Human Cancer Biology

Inhibition of Phosphotyrosine Phosphatase 1B Causes Resistance in BCR-ABL-PositiveLeukemiaCellstotheABLKinaseInhibitorSTI571 Noriko Koyama,1Steffen Koschmieder,1SandhyaTyagi,1Ignacio Portero-Robles,1Jo« rg Chromic,1 Silke Myloch,1Heike Nu« rnberger,1Ta nja Ro s s m a ni t h , 1Wolf-Karsten Hofmann,2 Dieter Hoelzer,1and Oliver Gerhard Ottmann1

Abstract Protein tyrosine phosphatase 1B(PTP1B) is a negative regulator of BCR-ABL-mediated transfor- mation in vitro and in vivo. Toinvestigate whether PTP1B modulates the biological effects of the abl kinase inhibitor STI571in BCR-ABL-positive cells, we transfected Philadelphia chromosome ^ positive (Ph+) chronic myeloid leukemia cell-derived K562 cells with either wild-type PTP1B (K562/PTP1B), a substrate-trapping dominant-negative mutant PTP1B(K562/D181A), or empty vector (K562/mock). Cells were cultured with or without STI571and analyzed for its effects on proliferation, differentiation, and apoptosis. In both K562/mock and K562/PTP1B cells, 0.25 to 1 Amol/L STI571 induced dose-dependent growth arrest and apoptosis, as measured by a decrease of cell proliferation and an increase of Annexin V-positive cells and/or of cells in the sub-G1 apoptotic phase. Western blot analysis showed increased protein levels of activated caspase-3 and caspase-8 and induction of poly(ADP-ribose) polymerase cleavage. Low con- centrations of STI571promoted erythroid differentiation of these cells. Conversely, K562/D181A cells displayed significantly lower PTP1B-specific tyrosine phosphatase activity and were signifi- cantly less sensitive to STI571-induced growth arrest, apoptosis, and erythroid differentiation. Pharmacologic inhibition of PTP1B activity in wild-type K562 cells, using bis(N,N-dimethylhy- droxamido)hydroxooxovanadate, attenuated STI571-induced apoptosis. Lastly, comparison of the STI571-sensitive Ph+ acute lymphoblastic leukemia cell line SupB15 with a STI571-resistant subline revealed significantly decreased PTP1Bactivity and enhanced BCR-ABL phosphorylation in the STI571-resistant SupB15 cells. In conclusion, functional PTP1B is involved in STI571- induced growth and cell cycle arrest, apoptosis, and differentiation, and attenuation of PTP1B function may contribute to resistance towards STI571.

Philadelphia chromosome–positive (Ph+) chronic myeloid nib) is a selective BCR-ABL tyrosine kinase inhibitor that has leukemia (CML) and acute lymphoblastic leukemia (ALL) have significantly improved the prognosis of CML. Whereas 80% of become model diseases for the effectiveness of targeted drug patients with newly diagnosed CML achieve a complete therapy. The p185Bcr-Abl and p210Bcr-Abl tyrosine kinase proteins cytogenetic response to STI571, acquired (secondary) resis- are formed by the reciprocal translocation between chromo- tance to STI571 occurs with an annual incidence of f4% somes 9 and 22 (Philadelphia chromosome). STI571 (imati- (1–3). Primary resistance to STI571 is considerably more frequent in patients with advanced CML or Ph+ ALL and secondary resistance develops rapidly in the majority of Authors’Affiliations: 1Division of Hematology, Department of Internal Medicine II, responding patients (4, 5). At relapse, most patients display 2 Johann Wolfgang Goethe University, Frankfurt, Germany and Department of enhanced BCR-ABL kinase activity, reflecting loss of kinase Hematology, Oncology and Transfusion Medicine, University Hospital Benjamin Franklin, Berlin, Germany inhibition by STI571 (6). Several mechanisms of resistance Received 12/1/04; revised 10/27/05; accepted 11/18/05. against STI571 have been reported in patients with CML, Grant support: Held und Hecker Stiftung (N. Koyama); Deutsche including point mutations in the tyrosine kinase domain Forschungsgemeinschaft grant KO2155/1-1 (S. Koschmieder); BMBF grant and amplification of BCR-ABL at the genomic or transcrip- 01GI9971, Nationales Genomforschungsnetz (NGFN), and Novartis Pharma AG, Germany (O.G. Ottmann). tional level (7, 8). However, neither mutation nor amplifica- The costs of publication of this article were defrayed in part by the payment of page tion of BCR-ABL is detected in a significant number of charges. This article must therefore be hereby marked advertisement in accordance patients (7, 8). with 18 U.S.C. Section 1734 solely to indicate this fact. Protein tyrosine phosphatases (PTP) encompass a large Note: N. Koyama and S. Koschmieder contributed equally to this work. S. Koschmieder is currently at Medizinische Klinik und Poliklinik A, University family of enzymes that catalyze the dephosphorylation of Hospital of Muenster, Muenster, Germany. tyrosyl-phosphorylated proteins. In conjunction with protein Requests for reprints: Oliver Gerhard Ottmann, Department of Hematology and tyrosine kinases, they regulate the level of protein tyrosine Oncology, University Hospital Frankfurt/Main, Theodor-Stern-Kai 7, 60590 phosphorylation and are important for fundamental physio- Frankfurt am Main, Germany. Phone: 49-69-6301-6365; Fax: 49-69-6301- logic processes including cell growth and differentiation (9). 6089; E-mail: [email protected]. F 2006 American Association for Cancer Research. PTPs have been shown to be implicated in a wide range of doi: 10.1158/1078-0432.CCR-04-2392 cancers including breast, prostate, and brain cancer, juvenile

