DOCSLIB.ORG

(4 Points Apiece): 1. the Steps of Glycolysis Between

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(4 Points Apiece): 1. the Steps of Glycolysis Between Name: 2 points Chem 465 Biochemistry II Test 1 Spring 2016 Multiple choice (4 points apiece): 1. The steps of glycolysis between glyceraldehyde 3-phosphate and 3-phosphoglycerate involve all of the following except: A) ATP synthesis. B) catalysis by phosphoglycerate kinase. C) oxidation of NADH to NAD+. D) the formation of 1,3-bisphosphoglycerate. E) utilization of Pi. 2. Which one of the following statements about gluconeogenesis is false? A) For starting materials, it can use carbon skeletons derived from certain amino acids. B) It consists entirely of the reactions of glycolysis, operating in the reverse direction. C) It employs the enzyme glucose 6-phosphatase. D) It is one of the ways that mammals maintain normal blood glucose levels between meals. E) It requires metabolic energy (ATP or GTP). 3. Aside from maintaining the integrity of its hereditary material, the most important general metabolic concern of a cell is: A) keeping its glucose levels high. B) maintaining a constant supply and concentration of ATP. C) preserving its ability to carry out oxidative phosphorylation. D) protecting its enzymes from rapid degradation. E) running all its major metabolic pathways at maximum efficiency. 4. Glucose labeled with 14C in C-3 and C-4 is completely converted to acetyl-CoA via glycolysis and the pyruvate dehydrogenase complex. What percentage of the acetyl-CoA molecules formed will be labeled with 14C, and in which position of the acetyl moiety will the 14C label be found? A) 100% of the acetyl-CoA will be labeled at C-1 (carboxyl). B) 100% of the acetyl-CoA will be labeled at C-2. C) 50% of the acetyl-CoA will be labeled, all at C-2 (methyl). D) No label will be found in the acetyl-CoA molecules. E) Not enough information is given to answer this question. 5. In mammals, each of the following occurs during the citric acid cycle except: A) formation of á-ketoglutarate. B) generation of NADH and FADH2. C) metabolism of acetate to carbon dioxide and water. D) net synthesis of oxaloacetate from acetyl-CoA. E) oxidation of acetyl-CoA. 6. Which of the following is correct concerning the mitochondrial ATP synthase? A) It can synthesize ATP after it is extracted from broken mitochondria. B) It catalyzes the formation of ATP even though the reaction has a large positive G'°. C) It consists of F0 and F1 subunits, which are transmembrane (integral) polypeptides. D) It is actually an ATPase and only catalyzes the hydrolysis of ATP. E) When it catalyzes the ATP synthesis reaction, the G'° is actually close to zero. 7. The relative concentrations of ATP and ADP control the cellular rates of: A) glycolysis. B) oxidative phosphorylation. C) pyruvate oxidation. D) the citric acid cycle. E) all of the above. Longer questions (14 points each) - You may skip any 1 question. 8. Discuss the different levels of control that help to balance phosphofructokinase-1 in the glycolytic pathway and fructose 1,6- bisphoshatase-1 in the gluconeogenesis pathway. ATP is an allosteric inhibitor of Phosphofructokinase (PFK-1), and act as an inhibitor by lowering affinity for substrate. ADP and AMP act to relieve this inhibition. Citrate (from TCA cycle) acts to enhance inhibitory effect of ATP 1,6 bisphosphatase is allosterically inhibited by AMP Additional hormonal control through fructose 2,6-Bisphophate when blood glucose too low, glucagon released this releases cAMP in cell This stimulates cAMP dependent protein kinase This phosphorylates the PFK-2/FBPase-2 enzyme changing it to the form where the FBPase-2 is active and PFK-2 is inactive This lowers level of fructose 2,6-Bisphosphate This allosterically makes PFK-1 almost completely inactive, so glycolysis slows to a standstill, and it activates 