A Novel P.G112E Mutation in BFSP2 Associated with Autosomal Dominant Pulverulent Cataract with Sutural Opacities

Current Eye Research, 2014; 39(10): 1013–1019 ! Informa Healthcare USA, Inc. ISSN: 0271-3683 print / 1460-2202 online DOI: 10.3109/02713683.2014.891749

ORIGINAL ARTICLE A Novel p.G112E Mutation in BFSP2 Associated with Autosomal Dominant Pulverulent Cataract with Sutural Opacities

Qing Liu, Kai Jie Wang and Si Quan Zhu

Beijing Tongren Eye Center, Beijing Tongren Hospital, Capital Medical University, Beijing Ophthalmology & Visual Sciences Key Lab, Beijing, China

ABSTRACT Purpose: To identify the genetic defect in a Chinese family with bilateral pulverulent sutural cataract. Materials and methods: A three-generation family with congenital cataract was recruited in the study. The study protocol followed the principles of the Declaration of Helsinki. Detailed family history and clinical data were recorded. Genomic DNA was extracted from peripheral blood leukocytes. Candidate gene sequencing was performed to identify the disease-causing mutation. The effects of amino acid changes on the structure and function of proteins were predicted by bioinformatics analysis. Results: All affected individuals presented pulverulent opacities in the embryonal nucleus and sutures. Direct candidate gene sequencing revealed a heterozygous c. 335 G4A variation in the beaded filament structural protein 2(BFSP2) gene, which resulted in the replacement of a highly conserved glycine by glutamic at codon 112 (p. G112E). Haplotype analysis indicated that the affected members shared a common haplotype with markers near BFSP2. This mutation co-segregated with all affected individuals and was not observed in For personal use only. unaffected members or in 120 ethnically matched controls. Bioinformatic analyses confirmed that the mutation altered the hydrophobic and secondary structure of the protein around the substitution site. Conclusions: We report a novel mutation (p.G112E) in the BFSP2 gene, underscoring the physiological importance of the beaded filament protein and supporting its role in human cataract formation. Keywords: BFSP2, congenital cataract, gene, mutation, sutural

INTRODUCTION cataracts.4–8 Among these genes, alpha A-crystallin (CRYAA), bA1-crystallin (CRYBA1), and bB2-crystallin

Curr Eye Res Downloaded from informahealthcare.com by University of Melbourne on 12/18/14 Congenital cataract is one of the main causes of (CRYBB2), major intrinsic protein (MIP), beaded blindness in children worldwide,1 with a prevalence filament structural protein 2(BFSP2) and connexin of 1–6 cases/10 000 live births.2 Cataracts can be 50(CX50) have been reported to be associated with isolated or they can occur in association with various sutural cataracts.2,9–11 Thus, these represent excellent different metabolic diseases and genetic syndromes. candidate genes for the study of hereditary isolated Approximately, half of the cataracts are genetically sutural cataracts or other forms of morphological determined. Autosomal dominant congenital cataract lens changes. (ADCC) is the most common mode of inheritance, In this study, we applied a function candidate although autosomal recessive and X-linked cataracts testing approach to investigate six known cataract have also been reported.3 candidate genes in a Chinese family with pulveru- Until now, at least 18 genes have been identified lent sutural cataracts. A novel G!A mutation to be associated with isolated inherited congenital in BFSP2 that co-segregated with the disease

Received 19 July 2013; revised 16 January 2014; accepted 1 February 2014; published online 21 March 2014 Correspondence: Prof. Si Quan Zhu, Beijing Tongren Eye Center, Beijing Tongren Hospital, Capital Medical University; Beijing Ophthalmology & Visual Sciences Key Laboratory, 1 Dong Jiao Min Xiang, Beijing 100730, China. Tel: +86 10 58269605. Fax: +86 10 85110023. E-mail: [email protected]

1013 1014 Q. Liu et al.

phenotype was identified to be responsible for and 120 ethnically matched controls to confirm the ADCC. mutation.

