight at room temperature. The reaction mix 4-allyl-3-hydroxy-2-methylbenzoic acid ture became a thick white slurry. The pH was adjusted to 2 with conc. HC1. A precipitate formed, and was filtered under vacuum and dried. The combined dried product was dissolved OH in DCM and purified on an ISCO system using 40 g silica column and hexane/EtOAc solvent gradient. The product eluted -30% EtOAc in hexane, and the fractions were col lected and dried under vacuum to give (2.4g.98%) SKC-01 116. "H NMR (400 MHz, CDC1) & 12.0 (brs, 1H), 7.92 (d. OH NaOH OH J=8.1 Hz, 1H), 7.18 (d. J=8.1 Hz, 1H), 6.03-5.67 (m, 1H), 5.26-4.89 (m, 2H), 3.31 (d. J=6.6 Hz, 2H), 2.44 (s.3H), 2.37 (s, 3H). 15 SKC-01-098 Step 6: Synthesis of (R)-6-allyl-3-(2-(3,5-dimethyl benzoyl)-2-(2,2-dimethylhexan-3-yl)hydrazinecarbo nyl)-2-methylphenyl acetate To a stirred solution of the methyl 4-allyl-3-hydroxy-2- methylbenzoate (6.5 g. 31.6 mmol) in a mixture of THF: MeOH (3:1 ratio, 80 ml) at room temperature was added 25.3 g (316 mmol) of 50 w/w % aqueous NaOH solution, and the reaction mixture was stirred at 50° C. for 4 h. LCMS showed OH it as a clean reaction. The reaction mixture was cooled to 25 room temperature and the methanol was removed on a rotovapor and diluted with ethyl acetate. The crude reaction SOCl mixture was acidified with 1N HC1. Some of the product precipitated out. It was diluted with water and extracted using ethyl acetate. The organic fractions were collected, dried over 30 s anhydrous MgSO4, filtered, and concentrated. The crude SKC-01-116 product was purified using an ISCO system (80 g silica col umn, hexane/EtOAc gradient. The product eluted -30% EtOAc in hexane, and the product fractions were collected 35 C and concentrated. "H NMR (400 MHz, CDC1) & 7.58 (d. J=8.0 Hz, 1H), 7.03 (d. J=8.0 Hz, 1H), 6.12-5.78 (m, 1H), 5.30-5.08 (m, 2H), 3.45 (d. J=6.3 Hz, 2H), 2.54 (d. J=3.7 Hz, 3H). 40 Step 5: Synthesis of s 3-acetoxy-4-allyl-2-methylbenzoic acid SKC-03-117

45 OH

50

NaOH

55 s SKC-03-119 SKC-01-116

4-Allyl-3-hydroxy-2-methylbenzoic acid (2.0 g, 10.4 To a solution of 3-acetoxy-4-allyl-2-methylbenzoic acid mmol) was slurried in 6 ml water in a 500 ml round bottom 60 (1.5 g. 6.40 mmol) in a 250 ml round bottom flask closed with flask, cooled in an ice bath, and stirred. Aqueous NaOH a drying tube was added anhydrous DCM (10 ml), and the solution (4.2 g of 50% NaOH in 6 ml water) was added reaction mixture was stirred at room temperature. To this was slowly. The mixture was stirred for few minutes until the added excess thionyl chloride (2 ml) and a drop of anhydrous Solution was clear. Acetic anhydride was added drop wise 65 DMF, and the reaction mixture was stirred overnight at room until pH 6 was obtained, by that time the reaction mixture temperature. The excess thionyl chloride was removed under become a thick slurry with an off white color. The mixture vacuum at 40°C. on a water bath after cooling the trap with US 9,127,024 B2 127 128 dry ice. Anhydrous DCM was added and removed under -continued vacuum to make the product dry. This was used as such for the next step. The above acid chloride (1.55 g. 6.15 mmol) was dissolved in anhydrous DCM (6 ml) and was added to a stirred solution of previously synthesized (R) N-(2,2-dimethylhexan-3-yl)- 3,5-dimethylbenzohydrazide (1.7 g. 6.15 mmol. 95% ee) in 6 ml of anhydrous DCM at room temperature under argon. Anhydrous triethylamine (0.86 ml, 6.15 mmol) was added 10 and the reaction mixture was stirred overnight at room tem perature. LCMS showed a major peak with the expected -2SKC-01-120 5 product mass. The crude mixture was adsorbed on silica and dried under vacuum. The dry powder was loaded on a car 15 Step 7: Synthesis of (R)-4-allyl-N'-(3,5-dimethylben tridge and purified using an ISCO system (40 g silica column, Zoyl)-N'(2,2-dimethylhexan-3-yl)-3-hydroxy-2-me hexane/EtOAc gradient). The product eluted ~20% EtOAc in thylbenzohydrazide hexane, and the product fractions were collected and concen trated to give SKC-03-019 (2.8 g., 93%). This was used as such for the next deacetylation step. "H NMR (400 MHz, DMSO-d) & 10.38 (d. J=63.8 Hz, 1H), 7.22-6.93 (m, 4H), 6.72 (dd, J=45.7, 7.8 Hz, 1H), 6.02-5.60 (m. 1H), 5.25-4.91 (m. 2H), 4.45 (dd, J=67.4, 10.2 Hz, 1H), 3.19 (d. J=6.7 Hz, 2H), 2.30 (s.3H), 2.24 (m, 2H), 1.99 (s, 6H), 1.15-1.41 (m, 25 5H), 1.04 (s, 9H), 0.88-0.79 (m, 3H). Similarly, the reaction below was conducted using the acid chloride (400 mg, 1.58 mmol), N-(tert-butyl)-3,5-dimethyl benzohydrazide (291 mg, 1.32 mmol), TEA (0.184 ml, 1.32 30 mmol) in anhydrous ether (25 ml). LCMS showed the main peak with the expected product mass, and the crude mixture was purified using an ISCO system (24 g silica column, s hexane/EtOAc gradient). The product eluted with ~35% SKC-03-019 EtOAc in hexane. The product fractions were collected and 35 dried under vacuum to give SKC-01-120 (260 mg. 45%). "H NMR (400 MHz, CDC1) & 7.64 (s, 1H), 7.06 (s. 2H), 7.00 (s, 1H), 6.93 (d. J=7.7 Hz, 1H), 5.93-5.66 (m, 1H), 5.14-4.96 (m, 2H), 3.20 (d. J=6.6 Hz, 2H), 2.29 (d. J=12.3 Hz, 9H), 1.81 (br s, 3H), 1.58 (s, 9H). 40

O

OH 45 SOCl. SKC-03-023 21 -as SKC-03-019 (2.7g, 5.48 mmol) was dissolved in a mixture 50 of MeOH:HO (3:1 ratio, 40 ml) in a 250 ml round bottom flask. To this, excess sodium bicarbonate (6.91 g, 82 mmol) s was added, and the reaction mixture was stirred overnight at 60° C. LCMS showed a single peak with the expected product mass. The reaction mixture was cooled and the MeOH was N O 55 removed on a rotavapor under vacuum. After aqueous work O HN1 up and extraction with ethyl acetate, the organic fractions were dried over anhydrous MgSO filtered, and concen C trated. The crude mixture was dissolved in DCM, adsorbed on 60 silica, and dried until it was free flowing. This was loaded on 21 Her to a cartridge and purified using an ISCO system (40 g silica gel column, hexane/EtOAc gradient). The product eluted with 30% EtOAc in hexane, and the fractions were collected and dried under vacuum to give 2.2 g (89%) of SKC-03-023. 65 "H NMR (400 MHz, DMSO-d) & 10.17 (d. J=65.5 Hz, 1H), SKC-01-119 8.37 (s, 1H), 7.10-7.03 (m,3H), 6.87-6.84 (m, 1H), 6.24-6.23 (m. 1H), 5.90-5.83 (m, 1H), 5.20-4.87(m, 2H), 4.52-4.42 (m, US 9,127,024 B2 129 1H), 3.64-3.60(m, 2H), 2.24 (d. J–4.7 Hz, 6H), 1.61-1.78 (m, -continued 4H), 1.41 (brs, 3H), 1.03 (d. J–7.2 Hz, 9H), 0.85 (t, J=6.9 Hz, 3H). R B-H RCO(PPh3)2C(PPh3)2 Similarly, the following reaction was conducted using M THF SKC-01-120 (710 mg, 1.63 mmol) and sodium bicarbonate O (1.37 g. 16.26 mmol) in a mixture of MeOH:HO (3:1 ratio, 12 ml), and stirred the mixture at 45° C. overnight. After H , aqueous work up and extraction with EtOAc, the crude mix O ture was purified using an ISCO system (24 g silica column, 10 hexane/EtOAc gradient). The product eluted with ~38% N O O N1 EtOAc in hexane to give SKC-01-135 (320 mg, 50%). "H H NMR (400 MHz, CDC1+DMSO-d) & 9.49 (s, 1H), 6.49 (d. J=4.7 Hz, 2H), 6.36 (d. J=3.6 Hz, 1H), 6.17 (t, J=6.8 Hz, 1H), o-B 5.82-5.48 (m. 1H), 5.38–5.11 (m, 1H), 5.40-5.15 (m. 1H), 15 4.53-4.15 (m, 2H), 3.57-3.09 (m, 1H), 2.72 (d. J=5.0 Hz, 2H), OH 1.66 (s, 6H), 1.25 (d. J=6.2 Hz, 3H), 0.95 (dd, J=8.7, 6.9 Hz, 9H). SKC-01-143

