DOCSLIB.ORG

PHYLOGENY and SYSTEMATICS of GROUND ROLLERS &Lpar

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PHYLOGENY and SYSTEMATICS of GROUND ROLLERS &Lpar The Auk 118(4):849-863, 2001 PHYLOGENY AND SYSTEMATICS OF GROUND ROLLERS (BRACHYPTERACIIDAE) OF MADAGASCAR JEREMYJ. KIRCHMAN,L3 SHANNON J. HACKETT,• STEVENM. GOODMAN,L2 AND JOHN M. BATES• tFieldMuseum of Natural History, 1400 South Lake Shore Drive, Chicago, Illinois 60605, LISA; and 2WorldWide Fund for Nature,Boite Postale 738, Antananarivo (101), Madagascar ABSTRACT.--Westudied relationshipsof five extant membersof the endemicMalagasy family Brachypteraciidae,the ground rollers, using severalmitochondrial genes (cyto- chrome-b,NADH dehydrogenase2, 12Sribosomal RNA, and cytochromeoxidase I). As out- groups,we usedother coraciiforms including the CuckooRoller (FamilyLeptosomatidae, Leptosomusdiscolor), several true rollers (Corcaciidae) and a tody(Todidae). Partial sequences of the Long-tailedGround Roller (LIratel0rnis chimaera) were obtained from toe pad samples taken off museumspecimens. For a combineddata set of all genes,Kimura two-parameter distancesbetween sequences of the five groundroller species were high, averaging 11% di- vergence.For several species, samples were available from widely separatedgeographic re- gionsand intraspecificsequence divergence was low (-<0.8%).Unweighted and weighted parsimonyand maximum-likelihood analyses consistently recovered monophyly of thefam- ily, a sisterrelationship between Brachypteraciidae and Coraciidae,and monophylyof one of three currentlyrecognized ground roller genera(Atelornis). At the baseof the Brachyp- teraciidaeclade, we couldnot fully resolverelationships between Uratelornis and two species currentlyplaced in Brachypteracias.Because of the uncertaintyof basalnodes in our phylo- geneticreconstructions, we recommendreturning B. squamigerato themonotypic genus Geo- biastes.High levelsof divergenceamong ground rollers are similar to levelsfound in other aviangroups endemic to Madagascar.However, we suggestthat moleculardivergences ap- pearfar too low to be consistentwith mid-Eocenefossils attributed to the family.Received 3 August2000, accepted28 February2001. MADAGASCAR LONG HAS commanded atten- phylogeneticanalyses are necessaryto better tion of biologistswith its high level of ende- understandfactors that have shapedMadagas- micity and large number of animal groupsre- car'sextraordinary endemicity. puted to be examplesof adaptiveradiations. In recentyears, there has been a dramaticin- The island last was connected to Africa -160 creasein number of field researchersconducting Mya and to India -90 Mya (Krauseet al. 1997) ecologicalstudies on Malagasybirds, particular- resultingin a long period of isolationthat al- ly the endemicradiations. Reconstructing phy- most certainlybegan prior to the evolutionof logeniesand testingmonophyly of suchgroups the vast majority of extant bird groups (Fed- is criticalto understandingtheir evolutionary his- uccia 1999). Thus, it is assumedthat ancestors tory.An exampleis the groundrollers (Brachyp- of the modern Malagasy avifaunaarrived on teraciidae),which have been the subjectof several the islandby dispersal.Given that their affini- ecologicalstudies (Appert 1968, Turner 1984, ties are believedto be primarily African (Mo- Rakotoarisoa 1998, 1999; Razafimahaimodison reau 1966, Dorst 1972, Keith 1980), dispersal 1995, Thorstrom and Lind 1999). This family acrossthe 400-550 km passageof the Mozam- long hasbeen allied to the African "true" roll- biqueChannel between Africa andMadagascar ers (Coraciidae),but little is known regarding is the most likely explanationfor the island's their phylogeny. colonization.Phylogenetic work on Malagasy Ground rollers currently are recognizedas a bird groups(Prum 1993,Houde et al. 1997,Ci- family (Brachypteraciidae,Order