MATERIALS AND METHODS DNA Genotyping and Haplotype Analysis

Clinical Evaluation and DNA Specimens PCRs were performed with two microsatellite markers close to the BFSP2 gene. PCR products from each A three-generation family with ADCC from Tianjin, DNA sample were separated from a 6% polyacryl- China, was recruited at Beijing Tongren Hospital, amide gel and examined. Pedigree and haplotype the Capital Medical University. Both affected and data were analyzed with Cyrillic software (ver. 2.1; unaffected individuals underwent detailed ophthal- Cherwell, Scientific Ltd, Oxford, UK). The marker mic examinations including visual acuity, slit lamp order and distances between the markers were taken examination, ultrasonography, fundus examination, from the NCBI database. and intraocular pressure measurement. The phenotypes were documented by slit lamp photography. A total of 120 unrelated ethnically matched controls Bioinformatics Analysis with no family history of congenital cataracts were also recruited. They were given complete ophthalmo- The CLC Free Workbench 5.0 software (CLC bio, logic examinations. None of the controls exhibited eye Aarhus, Denmark) was used to align the protein diseases except mild myopia and senile cataracts. sequences from several different species. This study was conducted in accordance with the Hydrophobicity comparison between wild type tenets of the Declaration of Helsinki and approved and mutant type was also analyzed by CLC by the Ethics Committees for Medical Research at the software. Garnier–Osguthorpe–Robson (GOR) soft- Capital Medical University in Beijing, China. With the ware (Promega, Madison, WI) was used to predict consent of all participants, the peripheral venous the effect of the mutation on the secondary structure blood of all participants was collected and genomic of BFSP2. The possible impact of an amino acid DNA was extracted using a QIAamp DNA kit substitution on the structure and function of the (Qiagen, Valencia, CA) in accordance with the manu- protein was predicted by Polyphen-2. facturer’s instructions.

For personal use only. RESULTS Mutation Screening Clinical Findings Mutation screening was performed for the six candidate genes, including CRYAA (GenBankNM_000394), We identified a three-generation Chinese family with CRYBA1 (GenBankNM_005208), CRYBB2 (GenBank clear diagnosis of ADCC (Figure 1). All affected NM_000496), MIP (GenBankNM_012064.3), CX50 individuals in this family presented pulverulent (Genbank NM_005267), and BFSP2 opacities in the embryonal nucleus and sutures (GenBankNM_003571). We amplified each exon and (Figure 2). Nine family members (five affected and intron–exon junction of the genes with previously four unaffected) participated in the study. The pro- 12

Curr Eye Res Downloaded from informahealthcare.com by University of Melbourne on 12/18/14 published primer sequences (Table 1) by polymerase band was a 6-year-old boy (III: 2), who was diagnosed chain reaction (PCR). Each reaction mix (25 ml) con- with bilateral cataract at the age of four (Figure 2A). tained 20 ng of genomic DNA, 1 PCR buffer, 1.5 mM The affected member (III: 1) was 15-year-old and MgCl2, 0.2 mM dNTPs, 0.5 mM each of forward and diagnosed with bilateral cataract at age 2. Another reverse primers and 2.5 U of Taq DNA polymerase affected member (II: 3) had a similar phenotype as (Qiagen, Valencia, CA). A PCR program was per- the proband (Figure 2B). According to the medical formed for DNA amplifying: 95 C for 3 min; followed records, the other affected individuals had been by 35 cycles at 95 C for 30 s, 57–63 C for 30 s diagnosed with bilateral sutural cataracts and had (annealing temperature depending on different pri- cataract extraction performed among 8–15 years old. mers); 72 C for 45 s; and a final extension at 72 C for There was no family history of other ocular or 7 min. The PCR products of the proband and one systemic diseases. unaffected member were sequenced using an ABI3730 Automated Sequencer (PE Biosystems, Foster City, CA). The sequencing results were analyzed using Mutation Analysis Chromas 2.33 and compared with the reference sequence in the NCBI database. Then we screened Direct sequencing of the coding regions of the candi- the BFSP2 mutation in samples of the family members date genes, we identified a novel heterozygous

Current Eye Research A Novel Mutation in BFSP2 Associated with ADCC 1015

TABLE 1 Primer sequences for PCR amplification.

Name Forward (50–30) Reverse (30–50)