An oven dried, 100 ml two-necked round bottom flask was equipped with a teflon coated magnetic stir bar, and two O N rubber septum with one of the septum with a needle con N1 N O NaHCO nected to an argon/vacuum manifold. This argon flushed H He 25 round bottom flask was charged with SKC-01-140 (510 mg. 1.13 mmol), anhydrous THF (5 ml) and modified Wilkinson's 21 catalyst (40 mg, 0.057 mmol). After three vacuum/argon purge cycles, the mixture was stirred at room temperature until all of the reagents dissolved (<2 min) To this stirred clear 30 reaction mixture was added 4.4.5.5-tetramethyl-1,3,2-diox s aborolane (Bpin-H) (0.494 ml, 3.40 mmol) via syringe, fol SKC-01-120 lowed by another argon/vacuum/argon purge. The reaction mixture was stirred at room temperature for overnight. The color of the reaction mixture changed from a light yellow to a O N 35 dark brown solution. After overnight stirring, LCMS showed 1N O complete conversion to the product. The reaction mixture was H quenched by carefully adding few drops of water (<1 ml) and 21 MeOH (5 ml) and the solvent was under vacuum on a 40 rotavapor. The dry crude product was dissolved in DCM and OH adsorbed on silica, and dried under vacuum. Once it was free flowing, it was loaded on an empty cartridge and purified SKC-01-135 using an ISCO system (12 g silica column, hexane/EtOAC gradient). The product fractions were collected (at 10% 45 EtoAc/hexane) and dried under vacuum (630 mg.96% yield). Step 8: Synthesis of (R)- N'-(3,5-dimethylbenzoyl)- "H NMR (400 MHz, DMSO-d) & 10.16 (d. J=64.4 Hz, 1H), N'-(2,2-dimethylhexan-3-yl)-3-hydroxy-2-methyl-4- 8.21 (s, 1H), 7.92 (s, 1H), 7.11 (s, 1H), 7.03 (s, 1H), 6.83 (d. (3-(4.4.5.5-tetramethyl-1,3,2-dioxaborolan-2-yl) J=7.6 Hz, 1H), 6.42-6.16 (m. 1H), 4.62-4.24 (m, 1H), 2.25 (d. propylbenzohydrazide J–4.5 Hz, 5H), 2.00 (s, 6H), 1.60 (s. 2H), 1.55-1.38 (m, 4H), 50 1.17 (s, 9H), 1.08 (s, 9H), 1.05-0.99 (m, 3H), 0.88-0.78 (m, 2H). Using the same procedure as described above, the follow ing reaction was conducted. H 55 2, O N1 N O O N H N O 60 N1 Bpin-H H RhCOCl(PPh3)2 -e- 21 THF, rt OH OH 65 SKC-01-140 SKC-01-125, 135 US 9,127,024 B2 131 132 -continued this stirred clear reaction mixture was added 4,4,5,5-tetram ethyl-1,3,2-dioxaborolane (Bpin-H) (0.354 ml, 2.43 mmol) via Syringe, followed by another argon/vacuum/argon purge. 5 The reaction mixture was stirred at room temperature over O N night. After stirring overnight, LCMS showed complete con O 1N O version to the product. The reaction mixture was quenched by H carefully adding few drops of water (<1 ml) and MeOH (5 ml) o-B 10 and the solvent was removed under vacuum on a rotavapor. The dry crude product was dissolved in DCM and adsorbed OH on silica and dried under vacuum. Once it was free flowing, it was loaded on an empty cartridge and purified using an ISCO SKC-01-126, 134 15 system (12 g silica column, hexane/EtOAc gradient). The product eluted with -30% EtOAc in hexane. The product An oven dried, 100 ml, two necked, round bottom flask was fractions were collected and dried under vacuum (310 mg. equipped with a teflon coated magnetic stir bar, and two 73% yield). This experiment was repeated. (SKC-01-128, rubber septum with one of the septum with a needle con 63% yield and SKC-01-134, 73% yield). H NMR (400 MHz, nected to an argon/vacuum manifold. This argon flushed DMSO-d) & 10.34 (s, 1H), 8.24 (s, 1H), 7.13-6.96 (m, 3H), round bottom flask is charged with 4-allyl-3-hydroxy-DAH 6.80 (d. J=7.7 Hz, 1H), 6.14 (d. J–7.7 Hz, 1H), 2.26 (s, 6H), (320 mg. 0.811 mmol), modified Wilkinson's catalyst (28 1.74 (s.3H), 1.51-1.47 (m, 11H), 1.17 (s, 12H), 1.12-1.00 (m, mg, 0.04.1 mmol) and anhydrous THF (5 ml). After three 25 2H), 0.65 (t, J=7.9 Hz, 2H). vacuum/argon purge cycles, the mixture was stirred at room temperature until all of the reagents dissolved (<2 min). To Step 9: Synthesis of Cpd. No. 70

O

OH

SKC-01-143

HO

HO

OH

Cpd. No. 70 US 9,127,024 B2 133 134 The above Bpin-DAH (630 mg, 1.09 mmol) was mixed 2.47-2.37 (m, 2H), 2.22 (s, 6H), 1.72 (s.3H), 1.47 (d. J–3.5 with THF:water mixture (4:1, 20 ml) and sodium periodate Hz, 11H), 0.58 (t, J=7.9 Hz, 2H). (1.4g, 6.53 mmol), and a 2.0 M solution of HCl in THF (1.09 ml, 2.18 mmol) was added. The reaction mixture was stirred Example 3 at room temperature overnight. LCMS showed one main Synthesis of (R)-(3-(4-(2-(3,5-dimethylbenzoyl)-2- peak. The Solvent was removed on a rotavapor, and the resi (2,2-dimethylhexan-3-yl)hydrazinecarbonyl)-2- due was diluted with EtOAc and extracted. The organic frac methoxy-3-methyl-phenyl)propyl)boronic acid (Cpd. tions were dried over anhydrous MgSO, filtered and concen NO. 27 trated. The crude product was adsorbed on neutral alumina 10 and purified using an ISCO system (8 g neutral alumina H column, DCM/MeOH solvent mixture). The product eluted O '',4. with ~5% MeOH in DCM and was collected and dried. "H K2CO3, NMR spectrum in DMSO-d showed a mixture of at least N O MeI N 1 -- three products. DO was added. 'HNMR (400 MHz, DMSO H acetone, d+DO) & 7.23-7.00 (m, 3H), 6.98-6.79 (m, 1H), 6.55-6.17 539% (m. 1H), 4.72-4.17 (m, 1H), 2.30 (s, 6H), 1.91-1.69 (m, 2H), 1.72-1.31 (m, 9H), 1.08 (s, 9H), 0.94-0.83 (m, 3H), 0.67 (t, J=7.8 Hz, 2H). OH In a similar fashion, Cpd. No. 69 was prepared as follows: O N N O H -e- B O e urOH

SKC-01-128,O "-- O N N O N O N Y HOY HO1 OH p/ O \ OH Cpd. No. 69

The above Bpin-DAH (75 mg, 0.11 mmol) was mixed with -continued THF:HO mixture (4:1, 10 ml) and sodium periodate (184 mg, 0.861 mmol), and a 2.0 M solution of HCl in THF (0.144 ml, 0.287 mmol) was added. The mixture was stirred at room 50 temperature overnight. LCMS showed single peak. The sol vent was removed on a rotavapor under vacuum, and the residue was diluted with EtOAc and extracted. The organic fractions were dried over anhydrous MgSO, filtered and 55 concentrated. The crude product was adsorbed on neutral H alumina and purified using an ISCO system (8 g neutral , alumina column, DCM/MeOH solvent mixture). The single O 4. product eluted with -5% MeOH in DCM was collected and 60 N O N1 He dried. The product was not soluble in CDC1, so it was dis H solved in DMSO-d for "H NMR analysis. The "H NMR 6796 spectrum in DMSO-d showed a mixture of at least three products. A few drops of DO was added to deuterate any 65 -C exchangeable protons. HNMR (400 MHz, DMSO-d+DO) On & 7.01 (s, 3H), 6.87-6.72 (m, 1H), 6.13 (d. J=7.7 Hz, 1H), US 9,127,024 B2 135 136 -continued -continued

H o, O NaIO4. N1 N O O N-N O HCI 10 H H o-B 21

O n O N Cpd. No. 29 15 SKC-03-036

To a solution of SKC-03-023 (500 mg, 1.11 mmol) in anhydrous acetone (5 ml) in a 1-neck 100 ml round bottom flask fitted with a reflux condenser, at room temperature under argon was added anhydrous KCO (169 mg, 1.22 mmol). The reaction mixture was stirred at 50° C. for 30 min. To this, MeI (0.104 ml, 1.66 mmol) was added, and the reaction mixture was stirred overnight at 50° C. LCMS showed it to be H 25 a clean reaction. The reaction mixture was diluted with o, EtOAc and filtered to remove KCO. The filtrate was dried O 8. under vacuum. The crude mixture was adsorbed on silica, N O dried to make it free flowing, loaded on a cartridge, and HO N1 30 purified using an ISCO system (24g Silica column, hexane/ B EtOAc gradient). The product eluted with ~15% EtOAc in HO-1 hexane. The product fractions were collected and concen trated to give the methylated product SKC-03-036 (270 mg. O N 52%). H NMR (400 MHz, CDC1,) & 7.16-6.83 (m, 4H), 6.48 35 (d. J–7.8 Hz, 1H), 5.92 (m. 1H), 5.08 (m, 2H), 4.66 (t, J=25.6 Cpd. No. 27 HZ, 1H), 3.663 (s.3H), 3.38 (d. J=6.5 Hz, 2H), 2.27 (s, 6H), 1.85-1.76 (m, 4H), 1.54-1.34 (m, 3H), 1.11 (d. J=19.7 Hz, 9H), 0.94-0.86 (m, 3H). Step 2: Synthesis of (R)- N'-(3,5-dimethylbenzoyl)- 40 N'-(2,2-dimethylhexan-3-yl)-3-methoxy-2-methyl-4- Step 1: Synthesis of (R)-4-allyl-N'-(3,5-dimethylben (3-(4.4.5.5-tetramethyl-1,3,2-dioxaborolan-2-yl) Zoyl)-N'(2,2-dimethylhexan-3-yl)-3-methoxy-2-me propylbenzohydrazide thylbenzohydrazide 45

