1 SLY1 and Syntaxin 18 specify a distinct pathway for Procollagen VII
2 export from the endoplasmic reticulum.
3
1,2 # 1, 2 # 1,2 4 Cristina Nogueira , Patrik Erlmann , Julien Villeneuve , António J. M.
1,2 3 3 5 Santos , Emma Martínez-Alonso , José Ángel Martínez-Menárguez , and
1,2,4,* 6 Vivek Malhotra
7
1 8 Cell and Developmental Biology Program, Centre for Genomic Regulation
9 (CRG), Dr. Aiguader 88, 08003 Barcelona, Spain.
2 10 Universitat Pompeu Fabra (UPF), Dr. Aiguader 88, 08003 Barcelona, Spain.
11 3 Department of Cellular Biology and Histology, Faculty of Medicine,
12 University of Murcia, 30100 Espinardo, Spain
4 13 Institució Catalana de Recerca i Estudis Avançats (ICREA), Pg. Lluis
14 Companys 23, 08010 Barcelona, Spain.
15 #These authors contributed equally to this work.
16 *Corresponding author: Vivek Malhotra
17 Running title: Procollagen export from the ER
19 Phone: +34 93 316 0235
20 Fax: +34 93 3969 983
21
1 22 TANGO1 binds and exports Procollagen VII from the endoplasmic
23 reticulum (ER). Here we report a connection between the cytoplasmic
24 domain of TANGO1 and SLY1, a protein that is required for membrane
25 fusion. Knockdown of SLY1 by siRNA arrested Procollagen VII in the ER
26 without affecting the recruitment of COPII components, general protein
27 secretion, and retrograde transport of the KDEL containing protein BIP,
28 and ERGIC53. SLY1 is known to interact with the ER specific SNARE
29 proteins Syntaxin 17 and 18, however only Syntaxin 18 was required for
30 Procollagen VII export. Neither SLY1 nor Syntaxin 18 was required for the
31 export of the equally bulky Procollagen I from the ER. Altogether, these
32 findings reveal the sorting of bulky collagen family members by TANGO1
33 at the ER and highlight the existence of different export pathways for
34 secretory cargoes one of which is mediated by the specific SNARE complex
35 containing SLY1 and Syntaxin 18.
36
37
2 38 Introduction
39 Collagens are the most abundant secretory proteins, comprising 25-30% of the
40 human body dry weight (Pataridis et al., 2008). They are required for cell
41 attachment, tissue organization and remodeling, and for the differentiation of
42 chondrocytes to produce mineralized bones (Gelse et al., 2003; Wilson et al.,
43 2011). There are at least 28 different kinds of collagens, composed of homo or
44 hetero trimers of polypeptide chains coiled around each other to form a triple
45 helix (Shoulders and Raines, 2009). These unbendable triple helices, which can
46 be up to 450 nm long, as in the case of Collagen VII, are too big to fit into the
47 conventional transport carriers of the secretory pathway that have been
48 identified thus far (Malhotra and Erlmann, 2011). How are these bulky proteins
49 exported from the ER?
50
51 While the debate on the trafficking of collagen-like molecules across the
52 Golgi stack goes unabated, new data are beginning to unravel the mechanism by
53 which collagens are exported from the ER. A protein called TANGO1 has been
54 identified for its requirement in the export of Procollagen VII (PC VII) from the
55 ER in tissue culture cells (Saito et al., 2009). The knockout of TANGO1 in mice
56 results in the production of a pup that dies at birth due to defective bone
57 mineralization. The cause is a block in the secretion of multiple collagens
58 needed for the differentiation of chondrocytes (Wilson et al., 2011). TANGO1 is
59 also required for collagen secretion in Drosophila melanogaster (Lerner et al.,
3 60 2013; Pastor-Pareja and Xu, 2011). TANGO1 binds PC VII via its SH3 domain
61 in the lumen of the ER (Saito et al., 2009). On the cytoplasmic side, TANGO1
62 binds cTAGE5 and both these proteins contain a proline rich domain that
63 interacts with the COPII components SEC23/24 (Saito et al., 2009; Saito et al.,
64 2011). We have proposed that binding of PC VII to TANGO1 in the lumen
65 promotes the binding of TANGO1’s proline rich domain to SEC23/24. This
66 retards the recruitment of SEC13/31 to SEC23/24 and thus delays the events
67 leading to the biogenesis of the COPII vesicle (Malhotra and Erlmann, 2011).
68 Upon growth to a size that is large enough to encapsulate PC VII, TANGO1
69 dissociates from both PC VII and SEC23/24. The binding of SEC13/31 to
70 SEC23/24 completes the assembly of COPII components on a patch of the ER.
71 These events then lead to the export of PC VII, presumably in a mega carrier
72 from the ER (Saito et al., 2009; Saito et al., 2011). Ubiquitination of SEC31 by
73 the CUL3-KLHL12 ligase complex has been reported to control the exit of
74 Procollagen I (PC I) from the ER (Jin et al., 2012; Malhotra, 2012). Sedlin is
75 reported to help in the export of PC I and II from the ER by regulating the
76 cycling of SAR1 activation state that is essential for COPII assembly at the ER
77 (Venditti et al., 2012). TANGO1 is not required for PC I export from the ER and
78 it is not known whether PC II export is TANGO1 dependent. Together these
79 data indicate that COPII components are required for the export of procollagens
80 from the ER, however, they also suggest the possibility that not all procollagens
81 exit the ER by the same mechanism.
4 82 We now show the involvement of SLY1 (or SCFD1) in specific ER
83 export events. SLY1 is a member of the STXBP/unc-18/SEC1 family of proteins
84 that regulate the assembly or the activity of SNAREs in membrane fusion events
85 (Carr and Rizo, 2010). The yeast ortholog SLY1, an essential gene, has been
86 described as a single copy suppressor of the YPT1 deletion (Dascher et al., 1991)
87 and implicated in forward and retrograde trafficking (Li et al., 2005; Ossig et al.,
88 1991). In contrast with its essential roles in yeast, a temperature sensitive mutant
89 of Sly1 in zebra fish is not lethal on the cellular level but rather creates
90 developmental defects in embryonic stages (Nechiporuk et al., 2003). In
91 mammals, SLY1 has been reported to function in conjunction with Syntaxin 5
92 (STX5) in the ER to Golgi transport and might also function in the assembly of
93 pre-Golgi intermediates (Rowe et al., 1998) together with Syntaxin 18 (STX18)
94 (Yamaguchi et al., 2002) and Syntaxin 17 (STX17) (Steegmaier et al., 2000).
95 SLY1 has been shown to interact with the COG4 complex and suggested to play
96 a role in intra Golgi and retrograde transport (Laufman et al., 2009). It is
97 important to note that in mammalian cells these proposed roles of SLY1 in
98 traffic between ER and Golgi membranes are based entirely on the use of
99 artificial temperature sensitive mutant protein Vesicular Stomatitis Virus (VSV)-
100 Glycoprotein (G) protein and the artificial cargo signal sequence (ss)-Green
101 Fluorescent Protein (GFP). The role of SLY1 in the trafficking of endogenous
102 cargoes and its potential mechanism of action is therefore a matter of debate.
5 103 We describe here our data that reveal the existence of different export
104 routes for secretory cargoes from the ER: of specific interest is the finding that
105 SLY1 and the ER specific t-SNARE STX18 are necessary for the export of PC
106 VII but not of the equally bulky PC I from the ER.
107
6 108 Results
109 SLY1 is cross-linked to the ER exit sites specific TANGO1 and localizes to
110 ER exit sites
111 To search for proteins that interact with cytoplasmically oriented portions of
112 TANGO1, we expressed a Myc-His tagged version of a truncated form of
113 TANGO1 (TANGO1ct) that lacks the luminal domain in HeLa cells. After
114 crosslinking with membrane permeable DSP and lysis, proteins were recovered
115 on a Nickel agarose column and analyzed by mass spectrometry. Of interest was
116 the finding of SLY1 in the pool of proteins cross-linked to TANGO1.
117 To further ascertain the mass spectrometry data, we immunoprecipitated
118 Myc-His tagged TANGO1ct from transfected and crosslinked HeLa cells as
119 described above and western blotted the bound material with anti-Myc and
120 SLY1 antibodies, respectively. Our data show the presence of SLY1 in the
121 TANGO1 immunoprecipitate (Figure 1A). SLY1 is a cytoplasmic protein but
122 our findings suggest that it interacts with the ER exit sites anchored TANGO1,
123 so is there a pool of SLY1 associated with ER exit sites where TANGO1
124 resides? We have previously documented the use of a human cell line called
125 RDEB/FB/C7 that stably expresses and secretes Collagen VII (Chen et al., 2002;
126 Saito et al., 2009). We used lentivirus to express SLY1-GFP in RDEB/FB/C7
127 cells. In fixed cells the GFP signal is localized throughout the cytoplasm with a
128 slight accumulation in the perinuclear region. After prepermeabilization of the
129 cells with saponin and extensive washes to remove the cytoplasmic pool of
7 130 proteins before fixation, a pool of SLY1-GFP was found to colocalize with the
131 ER exit sites specific COPII component SEC31 (Figure 1B). Arrowheads mark
132 single exit sites that label for SEC31 and SLY1. In addition, a perinuclear SLY1
133 containing and SEC31 lacking pool was observed. This perinuclear pool of
134 SLY1 partially overlaps with GM130, a marker of the early Golgi cisternae
135 (Figure 1B). Our data show that although most of SLY1 was Golgi localized,
136 we detected a small pool that co-localized with Sec31. At present we do not
137 know whether recruitment of SLY1 to the ER exit site is by direct binding to
138 TANGO1 or indirectly through other proteins on the cytoplasmic side.
139
140 SLY1 is required for Procollagen VII secretion
141 The identification of SLY1 in a pool of proteins that are cross linked to
142 TANGO1 prompted us to test its involvement in PC VII export from the ER. In
143 addition to the RDEB/FB/C7 cell line in which Collagen VII was exogenously
144 introduced, we tested the immortalized human esophageal cell line Het1a to
145 monitor the involvement of SLY1 in the export of endogenous PC VII.