www.aacrjournals.org 2025 Clin Cancer Res 2006;12(7) April 1, 2006 Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2006 American Association for Cancer Research. Human Cancer Biology myelomonocytic leukemia, myelodysplastic syndromes, acute PTP1B- or T-cell PTP-specific phosphatase activity, 300 Ag of cell lysate myeloid leukemia, and B-cell lymphomas (10–13). PTP1B is a proteins were immunoprecipitated with monoclonal antibodies against widely expressed nonreceptor PTP that has been shown to be human PTP1B, human T-cell PTP (both from Oncogen, Seattle, WA), a negative regulator of multiple tyrosine kinases, including or mouse immunoglobulin G (Dako, Hamburg, Germany) for 1 hour at 4jC followed by 30 AL of a 50% protein A agarose beads (Amersham, receptor tyrosine kinases such as the insulin receptor, epidermal Freiburg, Germany) for an additional hour. Immune complexes were growth factor receptor, and erythropoietin receptor, as well washed thrice with HEPES buffer (pH 7.0) and used for the tyrosine as of cytoplasmic tyrosine kinases such as Src family kinases phosphatase assays. Activity was determined within a linear range of (14–20). PTP1B was shown to bind to and dephosphorylate detection and the background in the presence of mouse immunoglob- BCR-ABL and to antagonize BCR-ABL-mediated signaling and ulin G was subtracted. Phosphatase activities were calculated using transformation in vivo and in vitro (14–17). Overexpression purified recombinant human CD45 provided in the kit as a control. of PTP1B antagonized BCR-ABL-mediated transformation of Cell cycle, apoptosis, and cell-surface marker analysis. After treatment Rat-1 fibroblasts, reducing their capacity to generate colonies with STI571, cells were pelleted, fixed in 70% methanol on ice for in soft agar and their ability to form tumors in nude mice (15). 1 hour, and resuspended in propidium iodide solution (0.01 mg/mL In addition, both PTP1B overexpression and inhibition of propidium iodide, 200 units/mL RNase, 1% Triton X-100, 0.1 mmol/L EDTA, 0.38 mmol/L sodium citrate). Cell cycle analysis was carried out BCR-ABL by STI571 induced erythroid differentiation of BCR- using a FACScan analyzer and CellQuest software (Becton Dickinson, ABL-positive K562 cells (15). Interestingly, BCR-ABL induces Heidelberg, Germany). For the analysis of apoptosis, cells were stained expression of PTP1B (14, 21), suggesting that PTP1B is using the Annexin V kit according to the instructions of the manufac- implicated in a negative feedback loop of BCR-ABL. Because turer (Roche). bis(N,N-Dimethylhydroxamido)hydroxooxovanadate STI571 preferentially binds to the unphosphorylated confor- (DMHV; Calbiochem, Bad-Soden, Germany) was used for inhibition mation of the ABL kinase domain (22), we hypothesized that of phosphatase activity of PTP1B. For cell-surface marker expression attenuation of PTP1B activity would enhance phosphorylation analysis, cells were stained with phycoerythrin-conjugated anti-glyco- of BCR-ABL and thereby promote abnormal phosphorylation phorin-A antibodies or an isotype-matched nonspecific control anti- of its downstream signals and STI571 resistance. body, and analyzed using FACScan (all from Becton Dickinson). We therefore investigated whether suppression of PTP1B Western blotting. Western blotting was essentially done as previ- ously described (23). The following antibodies were used: anti-PTP1B activity would cause STI571 resistance in p210Bcr-Abl positive (Calbiochem), anti-T-cell PTP (Calbiochem), anti-phospho-extracellu- K562 cells and whether PTP1B activity is altered in an STI571- Bcr-Abl lar signal-regulated kinase (ERK)-1/ERK2 (Promega, Madison, WI), anti- resistant subline of p185 positive SupB15 cells, a Ph+ ALL ERK1/ERK2, anti-Akt, anti-phospho-Akt, anti-c-ABL, antitubulin, cell line derived from STI571-sensitive wild-type SubB15 cells. anti-active caspase-8 (all from Santa Cruz Biotechnology, Santa Cruz, CA), anti-phospho-signal transducer and activator of transcription Materials and Methods 5 (STAT5), anti-phosphotyrosine (both from Upstate Biotechnology, Lake Placid, NY), anti-STAT5 (Transduction Laboratories, Lexington, Cells and reagents. K562 cells (Deutsche Sammlung fu¨r Mikroorga- KY), anti-cleaved caspase-3 (Cell Signaling, Beverly, MA), and anti- nismen und Zellkulturen GmbH, Braunschweig, Germany) were poly(ADP-ribose) polymerase (Roche, Basel, Switzerland). F propagated in RPMI 1640 supplemented with 1% L-glutamine Statistical analysis. Data are expressed as mean SD and were (Invitrogen, Karlsruhe, Germany) and 10% FCS (Serva, Heidelberg, compared using a paired Student’s t test. Differences were considered Germany). SupB15 cells were cultured in RPMI 1640 supplemented significant when P < 0.05. All experiments were done at least twice. with 15% FCS and 1% L-glutamine. To select for the STI571-resistant phenotype, SupB15 cells were cultured with gradually increasing concentrations of STI571 for 6 months. Cells were then further Results maintained in the presence of 1 Amol/L STI571. The antiproliferative effects of STI571 were examined using WST-1 reagent (Roche, PTP1B-mutant (D181A) transfected K562 cells displayaltered Mannheim, Germany) according to the protocol of the manufacturer. PTP1B activity. To investigate whether PTP1B modulates the Overexpression of full-length or mutant PTP1B in K562 cells. Human biological effects of STI571, BCR-ABL-positive K562 cells were PTP1B cDNA from K562 cells was amplified by PCR and cloned into transfected with expression plasmids harboring either wild-type Bam Eco the HI and RI site of pcDNA3 (Invitrogen) after ligation of two human PTP1B (K562/PTP1B), a substrate-trapping PTP1B- Pst V I-restricted fragments. The following primers were used: 5 -ATTG- D181A-mutant (K562/D181A) that retains substrate binding GATCCATGGAGATGGAAAAGGAGTTCGAGCAGATC (PTP1B sense ability but is catalytically impaired (24), or the vector alone 1 BamHI) and 5V-GCCGATGCCTGCACTGCAGTGCACCACAAC (PTP1B antisense 1), as well as 5V-GTTGTGGTGCACTGCAGTGCAGG- (K562/mock), and stable cell lines were generated. Western blot CATCGGC (PTP1B sense 2) and 5V-ATTGAATTCTTACTATGTGTT- analysis showed that PTP1B and PTP1B-D181A proteins were GCTGTTGAACAGGAA (PTP1B antisense 2 EcoRI). The aspartate 181 overexpressed 2- and 3-fold as compared with K562/mock cells, to alanine mutant PTP1B (PTP1B-D181A) was generated using a respectively (Fig. 1A). As expected, phosphatase activity was mutagenesis kit (Clontech, Heidelberg, Germany). All constructs were significantly lower in K562/D181A cells than in K562/mock cells confirmed by DNA sequencing. K562 cells were transfected with 1 Ag whereas K562/PTP1B cells displayed a trend towards higher PTP of either pcDNA3 alone (K562/mock), PTP1B-pcDNA3 (K562/PTP1B), activity as compared with K562/mock cells (Fig. 1B). Over- or PTP1B/D181A-pcDNA3 (K562/D181A) using lipofectamine as expression of wild-type PTP1B or PTP1B-D181A-mutant had no described by the manufacturer (Invitrogen), and positive clones were obvious effect on cell proliferation over 8 weeks (data not shown). selected under 1 mg/mL G418 (Invitrogen). All experiments were done PTP1B regulates STI571-induced changes of phosphotyrosine using early passage cells to avoid changes of the cell lines over time. PTP1B phosphatase activityassay. PTP1B- and T-cell PTP–specific proteins in K562 cells. First, we examined whether alterations tyrosine phosphatase activities were analyzed through dephosphoryla- of PTP1B phosphatase activity in K562 cells interfered with the tion of a tyrosine phosphatase– specific synthetic phosphorylated effects of STI571 on BCR-ABL-mediated signaling processes. peptide using the Universal tyrosine phosphatase assay Kit (Takara Within 8 hours of exposure to STI571, phosphorylation levels Bio, Kyoto, Japan) following the protocol of the manufacturer. For of BCR-ABL in K562/mock and K562/PTP1B cells had