1,6- bisphoshatase-1 to turn on gluconeogenesis. Conversely when blood sugar is high, insulin is released this increases the activity of phosphoprotein phosphatase which de- phosphorylates the PFK-2/FBPase-2 enzyme changing it to the form where the FBPase-2 is inactive and PFK-2 is active This raises the concentration of fructose 2,6-Bisphophate This stimulates PFK-1 and inhibits FBPase-1 increasing glycolysis and shutting down gluconeogenesis. -2- 9. This page is blank because I want you to fill it in with the gluconeogenesis pathway from pyruvate to glucose by showing the structure of all intermediates. At each step also give the name of the enzyme and ÄG of the reaction. To help you on your way, here is a list of all then enzymes in alphabetical order: Aldolase, Enolase, Fructose 1,6-bisphosphatase-1, Glucose 6-phosphatase, Glyeraldehyde 3-phosphate dehydrogenase, PEP carboxykinase, Phosphoglycerate kinase, Phosphoglycerate mutase, Phosphohexose isomerase, Pyruvate carboxylase, Triose phosphate isomerase. I know you were expecting the glycolytic pathway. If you need to, do the glycolytic pathway and then put in the reverse arrows and the appropriate reverse reactions and change the sign of the ÄG’s. Don’t worry about the ÄG’s of the 4 reverse reactions that I didn’t tell you to memorize. - 6 Pyruvate + HCO3 + ATP oxaloacetate + ADP + Pi ÄG ? Pyruvate carboxykase Biotin oxaloactate + GTP 6PEP + GDP ÄG? Phosphoenolpyruvate carboxykinase Mg2+ Two PEP 6 two 2-Phosphoglycerate ÄG -7.5 Enolase Mg2+ Two 2-Phosphoglycerate6Two 3-Phosphoglycerate ÄG -4.4 Phosphoglycerate mutase Mg2+ Two 3-Phosphoglycerate + 2 ATP6Two 1,3-Bisphophoglycerate + 2ADP ÄG +18.5 phosphoglycerate kinase Mg2+ Two 1,3-Bisphosphoglycerate +2 NADH6Two Glyceraldehyde-3-P + 2NAD+ ÄG -6.3 glyceraldehyde 3-phosphate dehydrogenase One Glyceraldehyde-3-P 6One Dihydroxyacetonephosphate ÄG -7.5 Triose isomerase Dihydroxyactone phosphate + Glyceraldehyde-3-P 6Fructose 1,6bisphosphate Aldolase ÄG -23.8 Fructose-1,6-bisphophate6Fructose-6-P + Pi ÄG -16.3 Fructose 1,6-bisphophatase Mg2+ Fructose 6-P6Glucose 6-P ÄG -1.7 Phophohexose isomerase Mg2+ Glucose 6-P6Glucose ÄG -13.8 Glucose 6-phophatase Mg2+ -3- 10. Sketch the pathway in which pyruvate is completely oxidized to CO2. In this pathway be sure to identify all reactions that generate ATP, GTP, NADH or FADH2. Also show the anapleotropic reaction that are used to fill in TCA intermediates when they are depleted. I would prefer structures for all intermediates, and a cycle, but this is something I can’t put in with a word processor Pyruvate pyruvate dehydrogenase CoASH,NAD, TPP,Lippoate, FAD -33.3 Acetyl CoA (Oxaloacetate) citrate syntase -32.2 Citrate aconitase Iron-sulfur center 13.3 Isocitrate + NAD 6NADH isocitrate dehydrogenase Mn2+ NAD -20.9 á-ketoglutarate + NAD 6NADH á-ketoglutarate dehydrogenase CoASH,NAD, TPP,Lippoate, FAD -33.5 Succinyl CoA + GDP or ADP 6GTP or ATP Succinyl-CoA synthetase -2.9 6 Succinate + FAD FADH2 Succinate dehydrogenase FAD, FeS clusters 0 Fumarate fumarase -3.8 L-malate + NAD 6NADH l-malate dehydrogenase 29.7 Oxaloacetate Anapleotropic: - 6 Pyruvate + HCO3 + ATP Oxaloacetate + ADP + Pi pyruvate carboxylase 6 PEP + CO2 + GDP oxaloacetate + GTP PEP carboxykinase - 6 PEP + HCO3 oxaloacetate + Pi PEP carboxylase - 6 Pyruvate + HCO3 + NADH malate + NAD malic enzyme -4- 11. Discuss how the pyruvate dehydrogenase complex works, and how it is similar to or different than the á-ketoglutarate dehydrogenase complex. Include names of all cofactors involved in the complexes and the steps involved in the overall reaction. I would start with a sketch like figure 16-6 from your text. The PDH complex contains three enzymes, Pyruvate dehydrogenase (E1), dihydrolipoyl transacetylase (E2) and dihydrolipoyl dehydrogenase (E3) The number of copies of each enzyme varies from species to species, but hey are all associated