146 RDEB/FB/C7 and Het1a cells were transfected with siRNA oligos specific for
147 SLY1, TANGO1, or a scrambled oligo as a control. RDEB/FB/C7 cells were
148 transfected twice to increase knockdown efficiency. The levels of SLY1 and
149 TANGO1 after knockdown were monitored by western blotting and revealed an
150 approximately 90% reduction compared with control cells. Knockdown of
151 TANGO1 did not significantly alter SLY1 protein levels and vice versa (Figure
8 152 2A). 48 hours after the last siRNA transfection, the cells were washed and then
153 incubated with fresh medium containing ascorbic acid (2µg/ml) for 20 hours.
154 The medium and the cell lysates were western blotted with an anti-Collagen VII
155 antibody. Knockdown of SLY1 inhibited PC VII secretion (Figure 2B).
156 Quantitation of the ratio of the secreted to intracellular PC VII revealed a 75%
157 reduction upon SLY1 knockdown compared with control cells. PC VII secretion
158 was 90% reduced upon TANGO1 knockdown, compared with control cells
159 (Figure 2C).
160
161 We then transfected RDEB/FB/C7 or Het1a cells with SLY1 siRNA,
162 TANGO1 siRNA or a control siRNA, as described above, treated the cells with
163 ascorbic acid and after 72 hours the cells were fixed and incubated with
164 antibodies against Collagen VII, the ER resident chaperone Hsp47 and GM130.
165 In control cells, we did not detect intracellular PC VII because it is rapidly
166 exported from the ER and secreted by the cells. In SLY1 knockdown cells, on
167 the other hand, PC VII accumulated in large structures that also contained the
168 collagen specific protein chaperone Hsp47 (Saga et al., 1987). Similar large
169 patches of PC VII are also evident in RDEB/FB/C7 cells depleted of TANGO1,
170 which is well known for its role in the export of PC VII from the ER (Saito et
171 al., 2009; Saito et al., 2011) (Figure 2D upper panel). We did not observe
172 accumulation of PC VII in the Golgi membranes upon knockdown of either
173 SLY1 or TANGO1 (Figure 2D lower panel). The very low levels of Collagen
9 174 VII expressed in Het1a cells are difficult to detect by the standard western
175 blotting approaches, however, the accumulation of PC VII in the ER and
176 colocalization with Hsp47 by fluorescence microscopy is also evident in SLY1
177 and TANGO1 depleted Het1a cells (Figure 2E). Based on these data we suggest
178 that SLY1 knockdown arrests PC VII in the ER where it accumulates in large
179 patches.
180
181 To further ascertain the site of PC VII localization in SLY1 knockdown
182 cells we visualized PC VII by immunoelectron microscopy. In control cells,
183 gold conjugated secondary antibodies used to visualize anti-Collagen VII
184 antibody were found distributed throughout the ER. In SLY1 knockdown cells,
185 however, PC VII was observed in large patches within dilated ER (Figure 3) but
186 smaller vesicles that could correspond to intermediates en route were not visible.
187 These patches, we suggest, correspond to the patches of PC VII observed in the
188 fluorescence micrographs of SLY1 knockdown cells (Figure 2D). Similar
189 patches of PC VII were also evident upon knockdown of TANGO1 (Figure 3).
190
191 SLY1 knockdown does not affect the overall levels of COPI and COPII
192 components
193 We then tested whether SLY1 knockdown affected the stability of proteins
194 involved in the transport of cargoes between the ER and the Golgi. For this, we
195 monitored the levels of COPI and COPII components in the lysates of SLY1,
10 196 TANGO1 knockdown or control siRNA treated RDEB/FB/C7 cells. The level of
197 SAR1, the initiator of the COPII vesicle budding process, did not change upon
198 SLY1 or TANGO1 knockdown. Also unchanged were the levels of the other
199 COPII components that are required for the export of secretory cargo, including
200 components of the extracellular matrix, from the ER, specifically SEC23A
201 (Boyadjiev et al., 2006) and SEC31 (Jin et al., 2012). Because of the possible
202 involvement of SLY1 in the retrograde trafficking pathway we also tested
203 components of the COPI coat: β-COP and ε-COP, and their levels were also
204 unchanged (Figure 4).
205
206 SLY1 is not required for general protein recycling to the ER
207 We tested the involvement of SLY1 in retrograde trafficking by monitoring the
208 localization of a protein called GRP78/BIP that contains a KDEL sequence and
209 cycles between the ER and the early Golgi cisternae. A block in retrograde
210 transport leads to an accumulation of GRP78/BIP in the Golgi apparatus and its
211 subsequent secretion from the cells (Yamamoto et al., 2003). GRP78/BIP was
212 localized to the ER in SLY1 knockdown cells and control cells (Figure 5A).
213 Moreover, GRP78/BIP was not detected in the medium collected from control,
214 SLY1 or TANGO1 depleted cells (Figure 5B). To further quantitate the
215 involvement of SLY1 in transport between the Golgi apparatus and the ER, we
216 used a procedure to trap cycling proteins in the ER as described previously
217 (Pecot and Malhotra, 2006). HeLa cells treated with control siRNA or cells
11 218 depleted of TANGO1 or SLY1 were transfected with the following constructs:
219 one encoding ERGIC53, a protein that cycles between the early Golgi/ERGIC
220 compartment and the ER, fused to FKPB and GFP, and another encoding the
221 invariant chain of the Major Histocompatibility Complex class II receptor (Ii)
222 fused to FRAP-HA. In HeLa cells the Ii chain lacking its MHC counterpart is
223 retained in the ER (Lotteau et al., 1990). Rapamycin is known to bind FRAP and
224 this dimer tightly binds FKBP. This procedure can therefore be used to test if
225 FRAP and FKBP containing proteins reside in close proximity and thus are
226 accessible to each other. We observed the cells by fluorescence microscopy at
227 steady state and 15, 30 and 60 minutes after the addition of Rapamycin or in
228 control cells without the addition of Rapamycin. Colocalization of the two
229 constructs was assessed by calculating the Pearson's colocalization coefficient.
230 Knockdown of TANGO1 or SLY1 did not affect the kinetics of ERGIC53
231 redistribution to the ER (Figure 5C). We therefore conclude that under our
232 experimental conditions knockdown of SLY1 or TANGO1 does not affect
233 retrograde trafficking.
234 Retention of PC VII in the ER, upon knockdown of SLY1 or TANGO1, is
235 therefore not because of a defect in cycling of a component that is specifically
236 required for the constitutive trafficking between the ER and the early Golgi
237 cisternae.
238
239 SLY1 knockdown does not affect secretion of bulk-endogenous-cargoes
12 240 Is bulk protein secretion affected by SLY1 knockdown? RDEB/FB/C7 cells
241 were transfected with SLY1, TANGO1 or a scrambled siRNA oligo, and after
242 72 hours, the cells were washed, cultured in methionine and cysteine free
243 medium for 1 hour, pulsed with 35S-methionine for 20 min in methionine free
244 medium, washed and then incubated in complete medium. Another control was
245 included in which scrambled siRNA oligo transfected cells were incubated with
246 Brefeldin A (BFA) during the chase period. The medium was collected after 2
247 hours and then analyzed by SDS-PAGE/autoradiography to identify the secreted
248 polypeptides. Treatment with BFA, as expected, inhibited the secretion of newly
249 synthesized proteins. Surprisingly, SLY1 knockdown did not have any
250 appreciable effect on the secretion of newly synthesized proteins (Figure 6A).
251 This approach does not reveal the specific polypeptides secreted in a SLY1
252 dependent manner, but shows that the overall pattern of polypeptides detected
253 by SDS PAGE is not affected by SLY1 knockdown.
254 It has been shown that SLY1 depletion inhibits the trafficking of widely
255 used model cargoes such as the temperature sensitive VSVG (Dascher and
256 Balch, 1996) and signal sequence GFP (Gordon et al., 2010). We tested the
257 effect of SLY1 and TANGO1 depletion on the secretion of signal sequence -
258 Horseradish peroxidase (ss-HRP). HeLa cells stably expressing ss-HRP were
259 transfected with siRNAs targeting either SLY1 or TANGO1 or a scrambled
260 siRNA as a control. After 72 hours, cells were washed and ssHRP was
261 accumulated in the ER for 2 hours by incubating cells at 15°C. New protein
13 262 synthesis was then blocked by Cycloheximide (CHX) treatment and the cells
263 were incubated for the indicated time at 37°C to restart export and trafficking of
264 secretory cargo from the ER. The HRP activity in the lysate and the supernatant
265 was measured as described previously (Bard et al., 2006). The ratio of secreted
266 to internal HRP shows that depletion of SLY1 efficiently blocked secretion ss-
267 HRP and was comparable to known secretion inhibitory drug BFA. TANGO1
268 depletion reduced the secretion of ss-HRP to 50 % of that from control cells
269 (Figure 6B).
270
271 SLY1 knockdown does not affect Procollagen I export from the ER
272 The data presented thus far reveal the requirement of SLY1 in PC VII export,
273 the export of exogenously expressed secretory cargo ss-HRP, but not the bulk of
274 endogenous secretory cargoes. This is similar to the known effects of TANGO1
275 knockdown on the selective export of secretory cargo from the ER.
276 Interestingly, TANGO1 knockdown by siRNA does not affect the secretion of
277 the bulky PC I (Saito et al., 2009; Saito et al., 2011). Is SLY1 required for the
278 trafficking of PC I? RDEB/FB/C7 cells were transfected with siRNA oligos
279 specific for SLY1, TANGO1 or scrambled siRNA as a control and treated with
280 ascorbic acid, as described above. 20 hours after the last change of medium, the
281 cell lysates and the medium were western blotted with anti-Collagen I antibody.