Clin Cancer Res 2006;12(7) April 1, 2006 2026 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2006 American Association for Cancer Research. Inhibition of PTP1B Causes Resistance to STI571

sensitivity to STI571, transfected cells were cultured with and without STI571 and cell growth, cell cycle distribution, and erythroid differentiation were investigated. As shown by the dose-response curve in Fig. 3A, K562/D181A cells were sig- nificantly more resistant to the antiproliferative effects of STI571 than K562/mock and K562/PTP1B cells (Fig. 3A). In addition, the number of viable cells decreased to significantly greater extent in cultures of STI571-treated K562/mock and K562/ PTP1B cells than in K562/D181A cultures exposed to 0.25 Amol/ L STI571 (data not shown). When the effects of PTP1B on the STI571 modulated cell cycle distribution were analyzed by flow cytometry (Table 1), STI571 increased the fraction of sub-G1 apoptotic population in a dose-dependent manner in all of the transfectants. However, the percentage of sub-G1 apoptotic cells following exposure to either 0.25 or 0.5 Amol/L STI571 was significantly smaller in cultures of K562/D181A cells than of K562/mock cells (P < 0.05). In addition, the percentage of cells G2-M phases remained significantly higher in 0.5 Amol/L STI571–treated K562/D181A cultures than in K562/mock cultures (P < 0.05). K562/PTP1B did not differ from K562/mock cultures in cell cycle analysis assays except that they displayed a lower percentage of cells in G2-M phase (P < 0.05). These results suggest that whereas STI571 induces apoptosis and cell cycle arrest in all three cell lines, attenuation of PTP1B activity causes

