WILLIAMS COLLEGE LIBRARIES
COPYRIGHT ASSIGNMENT AND INSTRUCTIO S FOR A STUDENT THESIS
Your unpublished thesis, submitted for a degree at Williams College and administered by the Williams College Libraries, will be made available for research use. You may, through this form, provide instructions regarding copyright, access, dissemination and reproduction ofyour thesis. The College has the right in all cases to maintain and preserve theses both in hardcopy and electronic format, and to make such copies as the Libraries require for their research and archival functions.
~ The faculty advisor/s to the student writing the thesis claims joint authorship in this work.
_ I1we have included in this thesis copyrighted material for which I/we have not received permission from the copyright holder/so Ifyoll do not secure copyright pemli<;sions by the time your thesis is submitted. you will still be allowed to submit. However, ifthe necessary copyright permissions are not received, e-posting of your thesis may be affected. Copyrighted material may include image~ (tables. drawings, photograph~. figure,,;. maps. graphs, etc.), sound files. video material, data seb, and large por1,iolls of text.
1. COPYRIGHT An author by law owns the copyright to hislher work, whether or not a copyright symbol and date are placed on the piece. Please choose one ofthe options below with respect to the copyright in your thesis.
1? I1we choose not to retain the copyright to the thesis, and hereby assign the copyright to Williams College. ~elcc(ing this option will assign copyright to the College. If the authorls wishes later to publi5h the work, he/she/they will need to obtain permission to do so from the Libraries, which \\,'ill be granted except in unusual circumstances. The Libraries will be free in this case to also grant permission to another researcher to publish some or all of the the<;is. If you haY~ chosen this option, you do not need to complete the next section and can proceed to the liignature line.
_ I/we choose to retain the copyright to the thesis for a period of__ years, or until my/our death/s, whichever is the earlier, at which time the copyright shall be assigned to Williams College without need of further action by me/us or by my/our heirs, successors, or representatives ofmy/our estate/so Selecting this option allow::> the Ciuthor!s [he flexibility ofretaining his/her/their copyright for a period of year::> or for lite. II. ACCESS AND COPYING Ifyou have chosen in section I, above, to retain the copyright in your thesis for some period oftime, please choose one ofthe following options with respect to access to, and copying of, the thesis.
-LIIwe grant permission to Williams College to provide access to (and therefore copying of) the thesis in electronic format via the Internet or other means of electronic transmission, in addition to permitting access to and copying ofthe thesis in hardcopy format. Selecting this option allows the Libraries to transmit the thesis in electronic format via the Internet. This option will therefore permit worldwide access to the thesis and, because the Libraries cannot control the uses of an electronic vel'sion once it has been transmitted, this option also permits copying of the electronic version.
_ I1we grant permission to Williams College to maintain and provide access to the thesis in hardcopy format. In addition, I1we grant permission to Williams College to provide access to (and therefore copying of) the thesis in electronic format via the Internet or other means ofelectronic transmission after a period of years. Selecting this option allows the Libraries to transmit the thesis in electronic format via the Internet after a period of years. Once the restriction period has ended, this option permits worldwide access to the thesis, and copying of the electronic and hardcopy versions.
_ I/we grant permission to Williams College to maintain, provide access to, and provide copies ofthe thesis in hardcopy format only, for as long as I/we retain copyright. Selecting this option allows access to your work only from the hardcopy you submit fix as long as you retain cupyright in the work. Such access pertains to the entirety of your work. including any mcdia that it incorporates. Selecting this option allows the Libraries to provide cupies of the thesis to rt~searchers in hardcopy form only, not in electronic format.
_ I/we grant permission to Williams College to maintain and to provide access to the thesis in hardcopy format only, for as long as I1we retain copyright. Selecting this option allows access to your work only from the hardcopy you sllblnil for as long as you retain copyright in the \York. Such access pertains to the entirety of your work, including any media that it incorporates. This option cloes NOT permit the Libraries to provide copies of the thesis to researchers.
Signatures removed A Paraxis Homolog in Leech
by Elizabeth Bailey Brickley
Robert M. Savage, Advisor
A thesis submitted in partial fulfillment ofthe requirements for the Degree of Bachelor ofArts with Honors in Biology
WILLIAMS COLLEGE
Williamstown, Massachusetts
May 21,2010 2
"AND IT ISA STRANGE THING THAT MOSTOFTHE FEELING WE CALL RELIGIOUS, MOST OF THE MYSTICAL OUTCRYING WHICH IS ONE OF THE MOST PRIZED AND USED AND DESIRED REACTIONS OF OUR SPECIES, IS REALLY THE UNDERSTANDING AND THE ATTEMPT TO SAY THAT MAN IS RELATED TO THE WHOLE THING, RELATED INEXTRICABLY TO ALL REALITY, KNOWN AND UNKNOWABLE. THIS IS A SIMPLE THING TO SAY, BUT THE PROFOUND FEELING OF IT MADE A JESUS, A ST. AUGUSTINE, A ROGER BACON, A CHARLES DARWIN, AND AN EINSTEIN. EACH OF THEM IN HIS OWN TEMPO AND WITH HIS OWN VOICE DISCOVERED AND REAFFIRMED WITH ASTONISHMENT THE KNOWLEDGE THAT ALL THINGS ARE ONE THING AND THAT ONE THING IS ALL THINGS - PLANKTON,A SHIMMERING PHOSPHORESCENCE ON THE SEA AND THE SPINNING PLANETS AND AN EXPANDING UNIVERSE, ALL BOUND TOGETHER BY THE ELASTIC STRING OF TIME. IT IS ADVISABLE TO LOOK FROM THE TIDE POOL TO THE STARS AND THEN BACK TO THE TIDE POOL AGAIN." - ED RICKETTS, THE LOG FROM THE SEA OF CORTEZ
Many thanks to Professor Savage, Kris Anderson, and Sophia Sequeira for your guidance and support throughout this academic endeavor. Love and thanks to my inspiring and incredible family. And always, much love to the Penthouse. Writing this thesis challenged me to focus on the infinitesimal in order to understand that which is universal, inspired me to discover for myself the complexity that underlies the simplest functions of life, and ultimately taught me to find joy in the journey that leads to understanding. Thank you all for supporting me on the way. 3
ABSTRACT
A fundamental question in evolutionary developmental biology is whether molecular mechanisms of segmentation are conserved across the three segmented phyla: chordates, arthropods, and annelids. Conducting an EST screen with mRNA transcripts enriched during segmentation, Greenberger identified a bHLH gene in the leech, Helobdella robusta, with a high sequence homology to vertebrate Paraxis and Scleraxis genes (2008). In vertebrates, Paraxis and Scleraxis genes are critical for segmentation and mesodermal tissue formation during development. To confirm the identity ofthe candidate Paraxis-like gene in the annelid Helobdella robusta, I constructed a molecular phylogeny of putative Twist-family genes using Bayesian analysis for the evolution ofthe bHLH domains. Then, using whole mount in situ hybridization to characterize the spatial and temporal expression pattern ofthe
Paraxis-like gene in the leech Helobdella robusta, I found Paraxis-like is initially present as a maternal gene product and, with the onset of blast cell formation, is zygotically expressed in waves of expression progressing posteriorly along first the mesodermal and then the neuroectodermal lineages. Paraxis-like in Helobdella robusta is the first reported expression of a Paraxis homolog in a Protostome. While
Paraxis was previously believed to be restricted to chordates, these data demonstrate that Paraxis is expressed in the mesodermal tissue of Protostome annelids during segmentation and organogenesis. This finding suggests that the mesodermal function of Paraxis originated in the last common ancestor of Bilateria and provides support for a common origin for segmental pattern formation in
Bilateria. 4
TABLE OF CONTENTS
INTRODUCTION 5 The Model Organism, HelobdelJa robusta 8 The Evolution ofSegmentation 11 A Candidate Gene 12 TWist-family ofTranscription Factors 15 The Role ofParaxis in Somitogenesis 16 The Role ofScleraxis in Somitogenesis 19 Characterization of a Paraxis-like Gene in Leech 20 MATERIALS AND METHODS 21 Animals 21 Phylogenetic Reconstruction 21 in situ Hybridization 22 Imaging 23 RESULTS 24 Molecular Phylogeny 24 Selecting Sequences 24 Sequence Alignment and Phylogeny 37 Spatial and Temporal Expression of Paraxis-like in HelobdelJa robusta 40 Paraxis-like Expression in Early Development 40 Paraxis-like Expression during Gastrulation 42 Paraxis-like Expression Post-gastrulation 43 Paraxis-like Expression during Organogenesis 46 DISCUSSION 48 Evolution of the Paraxis subfamily 48 Paraxis Is Expressed throughout H. robusta Embryonic Development 49 Maternal RNA. 50 Segmental Precursorfor Neuroectodermal and Mesodermal Tissue 51 Implications of Leech Paraxis for Bilateria 54 Comparative Expression 54 Nervous System 56 Hau-Pax3/7 59 A Paraxis Homolog in Leech 61 WORKS CITED 63 5
INTRODUCTION
With approximately thirty ofthe thirty-five animal phyla and over one million species, Bilaterians represent the most diverse and abundant classification of animals (Burton, 2008). Critical to the origin of Bilaterians was the emergence of a third germ layer, the mesoderm, in early Metazoans. Germ layers are primary tissue layers that become apparent during the gastrulation of embryogenesis and give rise to all adult tissues and organs (Technau and Scholz, 2003). The development ofthe mesoderm is linked to the origin of a second body axis; this profound innovation led to the transition from radial symmetry to the unique bilateral symmetry for which Bilateria are named (Technau and Scholz, 2003). In addition, evolutionary biologists hypothesize that, with the ability to undergo epithelial-to-mesenchymal transitions, mesoderm tissues created a novel opportunity for animal tissue to oscillate between stable (Le. epithelial) to more loosely organized (Le. mesenchymal) structure during growth (Perez-Pomares and
Munoz-Chapuli, 2002). This dual presence of both firm and flexible body organization in a third germ layer provided Bilaterians with both the enhanced control of three-dimensional body organization and the greater plasticity that contributed to the explosion ofdiversity that exists within Bilateria today.
Molecular phylogenies have identified three major Bilaterian lineages:
Deuterostomia, Ecdysozoa, and Lophotrochozoa. While the taxa within these superphyla have diverged into a diversity ofbody plans, many gene pathways and molecular mechanisms are genetically conserved in all three lines and point to a 6 shared origin in the last common ancestor, known as Urbilateria. The evolutionary history of Bilateria can be reconstructed through careful interphyletic comparison to examine the ways traits are conserved, lost, and derived.
One notable common feature is segmentation, the process by which embryos develop repeated structural units along their anteroposterior axis. Intriguingly, the feature of segmentation is present in chordates, arthropods, and annelids -- one phylum from each ofthe three major clades of Bilateria (Fig.!). Animals from all three phyla sequentially add somites, transient metameric blocks of mesoderm, in a posterior progression during embryogenesis (Balavoine and Adoutte, 2003).
Questions remain whether the gene cascades and molecular precursors that lead to segmentation of the mesodermal tissues evolved independently or if the process was, instead, derived from common segmented ancestors (Peel, Chipman & Akam,
2005). Understanding the origins of the complex process of segmentation will enhance our ability to decipher the evolution ofmesodermal tissue and ultimately the evolutionary story of Bilateria. 7
~~.----'.., ----""- . --"'-...... , ...... , '--....- ...... \ .-~~ ...... - _r_- JI'O,,,,~ e.- ",""",,u,.- "'~ 't·-... "'- .. __ ~Woll'lCh.J , ...... r--. I '-.J"" ;
Figure 1. Bilaterian phylogeny demonstrating the divergence into the three main lineages: Ecdysozoa, Lophotrochozoa, and Deuterostomia. Segmented phyla are highlighted within each clade. (Tessmar-Raible and Arendt, 2003).
In order to gain a better understanding ofthe evolution ofmesoderm and of segmental pattern formation, it is necessary to have comprehensive data from the developmental gene expression patterns from all three major Bilaterian Hneages.
Historically, evolutionary development research has been heavily skewed toward the Deuterostomia and the Ecdysozoa lineages. The Deuterostome vertebrates Mus musculus and Danio rerio join the Protostome Ecdysozoan Caenorhabditis elegans and Drosophila melanogaster among the most robustly studied species in this field.
In contrast, the Lophotrochozoan model species, including Helobdella robusta and
Capitella telata, have been historically underrepresented and are only gradually being incorporated into the literature (Shain, 2009). 8
This thesis aims to enable more meaningful interphyletic comparison by
identifying and characterizing the spatiotemporal expression ofa candidate gene
implicated in mesoderm development in the segmented Lophotrochozoan model organism H. robusta. Ultimately, studying the comparative expression ofthis gene may help to expand our understanding of segmental pattern formation in annelids and the origin and evolution of mesoderm in Bilateria.
The Model Organism, Helobdella robusta
The Lophotrochozoa superphylum includes mollusks, flatworms, lophophorates, and annelids. Annelids, such as earthworms, polychaetes, and leeches, represent one ofthe world's most ecologically diverse animal groups, occupying habitats ranging from hydrothermal vents to glacial ice (Shain, 2009).
Segmentation is the most prominent feature ofthe annelid body plan. The glossiphoniid leech, HelobdeJla robusta, represents an ideal model organism for early developmental study because their embryos are relatively large, hardy, and easily cultured (Fig. 2). H. robusta adults are hermaphroditic and are capable of both selfand cross-fertilization. Fertilization occurs internally, but the eggs are deposited in a cocoon, known as the clitellum, on the ventral aspect ofthe parent, from which they can be easily collected for further study (Weisblat and Haung,
2001; Irvine and Martindale, 1996). 9
Figure 2. The segmented leech, Helobdella robusta, serves as an annelid model organism for studying mesoderm evolution.
