sign in sign up
<<
Home , Ctenitis, Davallia, Dryopteridaceae, Dryopteris, Dryopteris aemula, Dryopteris erythrosora

A Revised Framework of subg. Nothoperanema () Inferred from Phylogenetic Evidence, with Descriptions of Two New Sections Author(s): Li-Yaung Kuo , Yi-Han Chang , Jennifer M. O. Glowienka , Victor B. Amoroso , Shi-Yong Dong , Tzu-Tong Kao , Chun-Neng Wang , and Wen-Liang Chiou Source: Systematic , 41(3):596-605. Published By: The American Society of Taxonomists URL: http://www.bioone.org/doi/full/10.1600/036364416X692334

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Systematic Botany (2016), 41(3): pp. 596–605 © Copyright 2016 by the American Society of Plant Taxonomists DOI 10.1600/036364416X692334 Date of publication August 26, 2016 A Revised Framework of Dryopteris subg. Nothoperanema (Dryopteridaceae) Inferred from Phylogenetic Evidence, with Descriptions of Two New Sections

Li-Yaung Kuo,1 Yi-Han Chang,2,8 Jennifer M. O. Glowienka,3 Victor B. Amoroso,4 Shi-Yong Dong,5 Tzu-Tong Kao,6 Chun-Neng Wang,1,8 and Wen-Liang Chiou2,7 1Institute of Ecology and Evolutionary Biology, National Taiwan University, Taipei 106, Taiwan. 2Botanical Garden Division, Taiwan Forestry Research Institute, Taipei 100, Taiwan. 3Department of Life and Environmental Sciences, Carroll College, 1601 North Benton Avenue, Helena, Montana 59625, U. S. A. 4Center for Biodiversity Research and Extension in Mindanao (CEBREM) and Central Mindanao University, Mindanao, the Philippines. 5Key Laboratory of Plant Resources Conservation and Sustainable Utilization, South Botanical Garden, Chinese Academy of Sciences, Guangzhou 510650, China. 6Department of Biology, Duke University, Durham, North Carolina 27708, U. S. A. 7Dr. Cecilia Koo Botanic Conservation and Environmental Protection Foundation/Conservation Center, Pingtung County 906, Taiwan. 8Authors for Correspondence (YHC: [email protected]; CNW: [email protected])

Communicating Editor: Mark P. Simmons

Abstract—Dryopteris subgenus Nothoperanema (Dryopteridaceae) includes sections Acrophorus, Diacalpe, Nothoperanema, and Peranema. Phylogenetic relationships among these sections and their relationship to sect. Dryopsis ( Dryopteris subgenus Erythrovariae, Dryopteridaceae) are unclear. Additionally, previous phylogenetic work has not included Stenolepia, which has been suggested as an impor- tant relative of Peranema based on morphology. In this study, we examined phylogenetic relationships within subgenus Nothoperanema by including Stenolepia and utilizing six plastid regions (∼5,500 characters). Our inferred phylogeny revealed that sect. Dryopsis is not mono- phyletic. The Nothoperanema is highly supported, and includes sect. Acrophorus, sect. Diacalpe, sect. Nothoperanema, sect. Peranema, certain Dryopsis , and Stenolepia. By re-examining diagnostic morphological characters, we establish and describe two new sections under subgenus Nothoperanema: sect. Shiehia and sect. Stenolepia. This revision accommodates new species transferred from sects. Dryopsis and Stenolepia, and makes subgenus Nothoperanema and each of its sections natural groups. Finally, we provide a table with morphological comparisons and a key to sections.

Keywords—Acrophorus, Diacalpe, Dryopsis, Shiehia, Peranema, Stenolepia.