Fig. 1. Overexpression of mutant PTP-1Binterferes with PTP1B phosphatase K562 cells to be less sensitive to inhibition by STI571. activity. A, Western blot analysis of K562 cell clones stably transfected with STI571 has been shown to promote differentiation of K562 pcDNA3 (K562/mock), PTP1Bin pcDNA3 (K562/PTP1B), and the dominant- cells (15, 27, 28). To evaluate the role of PTP1B in this process, negative D181A mutant of PTP1B (K562/D181A).The densitometric ratio of PTP1B and tubulin expression is depicted for each lane. B, PTP1B-specific phosphatase we assessed the effects of STI571 on glycophorin-A expression, activity. *, P < 0.05, versus K562/mock. Columns, mean of triplicates from an a marker of erythroid differentiation. After 4 days, K562/D181A experiment that was repeated a total of thrice with similar results; bars, SE. cells showed no significant increase of glycophorin-A positive cells in response to 0.25 Amol/L STI571 whereas the percentage decreased whereas they were only marginally altered in K562/ D181A cells (Fig. 2A). Of note, the amount of constitutively phosphorylated BCR-ABL was elevated in K562/D181A cells compared with K562/mock and K562/PTP1B cells. Further- more, the amount of constitutively tyrosine-phosphorylated STAT5 was decreased in K562/PTP1B as compared with K562/ mock cells whereas that of AKTwas increased in K562/D181A cells as compared with K562/mock cells (Fig. 2B). Neither STAT5 nor AKT phosphorylation levels were altered by 8-hour incubation with STI571. The extent and kinetics of ERK dephosphorylation and hyperphosphorylation may critically dependent on the dose of STI571, and different STI571 dosages as well as time points analysis may explain seemingly discrepant observations (25, 26). We observed that STI571 reduced the level of ERK phosphorylation as early as 2 hours after onset of STI571 treatment in all three transfectants. However, after 4 hours, STI571 provoked a significant increase of ERK phosphorylation in K562/mock to roughly control levels and an increase to above-control levels in K562/PTP1B cells whereas total ERK protein expression remained unchanged. This reactivation of ERK was not observed in K562/D181A cells and the level of ERK phosphorylation remained significantly lower than that of untreated cells (Fig. 2B). The levels of ERK phosphorylation declined to each parental control level after 48 hours (data not Fig. 2. Overexpression of mutant PTP1B alters the phosphorylation of shown). Our results suggest that PTP1B is implicated in the phosphotyrosine proteins after incubation of cells with STI571. K562/mock, K562/ effects of STI571 on BCR-ABL-mediated signaling. PTP1B, and K562/D181Acells were cultured in the absence or presence of 0.25 Overexpression of PTP1B-mutant (D181A) counteracts Amol/L STI571at indicated times. Cell lysates were prepared and subjected to Western blotting. A, phosphotyrosine proteins (p-Y)andc-abl.B, phosphorylation STI571-induced growth inhibition, cell cycle arrest, and erythroid state of STAT5, AKT, and ERK1/2 proteins and the protein expression of differentiation. To evaluate the effects of PTP1B on cellular corresponding molecules.

www.aacrjournals.org 2027 Clin Cancer Res 2006;12(7) April 1, 2006 Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2006 American Association for Cancer Research. Human Cancer Biology

Overexpression of PTP1B-mutant (D181A) confers resistance of BCR-ABL-positive cells against STI571-induced apoptosis. To assess the contribution of PTP1B to STI571-induced apoptosis in more detail, cells were cultured for 48 hours with or without 0.25, 0.5, or 1 Amol/L STI571, followed by analysis of Annexin V expression by flow cytometry (Fig. 4A). In all cultures, the number of Annexin V-positive cells increased after treatment with STI571. However, STI571 induced significantly fewer Annexin V-positive cells in K562/D181A than in K562/mock or K562/PTP1B cells (P < 0.05; Fig. 4A). These results are consistent with our observation that the percentage of STI571- induced sub-G1 apoptotic cells was lower in K562/D181 cells than in K562/mock or K562/PTP1B cells (Table 1). To further confirm that diminished PTP1B activity confers STI571 resistance, we used DMHV, a phosphatase inhibitor of PTP1B, and analyzed its effects on STI571-induced apoptosis in wild-type K562 cells. As shown in Fig. 4B, pharmacologic inhibition of PTP1B by DMHV significantly reduced STI571- induced apoptosis. Altogether, our results show that inhibition of the catalytic function of PTP1B renders BCR-ABL-positive cells resistant against STI571-induced apoptosis. To elucidate the molecular mechanisms of PTP1B-mediated resistance to STI571-induced apoptosis in K562 cells, we examined caspase cleavage in STI571-treated cells (Fig. 4C). STI571 induced activated caspase-3 as well as caspase-8 in both K562/mock and K562/PTP1B cells as previously reported for BCR-ABL-positive cells (22). K562/D181A cells showed notably attenuated expression of cleaved caspase-3 as well as caspase- 8 as compared with K562/mock and K562/PTP1B cells after Fig. 3. Overexpression of mutant PTP1Binhibits effects of STI571on cell growth and erythroid differentiation. A, inhibitory effects of STI571on cell growth. Cells treatment with STI571 for 24 hours. Likewise, and consistent were treated with indicated concentrations of STI571for 48 hours. Points, mean of with resistance to STI571-induced apoptosis, poly(ADP-ribose) three separate experiments done in triplicate; bars, SD. *, P < 0.05; **, P < 0.001, versus K562/mock treated with corresponding concentration of STI571. B, effects polymerase cleavage was diminished in K562/D181A cells of STI571on erythroid differentiation. Cells were incubated without or with treated with 0.25 Amol/L of STI571 whereas it was readily 0.25 Amol/L STI571for 4 days and analyzed for glycophorin-A surface expression detectable in K562/mock and K562/PTP1B cells at this dose by flow cytometry.The percentage of glycophorin-A-positive cells is depicted for each culture. *, P < 0.05, versus untreated. level (Fig. 4C). These findings indicate that diminished function of PTP1B results in resistance to STI571-induced apoptosis accompanied by attenuated activation of the apo- of glycophorin-A positive cells increased significantly in K562/ ptotic caspase cascade. mock and K562/PTP1B cells exposed to 0.25 Amol/L STI571 Phosphatase activityof PTP1B is attenuated in an STI571- (P = 0.007 and P = 0.001, respectively; Fig. 3B). Together, these resistant SupB15 subline. The association between STI571 results indicate that reduction of PTP1B activity confers resistance and attenuated PTP1B phosphatase activity was resistance against STI571-induced growth inhibition, apoptosis, further investigated using SupB15 cells, an ALL cell line ex- cell cycle arrest, and erythroid differentiation of K562 cells. pressing p185Bcr-Abl. The STI571-resistant (SupB15-RT) subline