Leeches develop from a one-celled embryo to a complex animal with thirty- two body segments by the end of embryogenesis. Cell fate mapping studies demonstrate the pattern ofleech development appears to be conserved across clitellate annelid species (Storey, 1989; Goto, Kitamura & Shimizu, 1999; Nakamoto,
Arai & Shimizu, 2000). In development, the posterior growth zone of the early embryo contains five bilateral pairs ofteloblasts, the embryonic stem cells designated as M, N, 0, P, and Q(Fig. 31). These pairs ofteloblasts undergo repeated iterations ofstem cell-like asymmetric cell divisions with daughter cells budding off in a bandlet pushing the oldest cells towards the anterior of the embryo. The N, 0, P, and Qteloblasts generate exclusively ectodermal tissue. The Mteloblast pair contributes the mesodermal tissue (Weisblat and Shankland, 1985). Together, the five pairs of bandlets form two parallel germinal bands, which elongate along the anteroposterior axis. Eventually, the two germinal bands zip together from anterior to posterior to create the germinal plate, on which the segments are patterned
(Shain, 2009). In annelids, the basic segment is characterized by an oval-shaped 10 cross section, with oblique muscles, nephridia, nerve cord, and chaetae surrounding the endodermal gut tube (Irvine and Martindale, 1996).
\ b g"~.teft ~C'Il @ ~ ge gh r ighl A. B. C. D. E. tdorsal viey, I gb (ventral VH:W)
r\rllcrior \ AnteriOr~) pus".nm~
Posterior _.~ F. G."tt'J H.
(Segments) t Germinal plate
Germinal band t Bandlet t alast cells t - Teloblasts
I.
Figure 3. Important stages in embryogenesis. A.) Stage 1. Teloplasm shaded. B.) Stage 2. Teloplasm shaded. c.) Stage 3. Teloplasm shaded. D.) Early Stage 8. gb= germinal bands. E.) Mid-Stage 8. F.) Late Stage 8. Sphere indicates yolk. G.) Stage 10. H.) Stage 11. I.) Diagram of bandlet formation from the teloblasts in one half ofa stage 8 leech embryo. (Weisblat, 2001; Goldstein, Leviten & Weisblat, 2001). 11
The Evolution ofSegmentation
The term segmentation represents both the morphological feature, in which
repeated anatomical units comprising multiple tissue layers extend along the anteroposterior axis ofan animal, and the developmental process through which these metameres are generated (Seaver, 2004; Shain, 2009; Minelli and Fusco,
2004). Arthropods, annelids, and vertebrates have been highly successful among
Metazoans in exploiting a diversity of ecological niches. By providing repetitive building blocks, segmentation may have allowed these animals both increased body plan stability and flexibility to adapt to new tasks (Damen, 2007).
Currently, there are three dominant hypotheses regarding the origin and evolution of segmentation (Davis and Patel, 1999): (1) segmentation arose independently in each of the segmented phyla, (2) vertebrates developed segmentation independently while Protostomes arose from a segmented ancestor with the unsegmented groups displaying a secondary loss of segmentation, and (3) all Bilaterians arose from a segmented ancestor and arthropods, annelids, and vertebrates are the only phyla to retain segmentation (Fig. 4). Comparative expression data continues to be vital in testing the hypotheses. lethe cellular and molecular mechanisms of segmentation are similar across annelids, arthropods, and vertebrates, then segmentation is most likely derived from a common ancestor.
However, if the genetic mechanisms are profoundly different between the groups, then an independent evolution of segmental body plans is the most likely explanation. 12
(a) (b) (c)
,-- Arthropoda
Unsegmented IPhyla F-Annelida
IPhyla
Figure 4. Three hypotheses for the evolution ofsegmentation. (a) Segmentation evolved independently in each ofthe segmented phyla. (b) Vertebrates developed segmentation independently while Protostomes arose from a segmented ancestor with the unsegmented groups displaying a secondary loss of segmentation. (c) All Bilaterians arose from a segmented ancestor and arthropods, annelids, and vertebrates are the only phyla to retain segmentation. In this diagram, blue represents Deuterostomes and green represents Protostomes. Black bars indicate the evolution of segmentation. White bars indicate the loss of segmentation. (Davis and Patel, 1999).
A Candidate Gene
Research into the genetic basis of segmentation evolution began in the 1980s with large-scale genetic screens testing Drosophila melanogaster development.
These studies identified approximately 40 genes coding for a hierarchy of transcription and signaling factors that are necessary for normal segmentation in the blastoderm stage embryos offruitflies (Peel et aI., 2005). The findings within the fruitfly model system provided a useful point of reference to identif'y segmentation genes in other species using cloning by homology techniques.
However, when this approach was applied to annelids using arthropod gene products, researchers found the majority ofsegmentation homologs are expressed in the annelids, but appear to possess a different function (Pinnell, Lindeman,
Colavito, Lowe, Savage, 2006; Seaver and Kanishige, 2006). 13
For example, the engrailed gene is expressed with striped periodicity in both
Drosophila and leech. In fruitflies engrailed serves as a critical segment-polarity gene initiating a signal cascade to pattern cell fate along the length of the segment
(Heemskerk and Dinardo, 1994 reviewed in Shankland and Seaver, 2000).
However, laser cell ablation experiments in leech, with the ablation preceding the onset of engrailed expression, have demonstrated that the interrupted engrailed signaling has no influence on the development of surrounding cells. This finding indicates that engrailed does not playa vital role in segment polarity specification in leech (Seaver and Shankland, 1999 reviewed in Shankland and Seaver, 2000).
To remedy this challenge, the Savage lab adopted a novel and unbiased approach utilizing an EST screen to identifY mRNA transcripts enriched during segmentation. Using in situ hybridization, Greenberger found a candidate gene of interest, hereafter called Paraxis-like. Greenberger observed mRNA transcripts for this gene are expressed as a serial pattern in the mesoderm preceding the physical segmentation ofthe embryo (2008). 14
~. CAtCAAA;":;TA'C':;"';';A':tG;";';'C;';';'TTCCA"::N\CCGC~';::~;"CTC';;';';'GC;'':':;'GC.\GC;';'T!':;';';;'';;AA':;'';'TCG;;CTGTt.:~.: o I 1:I;j )' G7kGTTtTGATAGGTGGT~CTtTGTTt~GGtGtTGG=GTTTT=GTT7:TTGAGTtTT':GT~GTCG:':GTTAAGTtTG':TGTT;"GCTG;'C~GTTT:TG _I H Q N Y P P ~ Il Q I POP 0 II 0 K lOll II 0 0 0 ~ Il U 0 S I V 0 It ~. CAGAAATT:..AACTG..GGCGllCGGCAAACGCCCGAGAG,\G:.GATCGllCCTACAACG1:CAACiJ.TGCCTTCC;"CC..TTTGCG..TCC:'TC..T,\CCCACTGA III ...j-.- I IIIII t J I I 1 I I I I I 2:)0 x GTCTTTllTTTGACTCCGCTTG':CGTTTGCGGGCTCTCTCTCTAGCTTGGATGTTGCAGTTGTT;"CGG~GGTGGT~CGCTAGGTAGTATGGGTGACT _1 P E. It L It Il r " N A II ~ II 0 II TY II V N N A F H tl L II S II I' r Ii. ~. G:":..GCCG ..TCG;";';'G':TA:r':GllG;"TT(Mll':7ATCAGACTGGCTACCAGCT;'C,,,::;'G':TCACCT':C...C;'·:CGT.AT,;ll:;"C":G':";;CTT':;":C7GCA': ~--+~·+I...... I +~.-r...--+--o-+----t+ ):1.' CGGTCGGCTAGCTTT":G~!~GCTTCT~~T!!G~T~GTCTGACCGA~GGTCG~TGTATCGAGTGGAGGtGtG~C~TAG!T~tGGCTG~~GT~G~CG7G _I P A 6 A k ( g k ; l I[A t i i g ; IX"["; Q i Nib [ It t H ~. c;u,.CkACC:'TG::G't::;'GkATC';'GGGG;:t:::';;:7;;;''::C:'G;'::TCCTG~;G:'GA;.,;.;,.::'tCG7:;J.cC':''tG':'C:Z::':;;''G>..;;,;,.G':'TGS-::;''':GT:;;'T.::;,:.G;;: I 'OJ l" GT'N'rTGG'!;'':G:::'GTCT':'~GTCC::CG;''GTGJ..':-:GG-:CTG':'G::;''CZ-:TTACT::TT71'GAGC;.:i ..TGG....CTGG;.:;C:.-.::r:.-TCTA.:CAGTG:;.:::;.·:>T:.-CG OOPCVII II G SLT Il , . . v " LOt ,( D c. H V ~" ;,GCTG:'7G;'GTGGTGCCTGTG;';'GGCG':TG':':GJ..7GG7G 3GG..':';';'TGGG:: :G:. ,;;C;.T;;;"T::: G':;'';;G'::: CTG::;;:'- :AGe::;..:TTc;.....GG:';:C;,::-:'-,:;';';' i S:;>J l" -r'::GJ.CT A":-:C~C::;';;GG;'::A :':t';;CG<:G:'':::7G::':A':CA: :.:: :-:G'TtA';;C::G" :TGG-:;''3t;...:;;'::GTGC;u,...l,·:GG:'GT":GCG;'';'G':':':':CG:iGt;J.G::'tT _1 0 l M S G A C [ GAO 0 G GO" G P , , ,
l" ACCCC;u,.TGC;';"GA;;':ATC;"GCC'C~'TAGT::CG;"CTT;'~GGk.:.A~TT':.:.ACCAC;:'CCTTh::CC~:=TA;;A::T;C~CG;'TGA7TGCGTAGTnG'TA _1 G'i YGVIKt""fCl CiGG1G\V~' "lll "Htl 5" tUTTGCTG;'GTTTATGACA.llGAT1..AC;.TTAAr.CGAC::.'TTTTT;"';';'GATATTTTT7;'!"TTT;u.GAAA:ATTT;J,.:1..ACG'r'\CTTA':'TTGA,;,.T~TTT?"Tt ...... -t- Iii Ii .... I t i i.. Iii- ...... --!...... -\-o...... ,...... -+-+ 7JO AT'tkA.CG~CTCitAJ',,'r..CTGTTT.::T;..TTGTAATTTG<;!GAAAAAATT,CTAT~'tAAAA!'!CTt'rG!:.AAT,GTTGCA'i"GAATAAACTT~ _I LlS~ 011 H IrfLKlffllRll1 QRIYL"fF 5" nCT.u.uTTTG.G;.,;..;,tCTT.:;.u."::G:'TCTllC;'<:A.\T'l'GtTTC;'T~T'l'G;'CAACG'!'!TC;'!'!'GAT .:;.:;-r;.Ar.u.:.GT;';';";";';';';;'TT't ...... -+...... r-.--;-.-...... +...... ~~ ...-rt-.... •-r...-.....,...... -..,....~t-o- r-·...... I ...... \-o.•~t---"t~ A:.G;'TT::TAA:.C:':'TT;'G.:.ACTTGCT;'GA-:'tG'l'GT'!AACAAA~TATTT::':TTTAA':;TGTT~':;~G::AACTAT~GATT;'T'!TCA::.'TTTTTTT~
_1 f l K f· ~ K S !l N C f 1 K r; tl" v S liP N 1\ K 1\
Figure 5. EST ofthe H. robusta Paraxis-Iike gene. The 796 base pair transcript was translated as indicated by the arrows. The bHLH domain is highlighted with the red line.
The expressed sequence tag (EST) for the H. robusta Paraxis-like gene
contains a 796 base pair region with a basic helix-loop-helix (bHLH) domain (Fig. 5).