Coraciifor- bois et al. 1999, Fjeldsaet al. 1999,Johnson et mes) endemicto Madagascarwith five extant al. 2000) hasbegun to producea clearerpicture speciesplaced in three genera(Wetmore 1960, of the island's avifaunal history, but further Sibleyand Monroe1990). All speciesare forest- dwelling with four forms (Atelorniscrossleyi, A. 3 E-mail: [email protected] pittoides,Brachypteracias leptosomus, and B. squa- 849 850 KIRCHMANET AL. [Auk, Vol. 118 rnigera)occurring in humid forestsdominating is the sister of that clade. Although Cracraft's eastand centralhighlands, and the fifth species study primarily was concernedwith interfa- (Llratelornischirnaera) in the spiny bush of the milial relationships,he did include a hypothe- dry southwest(Langrand 1990). Both Brodkorb sis of phylogeny and "adaptive pathways" (1971) and Olson (1985) noted that there is no within the ground roller lineage.He proposed known fossil history of ground rollers. How- that Atelornis"is probablymore advancedfrom ever, well-preservedmaterial from the Eocene the primitive ground roller condition" exem- MesselFormation of Germanywas saidby Mar- plified by Brachypteracias,and that "Uratelornis tin (1983) and Feduccia (1999) to contain an ex- is unmistakedlycloser to Atelornisthan to Bra- ample of the Brachypteraciidae.Feduccia also chypteracias"(Cracraft 1971:748). Although described Eocene material from the North Cracraft did not examine characters in a cla- American Green River formation as reminis- distic framework, his work is the only modern cent of ground rollers. More recently,subfossil study to examinerelationships within the fam- material of the family has been recoveredfrom ily. Cracraft'sconclusions formed the founda- Holocene depositson Madagascar(Goodman tion of higher level relationshipsamong roller 2001). families in Maurer and Raikow's (1981) exam- Ground rollers first were considered a dis- ination of hindlimb myology within Coraci- tinct family (At61ornithin6s)by Chenu and des iformes and in Sibley and Ahlquist's (1990) Murs (1852),who placedthem at the beginning DNA-DNA hybridizationwork, both of which of the suboscinepasserines on the basisof tar- lacked a representativeof ground rollers. The sal and foot characters. The name "Atelornithi- dearth of comparative material in museums, dae," therefore, has priority over the name particularly skeletonsand tissues,has ham- "BrachypteraciidaeBonaparte, 1854." Howev- pered, until recently, further phylogenetic er, the latter name has been widely used in or- investigation. nithologicalliterature, and for the sakeof sta- The primary goal of our study was to use bility we follow Bock's(1994) recommendation DNA sequencedata from newly availabletissue that it be maintained. Ground rollers are now samples and recently developed "antique" universallyplaced in the Coraciiformesand are DNA protocolsto estimaterelationships of ex- consideredby someauthorities to be a subfam- tant groundrollers and their roller allies.In ad- ily of the Coraciidae (e.g. Peters 1945). Al- dition, we characterizepatterns of evolutionin though ground rollers differ markedly from four mitochondrialgenes increasingly used to coraciidsin their behavior,plumage, and post- reconstructphylogeny and discussrates of mo- cranial skeleton,the two groups are very sim- lecular evolutionby comparingour data to the ilar in their cranial osteology(Cracraft 1971) fossil record of rollers. Finally, we present a and in elements of the feeding apparatus classificationof extant ground rollers. (Burton 1984). Early classificationsof the family differed METHODS primarily with respectto the treatment of Bra- Taxaexamined.