Dryopteris subgenus Nothoperanema Tagawa was first estab- assigned to Dryopteris subgenus Erythrovariae sect. Dryopsis lished by Tagawa (1938) within Dryopteridaceae, and was later (Zhang 2012). raised to genus level (as Nothoperanema)withinDryopteridaceae The relationships between Nothoperanema and its allies (Ching 1966). This subgenus differs from others in Dryopteris including Dryopsis remain unclear. These unresolved rela- by bearing hair-like scales (i.e. Holttum and Edwards 1986; tionships may result from insufficient phylogenetic informa- Widén et al. 2001; or setae, cf. Zhang et al. 2013) on the adaxial tion; some of the phylogenetic inferences were based on only surface of laminae (Fig. 1A; Tagawa 1938; Ching 1966; Kramer one or two genetic regions (e.g. Li and Lu 2006; Liu et al. et al. 1990; Wu and Ching 1991; Zhang et al. 2013). Based on 2007; Ebihara 2011). Additionally, some previous phylogenies phylogenetic evidence, Peranema D. Don, Diacalpe Blume, and implied conflicting relationships (Li and Lu 2006; Liu et al. Acrophorus C. Presl were also included in this subgenus as dif- 2007; Ebihara 2011; McKeown et al. 2012; Zhang and Zhang ferent sections (Zhang and Zhang 2012). These three genera have 2012; Zhang et al. 2012). For example, Dryopteris maximowicziana been treated as distinct group(s) within the Dryopteridaceae (Miq.) C. Chr. [i.e. Dryopsis maximowicziana (Miq.) Holttum & because their sori are more or less enclosed and wrapped by P. J. Edwards or maximowicziana (Miq.) Ching] was alter- inferior indusia (Kramer et al. 1990). Peranema is characterized natively resolved as sister to Acrophorus + Nothoperanema or nested by its stalked sorus, which is enclosed in a spherical indusium in Nothoperanema (Ebihara 2011; McKeown et al. 2012), but also and suspended by an elongated and vascularized sorophore shown as being distantly related to Acrophorus + Nothoperanema + (stalk) underneath the abaxial surface of fertile (Fig. 1F). Diacalpe + Peranema in another study (Zhang et al. 2012). None of Diacalpe is similar to Peranema but has sessile sori without the current phylogenetic work includes Stenolepia Alderw., which sorophores (Fig. 1E). Acrophorus differs from the other two has been suggested as an important relative of Peranema based on genera in having hemispherical sori. Because of their distinctive morphology (Holttum and Edwards 1986; Kramer et al. 1990). soral morphology, these three genera have complex taxonomic To resolve the relationships of Nothoperanema and its relatives, histories; for example, they have been recognized together as this study utilizes not only non-coding regions (rps16-matK IGS, comprising an independent , Peranemaceae (Ching 1940). ndhF-trnN,andtrnL-F region), but also rapidly evolving coding Recently, they were revealed to have close relationships with regions (matK, ndhF,andchlL)thathavebeenappliedtoovercome Nothoperanema and certain species of Dryopsis Holttum & similar difficulties in other phylogenies (Kuo et al. 2011; Edwards that have round or reniform superior indusia (Li and Rothfels et al. 2012; Shinohara et al. 2013), for phylogenetic analy- Lu 2006; Liu et al. 2007; Ebihara 2011; McKeown et al. 2012). ses. We include Stenolepia, Dryopsis species, and all sections of Dryopsis is phylogenetically imbedded in Dryopteris (Li and Lu subg. Nothoperanema in our analyses to avoid any topological 2006; Liu et al. 2007; Ebihara 2011; McKeown et al. 2012; Zhang uncertainties due to incomplete taxon sampling of represented lin- and Zhang 2012). Most recently, Dryopsis species have been eages. Additionally, the diagnostic morphological characteristics