Ta b l e 1. Cell cycle analysis of PTP1B-overexpressing stable K562 cell lines

Cell line STI571 treatment, 48 h (Mmol/L) Sub-G1 G1 SG2-M K562/mock None 4.4 F 2.6 39.0 F 1.8 27.5 F 7.7 18.4 F 7.4 0.25 30.9 F 3.3 36.1 F3.0 22.1 F1.8 8.8 F 1.5 0.5 36.9 F 2.0 37.1 F2.1 15.5 F 1. 2 3. 4 F 0.8 K562/PTP1B None 6.0 F 2.1 40.5 F3.5 28.0 F 6.2 20.2 F 4.8 0.25 33.6 F 4.0 32.1 F2.3 22.3 F 3.5 5.1 F0.5* 0.5 38.6 F 3.8 32.5 F2.9 20.6 F 3.1 3.1 F 1.0 K562/D181A None 8.0 F 3.0 42.4 F5.7 25.7 F 4.2 16.0 F 4.3 0.25 18.8 F 3.9* 40.0 F3.6 22.3 F 1.1 12.7 F 2.9 0.5 25.2 F 3.9* 33.5 F2.7 24.3 F 2.1 9.9 F 0.8*

*P < 0.05 versus K562/mock in the presence of the respective concentration of STI571 (t test).

Clin Cancer Res 2006;12(7) April 1, 2006 2028 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2006 American Association for Cancer Research. Inhibition of PTP1B Causes Resistance to STI571

whether impaired PTP1B function mediates this effect, we examined PTP1B-specific phosphatase activity in SupB15-WT and SupB15-RTcells. As shown in Fig. 5B, PTP1B-specific tyrosine phosphatase activity was significantly lower in SupB15-RTcells as compared with SupB15-WTcells ( P < 0.05). To further show that attenuation of phosphatase activity was specific for PTP1B, we assessed T-cell PTP-specific phosphatase activity in SupB15-WTand SupB15-RTcells. No significant difference was observed in T-cell PTP-specific phosphatase activity between these cells (Fig. 5C). There was no difference in protein expression levels of PTP1B and T-cell PTP in both cell lines regardless of treatment with 1 Amol/L STI571 (Fig. 5D). To exclude the possibility that ABL tyrosine kinase domain mutations were responsible for STI571 resis- tance of SupB15-RTcells (29, 30), we sequenced exons 4 to 7 for all previously described mutations of BCR-ABL.No mutation was detected in either SupB15-WTor SupB15-RTcells (data not shown). Together, these results suggest that STI571 resistance of p185Bcr-Abl positive SupB15 cells may at least, in

Fig. 4. Overexpression of mutant PTP1Binhibits effects of STI571on apoptosis. A, percentage of AnnexinV-positive cells depicted for each K562 stable cell clone culturedin the absence or presence of different concentrations of STI571.*, P < 0.05, versus K562/mock culture at the respective concentration of STI571. Columns, average of triplicate experiments; bars, SE. B, percentage of AnnexinV ^ positive cells after the exposure of wild-type K562 cells to DMHV, a PTP1Binhibitor, in the absence or presence of STI571. *, P < 0.05, versus cells cultured with 1 Amol/L STI571but without DMHV. C, Western blot analysis of active caspase-3 and caspase-8 and poly(ADP-ribose) polymerase (PARP ) for each K562 stable cell clone. As control for equal loading, the blot was reprobed with antitubulin antibody. In a separate experiment,Western blotting was done using an anti-poly(ADP-ribose) polymerase antibody.The upper band depicts the uncleaved poly(ADP-ribose) polymerase protein and the lower band shows cleaved poly(ADP-ribose) polymerase protein. Fig. 5. Enhanced phosphorylation of BCR-ABL and decreased PTP1Bactivity in STI571-resistant SupB15-RTcells. A, SupB15-WTand SupB15-RTcells were cultured with or without1 Amol/L STI571for 24 hours. Equal amounts (30 Ag) of cell was generated from maternal SupB15 cells as described in lysates were analyzed for tyrosine phosphoproteins, c-Abl. pBCR-ABL/BCR-ABL Materials and Methods. Treatment of wild-type SupB15 ratios were calculated by densitometry and indicated under each lane. Tyrosine B (SupB15-WT) cells with 1 Amol/L of STI571 resulted in a protein phosphatase assay using PTP1Bimmunoprecipitated complex ( )and usingT-cell PTP (TC-PTP) immunoprecipitated complex (C). Columns, mean of profound reduction of BCR-ABL phosphorylation (Fig. 5A). In triplicates from an experiment that was repeated a total of four times with similar contrast, the level of BCR-ABL phosphorylation in the presence results; bars, SE. *, P < 0.05, versus SupB15-WT. D, SupB15-WTand SupB15-RT A cells were cultured with or without1 Amol/L STI571for 24 hours. Equal amounts of 1 mol/L STI571 remained higher in SupB15-RT cells as (30 Ag) of cell lysates were analyzed for PTP1BandT-cell PTP.Tubulin serves as a compared with SupB15-WTcells (Fig. 5A). Todetermine loading control.