--We compared mtDNA sequences chypteraciassquamigera, which also was placed from the following coraciiformspecies (number of in Atelornis (Chenu and des Murs 1852, Hart- individuals in parentheses):ground rollersAtelornis laub 1861) and in the monotypic genus Geo- pittoides(5), A. crossleyi(3), Brachypteraciasleptosornus biastes(Sharpe 1871, Hartlaub 1877). However, (2), B. squarnigera(1), Uratelornischirnaera (2); the taxonomy within the family has been stable CuckooRoller (Family Leptosomatidae),Le?tosomus since the last extant form, Uratelornis chimaera, discolor(1); the true rollers (Family Coraciidae)Eu- was described in 1895. rystornusorientalis (1), E. glaucurus(1), Coraciasgar- Cracraft (1971) examined cranial and post- rulus (1); and the JamaicanTody (Family Todidae), cranial skeletal anatomy in the families Cora- Todustodus (1). In this paper,we use the term "roll- ers" to refer to all membersof the Brachypteraciidae, ciidae (true rollers), Leptosomatidae(Cuckoo Coraciidae,and Leptosomatidaecollectively. For all Roller [Leptosomusdiscolor]), and in three spe- taxa exceptUratelornis chirnaera, tissue samples were ciesof ground rollers (both speciesof Atelornis preservedin salt-DMSObuffer (Seutinet al. 1991)or and Brachypteraciasleptosomus). He concluded in liquid nitrogen at the time of specimenprepara- that the Coraciidaeis the sistertaxon of ground tion and later stored in the collectionof geneticre- rollers and that the monotypicLeptosomatidae sources of the Bird Division, Field Museum of Nat- October2001] GroundRoller Phylogeny 857[ TABLE1. Primers used in PCR amplificationand sequencingof four mitochondrialgenes. H and L refer to primerslocated on the heavy and light strandsof the mitochondrialgenome, respectively, and numbers refer to the 3' baseof the primer referencedto the completemtDNA sequenceof the chicken(Gallus gallus; Desjardinsand Morais 1990). Cyt b 5' -• 3' sequence Reference L-14990 CCATCCAACATCTCAGCATGATGAAA Modified from Kocher et al. 1989 L-15656 AACCTACTAGGAGACCCAGA Helm-Bychowskiand Cracraft 1993 L-15920 ACATGAGTCGGAAGCCAACC Helm-Bychowski and Cracraft 1993 L-15311 CTACCATGAGGACAAATATC Helm-Bychowskiand Cracraft 1993 H-15424 GGAGGAAGTGCAGGGCGAAGAATCG Hackett
Load more

Recommended publications
  • MADAGASCAR: the Wonders of the “8Th Continent” a Tropical Birding Custom Trip
    MADAGASCAR: The Wonders of the “8th Continent” A Tropical Birding Custom Trip October 20—November 6, 2016 Guide: Ken Behrens All photos taken during this trip by Ken Behrens Annotated bird list by Jerry Connolly TOUR SUMMARY Madagascar has long been a core destination for Tropical Birding, and with the opening of a satellite office in the country several years ago, we further solidified our expertise in the “Eighth Continent.” This custom trip followed an itinerary similar to that of our main set-departure tour. Although this trip had a definite bird bias, it was really a general natural history tour. We took our time in observing and photographing whatever we could find, from lemurs to chameleons to bizarre invertebrates. Madagascar is rich in wonderful birds, and we enjoyed these to the fullest. But its mammals, reptiles, amphibians, and insects are just as wondrous and accessible, and a trip that ignored them would be sorely missing out. We also took time to enjoy the cultural riches of Madagascar, the small villages full of smiling children, the zebu carts which seem straight out of the Middle Ages, and the ingeniously engineered rice paddies. If you want to come to Madagascar and see it all… come with Tropical Birding! Madagascar is well known to pose some logistical challenges, especially in the form of the national airline Air Madagascar, but we enjoyed perfectly smooth sailing on this tour. We stayed in the most comfortable hotels available at each stop on the itinerary, including some that have just recently opened, and savored some remarkably good food, which many people rank as the best Madagascar Custom Tour October 20-November 6, 2016 they have ever had on any birding tour.