into one big complex that can be 5x bigger than a ribosome. The pyruvate is first decarboxylated on E1 and the remaining 2 carbons are bound to Thiamine pyrophosphate on this enzyme as a hydroxyethylgroup. This hydroxyethylgroup is then passed as an acetyl group to a lipoyllysine on the E2 enzyme. The acetyl group is then passed to Coenzyme A, leaving the lipoyllysine in a reduced form. The reduced lipoyllysine is then reoxidized by an FAD group on the E3 enzyme + which get reduced to FADH2, and then the FADH2 is reoxidized by an NAD that gets reduced to NADH on the E3 enzyme The pyruvate dehydrogenase and the á-ketoglutarate enzymes are very similar in both the E2 and the E3 parts of the complex. The main difference lies in the E1 part of the complex since it must interact with a different substrate. -5- 12A. If you start with 1 NADH in the mitochondrial matrix How many protons are transported out of the mitochondrial matrix in Complex I? __4_ How many protons are transported out of the mitochondrial matrix in Complex II? __0__ How many protons are transported out of the mitochondrial matrix in Complex III? _4___ How many protons are transported out of the mitochondrial matrix in Complex IV? _2___ 12 B. Depending on the organism, ATP synthase can have between 8 to 15 c subunits in the FO complex, and this, in turn, determines the number of protons that come back into the mitochondrial matrix for one complete turn of synthase complex. Based on your answer for 12A, how many ATPs are synthesized from one NADH in an organism with 9 c subunits in the Fo complex (you may ignore the ATP used in transport of Pi)? Explain. With 9 c units it takes 9 protons to make the ATPsynthase do a complete turn. Since 1 turn generates 3 ATP there are 9 protons/3 ATP Our NADH generated 10 protons so 10 protons x 3 ATP/9 protons = 3.3 ATP /NADH Based on your answer for 12A, how many ATPs are synthesized from one NADH in an organism with 15 c subunits in the Fo complex (you may ignore the ATP used in transport of Pi)? Explain.
Load more

Recommended publications
  • Construction and Enzymatic Characterization of E
    1 Minimizing acetate formation in E. coli fermentations 2 Marjan De Mey*, Sofie De Maeseneire, Wim Soetaert and Erick Vandamme 3 Ghent University, Laboratory of Industrial Microbiology and Biocatalysis, Department of 4 Biochemical and Microbial Technology, Faculty of Bioscience Engineering, Coupure links 5 653, B-9000 Ghent, Belgium 6 7 * Correspondence address: Marjan De Mey 8 Laboratory of Industrial Microbiology and Biocatalysis 9 Department of Biochemical and Microbial Technology 10 Faculty of Bioscience Engineering 11 Ghent University 12 Coupure links 653 13 B-9000 Gent 14 Tel: +32-9-264-60-28 15 Fax: +32-9-264-62-31 16 [email protected] 17 Keywords: acetate reduction, Escherichia coli, metabolic engineering 1 18 Abstract 19 Escherichia coli remains the best established production organisms in industrial 20 biotechnology. However, during aerobic fermentation runs at high growth rates, considerable 21 amounts of acetate are accumulated as by-product. This by-product has negative effects on 22 growth and protein production. Over the last 20 years, substantial research efforts have been 23 spent to reduce acetate accumulation during aerobic growth of E. coli on glucose. From the 24 onset it was clear that this quest should not be a simple nor uncomplicated one. Simple 25 deletion of the acetate pathway, reduced the acetate accumulation, but instead other by- 26 products were formed. This minireview gives a clear outline of these research efforts and the 27 outcome of them, including bioprocess level approaches and genetic approaches. Recently, 28 the latter seems to have some promising results. 29 30 1 Introduction 31 Escherichia coli was the first and is still one of the most commonly used production 32 organisms in industrial biotechnology.