CRYAA-1 AGCAGCCTTCTTCATGAGC CAAGACCAGAGTCCATCG CRYAA-2 GGCAGGTGACCGAAGCATC GAAGGCATGGTGCAGGTG CRYAA-3 GCAGCTTCTCTGGCATGG GGGAAGCAAAGGAAGACAGA CRYBA1-1 GGCAGAGGGAGAGCAGAGTG CACTAGGCAGGAGAACTGGG CRYBA1-2 AGTGAGCAGCAGAGCCAGAA GGTCAGTCACTGCCTTATGG CRYBA1-3 AAGCACAGAGTCAGACTGAA CCCCTGTCTGAAGGGACCTG CRYBA1-4 GTACAGCTCTACTGGGATTG ACTGATGATAAATAGCATGAA CRYBA1-5 GAATGATAGCCATAGCACTAG TACCGATACGTATGAAATCTG CRYBA1-6 CATCTCATACCATTGTGTTGAG GCAAGGTCTCATGCTTGAGG CRYBB2-1 GTTTGGGGCCAGAGGGGAGT TGGGCTGGGGAGGGACTTTC CRYBB2-2 CCTTCAGCATCCTTTGGGTTC GCAGTTCTAAAAGCTTCATCA CRYBB2-3 GTAGCCAGGATTCTGCCATAG GTGCCCTCTGGAGCATTTCAT CRYBB2-4 GGCCCCCTCACCCATACTCA CTTCCCTCCTGCCTCAACCTAA CRYBB2-5 CTTACCCTTGGGAAGTGGCAATGG TCAAAGACCCACAGCAGACA MIP-1 GTGAAGGGGTTAAGAGGC GGAGTCAGGGCAATAGAG MIP-2 CGGGGAAGTCTTGAGGAG CACGCAGAAGGAAAGCAG MIP-3 CCACTAAGG TGGCTGGAA CTCATGCCCCAAAACTCA CX50-1 CCGCGTTAGCAAAAACAGAT CCTCCATGCGGACGTAGT CX50-2 GCAGATCATCTTCGTCTCCA GGCCACAGACAACATGAACA CX50-3 CCACGGAGAAAACCATCTTC GAGCGTAGGAAGGCAGTGTC CX50-4 TCGAGGAGAAGATCAGCACA GGCTGCTGGCTTTGCTTAG BFSP2(1a) AATGCACAAACCCAAATGGT AGGCCCTGSSGACACT BFSP2(1a) GAGAGGCGAGTGGTAGTGGA GGCCTCAGCCTACTCACAAC BFSP2(2) TGCAGACAGAGCATTTCCAC GAGGGGTGTGAGCTGGATAA BFSP2(3) GCTGCAATTGCCTTCATTTT GGGTAACCTGACCCAACTTCA BFSP2(4) TCTGTGAAGCCTGTGTCTGG CCCGGCCTCAATTATTCTTT BFSP2(5) ACCCAGGAGGAGGAGGTTGT GGGAATCCCCTGGAAACTAA BFSP2(6) GGGGAATAGTCCAGGCTACC ATGGGTGCCTATGTGAGAGGG BFSP2(7) TTGTTCCAAAGGCCAGATTC CACTCAAGGGAATCCTTCCA For personal use only. Curr Eye Res Downloaded from informahealthcare.com by University of Melbourne on 12/18/14

FIGURE 1 Cataract pedigree and haplotype analysis. Pedigree and haplotype analysis of the cataract family shows the segregation of two microsatellite markers near BFSP2 gene. Squares and circles indicate males and females, respectively. Blackened symbols and bars denote affected status. The arrow indicates the proband.

c. 335 G4A variation in BFSP2 in the affected individ- unaffected family members or in the 120 controls. uals (Figure 3). This mutation caused a substitution We found no other mutations in the family except of glycine to glutamic at codon 112 (p. G112E). for a few non-pathogenic single nucleotide poly- The substitution was not found in any of the morphisms (SNPs).

! 2014 Informa Healthcare USA, Inc. 1016 Q. Liu et al.

FIGURE 2 Slit lamp photograph of the family members. (A) Proband (III: 2); figure shows pulverulent opacities in the embryonal nucleus and sutures of the lens. (B) Member (II: 3); with the same phenotype as the proband. For personal use only.

FIGURE 4 A multiple-sequence alignment in BFSP2 from different species. Alignment data indicates that the Gly at position 112 is highly conserved in different species (indicated by an arrow).