    [Show full text]
  • Dominican Republic Endemics of Hispaniola II 1St February to 9Th February 2021 (9 Days)
    Dominican Republic Endemics of Hispaniola II 1st February to 9th February 2021 (9 days) Palmchat by Adam Riley Although the Dominican Republic is perhaps best known for its luxurious beaches, outstanding food and vibrant culture, this island has much to offer both the avid birder and general naturalist alike. Because of the amazing biodiversity sustained on the island, Hispaniola ranks highest in the world as a priority for bird protection! This 8-day birding tour provides the perfect opportunity to encounter nearly all of the island’s 32 endemic bird species, plus other Greater Antillean specialities. We accomplish this by thoroughly exploring the island’s variety of habitats, from the evergreen and Pine forests of the Sierra de Bahoruco to the dry forests of the coast. Furthermore, our accommodation ranges from remote cabins deep in the forest to well-appointed hotels on the beach, each with its own unique local flair. Join us for this delightful tour to the most diverse island in the Caribbean! RBL Dominican Republic Itinerary 2 THE TOUR AT A GLANCE… THE ITINERARY Day 1 Arrival in Santo Domingo Day 2 Santo Domingo Botanical Gardens to Sabana del Mar (Paraiso Caño Hondo) Day 3 Paraiso Caño Hondo to Santo Domingo Day 4 Salinas de Bani to Pedernales Day 5 Cabo Rojo & Southern Sierra de Bahoruco Day 6 Cachote to Villa Barrancoli Day 7 Northern Sierra de Bahoruco Day 8 La Placa, Laguna Rincon to Santo Domingo Day 9 International Departures TOUR ROUTE MAP… RBL Dominican Republic Itinerary 3 THE TOUR IN DETAIL… Day 1: Arrival in Santo Domingo.
    [Show full text]
  • Bird Checklist Guánica Biosphere Reserve Puerto Rico
    United States Department of Agriculture BirD CheCklist Guánica Biosphere reserve Puerto rico Wayne J. Arendt, John Faaborg, Miguel Canals, and Jerry Bauer Forest Service Research & Development Southern Research Station Research Note SRS-23 The Authors: Wayne J. Arendt, International Institute of Tropical Forestry, U.S. Department of Agriculture Forest Service, Sabana Field Research Station, HC 2 Box 6205, Luquillo, PR 00773, USA; John Faaborg, Division of Biological Sciences, University of Missouri, Columbia, MO 65211-7400, USA; Miguel Canals, DRNA—Bosque de Guánica, P.O. Box 1185, Guánica, PR 00653-1185, USA; and Jerry Bauer, International Institute of Tropical Forestry, U.S. Department of Agriculture Forest Service, Río Piedras, PR 00926, USA. Cover Photos Large cover photograph by Jerry Bauer; small cover photographs by Mike Morel. Product Disclaimer The use of trade or firm names in this publication is for reader information and does not imply endorsement by the U.S. Department of Agriculture of any product or service. April 2015 Southern Research Station 200 W.T. Weaver Blvd. Asheville, NC 28804 www.srs.fs.usda.gov BirD CheCklist Guánica Biosphere reserve Puerto rico Wayne J. Arendt, John Faaborg, Miguel Canals, and Jerry Bauer ABSTRACt This research note compiles 43 years of research and monitoring data to produce the first comprehensive checklist of the dry forest avian community found within the Guánica Biosphere Reserve. We provide an overview of the reserve along with sighting locales, a list of 185 birds with their resident status and abundance, and a list of the available bird habitats. Photographs of habitats and some of the bird species are included.