    [Show full text]
  • Effects of Glucagon, Glycerol, and Glucagon Plus Glycerol On
    Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations 2011 Effects of glucagon, glycerol, and glucagon plus glycerol on gluconeogenesis, lipogenesis, and lipolysis in periparturient Holstein cows Nimer Mehyar Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Biochemistry, Biophysics, and Structural Biology Commons Recommended Citation Mehyar, Nimer, "Effects of glucagon, glycerol, and glucagon plus glycerol on gluconeogenesis, lipogenesis, and lipolysis in periparturient Holstein cows" (2011). Graduate Theses and Dissertations. 11923. https://lib.dr.iastate.edu/etd/11923 This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Effects of glucagon, glycerol, and glucagon plus glycerol on gluconeogenesis, lipogenesis, and lipolysis in periparturient Holstein cows by Nimer Mehyar A thesis submitted to graduate faculty in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Major: Biochemistry Program of Study Committee: Donald C. Beitz, Major Professor Ted W. Huiatt Kenneth J. Koehler Iowa State University Ames, Iowa 2011 Copyright Nimer Mehyar, 2011. All rights reserved ii To My Mother To Ghada Ali, Sarah, and Hassan
    [Show full text]
  • • Glycolysis • Gluconeogenesis • Glycogen Synthesis
    Carbohydrate Metabolism! Wichit Suthammarak – Department of Biochemistry, Faculty of Medicine Siriraj Hospital – Aug 1st and 4th, 2014! • Glycolysis • Gluconeogenesis • Glycogen synthesis • Glycogenolysis • Pentose phosphate pathway • Metabolism of other hexoses Carbohydrate Digestion! Digestive enzymes! Polysaccharides/complex carbohydrates Salivary glands Amylase Pancreas Oligosaccharides/dextrins Dextrinase Membrane-bound Microvilli Brush border Maltose Sucrose Lactose Maltase Sucrase Lactase ‘Disaccharidase’ 2 glucose 1 glucose 1 glucose 1 fructose 1 galactose Lactose Intolerance! Cause & Pathophysiology! Normal lactose digestion Lactose intolerance Lactose Lactose Lactose Glucose Small Intestine Lactase lactase X Galactose Bacteria 1 glucose Large Fermentation 1 galactose Intestine gases, organic acid, Normal stools osmotically Lactase deficiency! active molecules • Primary lactase deficiency: อาการ! genetic defect, การสราง lactase ลด ลงเมออายมากขน, พบมากทสด! ปวดทอง, ถายเหลว, คลนไสอาเจยนภาย • Secondary lactase deficiency: หลงจากรบประทานอาหารทม lactose acquired/transient เชน small bowel เปนปรมาณมาก เชนนม! injury, gastroenteritis, inflammatory bowel disease! Absorption of Hexoses! Site: duodenum! Intestinal lumen Enterocytes Membrane Transporter! Blood SGLT1: sodium-glucose transporter Na+" Na+" •! Presents at the apical membrane ! of enterocytes! SGLT1 Glucose" Glucose" •! Co-transports Na+ and glucose/! Galactose" Galactose" galactose! GLUT2 Fructose" Fructose" GLUT5 GLUT5 •! Transports fructose from the ! intestinal lumen into enterocytes!
    [Show full text]
  • Energy Metabolism: Gluconeogenesis and Oxidative Phosphorylation
    International Journal for Innovation Education and Research www.ijier.net Vol:-8 No-09, 2020 Energy metabolism: gluconeogenesis and oxidative phosphorylation Luis Henrique Almeida Castro ([email protected]) PhD in the Health Sciences Graduate Program, Federal University of Grande Dourados Dourados, Mato Grosso do Sul – Brazil. Leandro Rachel Arguello Dom Bosco Catholic University Campo Grande, Mato Grosso do Sul – Brazil. Nelson Thiago Andrade Ferreira Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Geanlucas Mendes Monteiro Heath and Development in West Central Region Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Jessica Alves Ribeiro Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Juliana Vicente de Souza Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Sarita Baltuilhe dos Santos Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Fernanda Viana de Carvalho Moreto MSc., Nutrition, Food and Health Graduate Program, Federal University of Grande Dourados Dourados, Mato Grosso do Sul – Brazil. Ygor Thiago Cerqueira de Paula Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. International Educative Research Foundation and Publisher © 2020 pg. 359 International Journal for Innovation Education and Research ISSN 2411-2933 September 2020 Vanessa de Souza Ferraz Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil. Tayla Borges Lino Motion Science Graduate Program, Federal University of Mato Grosso do Sul Campo Grande, Mato Grosso do Sul – Brazil.