The candidate gene shares a high level ofsequence identity with the genes for the
Twist-family transcription factors, Scleraxis and Paraxis (Fig. 6). Scleraxis and
Paraxis proteins play prominent roles in vertebrate somitogenesis, but have not
been characterized in arthropod embryogenesis. Twist is the dominant
developmental control gene implicated in Drosophila mesoderm patterning. To
prove that this bHLH gene is more closely related to the Paraxis gene than to the
Twist gene, I will construct a molecular phylogeny to analyze Paraxis-like in the context ofthe Twist family oftranscription factors. 15
MdJOt.t.y ~.-6·F·h·i"'B" "YljAjM f!I'" ·PT/.!l'RK·.:;t"-'p·:,-~v·7·l!Y "" ~ ~ P f , % homology Parax.$-~lKe (Hel~bdel*dl .?r~ ~RRrANAR~k~RTY~~~:AFrlHLPS~I~T~PA~~LbK~E~lRLATSY:AHL~TV 55 t',HdXl:> (~"u,;el.pro Q A.•...... -:;.:: .• T ..'A ..Tt....V ..•. l.. ••. 5 AN. '2.1 55 Sclerdxls (mol:seJ.pre- r,;'.:i.. • ...•NS .. 7 .•7:· ,I... . L $ •.. g •. r;N. l.~ 55 Twl.s~ bdel~\l.prc C.~I.D ~ (R".l. •• VL.,"';, ...... ;C .. I'.V.. L.3.- ..• 0 ••• R •. DF.YDQ 51l.5 54 TWlst 1m >u:::e) .pro -;). V!'1 •. V• •. w' • CSL. Eo .M.. ;<' ••••L. .- •••.•",. LK•. AR .• DF. YO. 56 . .\ DE-rlll<"-1 /It'Cu:,w I. pro ~. I:" . . 'J • •. " •• O:3L.E. .M•. 1<' •••• L. •- •••..• ' LI' .• ,'\R•. c:;:. YO. ,., " H Figure 6. The H. robusta Paraxis-Iike gene is more closely related to mouse Paraxis and Scleraxis gene sequences than it is to any other Twist-family genes. Twist-family ofTranscription Factors The Twist-family of proteins, named for the Twist gene first discovered in D. melanogGster, is an evolutionarily conserved family of bHLH transcription factors (Barnes and Firulli, 2009). Twist proteins play pivotal and varied roles in embryonic development and are also implicated in human pathological diseases, such as Saethre-Chotzen Syndrome (Barnes and Firulli, 2009). The bHLH motif is a protein dimerization-DNA binding domain that consists of a short string of basic DNA-binding amino acids followed by two amphipathic a-helices separated by an unstructured loop (Massari and Murre, 2000). When the hydrophobic face of a helix makes contact with the helix of another bHLH protein, a functional dimer forms that can bind to an E box consensus sequence (CANNTG, in which N stands for any nucleotide) and instigate partner-dependent transcriptional activation or repression of lineage-specific genes (Castanon and Baylies, 2002, Wilson-Rawls, Rhee, & Rawls, 2004). The Twist-family transcription factors are regulated through spatiotemporal transcriptional regulation, phosphorylation affecting dimer formation and DNA-binding affinity, and phosphoregulated cellular localization (Barnes and Firulli, 2009). 16 The most highly conserved genes of the Twist-family include: Twist 1, Twist 2 (formerly Dermo-1), Handt, Hand2, Scleraxis, and Paraxis (Barnes and Firulli, 2009). While Twist has been identified in annelids, the other Twist-family genes have yet to be characterized in segmented worms. Paraxis and Scleraxis genes have been best characterized in vertebrate somitogenesis. The Role ofParaxis in Somitogenesis Paraxis, a Class B bHLH Twist-family transcription factor, is highly conserved across vertebrates and plays a key regulatory role in somite morphogenesis. Expression patterns in mouse, chick, zebrafish, and frog embryos show Paraxis is first expressed in mesodermal cells in the posterior of the embryo during the primitive streak stage and expression progresses in a rostral-to-caudal wave within paraxial mesoderm, immediately preceding somite formation (Burgess, Cserjesi, Ligon & Olson, 1995; Barnes, Alexander, Hsu, Mariani, & Tuan, 1997; Shanmugalingam and Wilson, 1998; Carpio, Honore, Araya & Mayor, 2004). This process gives rise to the anteroposterior axis of the developing organism. Paraxis is uniformly maintained in the newly formed somites; however, following somite compartmentalization, Paraxis is quickly downregulated in the myotome despite persisting in the dermomyotome and the sclerotome until the somite reaches maturity (Burgess et aI., 1995). Like all bHLH proteins, Paraxis transcription factors must dimerize to functionally activate transcription; in fact, Paraxis can only bind DNA by forming a heterodimer with protein E12, a Class A bHLH protein (Wilson-Rawls et aI., 2004). EMSA experiments have shown that the E12/Paraxis heterodimer can bind and 17 directly regulate the RMCK, Ins-l, and Rhomboid E-boxes. In addition, Paraxis can bind to an E-box from the Scleraxis promoter, which is significant as Paraxis expression precedes Scleraxis expression in somite development (Wilson-Rawls et aI., 2004, reviewed in Barnes and Firulli, 2009). Functionally, Paraxis regulates the developmental control genes Mohawk and Pax. In an experiment in mouse, researchers found Mohawk, belonging to the TALE superclass ofatypical homeobox genes, is downregulated in the somites of null Paraxis mutants (Anderson, Arrendondo, Hahn, Valente, Martin, Wilson-Rawls & Rawls, 2006). Researchers have also found that Paraxis directly regulates Pax3 and Paxl, which are crucial for proper cellular differentiation in the axial muscles and vertebrae (Takahashi, Takagi, Hiraoka, Koseki, Kanno, Rawls & Saga, 2007; Wilson Rawls et aI., 2004; Wilson-Rawls, Hurt, Parsons, & Rawls, 1999). Using in situ hybridization to characterize expression patterns in H. robusta embryos, researchers found Hau-Pax3/7 A, a gene in the Pax3 subfamily, present as a maternal transcript in precursor cells to the mesoderm (Woodruff, Mitchell & Shankland, 2007). As the embryos developed, the maternal RNA disappeared and was replaced by serial expression of Hau-Pax3/7 A expression in the blast cell progeny of the mesodermal Mteloblasts. Morpholino-mediated knockdown of Hau Pax3/7A in the mesodermal blast cells disrupted morphogenesis in the mesoderm. Furthermore, knockdown led to abnormal formation ofthe dorsal cavities and, thus, interfered with the segmental organization of the germinal plate. If Paraxis is indeed present in leech mesoderm and mesodermal blast cells, Paraxis-mediated 18 Pax3 expression could present an intriguing factor in mesodermal development and segmentation in leeches. Experiments using Paraxis null-mutants in both mice and chicks demonstrate that Paraxis is critical to epithelialization ofthe dermomyotome (Burgess et aI., 1996; Sosic, Brand-Saberi, Schmidt, Christ, & Olson, 1997; johnson, Rhee, Parsons, Brown, Olson & Rawls, 2001). In fact, in Paraxis -j- mutants, the somites fail to undergo the epithelial-to-mesenchymal transformation (EMT) during somite formation (Burgess et aI., 1996; Sosic et aI., 1997). EMT plays an important role in embryogenesis as it decreases cell adhesion, thereby allowing cellular migration of neural crest and gastrulation cells (Linker, Lesbros, Gros, Burrus, Rawls & Marcelle, 2005). In wildtype chick Paraxis expression, somites in the mesoderm epithelialize and compartmentalize after a Wnt 6 signal, secreted by the ectoderm, binds to a Frizzled7 receptor on the cells ofthe segmental plate. Frizzled7 then activates the ~-catenin pathway, which regulates the expression of Paraxis on the dorsal cells of the somites and maintains their epithelial structure. The ventral cells, receiving Hedgehog signals, lose Paraxis expression and undergo EMT to differentiate into the sclerotome (Linker et aI., 2005). In addition to its role in epithelialization, Paraxis is crucial for the maintenance ofsomite polarity during embryonic development. In mice deficient for Paraxis, axial skeleton and peripheral nerve cells fail to align according to the proper anteroposterior axis and genes that are normally restricted to the posterior half of somites are present in a diffuse pattern throughout the somite (Johnson et aI., 19 2001). As a result, mice homozygous for a Paraxis null allele die within hours of birth. The Role ofScleraxis in Somitogenesis neural tube A 7 Like Paraxis, Scleraxis is highly ParaxIal meSOderm conserved across vertebrates. Unlike Paraxis, which is primarily involved in mesoderm patterning, Scleraxis is expressed uniformly B across the early embryo at stage 6 ofmouse embryonic development (Brown, Wagner, c Richardson & Olson, 1999). After specification dermamyotome ofthe somites is complete, at late stage 9 into stage 10, Scleraxis can be detected again in the D. lateral region ofthe sclerotome and also in the mesenchymal cells in the body wall and limb buds. As the embryo develops, Scleraxis is • Paraxis expressed next within the mesenchymal ScIerIDClS precursors ofthe skeleton and later is limited Figure 7. Schematic representation of Paraxis and Scleraxis expression in to regions of connective tissue formation. With the transverse sections through the paraxial mesoderm. (A) Paraxis is expressed immediately prior to somite onset of osteogenesis, Scleraxis levels begin to formation. (B) Paraxis is expressed throughout the epithelial somite. (e) decline (Cserjesi, Brown, Ligon, Lyons, Copeland, Paraxis is expressed in the dermomyotome and sclerotome during Gilbert, Jenkins & Olson, 1995). in vitro studies compartmentalization. (D) Paraxis is downregulated in the myotome. Scleraxis suggest bone morphogenetic proteins may is expressed in the sclerotome. (Burgess et al.. 1995). 20 downregulate Scleraxis to shift cells from mesodermal tissue to osteogenic tissue (Yeh, Tsai & Lee, 2005). Similar to Paraxis, Scleraxis becomes a functionally active transcription factor after it has formed a heterodimer with E proteins (Cserjesi et a!., 1995). Using null Scleraxis mutants, investigators have demonstrated Tenulomodulin and Collagen 14, both involved in tendon formation, to be the downstream targets of Scleraxis (Murchison, Price, Conner, Keene, Olson, Tabin & Schweitzer, 2007). Strikingly, Scleraxis null mutant mice fail to form a primitive streak and are ultimately unable to develop mesoderm (Brown et ai, 1999). This finding strongly suggests that Scleraxis serves an essential role in early mesoderm formation. In addition, Scleraxis null mutant mice that survive to term express severe disruption in tendon formation (Murchison et a!., 2007). Characterization ofa Paraxis-Iike Gene in Leech In this thesis, I will characterize the Paraxis-like gene in leech to advance our understanding of the molecular mechanisms controlling mesoderm development and segmental pattern formation in Lophotrochozoa. To confirm the identity of the candidate Paraxis-like gene, I will first construct a molecular phylogeny of putative Twist-family genes using Bayesian analysis for the evolution of the bHLH domains. Then, I will use whole mount in situ hybridization to characterize the spatial and temporal expression pattern ofthe Paraxis-like gene in the leech Helobdella robusta. By comparing this data to Paraxis and Scleraxis expression during vertebrate so mitogenesis, I hope to advance our understanding ofthe evolutionary history of mesoderm in Bilateria. 21 MATERIALS AND METHODS Animals A laboratory breeding colony of adult Helobdella robusta was raised in glass finger bowls containing 1% artificial pond water and was fed physid snails. The environment was temperature controlled at 27°C with a 12:12 hour light: dark cycle. Embryos were collected from the ventral surface of the adult leeches using forceps to remove the viscous cocoon. The collected embryos were staged, fixed in 4% formaldehyde for 30 minutes, and stored in 100% methanol at -20°(, Phylogenetic Reconstruction All of the Twist, Dermol, Hand1, and Hand2 protein sequences were collected from the National Center for Biotechnology Information (NCBI) protein databank. In addition, transcripts were identified by BLASTing the Homo sapiens Twist-family gene (i.e. Paraxis, Scleraxis, and Twist) and the Helobdella robusta Paraxis-like gene against sequenced genome projects within the Joint Genome Institute (JGI) and Flybase databanks. The 37 amino acid sequences selected for the phylogeny were aligned using CLUSTAL-W and were refined by eye (Thompson, Higgins & Gibson, 1994). For the phylogenetic reconstruction, only the bHLH domain was selected for analysis because no other region could be compared unambiguously for all of the available sequences. The phylogeny was estimated by comparing the aligned amino acid sequences using Bayesian analysis in the program MrBayes version 3.1.2 (Ronquist and Huelsenbeck, 2003). The amino acid substitution rate was estimated using the Jones Taylor Thornton OTT) fixed rate evolutionary model Oones, Taylor & Thornton, 1992). The model was run for 2,000,000 generations with a sample 22 frequency of 100 to achieve a standard deviation of split frequencies at 0.009572. 5000 trees were removed as a "burn-in" to estimate the consensus topology more accurately. in situ Hybridization Fixed embryos, stored in methanol. were rehydrated using phosphate buffered saline. Embryos stages 1-8 were devitellinated using forceps or a drawn out Pasteur pipette. Embryos stage 9 and older were permeabilized in a l~g/ mL Proteinase Kdigestion at room temperature for 10 minutes and refixed in 4% formaldehyde. The embryos were neutralized using acetic anhydride with TEA solvent. The washed embryos were prehybridized at 66°C for 1 hour. Complementary digoxigenin-substituted RNA probe, transcribed from the cDNA library, was denatured at 95°C for 10 minutes and cooled to 66°C. The probe was diluted to 1:800 and hybridized with the embryos for 48-72 hours in a 66°C water bath. The hybridized embryos were sequentially washed at 75°C for 20 minutes per rinse in pre-warmed prehybridization buffer, 2X SSC Chaps, 0.2X SSC Chaps, O.lX SSC Chaps, and in distilled, deionized water. The embryos were also washed at room temperature in phosphate-buffered saline with 0.3% triton X-l00 (PST) and incubated with heat-treated goat serum for 15 minutes to block non-specific antibody staining. The embryos were stored overnight with anti-digoxigenin AP antibody (1:5000 dilution) at 4°C. Excess antibody was removed using serial PST washes. Embryos were transferred to AP buffer and then treated in NST and xphosphate to reveal the immunological staining. To stop the color reaction, 23 embryos were transferred to PBT for 10 minutes and then fixed for 30 minutes in 4% formaldehyde. Imaging Fixed and stained embryos were dehydrated using serial 100% ethanol washes and were cleared using a 3:2 mixture of benzyl benzoate: benzyl alcohol (BBBA). Photographs were taken by Prof. Robert M. Savage. 