50 H , O

N O

55

O N -N O ke -O SKC-03-036 H Hs 60 21

OH O N SKC-03-023 65 B H S - M O US 9,127,024 B2 137 138 -continued -continued

H H w, o '. O N O N O OH N1 N1 H o-B B 10 HO1 O 1. O Cpd. No. 29 1. Cpd. No. 27 An oven dried, 100 ml, two necked, round bottom flask was 15 equipped with a teflon coated magnetic stir bar, and two To a solution of Cpd. No. 29 (230 mg, 0.388 mmol). In rubber septum with one of the septum with a needle con THF/water mixture (4:1 ratio. 5 ml) was added sodium perio nected to an argon/vacuum manifold. This argon flushed date (498 mg, 2.33 mmol) and then 2M HCl in ether (0.388 round bottom flask was charged with 4-allyl-3-hydroxy-DAH ml, 0.776 mmol). The reaction mixture was stirred at room (SKC-03-036,270 mg 0.58 mmol) in anhydrous THF (2 ml) temperature for few hours, the LCMS checked, and the reac and modified Wilkinson's catalyst (20.08 mg, 0.029 mmol), tion was allowed to continue to stir overnight. The reaction and three vacuum/argon purge cycles were performed. The mixture was filtered to remove the solid, washed with DCM. mixture was stirred at room temperature until all of the and dried under vacuum. The crude reaction mixture was reagents dissolved (<2 min). To this stirred clear reaction adsorbed on neutral alumina and dried. Once it was free mixture was added 4.4.5.5-tetramethyl-1,3,2-dioxaborolane 25 flowing it was loaded on an ISCO cartridge and purified (24g (Bpin-H) (0.254 ml, 1.74 mmol) via syringe, another argon/ neutral alumina column, MeOH-DCM solvent mixture). The vacuum/argon purge was performed, and the reaction mixture product eluted with 2% MeOH in DCM) to give 130 mg of was stirred for 5 h. The color of the reaction mixture turned Cpd. No. 27 (66%) in >95% ee. "H NMR (400MHz, DMSO from light yellow to dark brown. LCMS showed that the 30 d) & 10.43-9.78 (m. 1H), 8.35-8.03 (m. 1H), 7.18-6.89 (m, reaction completed in 5h but it was allowed to stir overnight. 4H), 6.66-6.38 (m. 1H), 4.67-4.36 (m. 1H), 3.60-3.51 (m, A few drops of water were slowly added. Once the efferves 3H), 3.30 (s.3H), 3.18 (d. J=5.3 Hz, 2H), 2.64-2.51 (m, 2H), cence ceased, MeOH was added and the reaction mixture was 2.25 (d. J–4.3 Hz, 6H), 1.88-1.16 (m, 8H), 1.03 (d. J-5.9 Hz, concentrated. The crude mixture was purified on an ISCO 9H), 0.89-0.80 (m, 3H). system (12 g silica column, hexane/EtOAc gradient). The 35 product eluted with 20% EtOAc/hexane. The product fraction Example 4 was collected and dried under vacuum to give 230 mg (67%) of Cpd. No. 29. H NMR (400 MHz, DMSO-d) & 10.15 (s, 1H), 7.11 (s, 1H), 7.08-6.91 (m, 3H), 6.48 (d. J–7.8 Hz, 1H), Synthesis of (R)-(3-(2-difluoromethoxy)-4-(2-(3.5- 4.53-4.28 (m. 1H), 3.55 (d. J–4.2 Hz, 3H), 2.25 (d. J–4.5 Hz, 40 dimethylbenzoyl)-2-(2,2-dimethylhexan-3-yl)hydra 6H), 1.79-1.74 (m, 2H), 1.66) s. 3H), 1.7-1.39 (m, 6H), 1.17 zinecarbonyl)-3-methylphenyl)propyl)boronic acid (s, 12H), 1.03 (d. J=5.8 Hz, 9H), 0.93 (t, J–7.1 Hz, 1H), 0.85 (Cpd. No. 28) (t, J=6.9 Hz, 3H), 0.69 (t, J=7.6 Hz, 2H). 45 Step 3: Synthesis of (R)-(3-(4-(2-(3,5-dimethylben Zoyl)-2-(2,2-dimethylhexan-3-yl)hydrazinecarbo nyl)-2-methoxy-3-methylphenyl)propyl)boronic acid (Cpd. No. 27) O 50 N-Nne H O -- 21 Cs2CO3 130° C., 3h 64% 55 H H 7, av, O F. O 4. NaIO4, N O RhCO(PPh3):Cl / N O HCI 60 N1 BPin-H, THF O N -b- -e- H THF:HO, H THF, reflux o-B rt 21

O 1. 65 Cpd. No. 29 US 9,127,024 B2 140 -continued The 3-hydroxy-4-allyl DAH (2.8 g. 6.21 mmol) was dis solved in DMF/water mixture (6:1 ratio, 11.6 ml) in a round H . bottom flask fitted with a reflux condenser. To this, cesium O carbonate (4.05 g, 12.43 mmol) and the difluoroacetate O N1 N. O NaIO, HCI sodium salt (1.42 g, 9.3 mmol) was added. The reaction h H THF:H2O mixture was stirred at 130°C. (condenser open to air) for 2 h O- 40° C., 4h 30 min. LCMS showed a conversion of 67% of product and N F 10 33% of starting material. After aqueous work up and extrac F tion with EtOAc, the crude product was purified using an ISCO system (24 g silica column, hexane/EtOAc gradient). H The product eluted with ~18% EtOAc in hexane and the 1, O . 15 starting material eluted with 25% EtOAc in hexane. The product fractions were collected and dried to give 1.13 g of N O pure product as a colorless solid (64% yield based on reacted HO N1 SM). 1.2 g of the starting material was recovered. The product HO1 B structure was assigned based on LCMS data. Step 2: Synthesis of (R)-3-(difluoromethoxy)-N'-(3, 5-dimethylbenzoyl)-N'-(2,2-dimethylhexan-3-yl)-2- N. F methyl-4-(3-(4.4.5.5-tetramethyl-1,3,2-dioxaboro F lan-2-yl) propylbenzohydrazide Cpd. No. 28 25

Step 1: Synthesis of (R)-4-allyl-3-(difluo romethoxy)-N'-(3,5-dimethylbenzoyl)-N'-(2,2-dim 30 H 4, ethylhexan-3-yl)-2-methylbenzohydrazide O f

N O

H 35

O w F N1 N O H N 40 F SKC-04-050

OH O RhCO(PPh3)2Cl B- H He SKC-03-023 45 M F O F C 'n Cs2CO3 H * DMF/HO, 4, O 130° C. O 50 2-3 h, 66% N H H o, O 55 N F SKC-04-052 N To a solution of the above synthesized 4-allyl-3-(difluo F romethoxy)-DAH (600 mg, 1.2 mmol) in anhydrous THF (6 SKC-04-050 65 ml) in a 100 ml 2-neck round bottom flask at room tempera ture under argon was added the catalyst (41.4 mg., 0.06 mmol). After 3-cycles of vacuum/argon purging, Bpin-H US 9,127,024 B2 141 142 (0.523 ml, 3.60 mmol) was added via syringe and another 2 crude mixture was dissolved in DCM and adsorbed on silica. purge cycles of vacuum/argon were performed. The reaction Once it was dried and free flowing, it was loaded on a car mixture was stirred for 4 hrs while refluxing under argon. In tridge and purified using an ISCO system (12 g silica column, 20 min, the color of the reaction mixture turned to light hexane/EtOAc gradient). 660 mg of the mixture (eluted with brown. LCMS after 2 h showed a ~46% conversion to prod ~15% EtOAc in hexane, SM-product, 36:62 ratio) was col uct. The temperature was lowered to 76° C. and the reaction lected after ISCO column and used as such for the next step. mixture was stirred overnight. LCMS showed additional two less polar peaks together with the unreacted Starting material Step 3: Synthesis of (R)-(3-(2-difluoromethoxy)-4- and the expected product. After the reaction, 2 ml of MeOH 10 (2-(3,5-dimethylbenzoyl)-2-(2,2-dimethylhexan-3- and few drops of water was added to the reaction mixture, the yl)hydrazinecarbonyl)-3-methylphenyl)propyl)bo Solvents were removed on a rotavapor under vacuum, and the ronic acid (Cpd. No. 28)

H H 4, O O & N O NaIO, HCI O N1 Her N- O H o-B 21 F O N Y F F SKC-04-052 (mixture, 36:62 ratio)

H A, O

N O OH N1 H

HO FN O F Cpd. No. 28 US 9,127,024 B2 143 The above mixture, (660 mg) was dissolved in a mixture of -continued THF: water (4:1, 30 ml) and sodium periodate (1.35 g, 630 mmol), and 2.0 M HCl in THF (1.05 ml, 2.10 mmol) was added. The reaction mixture was stirred at 40° C. for 1 h. F LCMS showed a major peak for the expected product. The reaction was allowed to continue to stir at 40°C. for another F F 30 min and at room temperature overnight. After aqueous O work up and extraction with ethyl acetate, the organic frac tions collected, dried over anhydrous MgSO, filtered, and O F NHoHC 10 HerHN1 concentrated. The crude mixture was purified using prepara F 25 wt % K2CO tive HPLC to give Cpd. No. 28 based on LCMS data. (>95% Br aqs 99% ee).