    [Show full text]
  • Supplement 1 Overview of Dystonia Genes
    Supplement 1 Overview of genes that may cause dystonia in children and adolescents Gene (OMIM) Disease name/phenotype Mode of inheritance 1: (Formerly called) Primary dystonias (DYTs): TOR1A (605204) DYT1: Early-onset generalized AD primary torsion dystonia (PTD) TUBB4A (602662) DYT4: Whispering dystonia AD GCH1 (600225) DYT5: GTP-cyclohydrolase 1 AD deficiency THAP1 (609520) DYT6: Adolescent onset torsion AD dystonia, mixed type PNKD/MR1 (609023) DYT8: Paroxysmal non- AD kinesigenic dyskinesia SLC2A1 (138140) DYT9/18: Paroxysmal choreoathetosis with episodic AD ataxia and spasticity/GLUT1 deficiency syndrome-1 PRRT2 (614386) DYT10: Paroxysmal kinesigenic AD dyskinesia SGCE (604149) DYT11: Myoclonus-dystonia AD ATP1A3 (182350) DYT12: Rapid-onset dystonia AD parkinsonism PRKRA (603424) DYT16: Young-onset dystonia AR parkinsonism ANO3 (610110) DYT24: Primary focal dystonia AD GNAL (139312) DYT25: Primary torsion dystonia AD 2: Inborn errors of metabolism: GCDH (608801) Glutaric aciduria type 1 AR PCCA (232000) Propionic aciduria AR PCCB (232050) Propionic aciduria AR MUT (609058) Methylmalonic aciduria AR MMAA (607481) Cobalamin A deficiency AR MMAB (607568) Cobalamin B deficiency AR MMACHC (609831) Cobalamin C deficiency AR C2orf25 (611935) Cobalamin D deficiency AR MTRR (602568) Cobalamin E deficiency AR LMBRD1 (612625) Cobalamin F deficiency AR MTR (156570) Cobalamin G deficiency AR CBS (613381) Homocysteinuria AR PCBD (126090) Hyperphelaninemia variant D AR TH (191290) Tyrosine hydroxylase deficiency AR SPR (182125) Sepiaterine reductase
    [Show full text]
  • Fructose-Induced Increases in Expression of Intestinal Fructolytic and Gluconeogenic Genes Are Regulated by GLUT5 and KHK
    Fructose-induced increases in expression of intestinal fructolytic and gluconeogenic genes are regulated by GLUT5 and KHK. Chirag Patel, Véronique Douard, Shiyan Yu, Phuntila Tharabenjasin, Nan Gao, Ronaldo P Ferraris To cite this version: Chirag Patel, Véronique Douard, Shiyan Yu, Phuntila Tharabenjasin, Nan Gao, et al.. Fructose- induced increases in expression of intestinal fructolytic and gluconeogenic genes are regulated by GLUT5 and KHK.. AJP - Regulatory, Integrative and Comparative Physiology, American Physio- logical Society, 2015, 309 (5), pp.R499-509. 10.1152/ajpregu.00128.2015. hal-01607831 HAL Id: hal-01607831 https://hal.archives-ouvertes.fr/hal-01607831 Submitted on 28 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Copyright Am J Physiol Regul Integr Comp Physiol 309: R499–R509, 2015. First published June 17, 2015; doi:10.1152/ajpregu.00128.2015. Fructose-induced increases in expression of intestinal fructolytic and gluconeogenic genes are regulated by GLUT5 and KHK Chirag Patel,1 Veronique Douard,1 Shiyan Yu,2 Phuntila Tharabenjasin,1 Nan Gao,2 and Ronaldo P. Ferraris1 1Department of Pharmacology and Physiology, New Jersey Medical School, Rutgers University, Newark, New Jersey; and 2Department of Biological Sciences, School of Arts and Sciences, Rutgers University, Newark, New Jersey Submitted 30 March 2015; accepted in final form 16 June 2015 Patel C, Douard V, Yu S, Tharabenjasin P, Gao N, Ferraris blood fructose is directly dependent on intestinal processing of RP.