    [Show full text]
  • Madagascar Highlights II 17Th October to 31St October 2021 (15 Days)
    Madagascar Highlights II 17th October to 31st October 2021 (15 days) Scaly Ground Roller by Jonathan Rossouw Madagascar is often referred to as the ‘Eighth Continent’ and its exceptional fauna and flora have evolved over millions of years of isolation. This legendary uniqueness is nowhere better reflected than in its birds, and the island hosts no less than five endemic families (the ground rollers, cuckoo roller, mesites, Malagasy warblers and vangas)! But the wonder of Madagascar extends well beyond its avifauna and we do not neglect the amazing lemurs, colourful chameleons and fascinating flora of this appropriately named “laboratory of evolution.” For our Madagascar Highlights tour we have cherry-picked the best of Madagascar and offered it in a shorter package, and as a result, this expedition provides a more relaxed pace and less demanding Madagascar experience than our Comprehensive tours. We target all five endemic Malagasy bird families as well as good numbers of lemurs and other representative wildlife, making this ideal for travellers with limited time or less interest in targeting every single endemic bird. RBL Madagascar - Highlights Itinerary 2 THE TOUR AT A GLANCE… THE ITINERARY Day 1 Arrival in Antananarivo Day 2 Antananarivo to Perinet Days 3 to 6 Perinet Special Reserve and Mantadia National Park Day 7 Perinet to Antananarivo Day 8 Antananarivo to Ifaty via Tulear Day 9 Ifaty Day 10 Ifaty to Tulear Day 11 San Augustin and Nosy Ve Day 12 Tulear to Berenty via Fort Dauphin Day 13 Berenty Lemur Reserve Day 14 Berenty Lemur Reserve to Fort Dauphin and Tana Day 15 Tana and departure TOUR ROUTE MAP… RBL Madagascar - Highlights Itinerary 3 THE TOUR IN DETAIL… Day 1: Arrival in Antananarivo.
    [Show full text]
  • Altriciality and the Evolution of Toe Orientation in Birds
    Evol Biol DOI 10.1007/s11692-015-9334-7 SYNTHESIS PAPER Altriciality and the Evolution of Toe Orientation in Birds 1 1 1 Joa˜o Francisco Botelho • Daniel Smith-Paredes • Alexander O. Vargas Received: 3 November 2014 / Accepted: 18 June 2015 Ó Springer Science+Business Media New York 2015 Abstract Specialized morphologies of bird feet have trees, to swim under and above the water surface, to hunt and evolved several times independently as different groups have fish, and to walk in the mud and over aquatic vegetation, become zygodactyl, semi-zygodactyl, heterodactyl, pam- among other abilities. Toe orientations in the foot can be prodactyl or syndactyl. Birds have also convergently described in six main types: Anisodactyl feet have digit II evolved similar modes of development, in a spectrum that (dII), digit III (dIII) and digit IV (dIV) pointing forward and goes from precocial to altricial. Using the new context pro- digit I (dI) pointing backward. From the basal anisodactyl vided by recent molecular phylogenies, we compared the condition four feet types have arisen by modifications in the evolution of foot morphology and modes of development orientation of digits. Zygodactyl feet have dI and dIV ori- among extant avian families. Variations in the arrangement ented backward and dII and dIII oriented forward, a condi- of toes with respect to the anisodactyl ancestral condition tion similar to heterodactyl feet, which have dI and dII have occurred only in altricial groups. Those groups repre- oriented backward and dIII and dIV oriented forward. Semi- sent four independent events of super-altriciality and many zygodactyl birds can assume a facultative zygodactyl or independent transformations of toe arrangements (at least almost zygodactyl orientation.