596 2016] KUO ET AL.: REVISION OF SUBG. NOTHOPERANEMA 597

Fig. 1. The morphological characters of subg. Nothoperanema. A. Hair-like scales on laminae adaxial surface of Dryopteris hendersonii (sect. Nothoperanema). B. Membranaceous and cordate scales on adaxial side of costae-rachis junctions of D. paleolata (sect. Acrophorus). C. Confluent groove between rachis and costae of D. squamiseta (sect. Nothoperanema). D. Non-confluent groove between rachis and costae of D. hypolepioides. E. Globose sori of D. pseudocaenopteris (sect. Diacalpe). F. Stalked and globose sori of D. peranema (sect. Peranema). for the Nothoperanema clade, the clade containing subg. Blume (Li and Lu 2006; Liu et al. 2007; Ebihara 2011; Nothoperanema and sister to the Aemulae clade (Zhang et al. McKeown et al. 2012; Zhang et al. 2012)] were included in our phyloge- netic analyses. The sampling of Dryopteris species included representatives 2012), and each lineage within this clade were re-examined. Based from each of the major revealed in previous analyses using compre- on the phylogenetic and morphological evidence, this study fur- hensive taxon sampling (Zhang et al. 2012). Between 27% and 100% of rec- ther provides a revised framework of Dryopteris subgenus ognized species were sampled for each section in subg. Nothoperanema Nothoperanema and a key to identify its infra-subgeneric sections. ( Zhang and Zhang 2012, and Zhang and Liu 2014). For sect. Dryopsis, eight of 21 species were sampled (sensu Zhang 2012). We included only one sample of Stenolepia, which is presumably monotypic (Kramer et al. 1990). Voucher information is summarized in Appendix 1. Materials and Methods Phylogenetic Analyses — DNA was extracted using a modified CTAB procedure (Wang et al. 2004). Universal and newly designed specific Phylogenetic Sampling — A total of 33 Dryopteris species and two primers were used for amplifying cpDNA regions, including trnL-L-F outgroups in the two most closely related genera [i.e. Roth and (trnL-F IGS + trnL gene), rps16-matK IGS, matK, ndhF, ndhF-trnN IGS, and 598 SYSTEMATIC BOTANY [Volume 41

Table 1. The PCR primers used in this study. (*primer for sequencing)

Primer names Primer sequence 5′-3′ Target region Target taxon Reference FERN chlN rEDS* GTACCYACTACTARGAAAAARCTATCTTC chlL for all This study FernN 3517 AACAGCCGACCGCTCTACC chlL for all ferns This study Dry chlL rFDA* GGGCATCRAATCCATTATCAG chlL for Dryopteris This study Dry chlL fGVD GGTTAYGGCGGAGTAGAC chlL for Dryopteris This study FERN rpsl6 fSRQE* CCCGRMRAGAAGGGARAG rps16-matK IGS for all ferns Kuo et al. 2011 EuI rps16 fQST AACCGTTCGTGATATYTTGAAACG rps16-matK IGS for eupolypod I ferns This study FERmatK fEDR* ATTCATTCRATRTTTTTATTTHTGGARGAYAGATT matK for all ferns Kuo et al. 2011 FERmatK rAGK CGTRTTGTACTYYTRTGTTTRCVAGC matK for all ferns Kuo et al. 2011 EuI matK rGLR ATCTCAATCTMCGCAATCCAT matK for eupolypod I ferns Kuo et al. 2011 Dry matK rNLH* GCGAACTRSAGYTTCTAVRTGAA matK for Dryopteris This study FERndhF fTMV* GCTCTHATHCAYGCNGCWACTATGGTRGC ndhF + ndhF-trnN IGS for all ferns Chen et al. 2013 FernN 2245 CTACGACCMATCGGTTAACAGCCG ndhF + ndhF-trnN IGS for all ferns Chen et al. 2013 Dry ndhF fESN* TGCTACATCCCCRAGAATCAAAT ndhF + ndhF-trnN IGS for Dryopteris This study Dry ndhf rGMD TCAAACGGGAGRTCCRTACCAG ndhF + ndhF-trnN IGS for Dryopteris This study f* ATTTGAACTGGTGACACGAG trnL-L-F for all ferns Taberlet et al. 1991 FernL 1Ir1* GGYAATCCTGAGCCAAATC trnL-L-F for all ferns Li et al. 2010