Example 5 15 h OTHP Synthesis of N'-(tert-butyl)-N-(3,5-dimethylben SKC-02-044 Zoyl)-1-hydroxy-6-methyl-3,4-dihydro-1H-benzoc 1.5.2dioxaborepine-7-carbohydrazide (Cpd. No. 75) N- O C NH O OH 25 N1 O O N H MeOH NH2 H2SO4 Br2 -e- -- -- TEA, 2 h, rt, 66% 23% up 30 OH OH l OTHP SKC-02-007 SKC-02-045 O O N 35 Br N-1\o O K2CO3,97% OH 40 N Br N1 N O Pd(OAc)2, ligand SKC-01-052 Bpin-H, TEA, 40° C. O O He N Br 45 10% KOHaqs/MeOH -e- 70% careful OTHP acidification 1N1 to pH2-4 OTHP 50 SKC-02-047 Br SKC-02-034 F HO F 55 O N N O O OH N1 O.1% F F H HCO2H He 60 ONB, ACN — - HO OTHP DCC O 1N1 92%0

Br OTHP SKC-02-042 65 SKC-02-048 US 9,127,024 B2 145 146 -continued 5-bromo derivatives. "H NMR (CDC1): 7.29-7.21 (dd, 2H), 5.64 (s, 1H), 3.81 (s.3H), 2.45 (s.3H). O N Step 2: Synthesis of methyl 4-bromo-2-methyl-3-2 N ((tetrahydro-2H-pyran-2-yl)oxy)ethoxy)benzoate N1 HO H Yp O / 'N / 10 O On Cpd. No. 75 N-1- O K2CO3, 97% 15 OH Step 1: Synthesis of methyl Br 3-hydroxy-2-methylbenzoate SKC-01-052 O ON

O OH O O N

MeOH O O He H2SO4 25 1N1 Br OH OH SKC-02-034 SKC-02-007 30 To a solution of methyl 4-bromo-3-hydroxy-2-methylben Experimental procedure as described in EXAMPLE 1. Zoate (1.0 g, 4.08 mmol) in anhydrous DMF (20 ml) under argon was added anhydrous KCO (1.12 g, 8.16 mmol), and Step 2: Synthesis of methyl the reaction mixture was stirred at room temperature for 2 h. 4-bromo-3-hydroxy-2-methylbenzoate 35 To this stirred mixture was added 2-(2-bromoethoxy)tetrahy dro-2H-pyran (1.28 g. 6.12 mmol). The reaction mixture was heated at 60°C. for 4 h. LCMS showed a single peak with the expected product mass. The heating was stopped and stirring was continued overnight at room temperature. After aqueous 40 O O work up and extraction with EtOAc, the organic fractions O O N dried over anhydrous MgSO filtered, and concentrated. The N crude product was purified using an ISCO system (40 g silica Br column, hexane/EtOAc gradient). The product eluted with -e- 23% ~10% EtOAc in hexane. The product fractions were collected 45 and concentrated to give 1.48 g (97% yield) of SKC-02-034. OH OH H NMR (400MHz, CDC1) & 7.53 (d. J=8.5 Hz, 1H), 7.46 (d. Br J=8.5 Hz, 1H), 4.78 (t, J–3.5 Hz, 1H), 4.22-4.03 (m, 3H), SKC-02-007 4.07-3.76 (m, 5H), 3.60-3.52 (m, 1H), 2.61 (s.3H), 1.98-1.38 SKC-01-052 (m, 6H). 50

A 500 ml 3-neck round bottom flask was fitted with two Step 3: Synthesis of 4-bromo-2-methyl-3-2-((tet dropping funnels. To this was added a solution of the tert rahydro-2H-pyran-2-yl)oxy)ethoxy)benzoic acid butyl amine (4.4g, 60.2 mmol) in CH2Cl2 (140 ml) and the flask was cooled to -78°C. A solution of bromine (9.6 g. 60.2 55 mmol) in CH2Cl2 (60 ml) was added drop wise over 30 minutes from the dropping funnel. The mixture was stirred at O On -78°C. for another 1 h. A solution of methyl 3-hydroxy-2- methylbenzoate (10.0g, 60.2 mmol) in CH2Cl2 (25 ml) was 60 10% KOHaqs/MeOH added from the second dropping funnel during 1 h. (US He 20051 10979). The reaction mixture was allowed to warm to 70% room temperature and stir for overnight. LCMS showed 3 1N1 O O pH2-4 peaks. Aqueous work up and extraction with DCM followed by flash column chromatography using an ISCO system Br (2x80 g silica gel column, hexane/EtOAc solvent mixture) 65 gave the product (1st peak, fractions 4-5, 3.3g, 22% yield). SKC-02-034 The side products isolated and characterized as dibromo and US 9,127,024 B2 147 148 -continued -continued O OH F

F F O

1N1 O O O F F Br Br 10 SKC-02-042

To the above methyl ester (330 mg, 0.884 mmol) in 2 ml of OTHP MeOH was added aqueous KOH (1.0 g of KOH in 10 ml water), and the reaction stirred at room temperature for 6 h. SKC-02-044 LCMS indicated -5% product formation. Added 3 ml of MeOH to the reaction mixture, and heated to 60° C. LCMS The above acid (SKC-02-042, 770 mg, 2.14 mmol) was showed a single peak. Added saturated NaHCO to a pH of 9. dissolved in anhydrous ethyl acetate (9 ml) in a 200 ml round Tried to extract the product in EtOAc but it stayed in aqueous bottom flask under argon and stirred at room temperature. To fraction. Cooled the reaction mixture in an ice bath and added this was added pentafluorophenol (434 mg, 2.36 mmol) and 1N HCl slowly to make it to pH4. Extracted the product using 1MDCC in DCM (2.36 ml, 2.36 mmol). The reaction mixture EtOAc and LCMS of both the fractions showed almost same was stirred at room temperature overnight. 5 ml of water was amount of the product. The aqueous fraction again acidified added with stirring for another 10 min. The precipitate was to pH 0-1, LCMS showed additional peak (minor) in addition 25 filtered off. The filtrate was diluted with EtOAc and water and to the major peak. The organic fractions were dried over anhydrous MgSO filtered, and concentrated. The crude extracted with ethyl acetate. The organic fractions were col product was purified using an ISCO system (12 g silica gel lected, dried over anhydrous MgSO filtered, and concen column, hexane/EtOAc gradient). The product eluted with trated. The crude mixture was adsorbed on silica and purified 25% EtOAc in hexane to give 220 mg (70% yield) of the 30 using an ISCO system (12 g silica column, hexane/EtOAC product. gradient). The product eluted with ~ 8% EtOAc in hexane. The experiment was repeated in 2.2g scale in a mixture of The product fractions were collected and dried to give SKC 30 ml of MeOH and 50 ml of 10% KOH adueous. The reac 02-044 (1.1 g, 98% yield). H NMR (400 MHz, MeOD) & tion was completed in 6 hat 55° C. Saturated NaHCO added 7.93 (d. J=8.5 Hz, 1H), 7.74 (t, J=11.3 Hz, 1H), 4.84 (t, J=3.3 and the mixture stirred at room temperature overnight. The 35 HZ, 1H), 4.26-4.10 (m,3H), 4.06-3.87(m, 2H), 3.72-3.55 (m, mixture was cooled in an ice bath 1N HCl was slowly added 1H), 2.74 (s.3H), 2.03-1.70 (m, 6H). to make it to pH 3-4. Extracted using EtOAc and then acidi fied the aqueous fractions again with 1N HCl to pH 1-2. Step 5: Synthesis of 4-bromo-N'-(tert-butyl)-2-me Extracted a second time. The combined organic fractions thyl-3-(2-((tetrahydro-2H-pyran-2-yl)oxy)ethoxy) were concentrated and purified using an ISCO system (40 g 40 benzohydrazide silica gold column, hexane/EtOAc gradient). The main peak eluted with 35% EtOAc in hexane to give SKC-02-042. "H F NMR (400 MHz, CDC1) & 7.67 (d. J=8.5 Hz, 1H), 7.48 (d. F F J=8.5 Hz, 1H), 4.77 (t, J=3.5 Hz, 1H), 4.26-4.02 (m, 3H), O 3.91-3.80 (m, 2H), 3.69-3.40 (m. 1H), 2.65 (s.3H), 2.01-1.39 45 25 wt % (m, 6H). O F K2CO3 aqs F Step 4: Synthesis of perfluorophenyl-4-bromo-2- Br NHHCI 9996 methyl-3-(2-((tetrahydro-2H-pyran-2-yl)oxy)ethoxy) HN benzoate 50 y OTHP