282 Our results reveal that the secretion of collagen I is not blocked by knockdown
283 of SLY1 or TANGO1 (Figure 6C). To further ascertain that SLY1 has no role in
14 284 PC I export, we transfected Saos 2 cells with siRNA oligos specific for SLY1,
285 TANGO1 or a scrambled siRNA and after 48 hours Saos 2 cells were washed,
286 and then incubated with fresh medium containing ascorbic acid for 20 hours.
287 The knockdown efficiency was determined by western blotting the cell lysates
288 and revealed a reduction greater than 75% in the levels of SLY1 and TANGO1
289 (Figure 6D). The intracellular and secreted PC I was measured by western
290 blotting the cell lysate and the medium, respectively. As in RDEB/FB/C7 cells,
291 knockdown of SLY1 or TANGO1 in Saos 2 cells did not affect the secretion of
292 PC I (Figure 6E). In fact, in both cells lines, we detected a marginal increase in
293 the secretion of Collagen I that is accompanied by an increase in the internal
294 levels of Collagen I in the knocked down cells. This suggests a potential effect
295 on the transcriptional regulation of Collagen I expression rather than a defect in
296 its trafficking.
297
298 SAR1 activity is necessary for Procollagen VII export
299 The assembly of the COPII coat is initiated by the activation of the small
300 GTPase SAR1 by the ER resident protein SEC12. Active SAR1 recruits the
301 inner coat proteins SEC23/24. The assembly of the outer coat proteins
302 SEC13/31 completes the biogenesis of COPII vesicles by inactivation of SAR1
303 (Zanetti et al., 2012). TANGO1 links PC VII to the inner COPII coat by
304 interacting with the SEC23/24 complex (Saito et al., 2009). To further ascertain
305 the involvement of COPII coat assembly at the ER for PC VII export, we
15 306 depleted either of the SAR1 isoforms A and B or both in RDEB/FB/C7 cells
307 using an siRNA mixture described earlier (Cutrona et al., 2013). Probing of cell
308 lysates with anti SAR1 antibody revealed a doublet of bands at the predicted
309 size of SAR1. As one can observe in the single knockdowns these bands
310 correspond to the two SAR1 isoforms, the upper, weaker band being SAR1 B
311 and the lower, stronger SAR1 A. Single knockdowns result in an almost
312 complete depletion of the individual isoforms, with double knockdown the
313 efficiency is approximately 75% for SAR1 A while SAR1 B is still fully
314 depleted (Figure 7A). The same procedure of SAR1 knockdown was repeated
315 and 48 hours after transfection with the specific siRNA oligos, the cells were
316 washed, and then incubated with fresh medium containing ascorbic acid for 20
317 hours. The medium and the cell lysates were western blotted with an anti-
318 Collagen VII antibody. Knockdown of SAR1 A alone had marginal effect on the
319 secretion of PC VII, whereas the knockdown of SAR1 B was largely ineffective.
320 However, knockdown of both SAR1 A and B led to an almost total block in PC
321 VII secretion, which accumulated in the cells (Figure 7B). To visualize the
322 intracellular site of PC VII accumulation, we transfected RDEB/FB/C7 cells to
323 deplete both SAR1 A and B as described above, and 24 hours later ascorbic acid
324 was added to the culture medium. 48 hours later, the cells were fixed and stained
325 with antibodies against Collagen VII and SEC31, respectively. In cells depleted
326 of SAR1 A and B, PC VII accumulated in large structures (Figure 7C) similar to
327 the patches of PC VII seen in RDEB/FB/C7 cells depleted of TANGO1 or SLY1
16 328 (Figure 2D). As expected the COPII component SEC31 localized to punctate
329 structures resembling ER exit sites in control cells, but not in cells depleted of
330 SAR1 A and B. Here SEC31 localized mostly in the cytosol and almost no
331 SEC31 positive punctae were visible (Figure 7C).
332
333 SLY1 knockdown does not affect Sec13/Sec31 localization to the ER exit
334 sites
335 Recruitment of SEC13/31 to SEC23/24 is the ultimate known event in the
336 assembly of COPII coats that leads to membrane fission and the separation of
337 COPII vesicles from the ER. Is SLY1 activity required before or after the COPII
338 recruitment to the ER exits sites? TANGO1, as shown previously, connects PC
339 VII to the COPII subunits through interaction with SEC23/24. The question we
340 asked was whether the location of COPII components and PC VII in cells that
341 are depleted of SLY1 is different compared with control cells that are exporting
342 Collagen VII. Since PC VII is rapidly exported from the ER after its synthesis,
343 our positive control, to test this hypothesis, was cells transfected with scrambled
344 siRNA oligos for 72 hours and then kept for 3 hours at 15°C to accumulate
345 secretory cargo in the ER and then shifted to 37°C for 30 min to restart cargo
346 export from the ER. These cells were visualized by fluorescence microscopy to
347 monitor the location of PC VII and either the COPII component SEC31 or
348 TANGO1. In the control cells, PC VII accumulated in the ER in large patches
349 similar to that observed in SLY1 or TANGO1 knockdown cells. The majority
17 350 of SEC31 and TANGO1 were localized to specific sites on the ER that
351 contained large patches of PC VII (Figure 8A).
352
353 We then compared the location of SEC31 and TANGO1 in RDEB/FB/C7
354 cells that had been transfected to knockdown specifically SAR1A and B,
355 TANGO1, or SLY1 by fluorescence microscopy with anti-Collagen VII and
356 SEC31 or TANGO1 antibodies (Figure 8 B-D). In SAR1 (A and B) knockdown
357 cells, as expected, SEC31 was distributed mostly in the cytoplasm and not
358 associated with the ER exit sites. Interestingly TANGO1 was still present at the
359 collagen-enriched patches, suggesting that the TANGO1-Collagen VII binding
360 is independent of TANGO1-SEC23/24 interaction (Figure 8B). In TANGO1
361 knockdown cells, the SEC31 positive ER exit sites appeared fewer in number on
362 the collagen patches and more random in localization (Figure 8C). Interestingly,
363 in SLY1 depleted cells the number and localization of SEC31 sites resembled
364 that of control cells (Figure 8D). SLY1 knockdown did not affect the location of
365 TANGO1 at the ER exit sites. These findings suggest that knockdown of SLY1
366 does not interfere with the capture of PC VII by TANGO1 nor with the
367 assembly of a complete COPII coat.
368
369 Syntaxin 18 and Syntaxin 5 are required for the export of Procollagen VII
370 from the ER
18 371 A large number of SNAREs have been localized and reported to traffic cargoes
372 between the ER and the Golgi (Table 1). SLY1 interacts with several of these
373 ER to Golgi SNARE proteins (Peng and Gallwitz, 2004). In order to further
374 elucidate the function of SNAREs in the export of PC VII we tested SLY1
375 interacting SNAREs, specifically the ER localized STX18 and STX17 as well as
376 the ER and Golgi membrane associated STX5 (Rowe et al., 1998; Steegmaier et
377 al., 2000; Yamaguchi et al., 2002). RDEB/FB/C7 or Saos2 cells were transfected
378 with siRNA oligos for the respective t-SNAREs. The knockdown efficiency of
379 the cognate mRNAs was assessed by rtPCR (Figure 9A). The medium from
380 RDEB/FB/C7 cells treated with siRNAs for STX5, 17 and 18 was collected as
381 previously described and western blotted for the presence of PC VII. We
382 observe that both knockdown of STX5 and 18 reduced the amount of PC VII
383 being secreted. STX17 had only marginal effect on the secretion of PC VII
384 (Figure 9B and 9C). The secretion of Collagen I to the media was assessed in
385 Saos2 cells. We observed a reduction of secreted protein when cells were treated
386 with siRNAs for STX5. Neither depletion of STX17 nor depletion of STX18
387 affected the levels of secreted Collagen I (Figure 9F). Alongside, we quantified
388 by immunofluorescence the number of cells that accumulate PC VII and I
389 intracellularly. For this, we counted at least 30 cells in each of five random
390 fields. In STX18 and STX5 knockdown samples more than 80% of the cells
391 accumulated PC VII in the ER compared to 25% of the cells in the control
392 (Figure 9D and 9E). These numbers are comparable to SLY1 or TANGO1
19 393 depleted cells. Accumulation of PC I was only detectable in STX5 depleted cells
394 (80%). STX18, like TANGO1 or SLY1 knockdown did not arrest PC I in the ER
395 (Figure 9G and 9H).
396
20 397 Discussion
398
399 Is the export of bulky collagens from the ER mediated by the standard COPII
400 machinery? How is the size of the COPII coats regulated to generate a mega
401 carrier for the export of collagens that can be up to 450 nm of rigid unbendable
402 structures? How are the secretory collagens connected with the cytoplasmic
403 COPII machinery? Are all the bulky collagens exported by a common secretory
404 pathway? Our new data show that knockdown of SAR1 A and B inhibits the
405 export of PC VII from the ER. This, combined with the data on the involvement
406 of SEC31 ubiquitination for the export of PC I from the ER (Jin et al., 2012) and
407 Sedlin, a component of the TRAPP II complex that affects the GTPase activity
408 of SAR1 and promotes PC I and II export (Venditti et al., 2012), strongly
409 indicates that SAR1 dependent recruitment of COPII components is required for
410 general collagen export from the ER.
411
412 Secretory cargo sorting in the ER
413 A large number of secretory cargoes bind receptors of the ERGIC53, ERV and
414 p24 families; the receptors in turn bind the inner COPII coat components and are
415 then packed into a standard COPII vesicle (Zanetti et al., 2012). Our previous
416 findings indicate that TANGO1, which localizes to ER exit sites, binds PC VII
417 in the lumen and SEC23/24 of the COPII coats on the cytoplasmic site (Saito et
418 al., 2009). The function of TANGO1 is facilitated by cTAGE5 (Saito et al.,
21 419 2011). cTAGE5 and TANGO1 interact through their second (proximal to the
420 proline rich domain) coiled-coiled domains at the ER exit sites. cTAGE5 does
421 not have a luminal domain and cannot therefore bind PC VII directly (Saito et
422 al., 2011). The TANGO1-cTAGE5 complex is proposed to stall the COPII
423 vesicles at the ER exit sites as they are being packed with PC VII and this
424 procedure is proposed to result in the production of a transport intermediate for
425 the export of PC VII from the ER (Malhotra and Erlmann, 2011). The process
426 by which PC I in the lumen of the ER is connected to COPII coat components
427 remains unclear.