chlL. The PCR reactions were performed in 15 μL reaction volumes, two Dryopsis members [i.e. Dryopteris maximowicziana and D. including 20 ng genomic DNA, 1 ×PCR buffer, 200 μM dNTP, 15 pmol manipurensis (Bedd.) C. Chr.] and Stenolepia (i.e. Dryopteris of each primer, and 0.5 U taq polymerase (ProTaq, PROTECH, Taipei, Taiwan) or 0.75 U Phusion polymerase (FINNZYMES, Espoo, Finland). hypolepioides Rosenst.) were embedded in the Nothoperanema Primer information is in Table 1. After sequencing, DNA sequences were clade, which was a highly supported monophyletic group aligned by ClustalW implemented in BioEdit v. 7.0.5.3 (Hall 1999) using (MLBS = 100, PP = 1.00, and MPBS = 100) and sister to the the default settings. Ambiguously aligned tandem repeats in rps16-matK Aemulae clade (Fig. 2). The file was deposited in Dryad IGS were removed from the alignments manually. The alignment was (http://dx.doi.org/10.5061/dryad.mr076). deposited in Dryad (http://dx.doi.org/10.5061/dryad.mr076). To infer the appropriate nucleotide substitution model of each cpDNA region for Perispore Morphology—The perispore morphology of all phylogenetic analyses, jModelTest v. 0.1.1 (Posada 2008) was employed, species examined are shown in Fig. 3, and these morphol- and the appropriate substitution models were selected based on the ogies are congruent with those described in previous studies Akaike information criterion (Akaike 1974). Garli 2.0 (Zwickl 2006) was (Holttum and Edwards 1986; Tryon and Lugardon 1991; used to reconstruct the maximum likelihood (ML) phylogeny. The pro- portions of invariant sites and state frequencies were estimated by the Chen 2007; Lu et al. 2007; Wang and Dai 2010; Ding et al. program. The “genthreshfortopoterm” option was set to 20,000. To find 2013). The species belonging to subgenus Nothoperanema the most likely ML tree, ten independent searches were carried out, and have folded perispores and the folds on perispores are usually the tree with highest likelihood was selected. To calculate ML bootstrap reticulate (Fig. 3A–D). Dryopteris hypolepioides has such reticulate support (BS) values (Felsenstein 1985), 500 replicates were run under the perispore folds. Three species of sect. Dryopsis, D. manipurensis, same criteria, except only one search was completed for each replicate. Phylogenetic analysis via Bayesian inference (PP) was performed using D. maximowicziana,andD. scabrosa,alsohavefoldedperispores MrBayes v.3.1.2 (Yang and Rannala 1997; Ronquist and Huelsenbeck but their folds are laminate (Fig. 3F–H). Dryopteris apiciflora,the 2003). Two simultaneous runs were carried out with four chains (106 type species of sect. Dryopsis,hasspinyperispores(Fig.3I), generations each), in which each chain was sampled every 1,000 gen- which are similar to those found in the remaining Dryopsis erations. Log likelihoods of MCMC runs were inspected in Tracer v1.6 (Rambaut and Drummond 2013) to determine convergence. The first members except for D. obtusiloba (Holttum and Edwards 1986; 25% of the sample was discarded as burn-in, and the rest was used to Tryon and Lugardon 1991; Chen 2007; Lu et al. 2007; Wang and calculate the 50% majority-rule consensus tree. The maximum parsi- Dai 2010; Ding et al. 2013). mony (MP) phylogeny was reconstructed using PAUP* 4.0 (Swofford 2003) under the setting of random-taxon-addition, TBR swapping, gaps as missing data, and equal weighting. Heuristic bootstrap analysis of Discussion the MP phylogeny was performed with 500 bootstrap replicates, ten random addition cycles per bootstrap replicate, TBR swapping, and Phylogenetic Patterns—The relationships among clades equal weighting. in our phylogeny are consistent with previous studies, while Perispore Morphology — A scanning electron microscope (TM-3000 relationships within the Nothoperanema clade showed some Hitachi) was used to examine perispore characters. samples were pre-treated with gold-coating. The voucher information for all spore differences (Geiger and Ranker 2005; Li and Lu 2006; Liu samples is provided in Appendix 2. et al. 2007; Ebihara 2011; McKeown et al. 2012; Sessa et al. 2012; Zhang and Zhang 2012; Zhang et al. 2012). Based on the rapidly evolving coding regions (i.e. matK, ndhF, and chlL), our inferred phylogeny successfully resolved major Results relationships within the Nothoperanema clade. The inter- Phylogeny—The cpDNA alignment matrix of trnL-L-F + section phylogenetic relationships in subg. Nothoperanema rps16-matK IGS + matK + ndhF + ndhF-trnN IGS + chlL com- inferred using these rapidly evolving coding regions alone prised a total of 5,473 characters with 1,618 variable sites, received higher bootstrap values compared to those resolved which were generated from 33 Dryopteris species and two using only non-coding regions (data not shown). Addition- outgroups in Dryopteridaceae. The highest log-likelihood value ally, the phylogeny based on these coding regions revealed of the ML tree (Fig. 2) was -20,396.989845. Sect. Dryopsis was not the same inter-section relationships as the phylogeny monophyletic; species classified in section Dryopsis were resolved inferred using all regions (i.e. non-coding + coding; Fig. 2). in the Dryopsis and Nothoperanema clades separately. In addi- This phylogeny strongly suggests the of sect. tion to sect. Nothoperanema, Acrophorus, Diacalpe,andPeranema, Peranema + Diacalpe + Acrophorus (MLBS = 86, PP = 1.00, and 2016] KUO ET AL.: REVISION OF SUBG. NOTHOPERANEMA 599