24 RESULTS Molecular Phylogeny To understand the evolutionary relationship between the deduced Paraxis- like gene in H. robusta and the Twist-family oftranscription factors, I estimated a phylogeny of Paraxis-like in the context of the putative Twist-family and Paraxis- subfamily genes. To create the phylogeny, I obtained a list of Twist-family genes that spanned 17 species across Metazoans. I used BLAST analysis to predict 5 additional Protostome Paraxis-like homologs. Using CLUSTAL-W in MEGA3, I created multiple alignments of the bHLH domains (Thompson et aI., 1994). Finally, Bayesian inference was used to construct a phylogenetic tree of the estimated evolution of the genes (Ronquist and Huelsenbeck, 2003; Jones et aI., 1992). Selecting Sequences In order to demonstrate that Paraxis-like is more similar to Paraxis and Scleraxis than to the other Twist-family genes, I collected sequences from H. sapiens in the six most conserved Twist-family proteins: Paraxis, Scleraxis, Twist, Dermal, Handl, and Hand2. Within the bHLH domain of the genes, Paraxis-like shares 67.8% and 69.5% sequence identity with the human Paraxis and Scleraxis genes and shares only 52-58% sequence identity with the other Twist-family genes (Fig. 8). Paraxis-like shares only a 52.5% identity with the Twist gene previously characterized in H. rabusta. 25 ~ bQsic helix loop helix tj Hgmology """"Paraxis-like H, robusta RRTANARERDRT YNVNNAFHHLRSIIP TEPADRKL5 KIETIRLATSYIAHLHTVINTDL Paraxis H. sapiens .QA QS ..T .. TA ..TL V LS AN.LLLGD 67.8 Scleraxis H. sapiens .H NS ..T.. TA .. TL L S 5 .. GN.LLAGE 69.5 Twist H. robusta · VL .. VQ.. QSL. D•. SQ .. K. V..L.5. - ...•.Q. LK R.. DF. YDQLENNK 52.5 Twist H. sapiens • VM .. VQ.. QSL. E.. AA .. K L. S. - Q. LK .. AR .. DF. YQ. LQS. E 55.9 Dermal H. sapiens •IL.. VQ.. QSL. E.. AA .. K L. S. - Q. LK .. AR .. DF. YQ. LQS. E 55.9 Handl H. sapiens KGSGPKK .. R.. E5I.S..AE .. EC .. NV T K.L Y.MD.LAK.A 52.5 Hand2 H. sapiens .G ... RK .. R.. QSI.S ..AE .. EC .. NV T K.L Y.MDLLAK.D 57.6 Figure 8. bHLH domain amino acid sequence alignments for H. robusta Paraxis-like and H. sapiens Twist-family genes. Paraxis-like shares higher sequence identity to H. sapiens Paraxis and ScIeraxis genes than it does to the other H. sapiens Twist-family transcription factors and is distinct from the Twist gene characterized in H. robusta. To construct the tree, I focused on sequences from Paraxis, Scleraxis, and Twist. Because Paraxis and Scleraxis have only yet been characterized in Deuterostomes, I selected representative vertebrate species for both genes and also a hemichordate Paraxis sequence. Because Twist has been well characterized across Metazoans, and thus, provides a more robust evolutionary framework for comparison, I included Deuterostome, Protostome, and cnidarian Twist sequences in the multiple alignments. In addition, I assumed Dermal, also known as Twist2, sequences would yield similar distinctions from Paraxis-Iike as those of Twist and therefore excluded additional Dermal genes from the phylogenetic analysis. Furthermore, as Handl and Hand2 share low identity with Paraxis-Iike, I also excluded additional examples of these genes from the analysis. In addition to the Twist-family protein sequences, I identified in silica putative Paraxis-Iike homologs. To provide evidence in support ofa Protostome Paraxis-like transcription factor, I searched first within the genome of another annelid, the basal polychaete Capitella telata. To identify a C. telata Paraxis-like 26 homolog, I BLASTed full-length translated EST sequences for H. robusta Paraxis-like, H. sapiens Paraxis, and H. sapiens Scleraxis against the C. te/ata genome (http://www.jgi.doe.gov/).Theclosestmatch.estEXTjgeneshl.pg.C740025. was consistent for all three queries. Furthermore, the E value for estEXTjgeneshl.pg.C]40025 differs from the next closest sequence, estEXTjgeneshl.pg.C1610005, by magnitude between 15 and 8. For ease, estEXTjgeneshl.pg.C]40025 is hereafter called "Paraxis-Iike." Table 1. BLAST matches and Evalues for Paraxis-Iike homolog in the Capitella telata genome. ACamteIIa teIQta BLAST output ~or HeoI bdeIIa robusta ParaXlS-/'k1 e query Protein lD Gene Name Bit Score E value 22S943 estEXTJgeneshl_pg.C740025 121 4e-30 221159 estExUgenesh1_pg.C1610005 79 7e-15 155726 estExcGenewise1.C31790001 69 ge-12 94620 e_gw1.l71.79.1 69 ge-12 B. Caoitella telato BLAST outout for Homo saoiens Paraxis ouery Protein lD Gene Name Bit Score E value 225943 estEXTJgeneshl_pg.C.740025 89 2e-19 221159 estExUgenesh1_pg.C_1610005 67 2e-11 162858 estExCGenewise1.C_4320011 60 2e-09 80741 gw1.275.68.1 60 2e-09 C. CaoiteIIa telato BLAST output or Homo saoiens Scleraxis ouer Protein lD Gene Name BitScore E value 225943 estEXTJgenesh1_pg.C.740025 109 3e-25 221159 estExUgenesh1_pg.C1610005 73 3e-13 94620 e.gw1.l71.79.1 71 1e-12 155726 estExt_Genewise1.C_31790001 71 1e-12 The bHLH region ofa Paraxis-like gene in C. te/ata shares over 76% sequence identity with the bHLH regions of H. sapiens Paraxis and Scleraxis and less than 60% identity with the H. sapiens Twist and Handl bHLH regions (Fig. 9). The C. te/ata 27 Paraxis-like gene is also distinct from the C. telata Twist bHLH domain, sharing less than 60% identity. l&nf. ~ bgsic: helix loop helix % Homology Paraxis-like C teloto RSSANARERDRT YSVNSAFITlRTlIP TEPADRKlS KIETlRLATSYISHlHTVl~GI Poraxis H. sapiens .QA QT.. TA V SA.. AN .. ll.O 76.3 Scleraxis H. sapiens .HT NT..TA S GN ..l..E 81.3 Twist C. telota ..I.. I. ..Q.. Q.l. EG.AH ..QI. ..l.S. '... . .Q ..KR.. OF. YQ .. RSEO 59.3 Twist H. sapiens . VM ..V...Q.. Q.l. E..AA .. KI. .•l.5. -... . .Q ..K..AR .. OF. YQ .. QSOE 57.6 Handl H. sapiens KG.GPKK .. R.. E.I. AE .. EC.. NV T. K AY.~O .. AKOA 57.6 Figure 9. bHLH domain amino acid sequence alignments for C. telata Paraxis-like and Twist and H. sapiens Twist-family genes. Paraxis-like shares higher sequence identity with H. sapiens Paraxis and Scleraxis genes than it does with the other H. sapiens Twist family transcription factors and is distinct from the Twist gene characterized in C. telata. I extended the search for Paraxis-like homologs within the Lophotrochozoan superphylum to the mollusk, Lottia gigantea. BLASTing the L. gigantea genome with H. robusta Paraxis-like, H. sapiens Paraxis, and H. sapiens Scleraxis resulted in two hits, gw1.213.9.1 and fgenesh2_pg.Csca_21300000S (http://www.jgLdoe.govI). The E value for both ofthese genes differs in magnitude by greater than 10 from the third closest match. For the phylogenetic analysis, I selected gw1.213.9.1 as a Paraxis-like homolog in L. gigantea that was used in the phylogenetic analysis. 28 Table 2. BLAST matches and Evalues for Paraxis-Iike homolog in the Lottia Jltnantea 2enOme. Protein ID Gene Name Bit Score Evalue 58249 gw1.213.9.1 105 1e-25 174714 fgenesh2_pg.Csca_213 000005 105 3e-25 133636 e gw1.85.141.1 81 8e-15 83668 gw1.3.4741 80 2e-14 B. Lottiaaiaantea BLAST outout or Homo saoiens Paraxis Query Protein ID Gene Name Bit Score E value 58249 gw1.213.9.1 87 2e-19 174714 fgenesh2_pg.C_sca_213 000005 87 7e-19 83668 gw1.3.474.1 65 6e-13 79113 gw1.85.84.1 62 3e-09 C. Lottia .QiQantea BLAST output or Homo saoiens SIc eraxis que v Protein ID Gene Name Bit Score E value 58249 gw1.213.9.1 101 1e-24 174714 fgenesh2_pg.C_sca_213000005 101 4e-24 133636 e gw1.85.141.1 75 6e-13 !l122Ji gw1 3474.1 74 8e-13 The bHLH domain of Paraxis-like in L. gigantea is more similar to H. sapiens Paraxis and Scleraxis (greater than 71% shared sequence identity) than it is to the bHLH domain of H. sapiens Twist-family genes (Fig. 10). Because Twist has not yet been characterized in L. gigantea, I searched the genome for a Twist-like homolog to provide further evidence that the predicted Paraxis-like gene in L. gigantea is indeed distinct from a Twist-like gene. Comparing the bHLH regions ofthe sequences reveals only a 52.5% shared sequence identity. 29 JiJmJJ. ~ basic beljx loop h@lix % Homology Paraxis-like L. gigantea RMSANARERDRT HSVNSAFVTLRTMIP TEPADRKLS KIEVLRLSASYIAHLNTLLMVGS Paraxis H. sapiens .QA Q I..TA l ....•V.•..•...I. .. AS ANV.Ll.D 71.2 5cleraxis H. sapiens .HI. NT .. TA L T AS S.. GNV.LA.E 71.2 Twist-like L. gigantea .VL ..V Q.. E.L.D .. AQ .. KI L.5.- QT.K.A5R .. DF.YQV.R5ED 52.5 Twist H. sapiens .VM ..VQ.. Q.L.E .. AA .. KI L.5.- QT.K.A.R .. DF.YQV.Q5DE 54.7 Handl H. sapiens KG.GPKK .. R.. E.1 .... AE .. EC .. NV .. ,T Kl. ,.AT ....Y.MDV.AKDA 54.2 Figure 10. bHLH domain amino acid sequence alignments for L. gigantea Paraxis-Iike and Twist-like and H. sapiens TWist-family genes. Paraxis-like shares a higher sequence identity with H. sapiens Paraxis and Scleraxis genes than it does with the other H. sapiens Twist-family transcription factors and is distinct from the Twist gene predicted in L. gigantea. Due to the putative conservation ofa Paraxis-like gene in the Lophotrochozoan superphylum, I then explored the possible existence of a Paraxis homolog within the Ecdysozoan clade. I performed a search using JGI on the basal arthropod crustacean Daphnia pulex. (http://www.jgLdoe.govI). estExUgeneshl_pg.C_890001 was identified as the highest matching sequence for all three queries. The E value for estExtjgeneshl_pg.C_890001, hereafter termed Paraxis-like for ease, differs from the next closest matches by a magnitude range of 10 to 16. 30 Table 3. BLAST matches and Evalues for Paraxis-Iike homolog in the Daphnia pulex genome. A. Damhnia puIex BLAST output for HeIbdll0 e a robusta Paraxis-Iki e query Protein ID CeneName Bit Score Evalue 227979 estExUgeneshl_pg.C_890001 100 5e-22 39727 e_gw1.1.756.1 70 3e-12 45040 e_gw1.8.477.1 70 3e-12 99035 fgeneshl_pg.Cscaffold_l0000458 69 7e-12 B. DaPIhnia pu ex BLAST output for Homo sapiens Paraxis Query Protein ID CeneName BitScore Evalue 227979 estExUgeneshl_pg.C890001 95 ge-23 259955 SNAP_00028013 55 5e-11 18360 gw1.137.20.1 60 2e-09 66944 e_gw1.571.8.1 59 3e-09 CDapJhnia puIex BLAST output for Homo SQPiens SIc eraxis Query Protein ID CeneName BitScore Evalue 227979 estExUgeneshl_pg.C_890001 113 2e-30 259955 SNAP_00028013 60 le-14 94620 gw1.147.45.1 69 5e-12 155726 gw1.8.476.1 67 2e-11 Like in the Lophotrochozoans, the bHLH region of the D. pulex Paraxis-like gene shares a significantly higher, greater than 81%. sequence identity with Paraxis and Scleraxis than it does with the other Twist family genes, which shared less than 60% identity. ~ SJ>e.c.i.e.s. bgsic heli x 1 pop Paraxis-like D. pulex Paraxis H. sapiens 81.4 Scleraxis H. sapiens 84.7 Twist-like D. pulex 57.6 Twist H. sapiens 59.3 Handl H. sapiens 54.2 Figure 11. bHLH domain amino acid sequence alignments for D. pulex Paraxis-like and Twist and H. sapiens Twist-family genes. Paraxls-Iike shares a higher sequence identity with H. sapiens Paraxis and Sc/eraxis genes than it does with the other H. sapiens Twist-family transcription factors and is distinct from the Twist gene characterized in D. pulex. 31 To provide support that this gene could be conserved throughout the arthropod phylum, I searched for a putative Paraxis homolog in the beetle Tribolium castaneum. Using Flybase, I found that a gene called "PREDICTED: similar to Scleraxis" to be the closest match to all three queries (http://flybase.org/). This gene was previously predicted using the gene prediction method GNOMON based on the NCBI RefSeq for Scleraxis (http://www.ncbLnlm.nih.gov). As seen in the following table, PREDICTED: similar to Scleraxis, hereafter termed Paraxis-like for simplicity, differs from the next closest match, PREDICTED: similar to heart and neural crest derivatives, by 7 to 11 orders of magnitude. Table 4. BLAST matches and Evalues for Paraxis-like homolog in the Tribolium castaneum genome. A. TribaIium castaneum BLAST output for Helobdella robusta Paraxis-like query Accession Number Gene Name Bit Score E value XP_001808472 PREDICTED: similar to Scleraxis 91 ge-19 XP_972310.1 PREDICTED: similar to heart and 67 8e-12 neural crest derivatives XP_968572.1 PREDICTED: similar to Transcription 63 2e-10 factor 21 XP_974297.1 PREDICTED: absent MD neurons and 62 4e-10 olfactorv sensilla B Tn'b 0 r/Um castaneum BLAST output or omosaptens Paraxis uery Accession Number Gene Name Bit Score E value XP_001808472.1 PREDICTED: similar to Scleraxis 90 1e-18 XP_972310.1 PREDICTED: similar to heart and 56 2e-08 neural crest derivatives XP_969923.2 PREDICTED: similar to helix-Ioop- 53 2e-07 helix protein hen NP_001034496.1 Twist 52 2e-07 C Tfl'b 0 r/Urn castaneum BLAST output or omosapiens ScIerax;s Query Accession Number Gene Name Bit Score E value XP_001808472.1 PREDICTED: similar to Scleraxis 97 6e-21 XP_968572.1 PREDICTED: similar to Transcription 62 2e-10 factor 21 XP_972310.1 PREDICTED: similar to heart and 62 3e-10 neural crest derivatives NP_001034496.1 Twist 61 4e-10 32 The bHLH region ofthe Paraxis-like gene in T. castaneum shares greater than 78% sequence identity with Paraxis and Scleraxis and less than 56% sequence identity with the bHLH regions ofthe other Twist-family genes. Further supporting the idea that a Paraxis-like gene may exist within the Ecdysozoa, the bHLH regions ofthe Paraxis-like gene in T. castaneum and the Paraxis-like gene in D. pulex share an identity of88.1%, which reveals a high level ofsequence similarity within the clade. lifne. .