428 In our experimental conditions, SLY-1 and the ER associated t-SNARE
429 STX18 are specifically required for the export of PC VII but not of the general
430 cargoes and PC I. This strongly indicates the existence of different export
431 pathways from the ER (Figure 10a). These findings also highlight that the
432 sorting of cargoes into different export routes is not driven solely by the size of
433 the secretory cargoes. While the mechanism regulating this sorting event
434 remains unclear it is worth highlighting that TANGO1 in Drosophila is localized
435 to the basal endoplasmic reticulum specific exit sites (Lerner et al., 2013).
436 Moreover, TANGO1 in Drosophila is required for the export of Collagen IV,
437 which is secreted into the basal face of the cells (Lerner et al., 2013). It is
438 therefore tempting to propose that secretory cargoes are sorted in the lumen of
439 the ER based on their final destination.
22 440 Human cells contain a second SLY1 like protein (SCFD2, Gene ID:
441 152579). A TANGO1 like protein called MIA2 that is expressed only in the liver
442 and small intestine has also been identified (Pitman et al., 2011). The cargoes
443 exported by these proteins are not known but they could, in combination with
444 SAR1, facilitate the export of other collagens, including Collagen I and perhaps
445 many other bulky molecules, from the ER.
446 At this juncture, it is also important to comment on our original finding
447 that TANGO1 inhibited the secretion of an artificial cargo ss-HRP in Drosophila
448 S2 cells (Bard et al., 2006). There is no evidence that TANGO1 binds HRP in
449 the lumen of the ER and yet both knockdown of TANGO1 and SLY1, as shown
450 here, affect ss-HRP secretion in mammalian cells. We suggest that the
451 exogenously expressed ss-HRP or ss-GFP exits the ER by any route available
452 and blocking any one, for example by TANGO1 or SLY1 knockdown, affects its
453 export because of a block in one of the possible exit routes.
454
455 The requirement of ER attached t-SNARE in cargo export from the ER
456 Our surprising finding is that SLY1, which is known to interact with STX18, a t-
457 SNARE for membrane fusion (Hatsuzawa et al., 2000), is required for the export
458 of PC VII from the ER. The function of SLY1, which is a member of the
459 STXBP/unc-18/SEC1 protein family, remains unclear. For example, it is not
460 known whether SLY1 regulates the activity of the SNARE complex, or helps
461 with the fusion or the disassembly of the SNAREs (Carr and Rizo, 2010). SLY1
23 462 at the ER -Golgi interface has been shown to interact with a large number of
463 SNAREs and could thus regulate a number of different SNARE complexes
464 (Dascher and Balch, 1996; Steegmaier et al., 2000; Yamaguchi et al., 2002). The
465 t- and v-SNAREs of the ER Golgi anterograde and retrograde trafficking routes
466 are summarized in table 1. So far the SNARE complexes reported for the
467 forward trafficking from ER to Golgi are complexes of Golgi t-SNAREs and a
468 specific v-SNARE. However, there is no evidence that the ER attached t-
469 SNAREs such as STX17, STX18, Sec20 and USE1/P31 are required for the
470 forward transport to the Golgi complex. It could be argued that SLY1 and
471 STX18 function to recycle a specific component, a v-SNARE; for example,
472 from ERGIC /early Golgi cisternae and without which, the cells terminate the
473 export of PC VII out of the ER. However, cycling of KDEL containing protein
474 BIP and ERGIC53 as well as the export of other secretory cargoes including the
475 bulky PC I is unaffected under these experimental conditions. Additionally, we
476 do not see any obvious accumulation of PC VII containing large vesicles in
477 between the ER and the Golgi. We therefore favor the possibility that SLY1 and
478 STX18 are required for the fusion of membranes to the ER to generate an export
479 carrier for PC VII. The working hypothesis for the export of PC VII from the ER
480 follows (Figure 10B).
481
482 1. A SAR1 dependent reaction initiates the assembly of COPII subunits
483 SEC23/24 at the ER exit sites.
24 484
485 2. Recruitment of TANGO1-cTAGE5 complex into this reaction with its
486 binding of PC VII in the lumen and SEC23/24 on the cytoplasmic site.
487 488 3. The binding of TANGO1-cTAGE5 to SEC23/24 retards the recruitment
489 of SEC13/31 and prevents premature pinching of membranes (Malhotra
490 and Erlmann, 2011; Saito et al., 2009; Saito et al., 2011). These ER exit
491 sites containing TANGO1 bound PC VII are then concentrated to generate
492 a specific patch, which for the sake of simplicity we call PCP (PC VII
493 concentrated patch).
494 495 4. A special pool of recycling membranes; for example, the ERGIC, then
496 fuse with PCP by a reaction that requires SLY1 and STX18.
497
498 5. As the PCP grows, TANGO1 dissociates from the collagen, which then
499 promotes the recruitment of SEC13/31 to the neck. This reaction also
500 prevents the packing of TANGO1-cTAGE 5 into the PC VII enriched bud
501 (PEB). The neck of this large PEB, concentrated in COPII coats,
502 undergoes fission by the same mechanism as that of a standard COPII
503 vesicle.
504
505 The PC VII enriched large membrane compartment separated from the ER
506 also contains recycled ERGIC membranes. This membrane bound
25 507 compartment in principle is the first post ER compartment that matures to
508 move PC VII in the anterograde direction for secretion.
509 Interestingly, Luini and colleagues have reported that export of PC I from the
510 ER requires its concentration at a domain close to the ER exit sites, which
511 they suggest protrudes and then separates from the ER to generate a PC I
512 enriched carrier (Mironov et al., 2003). Their model is reminiscent of our
513 scheme in which we place molecular components such as TANGO1 for the
514 concentration of PC VII followed by the fusion of membranes to grow the
515 PC VII enriched ER domain. However, the TANGO1 mediated concentration
516 of PC VII requires the involvement of COPII components, SEC23/24.
517 Additionally, the protrusion visualized by the microscopy based analysis
518 might correspond to growth of ER patch by SLY1 and STX18 dependent
519 fusion of the recycling (ERGIC) membranes. The challenge is to find
520 proteins that connect PC I with the COPII machinery, the SNAREs required
521 for the trafficking of PC I, and the visualization of membranes that we
522 propose are added to grow the patch of PC VII containing ER membrane into
523 a vectorial carrier en route to the cell surface for secretion.
524
26 525 Acknowledgments
526 We thank the entire Malhotra Lab for help with figures and corrections. We
527 would like to acknowledge the CRG’s mass spectrometry facility for sample
528 analysis and the CRG advanced light microscopy facility for help with
529 conventional and STED fluorescent microscopy. P. Erlmann was partially
530 funded by a DFG fellowship (ER 681/1-1). V. Malhotra is an Institució Catalana
531 de Recerca i Estudis Avançats (ICREA) professor at the Center for Genomic
532 Regulation and the work in his laboratory is funded by grants from Plan
533 Nacional (BFU2008-00414), Consolider (CSD2009-00016), Agència de Gestió
534 d'Ajuts Universitaris i de Recerca (AGAUR) Grups de Recerca Emergents
535 (SGR2009-1488; AGAUR-Catalan Government), and European Research
536 Council (268692).
537
27 538 Material and Methods
539
540 cDNA cloning and constructs
541 TANGO1 constructs were as described previously (Saito et al., 2009).
542 Full length SLY1 was amplified by RT-PCR from the total mRNA of HeLa cells.
543 SLY1 was cloned into the retroviral vector pLJM1-GFP (Addgene, Cambridge
544 MA) using Gibson cloning strategy (Gibson et al., 2009). SnapGene software
545 (from GSL Biotech, Chicago, IL; available at www.snapgene.com) was used for
546 molecular cloning procedures. The Ii-FRAP-HA plasmid has been previously
547 described (Pecot and Malhotra, 2006). The FKBP-ERGIC53-GFP plasmid was a
548 gift from Dr. Hauri (Ben-Tekaya et al., 2005).
549
550 Cell culture
551 RDEB/FB/C7 cells, HeLa, Het1a, and Saos2 cells were grown at 37°C with 5%
552 CO2 in complete DMEM with 10% fetal bovine serum. Plasmids were
553 transfected in HeLa, with TransIT-HeLaMONSTER® (Mirus Bio LLC,
554 Madison, WI) or X-tremeGENE9 (Roche, Indianapolis, IN) according to the
555 manufacture’s protocols. siRNAs were transfected in HeLa, RDEB/FB/C7,
556 Het1a and Saos2 with Hiperfect (Qiagen, Venlo, Netherlands) according to the
557 manufacture’s protocols. In the case of RDEB/FB/C7, siRNAs were transfected
558 twice, on day 0 and on day 1. For lentiviral infection of SLY1-GFP into
559 RDEB/FB/C7 cells, lentiviral particles were produced by co-tranfecting
28 560 HEK293 cells with a third generation packaging vector pool and pJLM1-SLY1-
561 GFP using TransIT®-293 (Mirus Bio LLC). At 72 hours post transfection the
562 viral supernatant was harvested, filtered and directly added to RDEB/FB/C7
563 cells.