Curr Eye Res Downloaded from informahealthcare.com by University of Melbourne on 12/18/14 Bioinformatics Analysis

The Gly at position 112 of human BFSP2 was located within a phylogenetically conserved region by multiple-sequence alignment (Figure 4). Using FIGURE 3 DNA sequence analysis of an affected member the GOR method, secondary structure prediction (III: 2) and an unaffected member (II: 5). The transversion is indicated that the p. G112E BFSP2 mutation led to observed at position 335(G4A) as a G/A double peak the replacements of three turns ‘‘T’’ with three (indicated by an arrow). The reading frame is indicated by an helix ‘‘H’’ at amino acid 100–112 and a coil ‘‘C’’ underline. with a helix ‘‘H’’ at position 105 (Figure 5). Comparing of hydrophobicity between wild Haplotype Analysis and mutant type revealed that the hydrophobicity of the mutant protein was decreased between Haplotype analysis confirmed that the affected indi- 100 and 120 amino acids (Figure 6). With viduals in the family shared a common haplotype PolyPhen-2 analysis, the score was 0.995 for the with markers D3S2322 and D3S3657 near the BFSP2 p.G112E, indicating that this mutation is probably gene (Figure 1). damaging.

Current Eye Research A Novel Mutation in BFSP2 Associated with ADCC 1017

DISCUSSION

In this study, we identified a novel mutation (p. G112E) in BFSP2 gene in a three-generation Chinese family with ADCC. This variation seemed to be disease causative as it co-segregated with the disease phenotype in all affected individuals and was absent in unaffected family members and 120 control subjects. Intermediate filaments (IFs) are a key component of the cytoskeleton in virtually all vertebrate cells, including those of the eye lens.13–16 The beaded filament structural protein encoded by BFSP2, phaki- nin, and its assembly partner, filensin (BFSP1), are FIGURE 5 The effect of p.G112E on secondary structure of both members of the IF protein family which are BFSP2 using the GOR method. Arrow indicates the position highly and solely expressed in lens fiber cells.17,18 of amino acids. (A) Secondary structure of wild-type BFSP2 round the site G112 (underlined). (B) Secondary structure BFSP2 is a member of the IF family, but demonstrated of mutant p.G112E (underlined) of BFSP2 of the corresponding highly unusual features that have extended the limits region. of the IF family.19 Lens-specific IFs, also known as For personal use only. Curr Eye Res Downloaded from informahealthcare.com by University of Melbourne on 12/18/14

FIGURE 6 Comparison of hydrophobicity between wild type and mutant BFSP2. Hydrophobicity of the mutant type decreased between 100 and 120 amino acids (indicated by an arrow).

! 2014 Informa Healthcare USA, Inc. 1018 Q. Liu et al.

TABLE 2 Summary of identified mutations in BFSP2 gene responsible for congenital cataract.

Mutation Amino acid Phenotype Origin of family Reference

c.696-698del p.E233del Variable cataract America 22 Phenotype, prominent sutures c.696-698del p.E233del Y-sutural, myopia China 24 c.696-698del p.E233del Progressive sutural China 25 c.696-698del p.E233del Progressive sutural China 23 c.859 C4T p.R287W Variable cataract phenotype, but America 21 prominent sutures with lamellar and nuclear c.1091G4A p.R339H Lamellar China 26 c.598_599dup p.Ala201Argfs Recessive, diffuse cortical Saudi Arabia 27 X19 c.335 G4A p.G112E Sutural, pulverulent China Present study

BFSP2 gene mutations that have been identified in this and other studies are shown.

beaded filaments, contribute to this cellular organiza- CONCLUSION tion, and their disruption compromises vision.20 The c.335 G4A substitution in BFSP2 observed in In conclusion, we report a novel p. G112E mutation in the present study results in the replacement of glycine BFSP2 associated with pulverulent sutural cataract of to glutamic at codon 112(p. G112E), localized in the Chinese origin, underscoring the physiological first exon of BFSP2. To our knowledge, this is the first importance of the beaded filament protein and sup- mutation identified in exon one of BFSP2 associated porting a role of BFSP2 in human cataract formation. with congenital cataract. Multiple-sequence align- These data also expand the genetic and phenotypic ments confirmed that Gly112 was highly conserved. heterogeneity of congenital cataracts. Polyphen-2 revealed that the p. G112E mutation in BFSP2 is probably damaging. The secondary structure of the mutant was also changed. CLC software ACKNOWLEDGEMENTS predicted that the substitution in BFSP2 protein would alter hydrophobicity between amino acids The authors thank the family members and all 100 and 120. Thus, all data indicate that the glycine participants for taking part in the study. This work