$.Qe.c.i.e..s. bosic helix lopp helix 'll Homology Poraxis-like T. castaneurn RSQANARERORT HSVNTAFSTLRTLIP TEPKDRKLS KIETLRLASSYISHLGTQLMAGP Paraxis H. sapiens .QA Q.•....TA v A.. ANV.Ll.D 78.0 Scleraxis H. sapiens .Hr N TA A , .•..NV.l..E 83.0 Twist H. sapiens . VM .. VQ.. Q. L. E. .AA ..KL ..L. S. -... ..Q.. K.. AR ..DF. YQV .QSDE 55.9 Twist To castaneum .VM .. VQ.. Q.L.E .. AS .. KS ...M.SD- Q..K.. AR .. DF.YHV.SNEN 54.2 Handl H. sapiens KGSGPKK .. R.. ESLS .. AE .. EC .. NV.A.T KT AY.MDV.AKDA 47.5 Paraxis-like D. pulex .. H S..TA A A V... 88.1 Figure 12. bHLH domain amino acid sequence alignments for T. castaneum Paraxis like and Twist and H. sapiens Twist-family genes. Paraxis-like shares higher sequence identity with H. sapiens Paraxis and Scleraxis genes than it does with the other H. sapiens Twist-family transcription factors and is distinct from the Twist gene characterized in T. castaneum. Next, I used the Homo sapiens Paraxis gene to search within the Ecdysozoan fruitfly Drosophila melanogaster genome to see ifan artifact ofa Paraxis-like gene could persist in the highly developed insect. Indeed, BLASTing the H. sapiens Paraxis gene against the D. melanogaster genome revealed CG33557 as the closest match for Paraxis-like, Paraxis, and Scleraxis (http://flybase.org). The Evalue for CG33557, hereafter called Paraxis-like, differed from the next closest match by between 4 and 11 orders of magnitude. 33 Table 5. BLAST matches and Evalues for Paraxis-Iike homolog in the Drosophila melanogastergenome. ADrasaplhii a meIano aster BSTLA output ~or HeIbdll0 e a robusta Paraxis-Iki e uery Accession Number Gene Name Bit Score E value XP_001BOB472 CG33557 80 4e-15 XP_972310.1 hand 66 6e-11 XP_968572.1 basic helix-Ioop-helox transcription 59 1e-8 factor XP_974297.1 RT01144p 59 1e-8 B. Drosoohila melanoaaster BLAST output for Homo saoiens Paraxis ouerv Accession Number Gene Name Bit Scare E value XP_001808472.1 CG3357 90 1e-18 XP_972310.1 hand 56 2e-08 XP_969923.2 RH30329p 53 2e-07 NP_001034496.1 Twist 52 2e-07 C. Drosoohila melanoaaster BLAST output for Homo saoiens Scleraxis ouerv Accession Number Gene Name Bit Score E value XP_001808472.1 PREDICTED: similar to 5cleraxis 97 6e-21 XP_968572.1 PREDICTED: similar to Transcription 62 2e-10 factor 21 XP_972310.1 PREDICTED: similar to heart and 62 3e-10 neural crest derivatives NP_001034496.1 Twist 61 4e-10 Paraxis-like in D. melanogaster shares over 65% identity ofamino acid residues within the bHLH regions to H. sapiens Paraxis and Scleraxis. However, the gene identified in the BLAST search was truncated in the basic region and was thus excluded from the phylogenetic analysis. Not surprisingly, D. melanogaster shared its highest homology to the bHLH domain ofanother arthropod Paraxis-like gene with 72.9% of its residues identical to that ofD. pulex. 34 liJme SJ=ill bel j x 1 nnn hel j x % Homology Poraxis-like D. melanogaster RT FNVNSAYEALRNLIP TEPMNRKLS KIEIIRLASSYITHLSSTLETGT Paraxis H. sapiens .. QS .. T.FT T VD TL. A..ANV.LL.D 65.3 Scleraxis H. sapiens .. NS ..T.FT T AD TL S.• GNV.LA.E 65.3 Twist D. melanogaster .. QSL.D.FKS.QQI. .. L.SD- QTLK .. TR .. DF.CRM.SSSD 42.9 Twist H. sapiens .. QSL.E.FA ...KI. ..L.SD- QTLK .. AR .. DF.YQV.QSDE 46.9 Handl H. sapiens .. ESI. .• FAE .. EC.. NV.ADT KTL T AY.MDV.AKDA 55.9 Paraxis-like T. castaneum .. HS .. T.FST .. T KD TL 5 ..GTQ.MA.P 69.5 Paraxis-l ike D. pulex .. HS FT T AD TL .•..•..A..GTQ.VA.P 72.9 Figure 13. bHLH domain amino acid sequence alignments for D. melanogaster Paraxis-like and Twist, H. sapiens Twist-family genes, and predicted arthropod Paraxis-like genes. Paraxis-like shares higher sequence identity with H. sapiens Paraxis and Scleraxis genes than it does with the other H. sapiens Twist-family transcription factors and is distinct from the Twist gene characterized in D. melanogaster. Paraxis-like in D. melanogaster shares more than 69% ofits bHLH identity with the Paraxis-like genes identified in T. castaneum and D. pulex. The identification of Paraxis-like genes within all three Bilaterian superphyla introduces the possibility that a Paraxis homolog may have evolved prior the evolution of Bilateria. To explore this possibility I searched within the cnidarian Nematostella vectensis genome. Interestingly, a potential homolog, gw.53.120.1, was identified by all three queries. The E value for gw.53.120.1, hereafter Paraxis-like for ease, differs from the next closest matches between 9 and 11 orders of magnitude. 35 Table 1. BLAST matches and Evalues for Paraxis-like homolog in the Nematostella vectensis genome. A. Nematastella vectensis BLAST autnut far Helabdella rabusta Paraxis-like query Protein ED Gene Name Bit Scare E value 29762 gw.53.120.1 100 3e-21 99666 e_gw.53.242.1 68 1e-11 106073 e_gw.80.307.1 67 2e-11 141592 e~.588.6.1 65 1e-10 B. Nematastella vectensis BLAST autnut far Hama saniens Paraxis ouerv Pratein ED Gene Name Bit Scare Evalue 29762 gw.53.120.1 89 4e-18 106438 e~.81.71.1 59 3e-09 106073 e_gw.80.307.1 59 4e-09 90352 e_gw.23.7.1 58 6e-09 C. Nematastella vectensis BLAST autnut for Hamo saniens Scleroxis ouerv Pratein ED Gene Name Bit Scare Evalue 29762 gw.53.120.1 103 2e-22 97005 e gw.44.68.1 66 3e-11 106073 e gw.80.307.1 66 3e-11 106438 e_gw.81.71.1 66 4e-11 Intriguingly, the bHLH region ofthe Paraxis-like gene shares over 76.3% sequence identity with the bHLH regions ofthe H. sapiens Paraxis and Scleraxis genes. Furthermore, the analyzed domain shares less than 62% sequence identity with its own Twist bHLH domain and with the other H. sapiens Twist-family genes' bHLH regions. lion« ~ basi c helix loop hp,U X % Homo} ogy paraxis-like N. vectensis RQAANARERNRT H$VNAAFNAlRllIP TEP5DRKLS KIETlRLASSYIAHLSTIlISGT paraxis H. sapiens ...... 0.. QT.. TTV ANV.ll.O 79.7 scleraxis H. sapiens .HT 0.. NT.. TTA S..GNV.lA.E 76.3 twist N. vectensis .AI .. VQ.. QAl. E... K.. KI l - Q R.. OF .CQV .GNNE 61.0 twist H. sapiens . VM .. VQ.. Q.l. E.. A... KI l - Q..K..AR ..OF. YQV .Q.OE 61.0 handl H. sapiens KGSGPKK ..R.. E.I.S.. AE .. EC .. NV.A.T K.....T.... Y.MOV.AKOA 50.8 Figure 14. bHLH domain amino acid sequence alignments for N. vectensis Paraxis-Iike and Twist and H. sapiens Twist-family genes. Paraxis-like shares higher sequence identity with H. sapiens Paraxis and Scleraxis genes than it does with the other H. sapiens Twist-family transcription factors and is distinct from the Twist gene characterized in N. vectensis. 36 After identifying Protostome genes sharing a high sequence identity with H. sapiens Paraxis, [ analyzed the bHLH regions of the selected protein sequences. All of the Protostome sequences share a greater than 66% sequence identity with the Paraxis-like gene identified in H. robusta. The bHLH region ofthe fellow annelid C. telata shares the highest sequence identity with 74.6% ofits amino acid residues consistent with H. robusta. ~ ~ bps;c helix loop h,.lix ~ Hnmolnnv Paraxis-l ike H. robusta RRTANARERDRT YNVNNAFHHLR5IIP TEPADRKL5 KIETIRLAT5YIAHLHTVINTDL Paraxis-like Co telata .55 5•. 5 .• IT.. TL L. 5 LMAGI 74.6 Poraxis-like L. gigantea .M5 ...... •.• H5 •. 5.•VT .. TM VL .. 5A N.LLING5 66.1 Paraxis-l ike O. pulex .5H H5 •. 5..TA ..TL. L. ..5 G.QLVAGP 69.5 Paraxis-like T. castanetlm .5Q H5 ..T.. 5T .. TL K 5 5 .. G.QLMAGP 67.8 Paraxis-like N. vectensis .QA N.. HS .• A.. NA ..ll. 5 L 5 S.ILISGT 66.1 Figure 15. bHLH domain amino acid sequence alignments for predicted Protostome Paraxis-like genes. 37 Sequence Alignment and Phylogeny Figure 16 shows the complete list ofselected and predicted sequences of Twist-family protein sequences aligned using CLUSTAL-W. 17 ofthe amino acid residues are conserved in the bHLH region ofall ofthe protein sequences of interest. This multiple alignment was then imported into MRBAYES for phylogenetic analysis. li.eM Sped es Il Paraxis H. sapiens RQAANARERDRT QSVNTAFTALRTLIP TEPVDRKLS ~IETLRLASSYIAHLANVLLLGD Paraxis U. musculus RQAANARERDRT QSVNTAFTALRTLIP TEPVDRKLS KIETLRLASSYIAHLANVLLLGE Paraxis G. gallus RQAANARERDRT QSVNTAFTALRTLIP TEPVDRKLS KIETLRLASSYISHLANVLLLGE Paraxis S. solar RNAANARERDRT QSVNTAFTALRTLIP TEPVDRKLS KIETLHLASSYISHLANTLQLGD Paraxis S. canicula RQAANARERDRT HSVNTAFSALRTLIP TEPfORKLS KIETLRLASSYISHLGNILLLGE Paraxis S. kowalevskii RTAANARERDRT HSVNSAFTTLRDLIP TEPPDRKLS KIETLRLAASYISHLETTLLVGE Scleraxis H. sapiens RHTANARERDRT NSVNTAFTALRTLIP [EPADRKLS KIETLRLASSYISHLGNVLLAGE Scleraxis M. musculus RH~ANARERDRT NSrNTAFTALRTL[P TEPADRKLS KIETLRLASSYIS~LGNVLLVGE Scleraxis G. gallus RHTANARERDRT NSVNTAFTALRTLIP EPADRKLS KIETLRLASSYISHLGNVLLVGE Scleraxis D. rerio RNAANARERDRT NSVNTAFTALRTLIP TEPADRKLS KIETLRLASSYISHLGNVLLVGE Scleroxis S. canicula RQAANARERDRT NSVNTAFTALRTLIP TEPADRKLS KIETLRLASSYISHLGNVLLLGE Twist H. robusta RVLANVRERQRT QSLNDAFSQLRKIVP TLPSD-KLS KIQTLKLATRYIDFLYDQLENNK Twist C. telata RSIANIRERQRT QSLNEGFAHLRQIIP TLPSD-KLS KIQTLKLATRYIDFLYQVLRSED Twist-l ike L. giganteo RVLANVRERQRT ESLNDAFAQLRKIIP TLPSD-KLS KIQTLKLASRYIDFLYQVLRSED Twist N. vectensis RAIANVRERQRT QALNEAFNKLRKIIP TLPSD-KLS KIQTLRLASRYIDFLCQVLGNNE Twist-like D. pulex RVLANVRERQRT QSLNEAFSALRKIIP TLPSD-KLS KIQTLKLAARYIDFLYQVLRTDD Twist T. castanet.m RVMANVRERQRT QSLNEAFASLRKSIP TMPSD-KLS KIQTLKLAARYIDFLYHVLSNEN Twist D. melanogaster RVMANVRERQRT QSLNDAFKSLQQIIP TLPSD-KLS KIQTLKLATRYIDFLCRMLSSSD Twist H. sapiens RVMANVRERQRT QSLNEAFAALRKIIP TLPSD-KLS KIQTLKLAARYIDFLYQVLQSDE Twist G. gallus RVMANVRERQRT QSLNEAFAALRKIIP TLPSD-KLS KIQTLKLAARYIDFLYQVLQSDE Twist S. canicula RVVANVRERQRT QSLNDAFATLRKIIP TLPSD-KLS KIQILKLATRYIDFLYQVLQNDE Twist S. kowalevskii R~ANVRERQRT QSLNEAFSALRKIIP TLPSD-kLS KIQTLKLATRYIDFLYQVLRSDE Twist S. purpuratus RVLANVRERQRT QSLNDAFTNLRKIIP TLPSD-KLS KIQTLKLASRYIDFLFQVLKSDE Twist C. elegans RACANRRERQRT KELNDAFTLLRKLIP SMPSD-KMS KIHTLRIATDYISFLDEMQKNGC Dermal H. sapiens RILANVRERQRT QSLNEAFAALRKIIP TLPSD-KLS KIQTLKLAARYIDFLYQVLQSDE Handl H. sapiens KGSGPKKERRRT ESINSAFAELRECIP NVPADTKLS KIKTLRLATSYIAYLMDVLAKDA Hand2 H. sapiens RGTANRKERRRT QSINSAFAELRECIP NVPADTKLS KIKTLRLATSYIAYLMDLLAKDD Figure 16. Partial amino acid sequence alignments ofTwist-family genes analyzed in the phylogenetic reconstruction. CLUSTAL-W alignments of 3' Paraxis, Scleraxis, Twist, Dermal, Handl, and Hand2 genes. Paraxis-like and Twist-like are the predicted Protostome homologs to H. sapiens Paraxis and Twist, respectively. Dashes represent gaps inserted to align homologous residues. Highlighting indicates amino acid residues identical to that of H. rabusta Paraxis-like. 38 To understand the evolutionary relationship between the Paraxis-like gene in H. robusta and other Twist-family genes, I performed Bayesian analysis with MrBayes using the Jones-Taylor-Thornton OTT) model of protein evolution CRonquist and Huelsenbeck, 2003; Jones et aI., 1992). 4 chains were run for 2,000,000 generations. After a burn-in of 5000 generations, every 100th tree was sampled to estimate the consensus topology. Clade credibility values and branch lengths were determined using MrBayes. The phylogeny in Figure 17 presents the analysis. This phylogenetic analysis separated the Twist family genes into three distinct clades: Hand, Paraxis/Scleraxis, and Twist Within the Paraxis/Scleraxis clade, the characterized vertebrate sequences separated into two families of orthologs: Paraxis and Scleraxis. All of the putative Paraxis-like Protostome genes fell within the Paraxis/Scleraxis clade. Both of the putative Twist-like genes were grouped within the Twist ortholog family. Interestingly, the Paraxis-like genes for Ecdysozoa are more closely related to each other than they are to any other sequences. Similarly, the Lophotrochozoa Paraxis-like genes in C. telata and L. gigantea are most closely related to one another. Paraxis-like in H. robusta falls into the Paraxis subfamily with a clade credibility value of 100%. Thus, this analysis identifies Paraxis-like as a Paraxis homolog. hand1 H sapiens _ hand2 H sapiens 39 0 0 => IparaxiSlike H robusla I '"0 ~ paraxislike C telata 3 E!. 2 paraxislike L gigantea '" paraxislike N vectem 0 0 Pa raxis H sapiens o par rE'I axis M musculus 0 0 ~ paraxis G gallus - 0 '" 0 paraxis S salar ~ _ paraxisS canicula 0 ... ~ I"'" scIeraxis H sapiens ~ scleraxis M musculus ~ 0 - ~ scleraxis G gallus 0 .. scleraxis 0 rerio ~ 0 .. scleraxis S canicula - '" paraxis S kowalevskii paraxislike 0 pulex 15 .....0=> paraxlslike T castaneum twist H robusta twist C telata _ twistlike L gigantea twist N vectensis _ twistlike D pulex twist T castaneum twist 0 melanogaster '"~ • twist H sapiens • twist G gallus twist S canicula ~ ~ twist S kowalevskii twist S purpura ... dermo1 H sapiens twist C elegans o o o o o o o o o o o <0 (» ..., OJ o o o o '"o '"o ..o o '"o o Figure 17. Phylogenetic analysis of Twist-family gene homologs. Bayesian phylogenetic tree of the Twist-family transcription factors Paraxis, Scleraxis, Twist, Dermot Hand!, and Hand2 constructed with alignment of amino acid sequences using Mega3 software. Hand! used as the outgroup. Numbers indicate the cladistic credibility for each node, based on MrBayes analysis. 