564
565 siRNA oligos
566 siRNAs for SLY1, TANGO1, STX5, STX17, STX18 and SAR1 A and B were
567 purchased from Eurofins MWG Operon (Huntsville, AL): SLY1 siRNA-
568 AGACUUAUUGAUCUCCAUA; TANGO1 siRNA-
569 GAUAAGGUCUUCCGUGCUU; STX5 siRNA-
570 GGACAUCAAUAGCCUCAAC; STX17 siRNA-
571 GACUGUUGGUGGAGCAUUU; STX18 siRNA-
572 CAGGACCGCUGUUUUGGAUUU; for knockdown of SAR1A+B a pool of 4
573 siRNAs were used as previously described (Cutrona et al., 2013). Control
574 siRNAs consisted of a pool of ON-TARGETplus Non-Targeting siRNAs (D-
575 001810-10-05, Thermo Scientific, Waltham, MA).
576
577 Antibodies
578 Antibodies used in conventional western blotting, immunofluorescence and
579 immunoelectron microscopy are the following: SLY1, Collagen VII, Collagen I,
580 GRP78/BIP, SEC23A (Abcam, Cambridge, UK); TANGO1 (LifeSpan
581 Biosciences, Seattle, WA); SAR1 (Milipore, Billerica, MA); HSP47 (Enzo Life
29 582 Sciences, Farmingdale, NY); SEC31, GM130 (BD Biosciences, San Jose, CA);
583 β-COP, myc, Tubulin, Actin (Sigma-Aldrich, St. Louis, MO); HA (Covance,
584 Princeton, NJ); ε-COP (a gift from Dr. Rothman).
585
586 Immunoprecipitation
587 HeLa cells were transfected with a plasmid encoding MycHis-Tagged
588 cytoplasmatic tail of TANGO1. 24 hours post transfection proteins were
589 crosslinked by incubation with the cell permeable cross linker DSP (Pierce,
590 Rockford, IL USA) for 30 min at room temperature. Residual cross linker was
591 quenched by adding Tris-HCl to a final concentration of 150 mM. Cells were
592 scraped into lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1% TX100, 1 mM
593 sodium orthovanadate, 10 mM sodium fluoride, and 20 mM β-glycerophosphate,
594 10 mM Imidazol) and lysates were clarified by centrifugation at 16.000g for 10
595 min at 4°C. The lysates were then incubated with Ni+-Agarose (Qiagen) beads
596 for 2 hours at 4°C on a rotating platform. The beads were washed 3 times with
597 lysis buffer and the specifically bound proteins eluted using PBS containing 500
598 mM Imidazol.
599
600 Collagen secretion
601 RDEB/FB/C7 or Saos2 cells were transfected with siRNA as described above.
602 24 hours after the last siRNA transfection, the medium was replaced with fresh
603 medium containing 2 μg/ml ascorbic acid. Fresh medium containing ascorbic
30 604 acid was added again to the cells 20 hours before being collected. Upon
605 collection, the media was centrifuged at low speed to remove any cell in
606 suspension and the supernatant boiled for 5 min with Laemmli SDS-sample
607 buffer. For cell lysis, the cells were washed with PBS, lysed and centrifuged at
608 14,000 rpm for 15 min at 4oC. The supernatants were boiled for 5 min with
609 Laemmli SDS-sample buffer. Both media and cell lysate were subjected to SDS-
610 PAGE (6% acrylamide) and western blotting with Collagen VII, Collagen I and
611 Tubulin antibodies. Image J (NIH, Bethesda, Maryland) was used for
612 quantitation.
613
614 Immunofluorescence microscopy
615 Cells grown on coverslips were fixed either with cold methanol for 10 minutes
616 at -20°C or with 4% paraformaldehyde in PBS for 10 minutes followed by
617 permeabilization with 0.2% Triton X100 at room temperature, and then
618 incubated with blocking reagent (Roche) for 30 min at room temperature.
619 Primary antibodies were diluted in blocking reagent and incubated overnight at
620 4°C. Secondary antibodies conjugated with Alexa 488, Alexa 594 or Alexa 647
621 were diluted in blocking reagent and incubated for one hour at room
622 temperature. For SLY1 localization studies, RDEB/FB/C7 expressing SLY1-
623 GFP were transfected with the indicated siRNAs; after 72 hours after
624 transfection cells were processed for immunofluorescence. Briefly, cells were
625 washed twice with room temperature KHM buffer (125 mM potassium acetate,
31 626 25 mM HEPES [pH 7.2], and 2.5 mM magnesium acetate). Cells were then
627 permeabilized by incubation in KHM containing 0.1% Saponin for 5 min on ice
628 followed by wash for 7 min at room temperature with KHM buffer. Cells were
629 subsequently fixed in 4% paraformaldehyde and processed for
630 immunofluorescence microscopy. Images were taken with a Leica TCS SPE
631 confocal with a 63x objective. SEC31 and TANGO1 localization images on
632 figure 8 were taken with a Leica TCS SP5II CW-STED system in STED mode
633 with a 100x 1.4NA objective at a pixel-size of 20nm using a 592nm depletion
634 laser and HyD detectors.
635
636 Immunoelectron microscopy
637 Cryoimmunoelectron microscopy was performed as described previously
638 (Martinez-Alonso et al., 2005). Control and SLY1 or TANGO1 depleted
639 RDEB/FB/C7 were fixed with 2% paraformaldehyde and 0.2% glutaraldehyde
640 in 0.1 M sodium phosphate buffer, pH 7.4. After washing in buffer, the cells
641 were pelleted by centrifugation, embedded in 10% gelatin, cooled on ice and cut
642 into 1 mm3 blocks. The blocks were infused with 2.3 M sucrose at 4oC
643 overnight, frozen in liquid nitrogen and stored until cryo-ultramicrotomy.
644 Sections (~50 nm-thick) were cut at -120°C with a diamond knife in a Leica
645 Ultracut T/FCS. Ultrathin sections were picked up in a mix of 1.8%
646 methylcellulose and 2.3 M sucrose (1:1). Cryosections were collected on carbon
647 and formvar-coated copper grids and incubated with rabbit polyclonal antibodies
32 648 against Collagen VII, followed by protein A-gold. After labeling, the sections
649 were treated with 1% glutaraldehyde, counterstained with uranyl acetate pH 7
650 and embedded in methyl cellulose-uranyl acetate pH 4 (9:1).
651
652 Retrograde transport
653 HeLa cells were transfected with the respective siRNAs as mentioned above.
654 Past 48 hours, the cells were transfected with FKBP-ERGIC53-GFP and Ii-
655 FRAP-HA plasmids as described previously (Pecot and Malhotra, 2006). 24
656 hours after plasmid transfection, cells were incubated with media only (control),
657 or media + CHX (100 µg/ml) + Rapamycin (200nM). At the indicated time
658 points, the cells were fixed and analyzed by fluorescence microscopy. ERGIC53
659 was visualized by GFP fluorescence, and Ii with a HA-antibody and an
660 Alexa594 labeled secondary antibody. Colocalization of the two proteins was
661 assessed in at least 30 cells from 5 different focus fields of an representative
662 experiment by calculating the Pearson's colocalization coefficient using Image J
663 software and the Colocalization Analysis plug-in. Pearsons colocalization
664 coefficient of 1 means total colocalization whereas 0 indicates no colocalization.
665
666 Metabolic labeling
667 Control and siRNA-treated cells were cultured in DMEM without L-methionine
668 and L-cysteine for 60 min and pulsed with 100 µCi 35Smethionine (Hartmann
669 Analytics) for 20min. The cells were washed three times with PBS and chased
33 670 with DMEM containing 10 mM unlabeled methionine for 2 h. For BFA
671 treatment, 10 µg/ml BFA was added to the medium for the last 10 min of
672 incubation and kept for the whole experiment. Cells were lysed with PBS
673 containing 1% Triton X-100. 20 µl of cell extracts was mixed with scintillation
674 cocktail, and the radioactivity was determined for normalization. The collected
675 medium was precipitated with TCA and analyzed by SDS-
676 PAGE/autoradiography.
677
678 HRP secretion assay in HeLa cells
679 HeLa cells stabily expressing ss-HRP were cultured in 12-well plate and
680 transfected with control siRNA, SLY1 or TANGO1 specific siRNA oligos.
681 Seventy-two hours later, cells were washed with medium and incubated with 1
682 ml of complete medium at 15°C for 2 hours. Then, cells were incubated with
683 500 μl of complete medium at 37°C in presence of 100 μM CHX. At the time
684 points indicated, the medium and cells were harvested for HRP secretion assay.
685 50 μl of the medium was collected and cells were lysed in 100 μl of lysis buffer
686 (50 mM Tris, pH 7.4, 150 mM NaCl, 0.1% sodium dodecyl sulfate (SDS), 1%
687 Nonidet P-40 (NP- 40) and 0.5% sodium deoxycholate) supplemented with
688 protease inhibitors, 1 mM Na3VO4, and 25 mM sodium fluoride and
689 centrifuged at 16,000 g for 15 min. For the chemiluminescence assay, 50 μl of
690 medium and cell lysate were mixed with an ECL reagent (Thermo Scientific)
34 691 and luminescence measured with a Victor 3 plate reader (PerkinElmer,
692 Waltham, MA).
693
35 694 Table 1- SNAREs involved in the early secretory pathway
Name t- or v- Sub-cellular localization Secretion Cargoes associated SNARE pathway STX 18 t ER (Itakura et al., 2012; Golgi to ER, Collagen VII (this Nakajima et al., 2004) ER to Golgi study), ssGFP (Gordon et al., 2010) STX 17 t ER (Itakura et al., 2012) Autophagy GFP-LC3 (Itakura et al., 2012) USE1/P t ER (Nakajima et al., Golgi to ER ERGIC-53, KDEL-R 31 2004; Okumura et al., (Aoki et al., 2009) 2006) SEC20 t ER (Nakajima et al., Golgi to ER, ssGFP (Gordon et 2004) ER to Golgi al., 2010) STX 5 t Golgi (Aoki et al., 2009; ER to Golgi, Collagen VII (this Rowe et al., 1998) Golgi to ER study), Collagen I (this study), ssGFP (Gordon et al., 2010) BET1 t ER-ERGIC-Golgi (Hay ER to Golgi Chylomicrons et al., 1996; Uemura et (Siddiqi et al., 2006) al., 2009) BET1L t Golgi (Tai et al., 2004) unkonwn SEC22B v ER-ERGIC-Golgi (Hay ER to Golgi, ssGFP (Gordon et et al., 1996; Tai et al., Golgi to ER al., 2010) 2004) YKT6 v ER-ERGIC-Golgi ER to Golgi, ssGFP (Gordon et (Volchuk et al., 2004; Golgi to ER al., 2010) Zhang and Hong, 2001) VTI1a v ER-ERGIC-Golgi ER to Golgi Chylomicrons (Flowerdew and (Siddiqi et al., 2006) Burgoyne, 2009) 695 t- targeting; v-vesicular; ER- endoplasmic reticulum; ERGIC- ER to Golgi intermediate 696 compartment; ssGFP - signal sequence GFP 697 36 698 Figures and legends
699
700 Figure 1. SLY1 immunoprecipitates with TANGO1 and localizes to ER exit
701 sites.