www.aacrjournals.org 2029 Clin Cancer Res 2006;12(7) April 1, 2006 Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2006 American Association for Cancer Research. Human Cancer Biology part, be due to enhanced phosphorylation of BCR-ABL and We further sought to analyze the molecular mechanisms reduction of PTP1B activity. underlying resistance to STI571-induced apoptosis in these cells. In K562/D181A cells, expression and phosphorylation Discussion levels of AKTwere markedly elevated. Activated AKThas been shown to phosphorylate and inactivate caspase-9, Cellular transformation by the BCR-ABL oncogene depends thereby preventing the cleavage and activities of the on its constitutive and deregulated tyrosine kinase activity, executioner caspases and apoptosis (28–29). Consistently, which results in phosphorylation of a large number of cellular we observed that STI571-induced activation of caspase-3 and signaling proteins including STAT5, ERK, and phosphatidyli- caspase-8 was decreased in STI571-resistant K562/D181A nositol 3-kinase/AKT. STI571 inhibits the function of BCR-ABL cells compared with K562/mock and K562/PTP1B cells through competitive binding at the ATP-binding kinase domain exposed to STI571. These effects could confer a survival of the ABL kinase and is highly effective in most patients with advantage to cells which display low PTP1B activity during chronic-phase, but not advanced, CML. A serious drawback of exposure to STI571. this specific treatment, however, is the emergence of drug Exposure of BCR-ABL-positive cells to STI571 has been resistance. PTP1B acts as a negative regulator of multiple shown to down-regulate ERK activation at early time points, signaling pathways, including insulin- and growth factor– followed by a significant increase in ERK activation at later mediated processes (9). Interestingly, expression of PTP1B is intervals (26, 34). Consistent with these reports, we observed increased by BCR-ABL (14, 21) and these effects coincide with activation of ERK after transient dephosphorylation in K562/ the ability of PTP1B to antagonize BCR-ABL-induced transfor- mock cells and in K562/PTP1B cells but not in K562/D181A mation (15). We hypothesized that PTP1B could be involved in cells, again indicating that inhibition of PTP1B activity alters resistance to STI571 in BCR-ABL-positive cells. Our results downstream signaling events of BCR-ABL in response to show that attenuated PTP1B phosphatase activity causes STI571. resistance to STI571-induced growth and cell cycle arrest, STI571 has been shown to induce erythroid cell differen- apoptosis, and differentiation in K562 cells. One possible tiation in BCR-ABL expressing cells (35), indicating that mechanism by which attenuation of PTP1B results in resistance BCR-ABL inhibits erythroid differentiation in these cells. to STI571 is enhanced activation of the BCR-ABL tyrosine Here, we show that inhibition of PTP1B activity interferes kinase in cells displaying low PTP1B activity. The presence of with STI571-induced glycophorin-A expression, suggesting enhanced expression of BCR-ABL has been reported as a that, in addition to control of growth and apoptosis, PTP1B mechanism of STI571 resistance (7, 31, 32). Amplification of is also involved in the differentiation of hematopoietic the BCR-ABL locus was frequently observed in those cells progenitor cells. leading to enhanced activation of its downstream signals. Consistent with a role of PTP1B in resistance to STI571, we Nevertheless, increased BCR-ABL expression was also observed observed attenuated PTP1B activity and enhanced phosphory- in the absence of genomic amplification (29). Mutations within lation of BCR-ABL in a STI571-resistant subline of SupB15 Ph+ the BCR-ABL tyrosine kinase domain have been implicated in ALL cells (SupB15-RT). Previous studies have indicated that resistance to STI571 but their precise role is still controversial. the loss of phosphatase T-cell PTP may contribute to STI571 Another mechanism of resistance to STI571 in cells displaying resistance in STI571-resistant sublines from CML cell line KT-1 low PTP1B activity may be reduced binding of STI571 to the (13). In this study, we detected neither decreased expression BCR-ABL protein due to increased BCR-ABL phosphorylation nor attenuated phosphatase activity of T-cell PTP in STI571- (33). In this context, it was recently shown that binding of resistant SupB15 cells as compared with wild-type SupB15 cells. STI571 to BCR-ABL requires dephosphorylation of tyrosine 393 These results indicate that attenuated function of PTP1B is of BCR-ABL and that overexpression of a Y393F mutant BCR- likely to be a common feature for STI571-resistance in CML and ABL, which cannot be dephosphorylated, confers resistance ALL cells. against STI571 (22). We here show that the level of BCR-ABL In conclusion, our results suggest that functional PTP1B is phosphorylation after treatment with STI571 is enhanced in involved in STI571-induced growth and cell cycle arrest, K562/D181A cells, which express a dominant-negative mutant apoptosis, and differentiation of BCR-ABL-positive leukemia of PTP1B.. These results strongly suggest that activation of cells and that strategies to enhance BCR-ABL dephosphoryla- BCR-ABL, by way of attenuated PTP1B function, may drive tion may decrease the development of resistance to STI571 in STI571 resistance in these cells. patients with BCR-ABL associated disease.