40 Spatial and Temporal Expression ofParaxis-Iike in Helobdella robusta To understand the spatial and temporal expression ofParaxis-like in H. robusta development, I performed a series of in situ hybridization experiments testing a Paraxis-like antisense mRNA probe across a spectrum of developmental stages in normal H. robusta embryos. The experiments suggest that H. robusta Paraxis-like is dynamically expressed throughout early development, gastrulation, postgastrulation, and organogenesis. Paraxis-like Expression in Early Development In early H. robusta development, Paraxis-like is expressed in the teloplasm and as a punctate patterning on the surface of the developing zygote. Between fertilization and the initiation ofthe first cleavage,leech zygotes undergo a cytoplasmic reorganization during which the teloplasm, a mitochondria and maternal mRNA-enriched yolk, forms in the center of the cell and migrates to the animal and vegetal poles (Weisblat and Huang, 2001). In the early one-celled embryo, Paraxis-like is expressed in the emerging teloplasm (Fig. 18A). After the first cleavage, the teloplasm becomes restricted to the CO cell ofthe stage 2 embryo. In the stage 2 embryo, Paraxis-like is expressed in the teloplasm of the CO cell (Fig. 18B). The second cleavage ofthe zygote creates four cells with the teloplasm restricted to the 0 macromere (Weisblat and Huang, 2001). The in situ hybridization of the four-celled embryo suggests that Paraxis-like is most strongly expressed within the 0 macromere, which later gives rise to the 5 bilaterally symmetric teloblasts, and is more faintly expressed throughout the remainder of the embryo (Fig. 18C). 41 GIb ~ B. c. Figure 18. Paraxis-Iike gene products in early H. robusta embryos, analyzed by in situ hybridization. Arrows indicate teloplasm expression. A.) Stage 1. Animal pole is up. Paraxis-like transcripts are distributed throughout the zygote with a concentration near the animal teloplasm. Punctate surface patterning persists throughout early development. B.) Stage 2. Paraxis-like transcripts are enriched in the CD teloplasm. c.) Stage 4. Paraxis-like transcripts are expressed throughout the embryo. (Weisblat and Huang, 2001). Scale bar: 100f!m. 42 Paraxis-like Expression during Gastrulation During gastrulation, Paraxis-like remains predominantly expressed in the progeny ofthe teloblast cells. As shown in the early stage 8 embryo, Paraxis-like expression, indicated with arrows, is iterated in patches in the bandlets cutting transversely across the coalescing germinal bands (Fig. 19A). The middle-late stage 8 embryo shows a symmetric segmental pattern ofParaxis-like expression in the 4 anterior segments ofthe fused germinal plate (Fig. 19B). The arrow indicates the point of coalescence ofthe bands, at which the ipsilateral Paraxis-like domains of expression merge together. A. B. Figure 19. Paraxis-like gene products in H. robusta, Stage 8 embryos, analyzed by in situ hybridization. Anterior at top. A.) Early Stage 8. Paraxis-like transcripts expression, indicated with white arrows, is iterated along the ipsiliateral bandlets as the germinal bands begin to coalesce in the anterior of the embryo. B.) Middle Stage 8. Paraxis-like transcripts are expressed bilaterally in the four anterior segments, indicated with white dots, as the germinal bands fuse into a germinal plate. The white arrow indicates the point of coalescence ofthe two germinal bands. Scale bar: 100!!m. 43 Paraxis-like Expression Post-gastrulation As gastrulation is completed, Paraxis-like follows a dynamic course of expression. Atransient full-length wave of expression is followed by two subsequent waves, which progress through all 32 body segments from the anterior to the posterior ofthe developing leech, in first the M (mesodermal) and then the N (neuroectodermal) lineages. In the late stage 8 embryo, Paraxis-like is expressed along the midline of the embryo and is concentrated in the developing nerve cord, indicated by the arrow at the anterior end (Fig. 20A). In addition, symmetrical segmental stripes extend transversely out from the midline. These stripes of Paraxis-like expression are most definitive in the anterior with expression becoming progressively more faint towards the posterior. This anterior to posterior progression of Paraxis-like expression is consistent in the stage 9 embryos (Fig. 20B-20C). In the mid-stage 9 embryo, the expression in the anterior appears to be more diffuse than the concentrated expression in the mid-body, which suggests a dynamic wave of expression (Fig. 20C). The ventral view of the early and mid-stage 9 embryos suggests Paraxis-like is expressed in both the Nand Mteloblast lineages (Fig. 20B-20C). At stage 9, Paraxis-like is clearly expressed in the progeny of the M blast cell. Paraxis-like transcripts are present in the cavitating mesodermal hemisomites distal to the hemiganglia and are iterated in symmetric mediolateral stripes, comprising developing muscle and nephridial tissues (Fig. 20D-20E) (Weisblat and Huang, 2001). In addition, faint expression is present in the N teloblast lineage (Fig. 20B- 44 20C). Paraxis-like expression along the midline ofthe embryo precedes the development ofthe central nerve cord. In addition, Paraxis-like can be faintly observed within the developing hemiganglia, which flank the emerging nerve cord along the ventral midline (Fig. 20C). 45 A. B. c. M Kinship Group D. E. Figure 20. Paraxis-Iike gene products in H. robusta, postgastrulation, analyzed by in situ hybridization. Anterior is top in A, B, D, and Eand left in C. Paraxis-like products are expressed in an anterior to posterior progression. A.) Late Stage 8. Paraxis-like is expressed along the ventral midline (white arrow) and in bilateral segments. B.) Paraxis like transcripts are found in the emerging nerve cord (white arrow) and as segmental mesodermal tissue (red arrows). C.) Middle Stage 9. Paraxis-like transcripts are found in the nerve cord (white arrow), hemiganglia (yellow dots, yellow bracket), and segmental bands (red arrows). D.) Magnification of 20B and schematic ofMkinship group. Paraxis like is expressed in the segmental precursor to mesodermal muscle (pink arrow) and nephridial tissues (orange bar) (Weisblat and Huang, 2001). Scale bar: 100flm. 46 Paraxis-like Expression during Organogenesis In early stage 10 of development, leech embryos progressively undergo organogenesis along their anteroposterior axis (Weisblat and Huang, 2001). Lateral stripes ofParaxis-like expression in the Mlineage transect the entire length ofthe embryo with faint expression along the length of the ventral nerve cord (Fig. 21). However, as this bilateral expression progresses, a wave of strong expression in the Mteloblast lineage seems to be followed by a wave of concentrated expression in the progeny of the N blast cell. The waves ofParaxis-like expression originate in the anterior and progress posteriorly. In the N lineage, Paraxis-like is distinctly expressed in the hemiganglia of the anterior of the embryo (Fig. 21A). Residual striations ofM lineage expression are also visible in the hemisomite tissue just distal to the hemiganglia. Moving toward the posterior of the embryo, Paraxis-like is most concentrated in stripes extending distally from the ventral midline and is weakly expressed in the hemiganglia between the thin transects. The magnified image and the schematic show how the Stage 10 expression of Paraxis-like is consistent with the anatomical location of the N kinship group that gives rise to leech neuroectodermal tissue (Fig. 218-C). 47 N Kinship Group c. Figure 21. Paraxis-Iike expression in H. robusta, Stage 10 embryo, displayed by in situ hybridization. A.) Paraxis-like transcripts are visible in an anterior-to-posterior progression along the length ofthe leech. In the posterior, Paraxis-like is present in horizontal transects (red arrows) stemming out from the ventral midline. In the anterior, Paraxis-like is expressed in the hemiganglia (yellow dots), nerve cord (white arrow), and as faint striations in the hemisomites (orange bars). B.-C) Magnification of 21A and schematic of N kinship group. Paraxis-like has strong expression in the hemiganglia (pink arrow) (Weisblat and Huang, 2001). Scale bar: 100flm. 48 DISCUSSION Paraxis-like in Helobdella robusta is the first reported expression of a Paraxis homolog in a Protostome. While Paraxis was previously believed to be restricted to chordates, these data demonstrate that Paraxis is expressed in the mesodermal tissue of Protostome annelids during segmentation and organogenesis. This finding suggests that the mesodermal function of Paraxis originated in the last common ancestor of Bilateria and provides support for a common origin for segmental pattern formation in Bilateria. Evolution ofthe Paraxis subfamily To construct the molecular phylogeny, I first obtained putative Twist-family amino acid sequences using the NCBI and Flybase protein data banks. In addition, I employed BLAST algorithms to identify putative Paraxis homologs in Lophotrochozoa, Ecdysozoa, and cnidaria. Using Bayesian analysis, I estimated a phylogeny for the evolution ofthe Paraxis subfamily within the framework ofthe well-characterized Twist-family genes. This phylogeny demonstrated that the candidate Paraxis-like gene fell within the Paraxis sub-family evolutionarily. Thus, Paraxis-like in H. robusta will be henceforth termed simply Paraxis. bHLH alignment homology showed H. robusta Paraxis is highly similar to both vertebrate Paraxis and Scleraxis and significantly divergent from H. robusta Twist. The phylogeny constructed using Bayesian Inference provides strong support for the identification of a Paraxis homolog in leech. H. robusta Paraxis and all ofthe putative Protostome Paraxis-like sequences fell within the Paraxisj Scleraxis subfamily with a clade credibility value of 100%. The presence of putative Paraxis 49 homologs in C. telata, L. gigantea, T. castaneum, and D. pulex suggests that Paraxis may be broadly conserved across Protostomes, and moreover, Bilateria. In addition, the identification ofa Paraxis-like gene sequence in the N. vectensis genome, a cnidarian, suggests that Paraxis may have evolved prior to the rise of Urbilateria. To resolve this possibility, the expression patterns and functional characteristics ofthe putative Paraxis homologs will need to be further explored across a diversity of metazoans from all of the major phyla. Furthermore, as the separation between Paraxis and Scleraxis is monophyletic within the Deuterostomes, it seems likely that the gene duplication event that led to the differentiation of Paraxis and Scleraxis occurred after Deuterostomes diverged from Protostomes. Thus, the Paraxis gene identified in H. robusta can be just as well understood to be a Scleraxis homolog. For this phylogeny, only the bHLH domains were aligned and analyzed because these were the only sequences that could be unambiguously compared across all Twist-family genes. Paraxis Is Expressed throughout H. robusta Embryonic Development. A spatiotemporal expression analysis suggests that Paraxis is initially present as a maternal gene product in the teloplasm during early development. Later, with the onset of blast cell formation, zygotic expression of Paraxis can be observed in waves of expression progressing posteriorly along first the mesodermal and then the neuroectodermal germ layers with a particular concentration in the leech nervous system. 50 Maternal RNA The broad distribution of Paraxis in the teloplasm ofthe early leech embryos suggests that Paraxis is initially introduced to the developing zygote as a maternal gene product Several other key developmental transcription factors, including Twist homolog Hro-twi, nanos, and Pax3 homolog Hau-Pax3/7A, are also present in maternal RNA in the teloplasm of early leech embryos (Soto et aI., 1997; Pilon and Weisblat, 1997; Woodruff et aI., 2007). Early Paraxis expression is concentrated in the teloplasm of the developing embryo (Fig. 22A-22E). Following the cytoplasmic reorganization during stage 1 of embryonic development, Paraxis is concentrated in the teloplasm at both the animal and vegetal poles. After the first cleavage, the Paraxis expression is localized to the CD cell, and the second cellular cleavage further limits expression to the D macromere and the micromeres. Significantly, the D macromere later gives rise to the 10 teloblasts from which the germinal bands and ectodermal and mesodermal tissues develop (Weisblat and Huang, 2001). Although non-specific binding of digoxigenin-Iabeled RNA probe to teloplasm has been reported in other studies using in situ hybridization in early leech embryos (Soto et aI., 1997), the Savage lab has conducted ten control experiments using sense probes to confirm the specificity ofthe Paraxis mRNA probe and to validate the presence of Paraxis in maternal RNA. While the in situ hybridization experiments suggest that Paraxis is a maternal transcript, the presence of a developmental function ofthis transcript has yet to be deduced. In the future, researchers should knockdown Paraxis in the teloplasm to determine whether maternally derived Paraxis is critical to early leech development. 