702 (A) Lysates from mycHis-TANGO1 (cytoplasmic tail) transfected or control
703 HeLa cell lysates were incubated with Nickel beads, bound proteins (75%) and
704 total lysates (10%) were separated by SDS-PAGE, endogenous SLY1 and
705 mycHis-TANGO1 (cytoplasmic tail) was detected by Western Blot using SLY1
706 and myc antibodies. (B) RDEB/FB/C7 cells stably expressing SLY1-GFP
707 (green) were fixed with 4% PFA and permeabilized with Triton-X100 or pre-
708 extracted with saponin, washed and then fixed with 4% PFA prior to
709 permeabilization with Triton-X100. Cells were labeled with an anti-SEC31 or an
710 anti-GM130 antibody (red) and DAPI (blue, Scale bar: 20µm); arrowheads
711 indicate colocalization of SLY1-GFP and SEC31.
712
713 Figure 2. SLY1 knockdown by siRNA inhibits Procollagen VII secretion.
714 RDEB/FB/C7 cells were transfected with siRNAs directed against SLY1,
715 TANGO1 or a scrambled siRNA. Het1a cells were transfected with the same set
716 of siRNAs. (A) Knockdown efficiency was tested after 72 hours by western
717 blotting cell lysates with anti-TANGO1 or anti-SLY1 antibodies. (B) PC VII
718 secretion was measured by western blotting RDEB/FB/C7 cell lysates and
719 supernatants collected for 20 hours in the presence of ascorbic acid with an anti-
37 720 Collagen VII antibody. Equal protein loading and cell lysis was controlled by
721 blotting with an anti-Tubulin antibody. (C) In three independent experiments,
722 intensities of the PC VII signal in the lysate and the supernatant was recorded by
723 densitometry. The ratio of external versus internal Collagen VII was normalized
724 to quantify secretion in control cells as 100%; Error bars: standard error of the
725 mean (SEM). siRNA treated RDEB/FB/C7 (D) or Het1a (E) cells were seeded
726 on coverslips and 20 hours after addition of ascorbic acid, cells were fixed and
727 visualized with the indicated antibodies and DAPI (blue) by fluorescence
728 microscopy (scale bars: 20µm).
729
730 Figure 3. Immuno electron microscopy localizes intracellular Procollagen
731 VII in SLY1 knockdown cells to the ER.
732 Control cells and cells depleted for SLY1 or TANGO1 were fixed for immuno
733 electron microscopy. Ultrathin cryosections were labeled with a polyclonal
734 rabbit antibody against Collagen VII followed by 10 nm protein A-gold
735 complex. Arrowheads mark ER exit sites. Bars, 250 nm.
736
737 Figure 4. SLY1 knockdown does not affect the levels of COPI and COPII
738 components.
739 Cell lysates from RDEB/FB/C7 cells transfected with siRNAs oligos against
740 SLY1, TANGO1 or a scrambled siRNA were western blotted with antibodies to
741 the indicated COPI and COPII components.
38 742
743 Figure 5. SLY1 knockdown does not affect retrograde trafficking.
744 (A) RDEB/FB/C7 cells depleted of SLY1 or control cells were visualized using
745 an anti-GRP78/BIP, an anti-GM130 antibody and DAPI by fluorescence
746 microscopy (scale bars: 20µm). (B) Lysates and 20 hours medium of SLY1,
747 TANGO1 or control knockdown RDEB/FB/C7 cells were analyzed by SDS-
748 PAGE and western blotted with an anti-GRP78/BIP antibody. (C) In HeLa cells
749 transfected with the indicated siRNAs the colocalization of FKBP-ERGIC53-
750 GFP and the ER localized Ii-FRAP-HA was determined at each indicated time
751 points after addition of Rapamycin. Trapping, and thus colocalization, was
752 measured by calculating the Pearsons colocalization coefficient between the
753 GFP signal and the Alexa594 stained Ii-FRAP-HA. The average values of at
754 least 30 cells analyzed per experiment for each condition are shown; Error bars:
755 SEM.
756
757 Figure 6. SLY1 knockdown does not block the export of endogenous
758 secretory cargo.
759 (A) RDEB/FB/C7 cells depleted for SLY1 or TANGO1 or control cells were
35 760 pulsed with S-methionine for 20 min and chased for 2 hours in complete
761 medium that included 5 mg/ml BFA where indicated. The medium from the
762 cells was collected and analyzed by SDS–PAGE and autoradiography. (B) HeLa
763 ss-HRP cells were transfected with control siRNA, SLY1 or TANGO1 specific
39 764 siRNA oligos or treated with BFA as a positive control for total block in
765 secretion. At the indicated time points, the medium and cell lysates were
766 harvested to measure HRP activity. The graph shows the ratio of secreted to
767 intracellular ss-HRP activity. Average values of three independent experiments
768 are shown; Error: SEM. (C) RDEB/FB/C7 cells were transfected with control
769 siRNA, SLY1 or TANGO1 specific siRNA oligos. Collagen I secretion was
770 measured by western blotting of RDEB/FB/C7 cell lysates and supernatants
771 collected for 20 hours in the presence of ascorbic acid with an anti-Collagen I
772 antibody. The samples were western blotted with an anti-Tubulin antibody to
773 monitor loading control and cell lysis. (D) Saos2 cells were transfected with
774 control, SLY1 or TANGO1 siRNAs. Knockdown efficiency was tested after 72
775 hours by western blotting cell lysates with anti-TANGO1 or anti-SLY1
776 antibodies. Actin was used as a loading control. (E) Collagen I secretion was
777 measured by western blotting Saos2 cell lysates and supernatants collected for
778 20 hours in the presence of ascorbic acid with an anti-Collagen I antibody. The
779 samples were also western blotted with an anti-Tubulin antibody to monitor
780 loading control and cell lysis.
781
782 Figure 7. SAR1 A and B knockdown blocks Collagen VII secretion.
783 RDEB/FB/C7 cells were transfected with siRNAs directed against SAR1A,
784 SAR1B, both or a scrambled control siRNA. (A) Knockdown efficiency was
785 determined after 72 hours by western blotting cell lysates with an anti-SAR1
40 786 antibody. Tubulin was used as a loading control. *- unspecific band. (B)
787 Collagen VII secretion was measured by western blotting RDEB/FB/C7 cell
788 lysates and supernatants collected for 20 hours in the presence of ascorbic acid
789 using an anti-Collagen VII antibody. (C) RDEB/FB/C7 cells treated with
790 ascorbic acid were seeded on coverslips and 72 hours after transfection with
791 control or SAR1 A and B siRNA the cells were fixed and visualized by
792 fluorescence microscopy with the indicated antibodies and DAPI (blue, scale
793 bars: 20µm).
794
795 Figure 8. SLY1 is required for post coat assembly events in PC VII export.
796 RDEB/FB/C7 cells were transfected with control siRNA (A) or siRNAs directed
797 against SAR1 A+B (B), TANGO1 (C) or SLY1 (D). Cells were incubated in
798 medium containing ascorbic acid for 72 hours. In control cells (A) protein
799 export from the ER was arrested for 3 hours at 15°C and cells were fixed after a
800 30 min release to 37°C. All other samples were fixed without a 15°C
801 temperature block (B-D). The ER exit sites were visualized using either anti-
802 SEC31 or anti-TANGO1 antibodies (green) in STED mode. PC VII patches
803 were visualized using either anti-Collagen VII (in combination with anti-
804 SEC31) or the colocalizing HSP47 (in combination with anti-TANGO1)
805 antibodies (red) in normal confocal mode. Edge length of the zoom boxes is
806 approx. 5µm.
41 807 Figure 9. The t-SNARE Syntaxin 18 is necessary for Procollagen VII but
808 not Procollagen I export.
809 To evaluate PC VII (B- E) and PC I export (F-H), RDEB/FB/C7 and Saos2 cells
810 were transfected with siRNAs directed against STX5, STX17, STX18 or a
811 scrambled siRNA. (A) Knockdown efficiency was assessed 48 hours after
812 transfection by RT-PCR. PC VII secretion (B) and PC I secretion (F) was
813 measured by western blotting cell lysates and supernatants collected for 20
814 hours in the presence of ascorbic acid with an anti-Collagen VII antibody from
815 RDEB/FB/C7 and Saos2 cells, respectively. Equal protein loading and cell lysis
816 was controlled by blotting with an anti-Tubulin antibody. (C) Intensities of
817 Collagen VII in the lysate and the supernatant was recorded by densitometry in
818 four independent experiments. The ratio of external versus internal Collagen VII
819 was normalized to quantify secretion in control cells as 100%; Error bars:
820 standard error of the mean (SEM). (D, G) siRNA treated RDEB/FB/C7 cells
821 were seeded on coverslips and 20 hours after addition of ascorbic acid, cells
822 were fixed and visualized with Collagen VII (D) or Collagen I (G) antibodies
823 (green), and DAPI (blue) by fluorescence microscopy. The percentage of cells
824 that accumulate PC VII (E) or PC I (H) intracellularly was determined by
825 counting at least 30 cells in five random fields. The number of cells
826 accumulating PC VII in the case of STX5 and STX18 siRNA was significantly
827 different from control cells (p< 0.05). Accumulation of PC VII in STX17 siRNA
42 828 cells was not significantly different from the control situation (p> 0.1). (Error
829 bars: standard error of the mean (SEM).