    [Show full text]
  • Targeting Pyruvate Carboxylase Reduces Gluconeogenesis and Adiposity and Improves Insulin Resistance Naoki Kumashiro,1,2 Sara A
    ORIGINAL ARTICLE Targeting Pyruvate Carboxylase Reduces Gluconeogenesis and Adiposity and Improves Insulin Resistance Naoki Kumashiro,1,2 Sara A. Beddow,3 Daniel F. Vatner,2 Sachin K. Majumdar,2 Jennifer L. Cantley,1,2 Fitsum Guebre-Egziabher,2 Ioana Fat,2 Blas Guigni,2 Michael J. Jurczak,2 Andreas L. Birkenfeld,2 Mario Kahn,2 Bryce K. Perler,2 Michelle A. Puchowicz,4 Vara Prasad Manchem,5 Sanjay Bhanot,5 Christopher D. Still,6 Glenn S. Gerhard,6 Kitt Falk Petersen,2 Gary W. Cline,2 Gerald I. Shulman,1,2,7 and Varman T. Samuel2,3 – We measured the mRNA and protein expression of the key transcriptional factors and cofactors (8 12). Yet, despite gluconeogenic enzymes in human liver biopsy specimens and the high degree of transcription regulation for these found that only hepatic pyruvate carboxylase protein levels enzymes, the control they exert over gluconeogenic flux is related strongly with glycemia. We assessed the role of pyruvate relatively weak (13–16). We recently reported that hepatic carboxylase in regulating glucose and lipid metabolism in rats expression of PEPCK and G6PC mRNA was not related to through a loss-of-function approach using a specific antisense fasting hyperglycemia in two rodent models of type 2 di- oligonucleotide (ASO) to decrease expression predominantly in abetes and in patients with type 2 diabetes (17). Thus, we liver and adipose tissue. Pyruvate carboxylase ASO reduced hypothesized that other mechanisms must account for in- plasma glucose concentrations and the rate of endogenous glucose production in vivo. Interestingly, pyruvate carboxylase ASO also creased hepatic gluconeogenesis and fasting hyperglycemia reduced adiposity, plasma lipid concentrations, and hepatic in type 2 diabetes.
    [Show full text]
  • 1 Silencing Branched-Chain Ketoacid Dehydrogenase Or
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Silencing branched-chain ketoacid dehydrogenase or treatment with branched-chain ketoacids ex vivo inhibits muscle insulin signaling Running title: BCKAs impair insulin signaling Dipsikha Biswas1, PhD, Khoi T. Dao1, BSc, Angella Mercer1, BSc, Andrew Cowie1 , BSc, Luke Duffley1, BSc, Yassine El Hiani2, PhD, Petra C. Kienesberger1, PhD, Thomas Pulinilkunnil1†, PhD 1Department of Biochemistry and Molecular Biology, Dalhousie Medicine New Brunswick, Saint John, New Brunswick, Canada, 2Department of Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia, Canada. †Correspondence to Thomas Pulinilkunnil, PhD Department of Biochemistry and Molecular Biology, Faculty of Medicine, Dalhousie University Dalhousie Medicine New Brunswick, 100 Tucker Park Road, Saint John E2L4L5, New Brunswick, Canada. Telephone: (506) 636-6973; Fax: (506) 636-6001; email: [email protected]. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.21.960153; this version posted February 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International
    [Show full text]
  • Transglutaminase-Catalyzed Inactivation Of
    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 12604–12609, November 1997 Medical Sciences Transglutaminase-catalyzed inactivation of glyceraldehyde 3-phosphate dehydrogenase and a-ketoglutarate dehydrogenase complex by polyglutamine domains of pathological length ARTHUR J. L. COOPER*†‡§, K.-F. REX SHEU†‡,JAMES R. BURKE¶i,OSAMU ONODERA¶i, WARREN J. STRITTMATTER¶i,**, ALLEN D. ROSES¶i,**, AND JOHN P. BLASS†‡,†† Departments of *Biochemistry, †Neurology and Neuroscience, and ††Medicine, Cornell University Medical College, New York, NY 10021; ‡Burke Medical Research Institute, Cornell University Medical College, White Plains, NY 10605; and Departments of ¶Medicine, **Neurobiology, and iDeane Laboratory, Duke University Medical Center, Durham, NC 27710 Edited by Louis Sokoloff, National Institutes of Health, Bethesda, MD, and approved August 28, 1997 (received for review April 24, 1997) ABSTRACT Several adult-onset neurodegenerative dis- Q12-containing peptide (16). In the work of Kahlem et al. (16) the eases are caused by genes with expanded CAG triplet repeats largest Qn domain studied was Q18. We found that both a within their coding regions and extended polyglutamine (Qn) nonpathological-length Qn domain (n 5 10) and a longer, patho- domains within the expressed proteins. Generally, in clinically logical-length Qn domain (n 5 62) are excellent substrates of affected individuals n > 40. Glyceraldehyde 3-phosphate dehy- tTGase (17, 18). drogenase binds tightly to four Qn disease proteins, but the Burke et al. (1) showed that huntingtin, huntingtin-derived significance of this interaction is unknown. We now report that fragments, and the dentatorubralpallidoluysian atrophy protein purified glyceraldehyde 3-phosphate dehydrogenase is inacti- bind selectively to glyceraldehyde 3-phosphate dehydrogenase vated by tissue transglutaminase in the presence of glutathione (GAPDH) in human brain homogenates and to immobilized S-transferase constructs containing a Qn domain of pathological rabbit muscle GAPDH.
