Supplementary Data Patients and Methods
Total Page：16
File Type：pdf, Size：1020Kb
Supplementary data Patients and Methods Case index At evaluation of clinical data collected during admissions made for epilepsy in the infancy of the index case (III-11), we observed that every episode of unconsciousness was associated with hypoglycemia lower than 50 mg/dl. Similar symptoms had been observed since the first months of life in her sister III-12. Both subjects, however, showed a normal insulin response after glucose load, thus excluding juvenile diabetes. Repeated inter-ictal electroencephalography (EEG) was inconsistent for epilepsy. Anti-epileptic drugs were removed and a balanced diet was started, thus preventing further episodes of hypoglycemia. Interestingly, III-12, at age 23, suffered from two novel episodes of loss of consciousness associated with hypoglycemia, after intake of alcoholic drinks with high sugar content. Blood analyses revealed a substantial increase of baseline levels of cortisol with insulin level within the normal range during the 36-48 h after each episode. The index case underwent a study protocol which included blood and urine analyses (comprising in particular dosage of vitamin D, muscle enzymes, markers of inflammatory, rheumatic and autoimmune and celiac diseases, thyroid, parathyroid and pancreas function, and research of occult blood in the stool), ophthalmologic examination comprising fundus, mesopic vision test and electroretinogram, cardiology with electrocardiogram (ECG) and cardiac ultrasound evaluation, entire skeletal X-ray, basic EEG with activation test and brain magnetic resonance imaging (MRI). The most relevant pathological findings were creatine phosphokinase (CPK) increase at 250 IU/L (n.v.=190IU/L), erythrocyte sedimentation rate (ESR), and high sensitivity C-reactive protein (hs- CRP) increased at 40 mm/h (n.v.=3-20 mm/h) and 6 mg/L (n.v.<2mg/L) ,respectively. Fasting blood glucose ranging 95-105 mg/dl (n.v.=60-110mg/dl) in repeated measurements was reported. Sideremia at 30-35 g/dl (n.v.= 37-147g/dl), 1.25-OH vitamin D lower than 20 ng/ml (n.v.=30- 100 ng/ml) and vitamin B12 lower than 180 ng/L (n.v.=180-914 ng/L) were also found at repeated 1 measurements. Plasma glucose and insulin levels after glucose load were normal. TSH increase at 6.1 mIU/L (n.v.=0.5-4.0 mIU/L) with normal levels of T3 and T4. Thyroid sonography demonstrated goiter with micro nodules. Blood platelet aggregation and secretion tests were conducted to evaluate the presence of coagulation defects that could explain the wound healing alteration and bleeding observed in the affected individual. A physiological activation of platelets was observed excluding the presence of a platelet disorder. At clinical history, 18 out of 21 members of the family reported one or more symptoms similar to those complained by the index case (Table S1). A clinical and instrumental study protocol was proposed like the one conducted in the proband. This latter and all the individuals who accepted the investigation have been followed up for twenty years by a team of specialists, including rheumatologist, ophthalmologist, hematologist, endocrinologist, orthopedist, abdominal surgeon and cardiologist. The following procedures have been conducted when appropriate, after signed informed consent. Muscle biopsies of the vastus lateralis of quadriceps and skin biopsies from the lateral aspect of the right thigh were processed according to standard protocols for histology, immunofluorescence (IF), biochemistry and expression studies. Skin specimens served also to establish fibroblast primary cell cultures. Peripheral venous blood samples were collected to conduct platelet aggregation and secretion studies and genomic DNA and RNA extraction [37]. Muscle and skin samples of 6 unrelated females (age ranging 25-50 years) from the tissues bank of our Department, as resulting normal at microscopy and biochemistry, were used as control tissues. The study was approved by ethics review committee at the relevant Institution and all participants provided informed consent. Gene identification strategy 2 To identify the responsible gene we used a combined approach of whole-exome sequencing (WES) and total blood RNA sequencing to detect mutations in coding regions, exon-intron splicing sites, untranslated regions (UTRs) as well as large insertions or deletions which could generate aberrant transcripts. For WES strategy, we analyzed three affected samples from the pedigree (IDs II-7, III-4 and III-11). In particular, the affected family members II-7 and III-11 manifested the complete phenotype; instead, the individual III-4 was not affected by severe myopia (Table S1). Genomic DNA was isolated from whole blood, using the QIAamp DNA Blood Midikit (Qiagen), according to the manufacturer’s protocol. Exonic regions of genomic DNA were enriched using the Agilent Haloplex Exome kit based on DNA digestion and capture. Exomes were barcoded and sequenced at multiple sites on the Illumina HiSeq1000 platform. Average coverage for all the experiments was 70x and at least 20x for 89% of the