    [Show full text]
  • Cfreptiles & Amphibians
    HTTPS://JOURNALS.KU.EDU/REPTILESANDAMPHIBIANSTABLE OF CONTENTS IRCF REPTILES & AMPHIBIANSREPTILES • VOL &15, AMPHIBIANS NO 4 • DEC 2008 • 28(1):157–158189 • APR 2021 IRCF REPTILES & AMPHIBIANS CONSERVATION AND NATURAL HISTORY TABLE OF CONTENTS FEATUREPredation ARTICLES on a Common Wolfsnake, . Chasing Bullsnakes (Pituophis catenifer sayi) in Wisconsin: LycodonOn the Road to aulicusUnderstanding the Ecology (Colubridae),and Conservation of the Midwest’s Giant Serpent ...................... by anJoshua M. KapferIndian 190 . The Shared History of Treeboas (Corallus grenadensis) and Humans on Grenada: Roller,A Hypothetical Coracias Excursion ............................................................................................................................ benghalensis (Coraciidae),Robert W. Henderson 198 RESEARCH ARTICLES in. The the Texas Horned Sathyamangalam Lizard in Central and Western Texas ....................... Emily Henry, JasonTiger Brewer, Krista Mougey, Reserve, and Gad Perry 204 . The Knight Anole (Anolis equestris) in Florida .............................................TamilBrian J. Camposano, Kenneth Nadu, L. Krysko, Kevin M. Enge,India Ellen M. Donlan, and Michael Granatosky 212 CONSERVATION ALERT . World’s Mammals in Crisis ...............................................................................................................................Sreedharan Nair Vishnu and Chinnasamy Ramesh .............................. 220 . More Than Mammals .....................................................................................................................................................................
    [Show full text]
  • Coracias Garrulus
    Coracias garrulus -- Linnaeus, 1758 ANIMALIA -- CHORDATA -- AVES -- CORACIIFORMES -- CORACIIDAE Common names: European Roller; Roller; Rollier d'Europe European Red List Assessment European Red List Status LC -- Least Concern, (IUCN version 3.1) Assessment Information Year published: 2015 Date assessed: 2015-03-31 Assessor(s): BirdLife International Reviewer(s): Symes, A. Compiler(s): Ashpole, J., Burfield, I., Ieronymidou, C., Pople, R., Wheatley, H. & Wright, L. Assessment Rationale European regional assessment: Least Concern (LC) EU27 regional assessment: Least Concern (LC) In Europe this species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence 10% in ten years or three generations, or with a specified population structure). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (30% decline over ten years or three generations). For these reasons the species is evaluated as Least Concern in Europe. Within the EU27 this species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence 10% in ten years or three generations, or with a specified population structure). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population
    [Show full text]
  • Onetouch 4.0 Scanned Documents
    / Chapter 2 THE FOSSIL RECORD OF BIRDS Storrs L. Olson Department of Vertebrate Zoology National Museum of Natural History Smithsonian Institution Washington, DC. I. Introduction 80 II. Archaeopteryx 85 III. Early Cretaceous Birds 87 IV. Hesperornithiformes 89 V. Ichthyornithiformes 91 VI. Other Mesozojc Birds 92 VII. Paleognathous Birds 96 A. The Problem of the Origins of Paleognathous Birds 96 B. The Fossil Record of Paleognathous Birds 104 VIII. The "Basal" Land Bird Assemblage 107 A. Opisthocomidae 109 B. Musophagidae 109 C. Cuculidae HO D. Falconidae HI E. Sagittariidae 112 F. Accipitridae 112 G. Pandionidae 114 H. Galliformes 114 1. Family Incertae Sedis Turnicidae 119 J. Columbiformes 119 K. Psittaciforines 120 L. Family Incertae Sedis Zygodactylidae 121 IX. The "Higher" Land Bird Assemblage 122 A. Coliiformes 124 B. Coraciiformes (Including Trogonidae and Galbulae) 124 C. Strigiformes 129 D. Caprimulgiformes 132 E. Apodiformes 134 F. Family Incertae Sedis Trochilidae 135 G. Order Incertae Sedis Bucerotiformes (Including Upupae) 136 H. Piciformes 138 I. Passeriformes 139 X. The Water Bird Assemblage 141 A. Gruiformes 142 B. Family Incertae Sedis Ardeidae 165 79 Avian Biology, Vol. Vlll ISBN 0-12-249408-3 80 STORES L. OLSON C. Family Incertae Sedis Podicipedidae 168 D. Charadriiformes 169 E. Anseriformes 186 F. Ciconiiformes 188 G. Pelecaniformes 192 H. Procellariiformes 208 I. Gaviiformes 212 J. Sphenisciformes 217 XI. Conclusion 217 References 218 I. Introduction Avian paleontology has long been a poor stepsister to its mammalian counterpart, a fact that may be attributed in some measure to an insufRcien- cy of qualified workers and to the absence in birds of heterodont teeth, on which the greater proportion of the fossil record of mammals is founded.