51 Segmental Precursorfor Neuroectodermal and Mesodermal Tissue As the leech embryos begin to form germinal bands, Paraxis appears to be expressed in iterated patches along the ipsilateral segmental tissue (Fig. 22F-22G). Initially, in early stage 8 embryos, Paraxis is expressed in bandlets spanning both ectodermal and mesodermal tissue (Data not shown). A similar pattern of expression, transecting all of the teloblast lineages of the germinal bands, has been observed in other key developmental genes, such as Hunchback, Notch, engrailed, and Nanos (Savage and Shankland, 1996; Rivera and Weisblat, 2009; Lans, Wedeen, and Weisblat, 1993; Pilon and WeisbIat, 1997). By mid-stage 8, as the germinal bands coalesce, Paraxis appears to be more specifically expressed within the progeny cells ofthe Nand Mlineages (Fig. 22G). Bilateral segmental patches of expression appear in the four anterior segments as the germinal bands fuse. In the future, these bands should be fluorescently labeled and sectioned parasagittally to determine conclusively that Paraxis is restricted to mesodermal and to neuroectodermal tissues. With gastrulation completed, Paraxis is expressed along the length of the ventral midline and in broad segmental stripes extending distally. The expression of Paraxis proceeds in a rostral-to-caudal gradient with a wave of expression in the M lineage followed by a wave in the N lineage (Fig. 22H-22L). As organogenesis progresses, Paraxis becomes more heavily concentrated in the newly developing ventral nerve cord and the segmental ganglia as it is downregulated in the mesodermal tissues. According to Greenberger's observations, Paraxis is no longer expressed in a segmental pattern during stage 11 when organogenesis is completed. S2 These findings suggest Paraxis plays a role in early mesodermal and neural differentiation. Evidence also indicates that H. robusta Paraxis is expressed distinctly from Twist. RT-peR analysis reveals Twist is expressed in early leech development and downregulated in H. robusta embryos after stage 9 (Soto et a!., 1997). Thus, the significant expression ofParaxis in stage 10 validates the specificity ofthe Paraxis probe. Furthermore, the high stringency ofthe presumed Paraxis expression patterns in this study argues against a cross reaction with Twist transcripts. S3 Stage 1 Stage 2 Stage 4. Early A. B. c. Stage 4. Mid Stage 6. Animal View Stage 8. Early D. E. F. Stage 8. Mid Stage 8, Late Stage 9 G. H. I. Stage 10 Stage 11 J. K. Figure 22. Overview ofParaxis expression in H. robusta. Arrows and arrowheads indicate Paraxis expression. A) Stage 1. Expression in the teloplasm at the animal pole (Greenberger. 2008). B.) Stage 2. Expression in the teloplasm of the CD cell. c.) Early Stage 4. Expression in the teloplasm of the D macromere and micromeres (Greenberger. 2008). D.) Mid Stage 4. Expression in the D macromere, micromeres, and the perinuclear cytoplasm (Greenberger, 2008). E.) Stage 6. Expression in all teloblasts and micromere cap (Greenberger, 2008). F.) Early Stage 8. Expression in bandlets across germinal bands. G.) Mid Stage 8. Expression in the 4 anterior segments of the fusing germinal plate. H.) Late Stage 8. Expression along ventral midline and in segmental stripes. I.) Stage 9. Expression most concentrated in the M lineage. J.) Stage 10. Expression in wave-like AP progression in M and N lineages. K.) Stage 11. No expression in ventral nerve cord ganglia (Greenberger, 2008). Scale bar: 100",m. 54 Implications of Leech Paraxis for Bilateria The phylogenetic and expression evidence support the presence ofa Paraxis homolog during segmentation of H. robusta. However, to prove a functional conservation for the Paraxis transcription factor across Bilateria, it is necessary to compare Paraxis between phyla. As demonstrated in the aforementioned engrailed example in arthropods and annelids, a conserved expression pattern does not equate to a conserved function. Here, I will lay out the evidence for a common origin of the mesodermal function of Paraxis in the last common ancestor of Bilateria and highlight areas for future experimental research to confirm this claim. Comparative Expression The findings of this thesis suggest that the molecular mechanisms of mesodermal patterning in Lophotrochozoa may be shared across Bilateria. Assuming Paraxis expression in H. robusta is representative of Paraxis expression in all annelids, the leech spatiotemporal expression data shares high similarity with vertebrate data. As indicated in the molecular phylogeny, the duplication event that led to the divergence of Paraxis and Scleraxis in vertebrates occurred subsequent to the divergence of Protostomes and Deuterostomes. Thus, Paraxis in H. robusta should be considered a homolog to both the Paraxis and Scleraxis genes in vertebrates. Taken in sum, vertebrate Paraxis and Scleraxis spatiotemporal expression is similar to H. robusta Paraxis expression. Like H. robusta, mice express Scleraxis broadly in early development (Brown et aI., 1999). Also similar to H. robusta, mouse, chick, zebrafish, and frog embryos express Paraxis during gastrulation and 55 subsequently in a rostral-to-caudal wave that progresses posteriorly through mesodermal tissue, immediately preceding segment formation (Burgess et aI., 1995; Barnes et aI., 1997; Shanmugalingam and Wilson, 1998; Carpio, et aI., 2004). In addition, delayed Paraxis expression in neuroectodermal tissues has also been demonstrated in Xenopus laevis (Carpio et aI., 2004). Mouse Scleraxis is expressed later in development during the early differentiation of the mesodermal somites. Then, both Paraxis and Scleraxis are universally downregulated throughout organogenesis. All together, the similar timing and domains of expression in vertebrate and annelid embryogenesis support the claim for a shared role of Paraxis across Bilateria. Unlike the temporal mesoderm patterning with Paraxis observed in vertebrates and annelids, the patterning of the mesoderm in Drosophila is primarily spatial and dominantly controlled by expression of the genes Dorsal, Snail, and Twist (Barnes and Firulli, 2009). In leech, Dorsal and Snail have been implicated in the differentiation of segments rather than in the patterning of mesodermal tissue (Goldstein et aI., 2001; Soto, Nelson & Weisblat, 1997). Aspatiotemporal expression analysis for the Twist homolog in leech has yet to be completed. in situ hybridization and knockdown experiments will be necessary to resolve whether the expression and function of Twist in H. robusta is consistent with that of Drosophila. While Drosophila is one ofthe best characterized arthropods, it represents a highly derived species. Thus, although mesodermal patterning in Drosophila appears to differ from that in H. robusta and vertebrates, it would be incorrect to discount the entire arthropod phylum due to this information bias. In fact, a variety 56 of other arthropods, including spiders, crustaceans, and myriapods, add somite-like structures posteriorly during segmentation much like vertebrates and annelids (Balavoine and Adoutte, 2003). In addition, the identification and conservation of Paraxis-like gene sequences in D. pulex and T. castaneum raises the possibility that Paraxis may serve a functional role in this posteriorly progressive patterning. Paraxis transcription factors may be a conserved arthropod segmentation mechanism that was lost or replaced by Twist in flies. Future projects should use in situ hybridization experiments to characterize the expression of Paraxis-like expression in arthropods that add segmental units posteriorly. Nervous System Understanding the timing and role of Paraxis in leech nervous tissue development is important for propelling the interphyletic comparisons with vertebrate Paraxis. So far, the only neural precursor Paraxis expression was discovered in Xenopus laevis (Carpio et aI., 2004). Carpio et al. demonstrated short lived expression in the sulcus limitans of the neural tube. Paraxis in X.laevis is downregulated in muscle tissues before it is transiently expressed in the neural tissues, similar to my observations of Paraxis in H. robusta. Unlike the broad expression in the H. robusta nervous system, Paraxis in X. laevis is limited to the third anterior region of the future spinal cord. Future research will be needed to determine if neural Paraxis expression is present and functionally conserved in vertebrates and across Bilateria. Due to its transient expression in a limited region, neural expression of Paraxis may have been heretofore overlooked in other vertebrates (Carpio et aI., 2004). Alternatively, Paraxis expression in leech 57 neuroectodermal tissue may indicate a unique expression of Paraxis derived in Lophotrochozoa. Greenberger observed expression of Paraxis in the ganglia beginning in stage 9 and maintained through stage 10 ofembryogenesis (Fig. 23) (2008). Her findings suggest a simultaneous expression of Paraxis in both the Mand Nlineages. In contrast, I observed a delay between the expression between the Mand Nlineages. The faint expression of Paraxis in the hemiganglia ofstage 9 became more strongly expressed in stage 10 after expression in mesodermal tissue has been down regulated. Both studies suggest Paraxis is downregulated more quickly in the mesodermal tissues than in the neuroectodermal tissues. Repetitive in situ hybridization experiments will be necessary in the future to definitively infer the timing of the onset of Paraxis expression in nerve tissue of leeches. 58 A 8. - c.. D. - Figure 23. Comparative expression ofParaxis in H. robusta, stage 9 and 10. A.-B.) Results ofGreenberger, 2008. C.-D.) Results of this thesis. A.) Stage 9. Expression in the hemiganglia (yellow arrowheads) simultaneous to the expression in the Mkinship stripes (white arrowheads and arrow). B.) Stage 10. Expression in the hemiganglia (white arrowheads). c.) Faint expression in the hemiganglia (yellow arrows) and strong expression in the M kinship group (white arrows). D.) Delayed expression between the M and Nkinship groups. Scale bar: 100",m. 59 Hau-Pax3/7 To make the case for a conserved mechanism of mesodermal patterning via Paraxis, it is also important to demonstrate conserved interactions with other molecules. Intriguingly, leech Paraxis appears to share a similar domain of expression as the leech Pax III homologs, Hau-Pax3/7A and B during embryonic development. Like Paraxis, Hau-Pax 3/7A is expressed initially as a maternal transcript in the teloplasm ofearly development. During gastrulation, Hau-Pax3/7A is similarly limited to the four anterior segments of the developing embryo (Fig. 24). After gastrulation, Hau-Pax3/7A is restricted to the Mlineage while its paralog Hau Pax3/78 is limited to the N lineage (Woodruff et aI., 2007; M. Shankland, [unpublished] referenced in Woodruff et aI., 2007). Also, much like Paraxis, Hau Pax3/7A is downregulated following the organogenesis of the leech nephridia. 60 A. 8. c. -M2 -'-'15 Figure 24. Comparative expression ofParaxis and Hau-Pax3/7A in H. robusta, stage 8. These images show a progression in development of Stage 8 from left to right. [n all embryos, expression is limited to the 4 anterior segments of the coalescing germinal plate. Expression is indicated by the white arrows, white arrowheads, and black arrowheads. A.) This thesis. B.) Greenberger, 2008. c.) Woodruff, 2007. Scale bar: 100f!m. PaxIII has been well characterized in the other segmented phyla, vertebrates and arthropods. In D. melanogaster development, Pax 1lI transcription factors Paired and Gooseberry are involved in segmentation, neurogenesis, and in a limited capacity in mesoderm tissue (Noll, 1993; Davis, D'Aiessio, and Patel, 2005). In vertebrates, the Pax III genes Pax3 and Pax7 are expressed in dorsal neuroectoderm and in the myogenesis ofthe somites, but have not been directly implicated in segmentation (Wada, Holland, Sato, Yamamoto & Satoh, 1997; Goulding, Lumsden & Paquette, 1994; Woodruffet aI., 1997). In vertebrates, Paraxis is involved in the regulation ofPax3. Studies in mouse embryo reveal that Pax3 expression in the dermomyotome is contingent on the continued presence of Paraxis transcription factors (Wilson-Rawls et aI., 1999). 61 With the conservation of Pax III genes across Bilateria and the co-localization with Paraxis expression in leech, further experiments should be conducted to determine if H. robusta Paraxis regulates Hau-Pax3/7A and B as vertebrate Paraxis regulates Pax3. This conserved relationship would further bolster the argument that Paraxis may have been a primitive trait inherited from the Urbilateria. Future research using knockdowns and fluorescent labeling will be necessary to prove a conserved regulation of the Pax genes regulated by Paraxis in H. robusta. In addition, scientists should attempt to identify the presence ofleech homologs for E12 proteins to which Paraxis dimerizes in vertebrates. A Paraxis Homolog in Leech In this thesis, I characterized a leech homolog of Paraxis. In addition, I identified putative Paraxis homologs in other Lophotrochozoa, Ecdysozoa, and cnidaria species. I demonstrated that H. robusta Paraxis shares similar spatiotemporal expression patterns in mesodermal tissue to the expression of vertebrate Paraxis and Scleraxis. This project provides an example of a shared molecular mechanism involved in segmentation. The presence ofa Paraxis homolog in a Protostome provides an intriguing opportunity for understanding the evolution of segmentation and mesodermal development in Bilateria. In mice, Paraxis is necessary for the expression of the most fundamental innovations associated with the rise of mesoderm in Bilateria: the alignment of cells along an AP axis and the stability-plasticity duality associated with EMT (Burgess et aI., 1996; Johnson et aI., 2001). Furthermore, the absence of Paraxis in mice disrupts the differentiation ofvertebrate body segments (Johnson, 62 2001). Even more profoundly, withoutScleraxis, mice embryos fail to form a primitive streak and to even develop mesodermal tissue (Brown et aI., 1999). These studies indicate that Paraxis serves a profound role in vertebrate segmentation and mesoderm development. In the future, knockdown experiments in leech will be necessary to determine if Paraxis shares such a fundamental role in annelid mesoderm development. All together, this research supports the hypothesis for a common origin ofsegmental pattern formation across Bilateria and suggests mesodermal function ofParaxis originated in Urbilateria. 