830
831 Figure 10. A working model for procollagen export from the ER.
832 (A) Multiple exit routes from the ER.
833 Cargo receptors of the ERGIC53, ERV and p24 families bind secretory cargoes
834 in the lumen and the inner COPII coat on the cytoplasmic side of the ER. These
835 receptors bound to cargoes are collected into COPII vesicles for export from the
836 ER. TANGO1 connects PC VII in the lumen of the ER with COPII coats on the
837 cytoplasmic side of the ER. The mechanism by which PC I is connected with the
838 COPII components is not known. Sedlin and ubiquitination of SEC31 are
839 required for PC I secretion but their role in PC VII export is not known.
840 (B) Building a Procollagen VII containing mega carrier by fusion of recycling
841 ERGIC membranes.
842 Post concentration of PC VII by TANGO1 at the ER exit sites, many of the ER
843 exit sites are concentrated to generate a patch enriched in PC VII. This patch
844 containing STX18 then promotes SLY1 dependent fusion of membranes from
845 the ERGIC. Accretion of membranes by this process grows PC VII enriched ER
846 patch. The COPII coats and the TANGO1 remain at the neck of the growing
847 patch. These components at the neck promote fission and the resulting mega
848 container enriched in PC VII and ERGIC membrane components is in fact the
849 first post ER compartment that matures to move PC VII forward.
43 850 References
851
852 Aoki, T., Ichimura, S., Itoh, A., Kuramoto, M., Shinkawa, T., Isobe, T., and 853 Tagaya, M. (2009). Identification of the neuroblastoma-amplified gene product 854 as a component of the syntaxin 18 complex implicated in Golgi-to-endoplasmic 855 reticulum retrograde transport. Mol Biol Cell 20, 2639-2649. 856 Bard, F., Casano, L., Mallabiabarrena, A., Wallace, E., Saito, K., Kitayama, H., 857 Guizzunti, G., Hu, Y., Wendler, F., Dasgupta, R., et al. (2006). Functional 858 genomics reveals genes involved in protein secretion and Golgi organization. 859 Nature 439, 604-607. 860 Ben-Tekaya, H., Miura, K., Pepperkok, R., and Hauri, H.P. (2005). Live 861 imaging of bidirectional traffic from the ERGIC. J Cell Sci 118, 357-367. 862 Boyadjiev, S.A., Fromme, J.C., Ben, J., Chong, S.S., Nauta, C., Hur, D.J., 863 Zhang, G., Hamamoto, S., Schekman, R., Ravazzola, M., et al. (2006). Cranio- 864 lenticulo-sutural dysplasia is caused by a SEC23A mutation leading to abnormal 865 endoplasmic-reticulum-to-Golgi trafficking. Nat Genet 38, 1192-1197. 866 Carr, C.M., and Rizo, J. (2010). At the junction of SNARE and SM protein 867 function. Curr Opin Cell Biol 22, 488-495. 868 Chen, M., Kasahara, N., Keene, D.R., Chan, L., Hoeffler, W.K., Finlay, D., 869 Barcova, M., Cannon, P.M., Mazurek, C., and Woodley, D.T. (2002). 870 Restoration of type VII collagen expression and function in dystrophic 871 epidermolysis bullosa. Nat Genet 32, 670-675. 872 Cutrona, M.B., Beznoussenko, G.V., Fusella, A., Martella, O., Moral, P., and 873 Mironov, A.A. (2013). Silencing of mammalian Sar1 isoforms reveals COPII- 874 independent protein sorting and transport. Traffic 14, 691-708. 875 Dascher, C., and Balch, W.E. (1996). Mammalian Sly1 regulates syntaxin 5 876 function in endoplasmic reticulum to Golgi transport. J Biol Chem 271, 15866- 877 15869. 878 Dascher, C., Ossig, R., Gallwitz, D., and Schmitt, H.D. (1991). Identification 879 and structure of four yeast genes (SLY) that are able to suppress the functional 880 loss of YPT1, a member of the RAS superfamily. Mol Cell Biol 11, 872-885. 881 Flowerdew, S.E., and Burgoyne, R.D. (2009). A VAMP7/Vti1a SNARE 882 complex distinguishes a non-conventional traffic route to the cell surface used 883 by KChIP1 and Kv4 potassium channels. Biochem J 418, 529-540. 884 Gelse, K., Poschl, E., and Aigner, T. (2003). Collagens--structure, function, and 885 biosynthesis. Adv Drug Deliv Rev 55, 1531-1546. 886 Gibson, D.G., Young, L., Chuang, R.Y., Venter, J.C., Hutchison, C.A., 3rd, and 887 Smith, H.O. (2009). Enzymatic assembly of DNA molecules up to several 888 hundred kilobases. Nat Methods 6, 343-345. 889 Gordon, D.E., Bond, L.M., Sahlender, D.A., and Peden, A.A. (2010). A targeted 890 siRNA screen to identify SNAREs required for constitutive secretion in 891 mammalian cells. Traffic 11, 1191-1204.
44 892 Hatsuzawa, K., Hirose, H., Tani, K., Yamamoto, A., Scheller, R.H., and Tagaya, 893 M. (2000). Syntaxin 18, a SNAP receptor that functions in the endoplasmic 894 reticulum, intermediate compartment, and cis-Golgi vesicle trafficking. J Biol 895 Chem 275, 13713-13720. 896 Hay, J.C., Hirling, H., and Scheller, R.H. (1996). Mammalian vesicle trafficking 897 proteins of the endoplasmic reticulum and Golgi apparatus. J Biol Chem 271, 898 5671-5679. 899 Itakura, E., Kishi-Itakura, C., and Mizushima, N. (2012). The hairpin-type tail- 900 anchored SNARE syntaxin 17 targets to autophagosomes for fusion with 901 endosomes/lysosomes. Cell 151, 1256-1269. 902 Jin, L., Pahuja, K.B., Wickliffe, K.E., Gorur, A., Baumgartel, C., Schekman, R., 903 and Rape, M. (2012). Ubiquitin-dependent regulation of COPII coat size and 904 function. Nature 482, 495-500. 905 Laufman, O., Kedan, A., Hong, W., and Lev, S. (2009). Direct interaction 906 between the COG complex and the SM protein, Sly1, is required for Golgi 907 SNARE pairing. EMBO J 28, 2006-2017. 908 Lerner, D.W., McCoy, D., Isabella, A.J., Mahowald, A.P., Gerlach, G.F., 909 Chaudhry, T.A., and Horne-Badovinac, S. (2013). A Rab10-dependent 910 mechanism for polarized basement membrane secretion during organ 911 morphogenesis. Dev Cell 24, 159-168. 912 Li, Y., Gallwitz, D., and Peng, R. (2005). Structure-based functional analysis 913 reveals a role for the SM protein Sly1p in retrograde transport to the 914 endoplasmic reticulum. Mol Biol Cell 16, 3951-3962. 915 Lotteau, V., Teyton, L., Peleraux, A., Nilsson, T., Karlsson, L., Schmid, S.L., 916 Quaranta, V., and Peterson, P.A. (1990). Intracellular transport of class II MHC 917 molecules directed by invariant chain. Nature 348, 600-605. 918 Malhotra, V. (2012). COPII vesicles get supersized by ubiquitin. Cell 149, 20- 919 21. 920 Malhotra, V., and Erlmann, P. (2011). Protein export at the ER: loading big 921 collagens into COPII carriers. EMBO J 30, 3475-3480. 922 Martinez-Alonso, E., Egea, G., Ballesta, J., and Martinez-Menarguez, J.A. 923 (2005). Structure and dynamics of the Golgi complex at 15 degrees C: low 924 temperature induces the formation of Golgi-derived tubules. Traffic 6, 32-44. 925 Mironov, A.A., Mironov, A.A., Jr., Beznoussenko, G.V., Trucco, A., Lupetti, P., 926 Smith, J.D., Geerts, W.J., Koster, A.J., Burger, K.N., Martone, M.E., et al. 927 (2003). ER-to-Golgi carriers arise through direct en bloc protrusion and 928 multistage maturation of specialized ER exit domains. Dev Cell 5, 583-594. 929 Nakajima, K., Hirose, H., Taniguchi, M., Kurashina, H., Arasaki, K., Nagahama, 930 M., Tani, K., Yamamoto, A., and Tagaya, M. (2004). Involvement of BNIP1 in 931 apoptosis and endoplasmic reticulum membrane fusion. EMBO J 23, 3216- 932 3226. 933 Nechiporuk, A., Poss, K.D., Johnson, S.L., and Keating, M.T. (2003). Positional 934 cloning of a temperature-sensitive mutant emmental reveals a role for sly1 935 during cell proliferation in zebrafish fin regeneration. Dev Biol 258, 291-306.