SKC-02-044 F O HO F N1 NH O OH H

F F Br --- 60 DCC

1S-1 r) OTHP Br 65 SKC-02-045 SKC-02-042 US 9,127,024 B2 149 150 EtOAc (4 ml) was added to a stirred solution of aqueous added 3,5-dimethylbenzoyl chloride (196 mg, 1.16 mmol). KCO solution (25 wt %, 600 mg KCO in 3.4 ml water) in The solution became clear. To this, TEA (0.162 ml, 1.16 a 200 ml round bottom flaskat room temperature. To this was mmol) was added drop wise. The reaction mixture was stirred added tert-butyl hydrazine hydrochloride (267 mg, 2.14 under argon at room temperature overnight. LCMS showed mmol) followed by the Pfester derivative (750 mg, 1.43 two peaks, the major one showed the expected product mass. mmol) dissolved in EtOAc (3 ml). The reaction mixture was The crude mixture was adsorbed on silica and purified using stirred at room temperature overnight. For checking the an ISCO system (12 g silica gel column, hexane/EtOAc gra LCMS, a small amount of the sample was mixed with slightly 10 dient). The product eluted with ~40% EtOAc in hexane. The acidic buffer solution (pH 6.5 from Aldrich) in order to product fractions were collected to give 560 mg (86% yield) quench any unreacted free hydrazine. The crude mixture was of the solid product SKC-02-047. H NMR (400 MHz, diluted with buffer solution (pH 6.5) and stirred for few DMSO-d) & 10.55 (s, 1H), 7.45 (d. J=8.1 Hz, 1H), 7.03 (d. minutes. LCMS showed two peaks, the major one with the 15 J–4.2 Hz,3H), 6.42 (dd, J=8.2, 1.9 HZ, 1H), 4.65 (t, J=3.1 Hz, expected product mass. After usual aqueous work up and 1H), 4.14-3.58 (m, 5H), 3.55-3.37 (m. 1H), 2.24 (s, 6H), 1.79 extraction with ethyl acetate, the organic fractions were dried (s, 3H), 1.77-1.37 (m, 15H). over anhydrous MgSO filtered and concentrated. The crude Step 7: Synthesis of N'-(tert-butyl)-N'-(3,5-dimethyl mixture was redissolved in DCM, adsorbed on silica, and benzoyl)-2-methyl-3-(2-((tetrahydro-2H-pyran-2-yl) purified using an ISCO system (12 g silica column, hexane/ oxy)ethoxy)-4-(4.4.5.5-tetramethyl-1,3,2-dioxaboro EtOAc gradient). The product eluted with ~45% EtOAc in lan-2-yl)benzohydrazide hexane. The product fractions were collected to give 490 mg. 80% yield of the hydrazide product SKC-02-050. "H NMR 25 (400 MHz, CDC1) & 7.38 (d. J=8.2 Hz, 1H), 7.26 (s, 1H), 6.96 (d. J–8.2 Hz, 1H), 4.89 (s, 1H), 4.72 (d. J–2.8 Hz, 1H), 4.15-4.03 (m, 3H), 3.97-3.73 (m, 2H), 3.51-3.49 (m, 1H),

2.41 (s.3H), 1.91-1.44 (m, 6H), 1.13 (s, 9H). 30 Step 6: Synthesis of 4-bromo-N-(tert-butyl)-N-(3.5- dimethylbenzoyl)-2-methyl-3-(2-((tetrahydro-2H Pd(OAc)2, ligand pyran-2-yl)oxy)ethoxy)benzohydrazide Bpin-H, TEA, 40° C. -- 35

N 40 OTHP NH O C N Y H SKC-02-047 TEA Hos Br 2 h, rt, 66% 45 O N N O OTHP N1 H SKC-02-045 50 O NB O N O N1 N O H 55 OTHP Br SKC-02-048

60 To a stirred solution of the above synthesized 4-bromo DAH (200 mg, 0.36 mmol) in anhydrous 1,4-dioxane (2 ml) OTHP in a 100 ml 2-necked round bottom flaskat room temperature SKC-02-047 under argon was added palladium (II) acetate (4.0 mg, 0.018 65 mmol), phosphine ligand (25.0 mg 0.071 mmol) and triethy To a stirred solution of the SKC-02-045 (500 mg, 1.16 lamine (0.15 ml, 1.069 mmol). After 3-cycles of vacuum/ mmol) in DCM (2 ml) in a 100 ml round bottom flask was argon purging, Bpin-H (0.16 ml, 1.069 mmol) was added via US 9,127,024 B2 151 152 Syringe followed by another 2 purge cycles of vacuum/argon. Example 6 The reaction mixture was stirred at room temperature for 10 min and then heated to 40° C. and stirred for 4 h. LCMS Synthesis of (R) N-(3,5-dimethylbenzoyl)-N-(2,2- showed product peak. After the reaction, 2 ml of MeOH and 5 dimethylpentan-3-yl)-1-hydroxy-6-methyl-3,4-dihy few drops of water were added to the reaction mixture and the dro-1H-benzoc1.5.2dioxaborepine-7-carbohy Solvents were removed on a rotavapor. The crude mixture was drazide (Cpd. No. 79) redissolved in DCM and adsorbed on silica. Once it was dried F and free flowing, it was loaded on a cartridge and purified 10 F F using an ISCO system (12 g silica column, hexane/EtOAc O 1. gradient) to give 50 mg of SKC-02-048. O F HN1 NHoTSOH 15 F Br BNB-9-3-3rd Solid Step 8: Synthesis of N'-(tert-butyl)-N'-(3,5-dimethyl He benzoyl)-1-hydroxy-6-methyl-3,4-dihydro-1H-benzo c1.5.2dioxaborepine-7-carbohydrazide O r

O

25 O N SKC-03-028 N -N O H O.1% H HCOH 9NB -e-ACN/HO C O

O

OTHP

SKC-02-048

40 O N N N1 45 H SKC-03-034 HO p O O O 50

Cpd. No. 75 O N BH 55 M O 50 mg of SKC-02-048 was stirred in 2 ml of a 1:1 mixture He of waterfacetonitrile containing 0.1% formic acid at 40°C. Pd(OAc) overnight, and checked by LCMS. After the reaction was complete, the Solvent was removed on a rotavapor under 60 vacuum and the crude product was purified by preparative HPLC and lyophilized to give 17 mg of Cpd. No. 75 as a pure dry powder. "H NMR (400 MHz, DMSO-d) & 10.49 (s, 1H),

8.39 (s, 1H), 7.57 (d. J–7.8 Hz, 1H), 7.04 (s, 3H), 6.19 (d. 65 J–7.9 HZ, 1H), 4.41-4.18 (m, 2H), 4.16-3.96 (m, 2H), 2.25 (s, SKC-03-037 6H), 1.70 (s.3H), 1.49 (s.9H). US 9,127,024 B2 153 154 -continued Step 1: Synthesis of 4-bromo-N'-((R)-2,2-dimeth ylpentan-3-yl)-2-methyl-3-(2-((tetrahydro-2H-pyran H 2-yl)oxy)ethoxy)benzohydrazide le O 5 N1 N O H

F 10 O F F H O 1.

O F NHoTSOH 15 F HN1 Br (ee>95%) --

SKC-03-040 H ,

N O N Y 25 H SKC-03-028 HCOH --- 30

A.

NH 35 N

Br SKC-03-040-1

40 A. O

N O

N 45 HO NB / O O Y YaYYaY SKC-03-034 50 Cpd. No. 79 EtOAc (6 ml) was added to a stirred solution of 25 wt % H aqueous KCO solution (800 mg KCO in 3.2 ml water) in A. a round bottom flaskat room temperature. To this was added "a tert-butyl hydrazine followed by the Pfester compound (1.0 N O 55 1. g, 1.904 mmol) dissolved in EtOAc (4 ml). The reaction N mixture was stirred at room temperature overnight. LCMS showed a single peak. The crude mixture was diluted with MeOH, concentrated, dissolved in DCM, adsorbed on silica, 60 and purified using an ISCO system (40 g silica gel column, O hexane/EtOAc gradient). The product eluted with ~35% EtOAc in hexane to give 610 mg (68%) of the product. H NMR (400MHz, DMSO-d) 89.66 (s, 1H), 7.52 (d. J=8.1 Hz, HO 1H), 6.97 (d. J=8.2 Hz, 1H), 4.85 (s, 1H), 4.70 (t, J=3.3 Hz, SKC-03-040-2 65 1H), 406-4.01 (m, 2H), 3.97-3.89 (m. 1H), 3.84-3.70 (m, 2H), 3.51-3.40 (m, 1H), 2.32 (s.3H), 1.82-1.35 (m, 8H), 1.04 (t, J–7.5 Hz, 3H), 0.93 (s, 9H). US 9,127,024 B2 155 156 Step 2: Synthesis of 4-bromo-N'-(3,5-dimethylben- Step 3: Synthesis of (R)- N'-(3,5-dimethylbenzoyl)- Zoyl)-N'-((R)-2,2-dimethylpentan-3-yl)-2-methyl- N'-(2,2-dimethylpentan-3-yl)-1-hydroxy-6-methyl-3, 3-(2-((tetrahydro-2H-pyran-2-yl)oxy)ethoxy)benzo- 4-dihydro-1H-benzoc 15.2dioxaborepine-7-car hydrazide bohydrazide (Cpd. No. 79)