63 WORKS CITED Aguinaldo AMA, Turbeville JM, Linford LS, Rivera MC, Garey JR, RaffRA, Lake JA. 1997. Evidence for a clade of nematodes, arthropods and other moulting animals. Nature 387(6632):489-493. Anderson DM, Arredondo J, Hahn K, Valente G, Martin JF, Wilson-Rawls J, Rawls A. 2006. Mohawk is a novel homeobox gene expressed in the developing mouse embryo. Developmental Dynamics 235(3):792-801. Balavoine G, Adoutte A. The Segmented Urbilateria: A Testable Scenario. Integrative and Comparative Biology 43(1):137-147. Barnes GL, Alexander PG, Hsu CW, Mariani BD, Tuan RS. 1997. Cloning and characterization ofchicken Paraxis: A regulator of paraxial mesoderm development and somite formation. Developmental Biology 189(1):95-111. Barnes RM, Firulli AB. 2009. A Twist ofinsight - the role ofTwist-family bHLH factors in development. International Journal of Developmental Biology 53 (7) :909-924. Baylies MK, Bate M. 1996. Twist: A myogenic switch in Drosophila. Science 272(5267):1481-1484. Baylies MK, Bate M, Gomez MR. 1997. The specification of muscle in Drosophila. In. Cold Spring Harbor Symposium on Quantitative Biology - Pattern Formation During Development; 1997 1997; Plainview, New York: Cold Spring Harbor Lab Press. p. 385-393. 64 Baylies MK, Michelson AM. 2001. Invertebrate myogenesis: looking back to the future ofmuscle development. Current Opinion in Genetics & Development 11(4):431-439. Bely AE, Weisblat DA. 2006. Lessons from leeches: a call for DNA barcoding in the lab. Evolution & Development 8(6):491-501. Brand-Saberi B, Rudloff S, Gamel Aj. 2008. Avian somitogenesis: Translating time and space into pattern. Somitogenesis. Berlin: Springer-Verlag Berlin. p. 42 57. Brown D, Wagner D, Li XQ, Richardson jA, Olson EN. 1999. Dual role ofthe basic helix-loop-helix transcription factor Scleraxis in mesoderm formation and chondrogenesis during mouse embryogenesis. Development 126(19):4317 4329. Brown D, Wagner D, Richardson j, Olson EN. 1998. Mouse embryos deficient for the bHLH protein Scleraxis fail to gastrulate. Developmental Biology 198(1):298. Burgess R, Cserjesi P, Ligon KL, Olson EN. 1995. Paraxis- A basic helix-loop-helix protein expressed in paraxial mesoderm and developing somites. Developmental Biology 168(2):296-306. Burgess R, Rawls A, Brown D, Bradley A, Olson EN. 1996. Requirement ofthe Paraxis gene for somite formation and musculoskeletal patterning. Nature 384(6609):570-573. Burton PM. 2008. Insights from DiplobIasts; the Evolution ofMesoderrn and Muscle. journal of Experimental Zoology. 310B:5-14. 65 Carpio R, Honore SM, Araya C, Mayor R. 2004. Xenopus Paraxis homologue shows novel domains ofexpression. Developmental Dynamics 231(3):609-613. Castanon I, Baylies MK. 2002. ATwist in fate: evolutionary comparison ofTwist structure and function. Gene 287(1-2):11-22. Christ B, Schmidt C, Huang RJ, Wilting J, Brand-Saberi B. 1998. Segmentation of the vertebrate body. Anatomy and Embryology 197(1):1-8. Cserjesi P, Brown D, Ligon KL, Lyons GE, Copeland NG, Gilbert DJ, jenkins NA, Olson EN. 1995. Scleraxis- a basic helix-loop-helix protein that prefigures skeletal formation during mouse embryogenesis. Development 121(4):1099-1110. Dale jK, Malapert P, Chal J, Vilhais-Neto G, Maroto M, johnson T, Jayasinghe S, Trainor P, Herrmann B, Pourquie 0.2006. Oscillations of the snail genes in the presomitic mesoderm coordinate segmental patterning and morphogenesis in vertebrate somitogenesis. Developmental Cell 10(3):355 366. Damen WGM. 2007. Evolutionary conservation and divergence of the segmentation process in arthropods. Developmental Dynamics 236(6):1379-1391. Davis GK, D'Alessio jA, Patel NH. 2005. Pax3/7 genes reveal conservation and divergence in the arthropod segmentation hierarchy. Developmental Biology 285(1):169-184. Davis GK, Patel NH. 1999. The origin and evolution of segmentation (Reprinted from Trends in Biochemical Science, vol 12, Dec., 1999). Trends in Cell Biology 9(12):M68-M72. 66 Delfini MC, Duprez D. 2000. Paraxis is expressed in myoblasts during their migration and proliferation in the chick limb bud. Mechanisms of Development 96(2):247-251. Dequeant ML, Pourquie 0.2008. Segmental patterning of the vertebrate embryonic axis. Nature Reviews Genetics 9(5):370-382. Freitas C, Rodrigues S, Charrier jB, Teillet MA, Palmeirim 1. 2001. Evidence for medial/lateral specification and positional information within the presomitic mesoderm. Development 128(24):5139-5147. Goldstein B, Leviten MW, Weisblat DA. 2001. Dorsal and Snail homologs in leech development. Development Genes and Evolution 211(7):329-337. Goto A, Kitamura K. Shimizu T. 1999. Cell lineage analysis of pattern formation in the Tubifex embryo.!. Segmentation in the mesoderm. International journal ofDevelopmental Biology 43(4):317-327. Goulding M, Lumsden A, Paquette Aj. 1994. Regulation of Pax-3 expression in the dermomyotome and its role in muscle development. Development 120(4):957-971. Greenberger E. The Paraxis-like Gene Is Expressed during Segmentation in the Annelid Leech Helobdella robusta. [Williamstown, Massachusetts]: Williams College. p. 65. Halanych KM, Dahlgren TG, McHugh D. 2001. Unsegmented annelids? Possible origins of four Lophotrochozoan worm taxa. In. Annual Meeting ofthe Society-for-Integrative-and-Comparative-Biology; jan 03-07 2001; Chicago, Illinois: Soc Integrative Comparative Biology. p. 678-684. 67 Ronquist F and Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572-1574. Irvine SM, Martindale MQ. 1996. Cellular and molecular mechanisms of segmentation in annelids. Seminars in Cell & Developmental Biology 7(4):593-604. Johnson J, Rhee J, Parsons SM, Brown D, Olson EN, Rawls A. 2001. The anterior/posterior polarity of somites is disrupted in Paraxis-deficient mice. Developmental Biology 229(1):176-187. Jones DT, Taylor WR, Thornton JM. 1992. The rapid generation of mutation data matrices from protein sequences. Comput Appli Biosci 8(3):275-82. Lans D, Wedeen CJ, Weisblat DA. 1993. Cell lineage analysis ofthe expression ofan engrailed homolog in leech embryos. Development 117: 857-871. Linker C, Lesbros C, Gros J, Burrus L, Rawls A, Marcelle C. beta-Catenin-dependent Wnt signalling controls the eipthelial organisation ofsomites through the activation of Paraxis. 132:3895-3905. Massari ME, Murre C. 2000. Helix-loop-helix proteins: Regulators oftranscription in eucaryotic organisms. Molecular and Cellular Biology 20(2):429-440. Minelli A. 1998. Segmented animals: origins, relationships, and functions - An introduction to the symposium on metamerism - (57th UZI Congress, San Benedetto del Tronto, 22-26 September 1996). Italian Journal of Zoology 65(1):1-4. Minelli A, Fusco G. 2004. Evo-devo perspectives on segmentation: model organisms, and beyond. Trends in Ecology & Evolution 19(8):423-429. 68 Murchison ND, Price BA, Conner DA, Keene DR, Olson EN, Tabin Cj, Schweitzer R. 2007. Regulation oftendon differentiation by Scleraxis distinguishes force transmitting tendons from muscle-anchoring tendons. Development 134(14):2697-2708. Murre C, McCaw PS, Baltimore D. 1989. A NEW DNA-BINDING AND DlMERIZATION MOTIF IN IMMUNOGLOBULIN ENHANCER BINDING, DAUGHTERLESS, MYOD, AND MYC PROTEINS. Cell 56(5):777-783. Nakamoto A, Arai A, Shimizu T. 2000. Cell lineage analysis ofpattern formation in the Tubifex embryo. II. Segmentation in the ectoderm. International lournal of Developmental Biology 44(7):797-805. Noll, M. 1993. Evolution and role ofPax genes. Current Opinion in Genetics & Development 3(4):595-605. Peel AD, Chipman AD, Akam M. 2005. Arthropod segmentation: Beyond the Drosophila paradigm. Nature Reviews Genetics 6(12):905-916. Perez-Pomares 1M, Munoz-Chapuli R. 2002. Epithelial-mesenchymal transitions: A mesodermal cell strategy for evolutive innovation in Metazoans. Anatomical Record 268(3):343-351. Pilon M and Weisblat DA. 1997. A nanos homolog in leech. Development 124: 1771-1780. Pinnell I, Lindeman PS, Colavito S, Lowe C, Savage RM. 2006. The divergent roles of the segmentation gene hunchback. Integrative and Comparative Biology 46(4):519-532. 69 Rawls lA, Parsons S, Wilson-Rawls NI. 1998. Mice lacking Paraxis and Myf-5 display severe defects in skeletal muscle and axial skeleton. Developmental Biology 198(1):345. Rieger RM, Purschke G. 2002. The coelom and the origin of the annelid body plan. In. Symposium on Morphology, Molecules, Evolution and Phylogeny in Polychaeta and Related Taxa; Sep 2002; Osnabruck, GERMANY: Springer. p. 127-137. Rivera AS, Weisblat DA. 2009. And Lophotrochozoa makes three: Notch/Hes signaling in annelid segmentation. Development Genes and Evolution 219(1):37-43. Savage RM and Shankland M. 1996. Identification and characterization of a hunchback orthologue, Lzf2, and its expression during leech embryogenesis. Developmental Biology 175: 205-217. Seaver EC. 2004. Evolution ofsegmentation from an annelid perspective. Zoological Science 21(12):1234-1234. Seaver EC, Kaneshige LM. 2006. Expression of 'segmentation' genes during larval and juvenile development in the polychaetes Capitella sp I and H-elegans. Developmental Biology 289(1):179-194. Seaver EC, Shankland M. 2000. Leech segmental repeats develop normally in the absence ofsignals from either anterior or posterior segments. Developmental Biology 224(2):339-353. Shain D. (Ed.). (2009). Annelids in Modern Biology. USA: Wiley-Blackwell. 70 Shankland M, Bissen ST, Weisblat DA. 1992. Description ofthe Californian leech Helobdella robusta sp-nov, and comparison with Helobdella triserialis on the basis of morphology, embryology, and experimental breeding. Canadian Journal of Zoology-Revue Canadienne De Zoologie 70(6):1258-1263. Shankland M, Seaver EC. 2000. Evolution ofthe Bilaterian body plan: What have we learned from annelids? Proceedings of the National Academy of Sciences of the United States ofAmerica 97(9):4434-4437. Shanmugalingam S, Wilson SW. 1998. Isolation, expression and regulation ofa zebrafish Paraxis homologue. Mechanisms of Development 78(1-2):85-89. Sosic D, BrandSaberi B, Schmidt C, Christ B, Olson EN. 1997. Regulation of Paraxis expression and somite formation by ectoderm- and neural tube-derived signals. Developmental Biology 185(2):229-243. Soto JG, Nelson BH, Weisblat, DA. A leech homolog of twist: evidence for its inheritance as a maternal mRNA. Gene 199(1-2):31-7. Stockdale FE, Nikovits W, Christ B. 2000. Molecular and cellular biology ofavian somite development. Developmental Dynamics 219(3):304-321. Storey KG. 1989. CELL LINEAGE AND PATTERN-FORMATION IN THE EARTHWORM EMBRYO. Development 107(3):519-531. Struck TH, Schult N, Kusen T, Hickman E, Bleidorn C, McHugh D, Halanych KM. 2007. Annelid phylogeny and the status of Sipuncula and Echiura. Bmc Evolutionary Biology 7:11. Thompson JD, Higgins DG, and TJ Gibson. 2004. CLUSTAL W: improving the sensitivity of multiple sequence alignment through sequence weighting, 71 position-specific gap penalties and weight matrix choice. Nucleic Acid Research 22(22): 4673-4680. Takahashi Y, Takagi A, Hiraoka S, Koseki H, Kanno J, Rawls A, Saga Y. 2007. Transcription factors Mesp2 and Paraxis have critical roles in axial musculoskeletal formation. Developmental Dynamics 236(6):1484-1494. Tessmar-Raible K, Arendt D. 2003. Emerging systems: between vertebrates and arthropods, the Lophotrochozoa. Current Opinion in Genetics & Development 13(4):331-340. Technau U, Scholz C. 2003. International journal of Developmental Biology. 47:531-539. Thamm K, Seaver EC. 2008. Notch signaling during larval and juvenile development in the polychaete annelid Capitella sp I. Developmental Biology 320(1):304 318. Tseng HT, jamrich M. 2004. Identification and developmental expression of Xenopus Paraxis. International journal of Developmental Biology 48(10):1155-1158. Wada, H, Holland PWH, Sato S, Yamamoto H, Satoh N. Neural tube is partially dorsalized by overexpression ofHrPax-37: The ascidian homologue ofPax-3 and Pax-7. Developmental Biology 187(2):240-252. Weisblat DA. 2007. Asymmetric cell divisions in the early embryo of the leech Helobdella robusta. Prog Mol Subcell BioI 45:79-95. Weisblat DA, Huang FZ. 2001. An overview ofglossiphoniid leech development. Canadian journal of Zoology-Revue Canadienne De Zoologie 79(2):218-232. 72 Weisblat DA, Shankland M. 1985. Cell lineage and segmentation in the leech. Philosophical Transactions of the Royal Society of London Series B- Biological Sciences 312(1153):39-&. Wilson-Rawls J, Hurt CR, Parsons SM, Rawls A. 1999. Differential regulation of epaxial and hypaxial muscle development by Paraxis. Development 126(23):5217-5229. Wilson-Rawls J, Rhee 1M, Rawls A. 2004. Paraxis is a basic helix-loop-helix protein that positively regulates transcription through binding to specific E-box elements. Journal of Biological Chemistry 279(36):37685-37692. Woodruff, JB, Mitchell BJ, Shankland M. 2007. Hau-Pax3/7A is an early marker of leech mesoderm involved in segmental morphogenesis, nephridial development, and body cavity formation. Developmental Biology 306(2):824-37. Yeh LCC, Tsai AD, Lee Je. 2005. Cartilage-derived morphogenetic proteins induce osteogenic gene expression in the C2C12 mesenchymal cell line. Journal of Cellular Biochemistry 95(1):173-188.