target. Paired sequencing reads were aligned to the reference genome (UCSC, hg19 build) using BWA and sorted with SAMtools and Picard. Post-alignment processing (local realignment around insertions-deletions and base recalibration), SNV, and small insertions-deletions (ins-del) calling were performed with Genome Analysis Toolkit (GATK) with parameters adapted to the haloplex-generated sequences. The called SNV and ins-del variants produced with both platforms were annotated using ANNOVAR [38-41]. In a first step, we performed a thorough survey of all previously identified genes associated with connective disorders, in order to definitively exclude their involvement in the disease phenotype. Sequencing data were analyzed as in our previous works [42, 43]. Data were filtered to eliminate common variants (MAF > 1%), neutral variants, variants with low quality score, and variants not shared by all analyzed affected subjects, when covered. Additional frequency filters were used by comparing internal databases of whole exome sequencing data (n = 300). Prioritization was also made based on MAF frequency. Considering a dominant mode of inheritance, we matched data from the three affected family members to obtain sixteen shared variants and in a second step we only compared the affected individuals II-7 and III-11 showing the severe myopia and III-4 was considered as 3 healthy. Only the c.9418G>A change, causing the missense variant p.V3140M in the LAMA5 gene, showed complete segregation with the disease in the family, was not found in 600 chromosomes from unrelated healthy subjects from the same geographical origin and was reported in Ensembl database with the rs number “rs369572769” and a minor allele frequency (MAF)<0.00007 (ESP6500: 1 allele A/8581 alleles G; EXAC: 5A/120359G). We analysed the p.V3140M variant with SIFT, PolyPhen2 and PMut software and confirmed a deleterious effect of this variant (Tables S2 and S3). The severe myopia was associated with a novel mutation in a different gene (manuscript in preparation), thus excluding this defect from the syndrome manifestations. RNA sequencing strategy. Blood total RNA from the affected family members II-7, III-4 and III-11 and from two unrelated controls was isolated by using the Tempus Spin RNA Isolation Kit (Life Technology), according to manufacturer’s protocol. Integrity was assessed by Experion (RNA StdSens Chip, Bio-Rad, Hercules, CA, USA). Total RNA was reverse transcribed using SuperScriptTM II Reverse transcriptase (Life Technology) according to manufacturer’s protocol. cDNA libraries were prepared using TruSeqTM RNA Sample Preparation kit (Illumina, San Diego, CA, USA) and paired-end reads were sequenced on Illumina HiSeq2000 platform. Mapping was performed using TopHat v2.0. Gene expression and alternative splicing were analyzed using Cufflinks v2.1.1 [44]. RNA sequencing confirmed the presence of the LAMA5 mutation and excluded the presence of gene rearrangements and mutations producing altered RNA processing both in LAMA5 and other genes. RNA sequencing data were analyzed to assess gene specific mRNA amount, by comparing data between cases and controls to search for those genes showing a difference >1.5-fold change. By using the “Advanced search tool” of the Gene Cards database was performed an in silico analysis to retrieve a list of genes encoding proteins involved in inflammation and wound healing (Tables S4 and S5). 4 Mutation analysis Validation and segregation analysis of the selected variants was performed by Sanger sequencing. PCR amplification and direct sequencing protocols have been previously described [42, 43]. LAMA5 oligonucleotides for mutation analysis were: LAMA5 F: 5’ - TGGGCAAGTATGTGGACCTC - 3’ LAMA5 R: 5’ - ACTCATTCCAGACACCCCAG - 3’ Fibroblast and myoblast primary cell cultures Skin biopsies were obtained from the affected family members (II-7, II-9, III-2, III-4, III-11 and III- 13), from healthy family members III-3 and III-10 and unrelated healthy individuals. The tissues pieces were enzymatically digested for 24 hours at 37°C by using Collagenase/Dispase kit (Roche), followed by a mechanically disaggregation with knife. Cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 4.5 g/L D-Glucose, 0.11 g/L Sodium Pyruvate, 10% FBS, 1% NEAA, 1% L-glutamine, Gentamycin 1:200, 1% Pen-Strep and 1% Amphotericin B at 37°C in a humidified CO2 5% air for about 4-5 weeks. Fibroblast cell lines were maintained and were used in all the experiments in sub-confluent mono-layers. LAMA5 synthetic peptides design The LG modules of the laminin alpha chains consist of 14 β strands labeled A−N arranged in two sheets resulting in a sandwich structure (figure S1B and C) [45]. Recently have been showed that short synthetic peptides (less than 20 amino acids long) designed on E and F strands of laminin alpha chains, manifest biological activities being able to promote cell attachment and to bind specific receptors [22]. Based on these previous studies, we synthesized two short LAMA5 synthetic peptides designed on the B strand which houses the V3140M mutation (China Peptides Co., Ltd) (figure S1F).