H 4, 10 O . °. N O NH N1 O

N1 C O 15 Br YHM O Br -e- TEA Pd(OAc) r DCM O 2O O r O CO 25 SKC-03-034 SKC-03-037

H 30 -N O Y N O H N O H 35 n p Br O O --

45 SKC-03-040 SKC-03-037

H To a solution of SKC-03-034 (310 mg, 0.658mmol) in 2 ml 50 O ', DCM as added the acid chloride (111 mg, 0.658 mmol). The solution became clear. TEA (66.5 mg 0.092 ml) was added -N O drop wise, and the reaction mixture was stirred under argon at N room temperature for 2 hours. The reaction mixture became a colorless thick slurry, and it was stirred overnight. LCMS 55 showed a single peak with the expected product mass. The CO2H reaction mixture was adsorbed on silica gel and purified using ? an ISCO system (12 g silica gel column, hexane/EtOAc gra dient). The product eluted with ~20% EtOAc in hexane to give 380 mg (96%) of SKC-03-037. "H NMR (400 MHz, DMSO-d) & 10.33 (d. J=57.6 Hz, 1H), 7.47 (d. J=8.1 Hz, C 1H), 7.10 (s, 1H), 7.06-6.97 (m, 2H), 6.62-6.41 (m, 1H), 4.70-4.60 (m. 1H), 4.33 (dd, J=820, 10.4 Hz, 1H), 3.99-3.82 (m,3H), 3.82-3.71 (m. 1H), 3.71-3.58 (m. 1H), 3.52-3.34 (m, as 1H), 2.24 (d. J=4.9 Hz, 6H), 1.83-1.28 (m, 11H), 1.12-0.99 SKC-03-040-1 (m. 12H). US 9,127,024 B2 158 -continued The Bpinlated product (SKC-03-040) obtained was stirred with 2 ml of a 1:1 mixture of waterfacetonitrile containing H 0.1% formic acid at 40°C. overnight. LCMS showed it as a 1, clean reaction. The solvent was removed and the residue was O (R) purified by preparative HPLC and lyophilized to give Cpd. N O No. 79 (83 mg: >95% ee) as a dry powder. N1 The protonated product obtained from the first step was HO also stirred with 2 ml of 1:1 mixture of waterfacetonitrile containing 0.1% formic acid at 40°C. overnight to give 41 mg p of SKC-03-040-2 (>95% ee) as a dry powder. 10 Using the procedure described above, Cpd. No. 82 was 'N / prepared from SKC-06-005: Cpd. No. 79 F H 15 o, O O (R) N O N O N1 N1 H O / O CO ? O 25 HO u?

SKC-03-040-2 O To a solution of SKC-03-037 (380 mg, 0.630 mmol) in anhydrous 1,4-dioxane (3 ml) in a 100 ml 2-necked round 30 bottom flask at room temperature under argon was added SKC-06-005 F palladium (II)acetate (7.07 mg, 0.031 mmol), phosphine ligand (44.1 mg, 0.126 mmol) and triethylamine (0.263 ml, 1.889 mmol). After 3-cycles of vacuum/argon purging, O Bpin-H (0.273 ml, 1.889 mmol) was added via syringe fol 35 N O lowed by another 2 purge cycles of vacuum/argon. The reac N1 tion mixture was stirred at room temperature for 10 min and HO H then warmed to 40° C. and stirred for 4 h. LCMS showed the N product peak and a more polar peak corresponding to the B protonated product (SKC-03-040-1). After the reaction, 2 ml / of MeOH and few drops of water were added to the reaction 40 mixture and it was concentrated under vacuum. The crude 'N / mixture was redissolved in DCM and adsorbed on silica. Once it was dried and free flowing, it was loaded on a car Cpd. No. 82 tridge and purified using an ISCO system (12g silica column, hexane/EtOAc gradient). The main fraction (Cpd. No. 70) eluted with 20% EtOAc in hexane. The second peak (SKC 45 Cpd. No. 82 LCMS MH+=443. 03-040-1) eluted with 25% EtOAc in hexane. The two prod uct peaks were separated. "H NMR of SKC-03-040 (400 Example 7 MHz, DMSO-d) & 10.33 (d. J=58.0 Hz, 1H), 7.48 (d. J=8.2 HZ, 1H), 7.07 (d. J=25.0 Hz, 3H), 6.70-6.23 (m, 1H), 4.78 4.60 (m. 1H), 4.43 (d. J=9.9 Hz, 1H), 3.99-3.80 (m, 3H), 50 Synthesis of (R)-(4-(2-(3,5-dimethylbenzoyl)-2-(2,2- 3.84-3.71 (m. 1H), 3.68 (d. J–3.2 Hz, 1H), 3.50-3.39 (m, 1H), dimethylpentan-3-yl)hydrazinecarbonyl)-2-(2-meth 2.24 (d. J–4.9 HZ, 6H), 1.80-1.34 (m, 8H), 1.09-0.92 (m, oxyethoxy)-3-methylphenyl)boronic acid (Cpd. No. 24H). 26)

O On 10% KOHaqs PN-1-1 MeOH Hs careful acidification OH 1N-'N to pH2-4 Br Br (purchased from SKC-04-011 Pharmaron)

US 9,127,024 B2 161 162 Step 1: Synthesis of methyl pure compound) was added 50 ml of 10% KOH acqueous 4-bromo-3-(2-methoxyethoxy)-2-methylbenzoate solution. The reaction mixture was stirred at 50° C. overnight. LCMS showed that reaction is only 75% complete. The reac tion was heated for another 7 hours, and then stirred overnight at room temperature. LCMS showed a single peak with expected product mass. Removed all Me?oH under vacuum. The aqueous reaction mixture was cooled in an ice bath 1N N-1-1 HCl was slowly added to pH 4-5. A white product precipitated K2CO3, DMF, 90° C. 10 out. It was filtered and dried under vacuum at 40°C. overnight OH to give 1.34 g (70%) of the acid SKC-04-012 as colorless

Br powder. "H NMR (400 MHz, DMSO-d) & 13.15 (brs, 3H), O On 7.54 (d. J=8.4 Hz, 1H), 7.46 (d. J=8.4 Hz, 1H), 4.09-3.90 (m, 15 2H), 3.73-3.63 (m, 2H), 3.33 (s.3H), 2.47 (s, 3H).

Step 3: Synthesis of perfluorophenyl 1n-'N 4-bromo-3-(2-methoxyethoxy)-2-methylbenzoate Br

SKC-04-011 O OH F

25 HO F DCC 2-Methyl-3-hydroxyl-4-Bromo methyl ester (2.0 g, 8.16 EtOAc mmol) was dissolved in anhydrous DMF (20 ml) in a 100 ml Hip round bottom flask fitted with a reflux condenser, and anhy O drous potassium carbonate (2.26g, 16.32 mmol) was added to 1N1 N. F. F it. The reaction mixture was stirred at room temperature 30 Br F under argon for 15 min. To this, 1-bromo-2-methoxyethane SKC-04-012 (1.70 g, 12.24 mmol) was added and the reaction mixture was F heated to 90° C. and stirred overnight under argon. LCMS F F showed single peak. The reaction mixture was cooled. After O aqueous work up and extraction with EtOAc, the organic 35 fractions were collected, dried over anhydrous MgSO fil O F tered, and concentrated. It was used in the next step without further purification. F Br 40 Step 2: Synthesis of 4-bromo-3-(2-methoxyethoxy)-2-methylbenzoic acid

45 O O N SKC-04-017

10% KOHaqs/MeOH -e- O careful acidification 50 4-Bromo-3-(2-methoxyethoxy)-2-methylbenzoic acid 1N1 N to pH4 (SKC-04-012, 1.37 g, 4.74 mmol) was dissolved in anhy drous EtOAc (20 ml) in a 250 ml round bottom flask under Br argon and stirred at room temperature. To this was added SKC-04-011 pentafluorophenol (0.959 g, 5.21 mmol) and 1M DCC in O OH 55 DCM (5.21 ml, 5.21 mmol). The reaction mixture was stirred at room temperature overnight. 2 ml of water was added with stirring for another 10 min. The precipitate was filtered off. The filtrate was diluted with EtOAc and extracted. After O 60 aqueous work up, the organic fractions collected, dried over C N anhydrous MgSO, filtered and concentrated. The crude mix Br ture was adsorbed on silica and purified using an ISCO sys SKC-04-012 tem (24 g silica column, hexane/EtOAc gradient). The prod 65 uct fractions eluted with 5% EtOAc in hexane to give 1.79g. To a MeOH (25 ml) solution of the above methyl ester (83% yield) of the Pfester derivative SKC-04-017 as a col SKC-04-011, (crude wt of 3.1 g, but calculated for 2.0 g of orless solid. US 9,127,024 B2 163 164 Step 4: Synthesis of (R)-4-bromo-N'-(2,2- dient). The product eluted -30% EtOAc in hexane mixture to dimethylpentan-3-yl)-3-(2-methoxyethoxy)-2- give 1.6 g (99%) of SKC-04-026. "H NMR (400 MHz, methylbenzohydrazide DMSO-d) & 9.66 (d. J=6.5 Hz, 1H), 7.51 (d. J=8.2 Hz, 1H), 6.96 (d. J=8.2 Hz, 1H), 4.84 (dd, J=6.5, 3.3 Hz, 1H), 4.01-3.96 (m. 2H), 3.72-3.63 (m, 2H), 3.34 (s.3H), 2.38-2.31 (m. 1H), F 2.29 (s.3H), 1.60-1.49 (m. 1H), 1.34-1.21 (m. 1H), 1.03 (t, F F J=7.5 Hz, 3H), 0.93 (s, 9H). O Step 5: Synthesis of (R)-4-bromo-N'-(2,2-dimethyl O F pentan-3-yl)-3-(2-methoxyethoxy)-2-methylbenzo F hydrazide Br 15

1, O C O O .