    [Show full text]
  • DNA Barcoding of the White-Collared Kingfisher Todiramphus Chloris (Boddaert 1783) (Alcedinidae) Using the Mitochondrial Cytochrome C Oxidase Subunit I Gene
    SHORT COMMUNICATION DNA barcoding of the White-Collared Kingfisher Todiramphus chloris (Boddaert 1783) (Alcedinidae) using the mitochondrial cytochrome c oxidase subunit I gene Adrian U. Luczon*, Abdel Hadi M. Mohammad Isa, Jonas P. Quilang, Perry S. Ong, Ian Kendrich C. Fontanilla DNA Barcoding Laboratory, Institute of Biology, University of the Philippines, Diliman 1101, Quezon City, Philippines he White-Collared Kingfisher (Todiramphus KEY WORDS: chloris) is a resident Philippine bird species. In accordance with the objective of the All Birds molecular phylogeny, White-collared Kingfisher, Alcedinidae, Barcoding Initiative (ABBI) to barcode all bird cytochrome c oxidase subunit I (COI), DNA barcoding species in the world, this study reports the first Tbarcodes of T. chloris using the mitochondrial gene cytochrome INTRODUCTION c oxidase subunit I (COI). COI sequences from this species as well as from other members of the family Alcedinidae available The White-Collared Kingfisher, Todiramphus chloris in Genbank and the Barcodes of Life Data (BoLD) Systems (Boddaert 1783), is a medium-sized kingfisher belonging to the were compared in order to test for the utility of COI to delineate family Alcedinidae, subfamily Daceloninae, sometimes under species. Monophyly of the species was established, supporting the alternative family Halcyonidae (Moyle 2006, Christidis and the use of barcodes for species discovery. Sequences between T. Boles 2008). The genus Todiramphus is composed of 22 species chloris and T. sanctus, however, revealed a close association (Dickinson 2003). Todiramphus was for a time placed under between the two species which warrants further taxonomic Halcyon, with T. chloris previously named as H. chloris in light review. of DNA hybridization experiments (Sibley and Monroe 1990) but was then ‘unlumped’ when it became clear that Halcyon was polyphyletic and is most likely composed of at least two *Corresponding author lineages, an Afro-Asian Halcyon and Australasian Todiramphus Email Address: [email protected] (Schodde and Mason 1997, Woodall 2001).
    [Show full text]
  • The Dazzling Diversity of Avian Feet I I Text Lisa Nupen Anisodactyl
    BIOLOGY insight into the birds’ different modes of life. THE BONES IN THE TOES Birds’ feet are not only used for n almost all birds, the number of bones locomotion (walking or running, Iin each toe is preserved: there are two swimming, climbing), but they bones in the first toe (digit I), three bones serve other important functions in in the second toe (II), four in the third (III) perching, foraging, preening, re- and five in the fourth (IV). Therefore, the production and thermoregulation. identity of a toe (I to IV) can be determined Because of this, the structure of a quite reliably from the number of bones in bird’s foot often provides insight it. When evolutionary toe-loss occurs, this into the species’ ecology. Often, makes it possible to identify which digit distantly related species have con- has been lost. verged on similar foot types when adapting to particular environ- ments. For example, the four fully demands of a particular niche or The first, and seemingly ances- webbed, forward-pointing toes environment. The arrangement tral, configuration of birds’ toes – called totipalmate – of pelicans, of toes in lovebirds, barbets and – called anisodactyly – has three gannets and cormorants are an ad- cuckoos, for example, is differ- digits (numbered II, III and IV) aptation to their marine habitat. ent from that in passerines (such orientated forwards and digit I The closely related Shoebill as finches, shrikes or starlings) in (the ‘big toe’, or hallux) pointing does not have webbed feet, per- the same environment. The func- backwards. This arrangement is haps because of its wetland habi- tional reasons for differences in shared with theropod fossils and The toes of penguins tat, but the tropicbirds, which foot structure can be difficult to is the most common, being found (below left) and gan- fancy form their own relatively ancient explain.