For personal use only. is likely critical to functionality. Altered regulation of was supported by the High-level Technical Personnel BFSP2, as well as the altered a-crystallin assemblies, Training Program of Beijing Municipal Health System may be the cause of the disease. (2009-3-37); National Natural Science Foundation of Until now, five mutations in BFSP2 have been China (51073096, 81200673, and 51273113), Beijing identified to be associated with congenital cataracts in Natural Science Foundation (2102021) and Specialized 21–27 eight pedigrees (Table 2). Clinical types of cata- Research Fund for the Doctoral Program of Higher racts induced by BFSP2 mutations are variable, but Education (20091107110008). mainly in the sutures of the lens, indicating a good phenotype–genotype pattern in ADCC. The discovery of these cataract-causing mutations in BFSP2 and the DECLARATION OF INTEREST

Curr Eye Res Downloaded from informahealthcare.com by University of Melbourne on 12/18/14 observation that targeted deletion of BFSP2 in the mouse genome resulted in loss of optical properties The authors report no conflicts of interest. The authors indicate that beaded filaments are critical to the 28 alone are responsible for the content and writing of optical properties of the lens. In mice with a the paper. naturally occurring BFSP2 mutation, a slowly emer- ging and progressive loss of optical clarity was noted.29–31 Moreover, the beaded filament was not REFERENCES required to achieve the differentiated phenotype but was required to maintain differentiated state and the 32 1. Gilbert C, Foster A. Childhood blindness in the context of order characteristic of the lens at the tissue level. VISION 2020: the right to sight. Bull World Health Organ This may be the mechanism by which BFSP2 mutation 2001;79:227–232. p. G112E causes loss of structural order in lens. 2. Reddy MA, Francis PJ, Berry V. Molecular genetic basis of All these data suggest that BFSP2 mutations are inherited cataract and associated phenotypes. Surv potentially important genetic modifiers of lens pheno- Ophthalmol 2004;49:300–315. 3. Francis PJ, Berry V, Bhattacharya SS, Moore AT. Genetics of types, and further functional experimentation is childhood cataract. J Med Genet 2000;37:481–488. required to confirm the mechanism of cataract- 4. Litt M, Kramer P, LaMorticella DM, Murphey W, Lovrien causing mutations in BFSP2. EW, Weleber RG. Autosomal dominant congenital cataract