NH SKC-04-017 N1 H TEA, DCM He Br 25 \ H O lit, -e- EtOAc, rt NHoTSOH O HN1 30 BNB-9-3-2nd solid SKC-04-026

35 H , O N1 NH H 40

Br

45

r SKC-04-028-3

SKC-04-026 50 To a solution of (R)-4-bromo-N'-(2,2-dimethylpentan-3- yl)-3-(2-methoxyethoxy)-2-methylbenzohydrazide (SKC EtOAc (12 ml) was added to a stirred solution of 25 wt % 04-026, 750 mg, 1.869 mmol) in anhydrous DCM (2 ml) was aqueous KCO Solution (1.63 g KCO in 6.5 ml water) in a added 3,5-dimethylbenzoyl chloride (315 mg, 1.869 mmol) round bottom flask at room temperature. To this was added 55 and triethylamine (0.260 ml, 1.869 mmol). The reaction mix tert-butyl hydrazine salt (1.784g, 5.90 mmol) followed by the ture was stirred at room temperature under argon overnight. above Pfester derivative (1.79 g, 3.93 mmol) dissolved in LCMS showed two major peaks. The crude mixture was EtOAc (8 ml). The reaction mixture was stirred at room dissolved in DCM and adsorbed on silica, and purified using temperature overnight. LCMS showed a main peak with the 60 an ISCO system (40 g silica gel column, hexane/EtOAc gra expected product mass. The crude mixture was diluted with dient). The product fraction eluted with 30% EtOAc in hex acidic buffer solution (Aldrich, pH 6.5) and extracted with ane to give SKC-04-028-3. "H NMR (400 MHz, DMSO-d) EtOAc. The organic fractions collected, dried over anhydrous & 10.57-10.08 (m, 1H), 7.48 (d. J=8.1 Hz, 1H), 7.19-6.96 (m, MgSO filtered and concentrated. The crude product was 65 3H), 6.49 (dd, J=50.2, 8.2 Hz, 1H), 4.33 (dd, J=820, 10.2 Hz, redissolved in DCM, adsorbed onto silica, and purified using 1H), 3.96-3.78 (m, 2H), 3.62 (t, J–4.6 Hz, 2H), 3.31 (s.3H), an ISCO system (40 g silica gel column, hexane/EtOAc gra 2.25 (s, 6H), 1.78-1.29 (m, 5H), 1.12-0.92 (m, 12H). US 9,127,024 B2 165 166 Step 6: Synthesis of (R)-(4-(2-(3,5-dimethylben -continued Zoyl)-2-(2,2-dimethylpentan-3-yl)hydrazinecarbo H nyl)-2-(2-methoxyethoxy)-3-methylphenyl)boronic le, acid (Cpd. No. 26) O N1 N O H H ? HO O NB 10 / N O HO O N 1. H Pd(OAc)2, ligand Bpin-H, TEA Br -e- O

O 15 Cpd. No. 26

O To a solution of the above synthesized 4-bromo-DAH 20 (SKC-04-028-3, 400 mg 0.750 mmol) in anhydrous 1,4- SKC-04-028-3 dioxane (4 ml) in a 100 ml 2-necked round bottom flask at room temperature under argon was added palladium (II) acetate (8.42 mg, 0.037 mmol), phosphine ligand (52.6 mg, 0.150 mmol) and triethylamine (0.314 ml, 2.249 mmol) After 25 3-cycles of vacuum/argon purging, Bpin-H (0.327 ml, 2.249 mmol) was added via Syringe followed by another 2 purge cycles of vacuum/argon. The reaction mixture was stirred at room temperature for 10 min and then warmed to 40°C. and stirred overnight. LCMS showed Bpinlated product peak and 30 a more polar peak with a mass corresponding to the proto nated product. After the reaction, 2 ml of MeCH and few drops of water were added to the reaction mixture. The sol vents were removed on a rotavapor under vacuum and the 35 crude mixture was redissolved in DCM and adsorbed on scoop Pk silica. Once it was dried and free flowing, it was loaded on a '. cartridge and purified using an ISCO system (24 g silica O column, hexane/EtOAc gradient). The two products eluted N O together The fractions were combined and purified using N a preparative HPLC. SKC-04-032 Pk1 was isolated (31 mg, H >95% ee). During HPLC purification, the Bpinlated product Her hydrolyzed slowly to the boronic acid derivative. After stir ring overnight in the HPLC solvent mixture (0.1% HCOH in water/ACN mixture, 2 ml) at 40° C., the material was re 45 purified by prep HPLC to give Cpd. No. 26 (9 mg) (>95% ee). Example 8 Synthesis of (R)-(3-(1-(2,2-dimethylpentan-3-yl)-2- (3-methoxy-2-methylbenzoyl)hydrazinecarbonyl)-5- methylphenyl)boronic acid (Cpd. No. 33)

OH O C

SOCl. He B B

O O

SKC-03-071 US 9,127,024 B2 167 168 -continued

H H 4, 1, O s O N1 N O N1 N O H H

NaIO, HCI Her 1. O B-O 1. O B1 OH O OH

SKC-03-072

H 4, O N1 N O H

1. O B1 OH OH Cpd. No. 33

Step 1: Synthesis of 3-methyl-5-(4.4.5.5,-tetram- 45 -continued ethyl-1,3,2-dioxaborolan-2-yl)benzoyl chloride O C

50 B-0 O

55 O OH SKC-03-071 3-Methyl-5-(4,4,5,5-tetramethyl-1,3,2dioxaborolan-2- yl)-benzoic acid (700 mg, 2.67 mmol) was placed into 100 ml SOCl. round bottom flask equipped with a stir bar. 3.0 ml of anhy -> drous chloroform was added to the flask followed by 2.0 ml of B-0 thionyl chloride and 1 drop of anhydrous DMF. The reaction mixture was stirred at 35° C. for 3 hours and then at room O temperature overnight. LCMS of the sample after quenching a small amount with MeOH showed that no acid left. The 65 solvent and excess thionyl chloride was removed under (purchased) vacuum to give SKC-03-071. SKC-03-071 was used in the next step without further purification. US 9,127,024 B2 169 170 Step 2: Synthesis of (R)-N'-2.2-dimethylpentan-3- yl)-3-methoxy-2-methyl-N'-(3-methyl-5-(4.4.5.5,- tetramethyl-1,3,2-dioxaborolan-2-yl)benzoyl)benzo hydrazide

O C H A. O

1. NH -e- r O N O 1. O

SKC-03071 BNB-9-39-F1 H H

O . O N1 N O N O H

1. O B1 O 1. O 5. B1 OH O OH

SKC-03-072 (mixture of products) The above acid chloride (SKC-03-071, 403 mg, 1.437 -continued mmol) was dissolved in anhydrous DCM (3 ml) and was 35 H added to a stirred solution of previously synthesized (R)— 4, N'-(2,2-dimethylpentan-3-yl)-3-methoxy-2-methylbenzohy O drazide (400 mg, 1.437 mmol, >95% ee) in 3 ml of anhydrous -N O NaIO4, DCM at room temperature under argon. Anhydrous triethy N lamine (0.200 ml, 1.437 mmol) was added and the reaction H HCI mixture was stirred at room temperature for 3 hours. LCMS 40 showed a major peak with the expected product mass together with Some other minor peaks. The crude mixture was adsorbed on neutral alumina and dried under vacuum. The dry 1. O B1 OH powder was loaded on a cartridge and purified using an ISCO system (24 g neutral alumina column, hexane/EtOAc gradi 45 OH ent). At ~15% EtOAc in hexane, the product eluted together SKC-03-072 with the hydrolysis product to give SKC-03-072 (270 mg) as (mixture of pdts) a mixture. This was used as such for the next hydrolysis step. Step 3: Synthesis of (R)-(3-(1-(2,2-dimethylpentan 50 H 3-yl)-2-(3-methoxy-2-methylbenzoyl)hydrazinecar bonyl)-5-methylphenyl)boronic acid (Cpd. No. 33) O N1 N O H lo, O

N O N 1 O OH H 1. B1 V -- 60 OH Cpd. No. 33 O 1. B -O

O The above mixture. SKC-03-072 (270 mg, 0.517 mmol) 65 was mixed with THF:HO mixture (4:1, 15 ml) and sodium periodate (221 mg, 1.034 mmol), and 2.0 M solution of HCl in THF (1.55 ml, 3.10 mmol) was added. The reaction mix US 9,127,024 B2 171 172 ture was stirred at room temperature for 2 hours. LCMS -continued showed single peak with the expected mass of the boronic acid. The solvent was removed on a rotavapor under vacuum. H After aqueous work up and extraction with EtOAc, the , organic fractions were dried over anhydrous MgSO, filtered O and concentrated. The crude product was purified using prep N O HPLC to give 32 mg (14%) of Cpd. No. 33. H NMR (400 N1 MHz, DMSO-d) & 10.51-9.87(m, 1H), 7.99 (brs, 1H), 7.64 H (dd, J–20.2, 11.7 Hz, 2H), 7.40-7.25 (m, 1H), 7.13-7.03 (m, F 1H), 6.98-6.89 (m. 1H), 6.48-6.17 (m. 1H), 4.58-4.12 (m, 10 s F 1H), 3.76-3.68 (m, 3H), 2.28 (d. J=6.5 Hz, 3H), 1.49 (d. "K F J=31.9 Hz, 5H), 1.16-0.92 (m, 12H). Cpd. No. 93 Using the method described above, (R)-(4-(2-(3,5-dimeth ylbenzoyl)-2-(2,2-dimethylhexan-3-yl)hydrazinecarbonyl)- 15 A solution of potassium hydrogen fluoride (1.81 ml, 5.43 3-fluorophenyl)boronic acid (Cpd. No. 13) was prepared mmol. 3.0 M in HO from Aldrich) was added to a stirring from SKC-07-018: solution of Cpd. No. 13 (0.300 g, 0.68 mmol) at room tem perature (J. Org. Chem. 77:6384–6393 (2012)). The colorless clear Solution starts to precipitate slowly in 5 minutes and resulted in a thick white precipitate in 20 min. The mixture H was stirred for 2.5 h at room temperature and then concen trated under reduced pressure to get a white Solid. Acetone O was added to the white solid and filtered through a filter N O NaIO4. funnel. The filtrate was concentrated under reduced pressure 25 N1 -e-HCI on a rotavapor until a small amount of precipitation was H observed. Diethyl ether was added to the resulting white solid O to encourage precipitation. The precipitate was collected by NB F filtration, washed with ether and dried to get the white borate O salt Cpd. No. 93 (0.276 g, 81% yield). H NMR (400 MHz, 30 DMSO) & 10.18 (d. J=56.9 Hz, 1H), 7.00-6.92 (m, 5H), 6.52 (dd, J=14.2, 7.1 Hz, 1H), 4.43 (dd, J=58.4, 8.6 Hz, 1H), 2.24 SKC-07-018 (s, 6H), 1.79-1.34 (m, 4H), 1.02 (d. J=3.2 Hz, 9H), 0.88 (dt, J=31.9, 6.9 Hz, 3H). Using the method described above, (R)-(4-(2-(3,5-dimeth H 35 ylbenzoyl)-2-(2,2-dimethylhexan-3-yl)hydrazinecarbonyl)- 4, O 2-fluorophenyl)boronic acid (Cpd. No. 22) was prepared from SKC-07-055A: N1 N O H HO 40 NB F H w, OH O s Cpd. No. 13 N O NaIO4, 45 Y HCI N Her H Cpd. No. 13 LCMS MH+=443. Potassium (R)-(4-(2-(3,5-dimethylbenzoyl-2(2,2-dimeth ylhexan-3-yl)hydrazine-1-carbonyl)-3-fluorophenyl)trifluo 50 roborate (Cpd. No. 93) was prepared from Cpd. No. 13 as follows: SKC-07-055A