    [Show full text]
  • Mousebirds Tle Focus Has Been Placed Upon Them
    at all, in private aviculture, and only a few zoos have them in their col1ec­ tions. According to the ISIS report of September 1998, Red-hacks are not to be found in any USA collections. This is unfortunate as all six species have been imported in the past although lit­ Mousebirds tle focus has been placed upon them. Hopeful1y this will change in the for the New Millennium upcoming years. Speckled Mousebirds by Kateri J. Davis, Sacramento, CA Speckled Mousebirds Colius striatus, also known as Bar-breasted or Striated, are the most common mousebirds in crops and frequent village gardens. USA private and zoological aviculture he word is slowly spreading; They are considered a pest bird by today. There are 17 subspecies, differ­ mousebirds make great many Africans and destroyed as such. ing mainly in color of the legs, eyes, T aviary birds and, surprising­ Luckily, so far none of the mousebird throat, and cheek patches or ear ly, great household pets. Although still species are endangered or listed on coverts. They have reddish brown body generally unknown, they are the up­ CITES even though some of them have plumage with dark barrings and a very and-coming pet bird of the new mil­ naturally small ranges. wide, long, stiff tail. Their feathering is lennium. They share many ofthe qual­ Mousebirds are not closely related to soft and easily damaged. They have a ities ofsmall pet parrots, but lack many any other bird species, although they soft chattering cal1 and are the most of their vices, which helps explain share traits with parrots.
    [Show full text]
  • Visual Fields in Hornbills: Precision-Grasping and Sunshades
    Ibis (2004), 146, 18–26 Blackwell Publishing Ltd. Visual fields in hornbills: precision-grasping and sunshades GRAHAM R. MARTIN1* & HENDRI C. COETZEE2 1School of Biosciences, The University of Birmingham, Edgbaston, Birmingham B15 2TT, UK 2Ground Hornbill Research and Conservation Project, Private Bag X1644, Warmbaths, 0480, Republic of South Africa Retinal visual fields were determined in Southern Ground Hornbills Bucorvus leadbeateri and Southern Yellow-billed Hornbills Tockus leucomelas (Coraciiformes, Bucerotidae) using an ophthalmoscopic reflex technique. In both species the binocular field is relatively long and narrow with a maximum width of 30° occurring 40° above the bill. The bill tip projects into the lower half of the binocular field. This frontal visual field topography exhibits a number of key features that are also found in other terrestrial birds. This supports the hypothesis that avian visual fields are of three principal types that are correlated with the degree to which vision is employed when taking food items, rather than with phylogeny. However, unlike other species studied to date, in both hornbill species the bill intrudes into the binocular field. This intrusion of the bill restricts the width of the binocular field but allows the birds to view their own bill tips. It is suggested that this is associated with the precision-grasping feeding technique of hornbills. This involves forceps-like grasping and manipulation of items in the tips of the large decurved bill. The two hornbill species differ in the extent of the blind area perpendicularly above the head. Interspecific comparison shows that eye size and the width of the blind area above the head are significantly cor- related.
    [Show full text]