Current Eye Research A Novel Mutation in BFSP2 Associated with ADCC 1019

associated with a missense mutation in the human alpha 20. Song S, Landsbury A, Dahm R, Liu Y, Zhang Q, Quinlan crystallin gene CRYAA. Hum Mol Genet 1998;7:471–474. RA. Functions of the intermediate filament cytoskeleton in 5. Wang J, Ma X, Gu F, Liu NP, Hao XL, Wang KJ, et al. the eye lens. J Clin Invest 2009;19:1837–1848. A missense mutation S228P in the CRYBB1 gene causes 21. Conley YP, Erturk D, Keverline A, Mah TS, Keravala A, autosomal dominant congenital cataract. Chin Med J (Engl) Barnes LR, et al. A juvenile-onset, progressive cataract 2007;120:820–824. locus on chromosome 3q21-q22 is associated with a 6. Steele EC Jr , Kerscher S, Lyon MF, Glenister PH, Favor J, missense mutation in the beaded filament structural Wang J, et al. Identification of a mutation in the protein-2. Am J Hum Genet 2000;66:1426–1431. MP19gene, Lim2 in the cataractous mouse mutant To3. 22. Jakobs PM, Hess JF, FitzGerald PG, Kramer P, Weleber RG, Mol Vis 1997;3:5;20–25. Litt M. utosomal-dominant congenital cataract associated 7. Pras E, Levy-Nissenbaum E, Bakhan T, Lahat H, Assia E, with a deletion mutation in the human beaded filament Geffen-Carmi N, et al. A missense mutation in the LIM2 protein gene BFSP2. Am J Hum Genet 2000;66:1432–1436. gene is associated with autosomal recessive presenile 23. Cui X, Gao L, Jin Y, Zhang Y, Bai J, Feng G, et al. The cataract in an inbred Iraqi Jewish family. Am J Hum E233del mutation in BFSP2 causes a progressive autosomal Genet 2002;70:1363–1367. dominant congenital cataract in a Chinese family. Mol Vis 8. Ramachandran RD, Perumalsamy V, Hejtmancik JF. 2007;13:2023–2029. Autosomal recessive juvenile onset cataract associated 24. Zhang Q, Guo X, Xiao X, Yi J, Jia X, Hejtmancik JF. Clinical with mutation in BFSP1. Hum Genet 2007;121:475–482. description and genome wide linkage study of Y-sutural 9. Hejtmancik JF. Congenital cataracts and their molecular cataract and myopia in a Chinese family. Mol Vis 2004;10: genetics. Semin Cell Dev Biol 2008;19:134–149. 890–900. 10. Su D, Guo Y, Li Q, Guan L, Zhu S, Ma X. A novel mutation 25. Zhang L, Gao L, Li Z, Qin W, Gao W, Cui X, et al. in CRYAA is associated with autosomal dominant suture Progressive sutural cataract associated with a BFSP2 cataracts in a Chinese family. Mol Vis 2012;18:3057–3063. mutation in a Chinese family. Mol Vis 2006;2:1626–1631. 11. Vanita V, Hennies HC, Singh D, Nurnberg P, Sperling K, ¨ 26. Ma X, Li FF, Wang SZ, Gao C, Zhang M, Zhu SQ. A new Singh JR. A novel mutation in GJA8 associated with mutation in BFSP2 (G1091A) causes autosomal dominant autosomal dominant congenital cataract in a family of congenital lamellar cataracts. Mol Vis 2008;14:1906–1911. Indian origin. Mol Vis 2006;12:1217–1222. 27. Aldahmesh MA, Khan AO, Mohamed J, Alkuraya FS. 12. Wang KJ, Li SS, Yun B, Ma WX, Jiang TG, Zhu SQ. A novel Novel recessive BFSP2 and PITX3 mutations: insights into mutation in MIP associated with congenital nuclear cata- mutational mechanisms from consanguineous popula- ract in a Chinese family. Mol Vis 2011;17:70–77. tions. Genet Med 2011;13:978–981. 13. FitzGerald PG, Casselman JC. Immunologic conservation 28. Sandilands A, Prescott AR, Wegener A, Zoltoski RK, of the fiber cell beaded filament. Curr Eye Res 1991;10: Hutcheson AM, Masaki S, et al. Knockout of the 471–478. 14. Gounari F, Merdes A, Quinlan R, Hess J, FitzGerald P, intermediate filament protein CP49 destabilises the lens Ouzounis CA, et al. Bovine filensin possesses primary and fibre cell cytoskeleton and decreases lens optical secondary structure similarity to intermediate filament quality, but does not induce cataract. Exp Eye Res 2003; proteins. J Cell Biol 1993;121:847–854. 76:385–391. 15. Hess J, Cassleman J, FitzGerald P. cDNA analysis of the 29. Sandilands A, Wang X, Hutcheson AM, James J, Prescott For personal use only. 49-kDa lens fiber cell cytoskeletal protein: a new, lens AR, Wegener A, et al. Bfsp2 mutation found in mouse 129 specific member of the intermediate filament family. strains causes the loss of CP49 and induces vimentin- Curr Eye Res 1993;12:77–88. dependent changes in the lens fibre cell cytoskeleton. 16. Hess JF, Casselman JT, FitzGerald PG. Chromosomal Exp Eye Res 2004;78:109–123. locations of the genes for the beaded filament 30. Alizadeh A, Clark J, Seeberger T, Hess J, Blankenship T, proteinsCP115 and CP47. Curr Eye Res 1995;14:11–18. Fitz Gerald PG. Characterization of a mutation in the lens- 17. Perng MD, Zhang Q, Quinlan RA. Insights into the beaded specific CP49 in the 129 strain of mouse. Invest filament of the eye lens. Exp Cell Res 2007;313:2180–2188. Ophthalmol Vis Sci 2004;45:884–891. 18. Mu¨ ller M, Bhattacharya SS, Moore T, Prescott Q, Wedig T, 31. Simirskii VN, Lee RS, Wawrousek EF, Duncan MK. Inbred Herrmann H, et al. Dominant cataract formation in FVB/N mice are mutant at the cp49/Bfsp2 locus and lack association with a vimentin assembly disrupting mutation. beaded filament proteins in the lens. Invest Ophthalmol Hum Mol Genet 2009;18:1052–1057. Vis Sci 2006;47:4931–4934. Curr Eye Res Downloaded from informahealthcare.com by University of Melbourne on 12/18/14 19. Hess JF, Casselman JT, FitzGerald PG. Gene structure and 32. Yoon KH, Blankenship T, Shibata B, Fitzgerald PG. cDNA sequence identify the beaded filament protein CP49 Resisting the effects of aging: a function for the fiber cell as a highly divergent type I intermediate filament protein. beaded filament. Invest Ophthalmol Vis Sci 2008;49: J Biol Chem 1996;271:6729–6735. 1030–1036.

! 2014 Informa Healthcare USA, Inc.