References 1. O’Brien SG, Guilhot F, Larson RA, et al. Imatinib com- 4. Sawyers CL, Hochhaus A, Feldman E, et al. Imatinib ABL gene mutation or amplification. Science 2001; pared with interferon and low-dose cytarabine for induces hematologic and cytogenetic responses in 293:876 ^ 80. newly diagnosed chronic-phase chronic myeloid patients with chronic myelogenous leukemia in mye- 8. ShahNP,NicollJM,NagarB,etal.MultipleBCR-ABL leukemia. N Engl J Med 2003;348:994 ^ 1004. loid blast crisis: results of a phase II study. Blood kinase domain mutations confer polyclonal resistance 2. Kantarjian H, Talpaz M, O’Brien S, et al. High-dose 2002;99:3530 ^ 9. to the tyrosine kinase inhibitor imatinib (STI571) in imatinib mesylate therapy in newly diagnosed Phila- 5. Ottmann OG, Druker BJ, Sawyers CL, et al. A phase 2 chronic phase and blast crisis chronic myeloid leuke- delphia chromosome-positive chronic phase chronic study of imatinib in patients with relapsed or refractory mia. Cancer Cell 2002;2:117^ 25. myeloid leukemia. Blood 2004;103:2873 ^ 8. Philadelphia chromosome-positive acute lymphoid 9. Tonks NK, Neel BG. Combinatorial control of the 3. Silver RT,Talpaz M, Sawyers CL, et al. Four years leukemias. Blood 2002;100:1965 ^ 71. specificity of protein tyrosine phosphatases. Curr Opin of follow-up of 1027 patients with late chronic phase 6. Hingorani SR, Tuveson DA. Targeting oncogene de- Cell Biol 2001;13:182^ 95. (L-CP), accelerated phase (AP), or blast crisis (BC) pendence and resistance. Cancer Cell 2003;3:414^ 7. 10. Di Cristofano A, Pandolfi PP. The multiple roles of chronic myeloid leukemia (CML) treated with imatinib 7. Gorre ME, Mohammed M, Ellwood K, et al. Clinical PTEN in tumor suppression. Cell 2000;100:387 ^ 90. in three large phase II trials. Blood 2004;104:11a. resistance to STI-571cancer therapy caused by BCR- 11. Tartaglia M, Niemeyer CM, Fragale A, et al. Somatic

Clin Cancer Res 2006;12(7) April 1, 2006 2030 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2006 American Association for Cancer Research. Inhibition of PTP1B Causes Resistance to STI571