45 936 Okumura, A.J., Hatsuzawa, K., Tamura, T., Nagaya, H., Saeki, K., Okumura, F., 937 Nagao, K., Nishikawa, M., Yoshimura, A., and Wada, I. (2006). Involvement of 938 a novel Q-SNARE, D12, in quality control of the endomembrane system. J Biol 939 Chem 281, 4495-4506. 940 Ossig, R., Dascher, C., Trepte, H.H., Schmitt, H.D., and Gallwitz, D. (1991). 941 The yeast SLY gene products, suppressors of defects in the essential GTP- 942 binding Ypt1 protein, may act in endoplasmic reticulum-to-Golgi transport. Mol 943 Cell Biol 11, 2980-2993. 944 Pastor-Pareja, J.C., and Xu, T. (2011). Shaping cells and organs in Drosophila 945 by opposing roles of fat body-secreted Collagen IV and perlecan. Dev Cell 21, 946 245-256. 947 Pataridis, S., Eckhardt, A., Mikulikova, K., Sedlakova, P., and Miksik, I. (2008). 948 Identification of collagen types in tissues using HPLC-MS/MS. J Sep Sci 31, 949 3483-3488. 950 Pecot, M.Y., and Malhotra, V. (2006). The Golgi apparatus maintains its 951 organization independent of the endoplasmic reticulum. Mol Biol Cell 17, 5372- 952 5380. 953 Peng, R., and Gallwitz, D. (2004). Multiple SNARE interactions of an SM 954 protein: Sed5p/Sly1p binding is dispensable for transport. EMBO J 23, 3939- 955 3949. 956 Pitman, J.L., Bonnet, D.J., Curtiss, L.K., and Gekakis, N. (2011). Reduced 957 cholesterol and triglycerides in mice with a mutation in Mia2, a liver protein that 958 localizes to ER exit sites. J Lipid Res 52, 1775-1786. 959 Rowe, T., Dascher, C., Bannykh, S., Plutner, H., and Balch, W.E. (1998). Role 960 of vesicle-associated syntaxin 5 in the assembly of pre-Golgi intermediates. 961 Science 279, 696-700. 962 Saga, S., Nagata, K., Chen, W.T., and Yamada, K.M. (1987). pH-dependent 963 function, purification, and intracellular location of a major collagen-binding 964 glycoprotein. J Cell Biol 105, 517-527. 965 Saito, K., Chen, M., Bard, F., Chen, S., Zhou, H., Woodley, D., Polischuk, R., 966 Schekman, R., and Malhotra, V. (2009). TANGO1 facilitates cargo loading at 967 endoplasmic reticulum exit sites. Cell 136, 891-902. 968 Saito, K., Yamashiro, K., Ichikawa, Y., Erlmann, P., Kontani, K., Malhotra, V., 969 and Katada, T. (2011). cTAGE5 mediates collagen secretion through interaction 970 with TANGO1 at endoplasmic reticulum exit sites. Mol Biol Cell 22, 2301- 971 2308. 972 Shoulders, M.D., and Raines, R.T. (2009). Collagen structure and stability. 973 Annu Rev Biochem 78, 929-958. 974 Siddiqi, S.A., Siddiqi, S., Mahan, J., Peggs, K., Gorelick, F.S., and Mansbach, 975 C.M., 2nd (2006). The identification of a novel endoplasmic reticulum to Golgi 976 SNARE complex used by the prechylomicron transport vesicle. J Biol Chem 977 281, 20974-20982.
46 978 Steegmaier, M., Oorschot, V., Klumperman, J., and Scheller, R.H. (2000). 979 Syntaxin 17 is abundant in steroidogenic cells and implicated in smooth 980 endoplasmic reticulum membrane dynamics. Mol Biol Cell 11, 2719-2731. 981 Tai, G., Lu, L., Wang, T.L., Tang, B.L., Goud, B., Johannes, L., and Hong, W. 982 (2004). Participation of the syntaxin 5/Ykt6/GS28/GS15 SNARE complex in 983 transport from the early/recycling endosome to the trans-Golgi network. Mol 984 Biol Cell 15, 4011-4022. 985 Uemura, T., Sato, T., Aoki, T., Yamamoto, A., Okada, T., Hirai, R., Harada, R., 986 Mori, K., Tagaya, M., and Harada, A. (2009). p31 deficiency influences 987 endoplasmic reticulum tubular morphology and cell survival. Mol Cell Biol 29, 988 1869-1881. 989 Venditti, R., Scanu, T., Santoro, M., Di Tullio, G., Spaar, A., Gaibisso, R., 990 Beznoussenko, G.V., Mironov, A.A., Mironov, A., Jr., Zelante, L., et al. (2012). 991 Sedlin controls the ER export of procollagen by regulating the Sar1 cycle. 992 Science 337, 1668-1672. 993 Volchuk, A., Ravazzola, M., Perrelet, A., Eng, W.S., Di Liberto, M., Varlamov, 994 O., Fukasawa, M., Engel, T., Sollner, T.H., Rothman, J.E., et al. (2004). 995 Countercurrent distribution of two distinct SNARE complexes mediating 996 transport within the Golgi stack. Mol Biol Cell 15, 1506-1518. 997 Wilson, D.G., Phamluong, K., Li, L., Sun, M., Cao, T.C., Liu, P.S., Modrusan, 998 Z., Sandoval, W.N., Rangell, L., Carano, R.A., et al. (2011). Global defects in 999 collagen secretion in a Mia3/TANGO1 knockout mouse. J Cell Biol 193, 935- 1000 951. 1001 Yamaguchi, T., Dulubova, I., Min, S.W., Chen, X., Rizo, J., and Sudhof, T.C. 1002 (2002). Sly1 binds to Golgi and ER syntaxins via a conserved N-terminal 1003 peptide motif. Dev Cell 2, 295-305. 1004 Yamamoto, K., Hamada, H., Shinkai, H., Kohno, Y., Koseki, H., and Aoe, T. 1005 (2003). The KDEL receptor modulates the endoplasmic reticulum stress 1006 response through mitogen-activated protein kinase signaling cascades. J Biol 1007 Chem 278, 34525-34532. 1008 Zanetti, G., Pahuja, K.B., Studer, S., Shim, S., and Schekman, R. (2012). COPII 1009 and the regulation of protein sorting in mammals. Nat Cell Biol 14, 20-28. 1010 Zhang, T., and Hong, W. (2001). Ykt6 forms a SNARE complex with syntaxin 1011 5, GS28, and Bet1 and participates in a late stage in endoplasmic reticulum- 1012 Golgi transport. J Biol Chem 276, 27480-27487. 1013 1014
47 Figure 1 A B standard saponin SEC31 SEC31 GM130
control mycHis-TANGO1(cytosolic tail)
-- SLY1
IP: His WB: SLY1 SLY1-GFP
-- SLY1
lysate WB: SLY1
-- TANGO1 merge (cyt. tail)
lysate WB: myc zoom Figure 2
ABCmedium lysate
siRNA siRNA control SLY1 TANGO1 control SLY1 TANGO1 control SLY1 TANGO1 control SLY1 TANGO1
TANGO1 -- Collagen VII
SLY1
RDEB FB/C7 Het1a -- Tubulin
DEHSP47 (red) Collagen VII (green) merge HSP47 (red) Collagen VII (green) merge sicontrol sicontrol siSLY1 siSLY1 siTANGO1 siTANGO1
GM130 (red) Collagen VII (green) merge sicontrol siSLY1 siTANGO1 Figure 3 Figure siTANGO1 siSLY1 siControl Figure 4
siRNA control SLY1 TANGO1
SAR1B ---
SAR1A - --
SEC23A --
SEC31A --
β-COP --
ε-COP --
SLY1 --
TANGO1 --
Tubulin -- Figure 5 A B GM130 (red) GRP-78/BiP GRP-78/BiP (green) lysate medium
siCrt siSLY1 siTANGO1siCrt siSLY1 siTANGO1 sicontrol
- GRP-78/BiP siSLY1
C coefficient Pearsonscolocalization Figure 6
A siRNA B
control SLY1 TANGO1BFA
C lysate medium
siRNA control SLY1 TANGO1control SLY1 TANGO1
-- Collagen I
4%-18% gradient gel
-- Tubulin D E lysate medium siRNA control SLY1 TANGO1 siRNA -- SLY1 controlSLY1 TANGO1 control SLY1 TANGO1
-- Collagen I -- TANGO1
-- Actin
-- Tubulin Figure 7
AB medium lysate
siRNA control SAR1A SAR1B SAR1A+B siRNA * control SAR1A SAR1B SAR1A+Bcontrol SAR1A SAR1B SAR1A+B -- SAR1 B -- SAR1 A -- Collagen VII
-- Tubulin
C Sec31 (red) Collagen VII (green) merge siControl siSAR1 A+B Figure 8 AB siControl siSAR1 A+B SEC31 TANGO1 SEC31 TANGO1 488-STED merge zoom
CD siTANGO1 siSLY1 SEC31 TANGO1 SEC31 TANGO1 488-STED merge zoom Figure 9 A B C RDEB SAOS2 lysate medium siRNA - + -rt siRNA - + -rt
Syntaxin 5
siRNA - + -rt siRNA siRNA - + -rt control Syntaxin 5 Syntaxin 17Syntaxin 18control Syntaxin 5Syntaxin 17Syntaxin 18 Syntaxin 17 -- Collagen VII siRNA - + -rt siRNA - + -rt Syntaxin 18
-- Tubulin
siRNA control SyntaxinSyntaxin 5 Syntaxin 17 -rt 18 -- hprt1 RDEB
-- hprt1
SAOS2 D E sicontrol siSyntaxin 5
siSyntaxin 17 siSyntaxin 18
F G H sicontrol siSyntaxin 5
lysate medium
siRNA control Syntaxin 5Syntaxin 17Syntaxin 18control Syntaxin 5Syntaxin 17Syntaxin 18
-- Collagen I
siSyntaxin 17 siSyntaxin 18 -- Tubulin Figure 10 A
Golgi stack
Ub- Ub- ERGIC53-family TANGO1 Erv-family -Ub cTAGE5 p24-family ? -Ub Sedlin general cargo Collagen VII Collagen I ER
B
Golgi stack
Syntaxin 5 maturation
ERGIC
SLY1 Syntaxin 18
Collagen VII ER Ub-
cargo receptor inner COPII coat outer COPII coat Ub- outer COPII coat SLY1 Syntaxin 5 with cargo SEC23/24, SAR1 SEC13/31 SEC13/31, ubiquitinated Syntaxin 18 v-SNARE