H o, H O 1, O N1 N O N1 N O aqs KHF MeOH H 60 HO H n B HO n B F / OH F HO Cpd. No. 22 65 Cpd. No. 13 Cpd. No. 22 LCMS MH+=443. US 9,127,024 B2 173 174 Using the method described above, (4-(2-(tert-butyl)-2-(3, 5-dimethylbenzoyl) hydrazinecarbonyl)-2-fluorophenyl)bo ronic acid (Cpd. No. 23) was prepared from SKC-07-055B:

5

H HCI O N- 1N O -e-NaIO4, OS 1N NaIO, B F H HCI 10 O -e- O-N- B SKC-07-043B O F 15 SKC-07-055B

F O O N O 2O Y N1 N O N H HO HO n B F n B OH OH F 25 Cpd. No. 25 Cpd. No. 23

Using the method described above, (R)-(4-(2-(3,5-dimeth- so ylbenzoyl)-2-(2,2-dimethylhexan-3-yl)hydrazinecarbonyl)- Example 9 3,5-difluorophenyl)boronic acid (Cpd. No. 24) was prepared from SKC-07-043A: Preparation of Synthetic Intermediates

35

H

F O ?ee, 4. O

N NaIO4. 40 1. N1 - C - O KOBut H -e- O NB F 21

O 45 OH (Pharmaron)

SKC-07-043A O

H 50 o1 NaIO/OsO4 F O 8, -- N O N N1 H 55 OH HO SKC-04-016 NB F

OH O

Cpd. No. 24 60 o1 TfG)/TEA He Cpd. No. 24 LCMS MH+=461. s Using the method described above, (4-(2-(tert-butyl)-2-(3, 5-dimethylbenzoyl) hydrazinecarbonyl)-3,5-difluorophenyl) 65 H OH boronic acid (Cpd. No. 25) was prepared from SKC-07- SKC-04-019 O43B: US 9,127,024 B2 175 176 -continued Step 1: Synthesis of methyl O 3-hydroxy-2-methyl-4-(prop-1-en-1yl)benzoate o1 NaBH4 O -- F 1. H O O KOBut so Her N-1C| F O SKC-04-02OB OH SKC-04-023 O O 15 o1 o1 HO O s O F OH \ SKC-04-016 N Z F K. OO O HON 4. In a round bottom flask fitted with a dropping funnel was SKC-04-021 added methyl 4-allyl-3-hydroxy-2-methylbenzoate (4.12 g, / ( 25 20 mmol) in anhydrous DMSO (20 ml) at room temperature O under argon. t-BuOK in 1.0 M THF (5.61 g, 50 mmol) was O N added drop wise to the stirred solution. After the addition, the o1 B-H reaction mixture was heated at 55° C. overnight. The reaction M O O O 30 was monitored using LCMS. After the reaction was complete, -e- Pd(OAc), TEA it is cooled, acidified with 1N HCl and stirred for 30 min. O F Ligand Aqueous work up and extraction with ethyl acetate gave the O-N crude mixture which was purified using an ISCO system (40 | 1

O 45 SKC-04-027-1 O o1 NaIO/OsO4 -e-

50 OH Or SKC-04-016 SKC-04-027-2 O O o1 55 o1 O O. O n

H OH 60 Cr SKC-04-019 To a solution of methyl 3-hydroxy-2-methyl-4-(prop-1-en lyl)benzoate (1.66 g, 8.05 mol) in dioxane?water (280 mL SKC-04-027-3 mixt 65 2.5/1 ratio) was added sodium periodate (3.96 g. 18.51 mmol) and 2.5 wt % solution of osmium tetroxide intert-butanol (3.3 ml, 2.66 mmol). The reaction mixture was stirred overnight at US 9,127,024 B2 177 178 room temperature. LCMS showed a single peak with the -continued expected product mass. After aqueous work up and extraction O with EtOAc, the crude product was purified on ISCO system (40 g silica gel column, hexane/EtOAc gradient) to get 1.2g o1 (77% yield) of the aldehyde. "H NMR (400 MHz, CDC1) & 11.39 (s, 1H), 9.93 (s, 1H), 7.45 (d. J=8.1 Hz, 1H), 7.38 (d. HO J=8.1 Hz, 1H), 3.93 (s, 3H), 2.44 (s, 3H). F O Step 3: Synthesis of methyl 4-formyl-2-methyl-3- ng 1< F 10 F (((trifluoromethyl)sulfonyl)oxy)benzoate O SKC-04-021,024

O To a stirred solution of the above compound (1.58 g, 4.84 15 mmol) in MeCH (10 ml) at ice temperature under argon was o1 Tf,0/TEA added sodiumborohydride (0.183 g, 4.84 mmol). LCMS after -as 2 hours showed a new main peak. The reaction was quenched O by adding water (-2 ml). The MeOH was removed on a n rotavapor. The reaction mixture was extracted with EtOAc, dried over anhydrous MgSO, filtered, concentrated, and H OH purified using an ISCO system (24 g silica column, hexane SKC-04-019 O EtOAc gradient). The product fractions were collected to give 970 mg (61%) of the final alcohol. "H NMR (400 MHz, o1 CDC1) & 7.93 (d. J=8.1 Hz, 1H), 7.56 (d. 1H), 4.84 (d. J=6.2 25 Hz, 2H), 3.92 (s.3H), 2.59 (s.3H), 2.14 (t, J=6.2 Hz, 1H). O n Step 5: Synthesis of methyl 2-methyl-4-(((tetrahy F dro-2H-pyran-2-yl)oxy)methyl)-3-(((trifluoromethyl) H O ng 1< F sulfonyl)oxy)benzoate | F O 30 SKC-04-020B, 023 O s \ To a stirred solution of methyl 4-formyl-3-hydroxy-2-me o1 N Z thylbenzoate (1.1 g, 5.66 mmol) in anhydrous DCM (22 ml) 35 at -78°C. under argon was added triflic anhydride (1.6 g. 5.66 HO mmol) drop wise followed by triethylamine (0.79 ml, 5.66 O F O HOv. AO Óag-CS F A.S mmol). The reaction mixture was stirred overnight and F O allowed to warm to room temperature. The reaction mixture O turned colorless to yellow during addition and then light 40 brown overnight. LCMS overnight stirring showed single SKC-04-021,024 O peak. After regular aqueous work up and extraction with DCM, the organic fractions were collected, dried over anhy drous MgSO filtered and concentrated. The crude mixture was adsorbed on silica gel and dried. This was loaded on the 45 cartridge and purified using an ISCO system (24 g silica gel column, hexane/EtOAc gradient). The product fractions were O collected and dried under vacuum to give 1.58 g (85% of the N-1-| F final product). H NMR (400 MHz, CDC1) & 10.26 (s, 1H), O 7.99 (d. J=8.1 Hz, 1H), 7.89 (d. J=8.1 Hz, 1H), 3.96 (s.3H), 50 2.63 (s.3H). SKC-04-025 Step 4: Synthesis of methyl 4-(hydroxymethyl)-2- methyl-3-(((trifluoromethyl) sulfonyl)oxy)benzoate To a stirred solution of the above alcohol (970 mg, 2.95 55 mmol) in anhydrous DCM (35 ml) in a round bottom flask O was added 3,4-dihydro-2H-pyran (2.48 g, 29.5 mmol) and pyridinium p-toluenesulfonate (371 mg, 1.47 mmol). The o1 reaction mixture was stirred overnight at room temperature O NaBH4 under argon. LCMS showed a single peak. After aqueous n 60 work up and extraction with DCM, the crude reaction mixture F was purified using an ISCO system-silica gel column, (24 g. H O hexane/EtOAc gradient) to give 780 mg (64%) of the final N-1C.| F product. "H NMR (400 MHz, CDC1) & 7.90 (d. J=8.1 Hz, O 65 1H), 7.55 (d. J=8.2 Hz, 1H), 4.90 (d. J=13.9 Hz, 1H), 4.75 SKC-04-020B, 023 4.56 (m, 2H), 3.91 (s.3H), 3.89-3.82 (m. 1H), 3.60-3.48 (m, 1H), 2.59 (s.3H), 1.93-1.50 (m, 6H).