    [Show full text]
  • Citric Acid Cycle
    CHEM464 / Medh, J.D. The Citric Acid Cycle Citric Acid Cycle: Central Role in Catabolism • Stage II of catabolism involves the conversion of carbohydrates, fats and aminoacids into acetylCoA • In aerobic organisms, citric acid cycle makes up the final stage of catabolism when acetyl CoA is completely oxidized to CO2. • Also called Krebs cycle or tricarboxylic acid (TCA) cycle. • It is a central integrative pathway that harvests chemical energy from biological fuel in the form of electrons in NADH and FADH2 (oxidation is loss of electrons). • NADH and FADH2 transfer electrons via the electron transport chain to final electron acceptor, O2, to form H2O. Entry of Pyruvate into the TCA cycle • Pyruvate is formed in the cytosol as a product of glycolysis • For entry into the TCA cycle, it has to be converted to Acetyl CoA. • Oxidation of pyruvate to acetyl CoA is catalyzed by the pyruvate dehydrogenase complex in the mitochondria • Mitochondria consist of inner and outer membranes and the matrix • Enzymes of the PDH complex and the TCA cycle (except succinate dehydrogenase) are in the matrix • Pyruvate translocase is an antiporter present in the inner mitochondrial membrane that allows entry of a molecule of pyruvate in exchange for a hydroxide ion. 1 CHEM464 / Medh, J.D. The Citric Acid Cycle The Pyruvate Dehydrogenase (PDH) complex • The PDH complex consists of 3 enzymes. They are: pyruvate dehydrogenase (E1), Dihydrolipoyl transacetylase (E2) and dihydrolipoyl dehydrogenase (E3). • It has 5 cofactors: CoASH, NAD+, lipoamide, TPP and FAD. CoASH and NAD+ participate stoichiometrically in the reaction, the other 3 cofactors have catalytic functions.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Mechanism F Formation of Oxaloacetate and Phosphoenol Pyruvate from Pyruvate1
    THE JOURNAL OF VITAMINOLOGY 14, 59-67 (1968) MECHANISM F FORMATION OF OXALOACETATE AND PHOSPHOENOL PYRUVATE FROM PYRUVATE1 HARLAND G. WOOD Department of Biochemistry, Case Western Reserve University Cleveland, Ohio 44, 106, U.S.A. Pyruvate, oxaloacetate and P-enolpyruvate have been known to be key compounds in metabolism for many years; pyruvate since 1911 when Neuberg found that yeast decarboxylates pyruvate to acetaldehyde, oxaloacetate since 1937 when Krebs pro posed the citric acid cycle, and P-enolpyruvate since 1934-1936 when Lohmann, Meyerhof and Kiessling discovered that 3-phosphoglycerate is converted to P enolpyruvate by dialyzed yeast or muscle extracts. These three compounds are the hub of numerous reactions leading to both synthesis and breakdown of carbo hydrates, fats and nitrogenous compounds (See the recent review by Utter (1) ). Furthermore, they are interlocked within themselves by a series of reactions re sulting in the synthesis of each fromn the other with accompanying breakdown of the companion compound. There has been a long debate concerning the mechanism of formation of P enolpyruvate from pyruvate. The conversion of P-enolpyruvate to pyruvate in glycolysis by pyruvate kinase was shown by Lardy and Ziegler (2) in 1945 to be reversible, but the equilibrium lies far to the right and the physiological signi ficance of the reversibility is questionable. The possibility that P-enolpyruvate might be formed by a pathway other than via pyruvate kinase was first raised by Kalckar (3) who found that kidney preparations could form P-enolpyruvate from malate and fumarate. At that time Wood and Werkman had discovered fixation of CO2 by heterotrophs and had postulated that the fixation occurs by combination of CO2 with pyruvate to give oxaloacetate.
    [Show full text]