mutations in PTPN11in juvenile myelomonocytic leu- down-regulation of erythropoietin receptor signalling. its the growth of BCR-ABL-positive cells. Blood kemia, myelodysplastic syndromes and acute myeloid Biochem J 2004;377:517^ 24. 1997;90:3691^8. leukemia. Nat Genet 2003;34:148 ^ 50. 20. Goldstein BJ, Bittner-Kowalczyk A, White MF, 28. Fang G, Kim CN, Perkins CL, et al. CGP57148B 12. Koyama M, OkaT, Ouchida M, et al. Activated prolif- Harbeck M.Tyrosine dephosphorylation and deactiva- (STI-571) induces differentiation and apoptosis and eration of B-cell lymphomas/leukemias with the SHP1 tion of insulin receptor substrate-1by protein-tyrosine sensitizes Bcr-Abl-positive human leukemia cells to gene silencing by aberrant CpG methylation. Lab phosphatase 1B. Possible facilitation by the formation apoptosis due to antileukemic drugs. Blood 2000;96: Invest 2003;83:1849 ^ 58. of a ternary complex with the Grb2 adaptor protein. 2246 ^ 53. 13. ShimizuT, MiyakawaY, Iwata S, et al. A novel mech- J Biol Chem 2000;275:4283 ^ 9. 29. Weisberg E, Griffin JD. Mechanism of resistance to anism for imatinib mesylate (STI571) resistance in 21. FukadaT,Tonks NK.The reciprocal role of Egr-1and the ABL tyrosine kinase inhibitor STI571in BCR/ABL- CML cell line KT-1: role of TC-PTP in modulating sig- Sp family proteins in regulation of the PTP1Bpromoter transformed hematopoietic cell lines. Blood 2000;95: nals downstream from the BCR-ABL fusion protein. in response to the p210 Bcr-Abl oncoprotein-tyrosine 3498^505. Exp Hematol 2004;32:1057 ^ 63. kinase. J Biol Chem 2001;276:25512^ 9. 30. Hofmann WK, Komor M, Wassmann B, et al. Pres- 14. LaMontagne KR, Jr., Flint AJ, Franza BR, Jr., 22. Miething C, Mugler C, Grundler R, et al. Phosphory- ence of the BCR-ABL mutation Glu255Lys prior to Pandergast AM, Tonks NK. Protein tyrosine phospha- lation of tyrosine 393 in the kinase domain of Bcr-Abl STI571 (imatinib) treatment in patients with Ph+ acute tase 1B antagonizes signalling by oncoprotein tyrosine influences the sensitivity towards imatinib in vivo. lymphoblastic leukemia. Blood 2003;102:659 ^ 61. kinase p210 bcr-abl in vivo. Mol Cell Biol 1998;18: Leukemia 2003;17:1695 ^ 9. 31. Mahon FX, Deininger MW, Schultheis B, et al. Se- 2965 ^ 75. 23. Koschmieder S, HofmannWK, KunertJ, et al.TGF h- lection and characterization of BCR-ABL positive cell 15. LaMontagne KR, Jr., Hannon G, Tonks NK. Protein induced SMAD2 phosphorylation predicts inhibition lines with differential sensitivity to the tyrosine kinase tyrosine phosphatase PTP1B suppresses p210 bcr- of thymidine incorporation in CD34+ cells from inhibitor STI571: diverse mechanisms of resistance. abl-induced transformation of rat-1 fibroblasts and healthy donors, but not from patients with AML after Blood 2000;96:1070 ^ 9. promotes differentiation of K562 cells. Proc Natl Acad MDS. Leukemia 2001;15:942 ^ 9. 32. le Coutre P,Tassi E,Varella-Garcia M, et al. Induction Sci U S A1998;95:14094^9. 24. Flint AJ, Tiganis T, Barford D, Tonks NK. Devel- of resistance to the Abelson inhibitor STI571in human 16. Ahmad F, Azevedo JL, Cortright R, Dohm GL, opment of ‘‘substrate-trapping’’ mutants to identify leukemic cells through gene amplification. Blood Goldstein BJ. Alterations in skeletal muscle protein- physiological substrates of protein tyrosine phos- 2000;95:1758^66. tyrosine phosphatase activity and expression in insu- phatases. Proc Natl Acad Sci U S A 1997;94: 33. Schindler T, Bornmann W, Pellicena P, Miller WT, lin-resistant human obesity and diabetes. J Clin Invest 168 0 ^ 5. Clarkson B, Kuriyan J. Structural mechanism for STI- 1997;100:449^58. 25. Kohmura K, MiyakawaY, Kawai Y, IkedaY, Kizaki M. 571 inhibition of Abelson tyrosine kinase. Science 17. Bjorge JD, Pang A, Fujita DJ. Identification of pro- Different roles of p38 MAPK and ERK in STI571-in- 2000;289:1938 ^ 42. tein-tyrosine phosphatase 1B as the major tyrosine duced multi-lineage differentiation of K562 cells. 34. Dan S, Naito M,TsuruoT. Selective induction of ap- phosphatase activity capable of dephosphorylating J Cell Physiol 2004;198:370 ^ 6. optosis in Philadelphia chromosome-positive chronic and activating c-Src in several human breast cancer 26. Yu C, Krystal G,Varticovksi L, et al. Pharmacologic myelogenous leukemia cells by an inhibitor of BCR cell lines. J Biol Chem 2000;275:41439 ^ 46. mitogen-activated protein/extracellular signal-regulat- ABL tyrosine kinase, CGP 57148. Cell Death Differ 18. Boute N, Boubekeur S, Lacasa D, IssadT.Dynamics ed kinase kinase/mitogen-activated protein kinase 19 9 8;5 :710 ^ 5. of the interaction between the insulin receptor and inhibitors interact synergistically with STI571to induce 35. JacquelA,HerrantM,LegrosL,etal.Imatinibindu- protein tyrosine-phosphatase 1Bin living cells. EMBO apoptosis in Bcr/Abl-expressing human leukemia ces mitochondria-dependent apoptosis of the Bcr- Rep 2003;4:313^ 9. cells. Cancer Res 2002;62:188 ^ 99. Abl-positive K562 cell line and its differentiation 19. CohenJ, Oren-Young L, Klingmuller U, Neumann D. 27. Deininger MW, Goldman JM, Lydon N, Melo JV.The toward the erythroid lineage. FASEB J 2003;17: Protein tyrosine phosphatase 1B participates in the tyrosine kinase inhibitor CGP57148B selectively inhib- 2160 ^ 2.

www.aacrjournals.org 2031 Clin Cancer Res 2006;12(7) April 1, 2006 Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2006 American Association for Cancer Research. Inhibition of Phosphotyrosine Phosphatase 1B Causes Resistance in BCR-ABL-Positive Leukemia Cells to the ABL Kinase Inhibitor STI571

Noriko Koyama, Steffen Koschmieder, Sandhya Tyagi, et al.

Clin Cancer Res 2006;12:2025-2031.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/12/7/2025

Cited articles This article cites 35 articles, 19 of which you can access for free at: http://clincancerres.aacrjournals.org/content/12/7/2025.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/12/7/2025.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/12/7/2025. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.

Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2006 American Association for Cancer Research.