Fig. 2. The ML phylogeny of the subg. Nothoperanema and its relatives. ML bootstrap support (MLBS) values, the posterior probabilities of Bayesian phylogenetic inference (PP), and MP bootstrap support (MPBS) values are indicated on each branch, as MLBS/PP/MPBS. The plus (+) sign represents MLBS = 100, PP = 1.00, or MPBS = 100. The thickened branch indicates MLBS ≥ 70 and PP ≥ 0.95. The gray blocks indicate the section status identified in this study.

MPBS = 70; Fig. 2). This relationship was neither resolved 2011; McKeown et al. 2012). Our phylogeny is consistent with nor supported in the previous studies (Li and Lu 2006; Liu this result; it further shows D. maximowicziana resolved with et al. 2007; McKeown et al. 2012; Zhang and Zhang 2012; another Dryopsis member (D. manipurensis) that is also nested Zhang et al. 2012). Instead, these previous studies inferred in the Nothoperanema clade (Fig. 2). Zhang et al. (2012) an alternative topology showing sect. Peranema as sister to inferred the unexpected position of D. maximowicziana nested sect. Nothoperanema + Diacalpe + Acrophorus. However, with within the Nephrocystis clade instead of Nothoperanema. the exception of Zhang et al. (2012), these relationships This seems to have resulted from the inclusion of DNA received only weak support in earlier studies. This latter sequences from misidentified samples, and, indeed, conflicts relationship may have resulted from including rbcL sequences in phylogenetic positions were found between the phylogeny in phylogenetic reconstruction as rbcL sequences usually con- reconstructed by their rbcL sequence (found nested in the tain higher levels of homoplasy (Kuo et al. 2011; Shinohara Nothoperanema clade; Ebihara 2011) and those reconstructed et al. 2013). by their trnL-L-F or rps4-trnS sequences (found nested in the Our phylogeny resolved the phylogenetic positions of Nephrocystis clade; data not shown). Stenolepia (i.e. Dryopteris hypolepioides) and two Dryopsis Morphology of the Nothoperanema Clade—Like other members (i.e. D. maximowicziana and D. manipurensis) within species in the Nothoperanema clade, Dryopteris hypolepioides, the Nothoperanema clade. This is the first phylogenetic anal- D. maximowicziana and D. manipurensis have the following ysis in which D. hypolepioides and D. manipurensis have been character states: 3-pinnatifid to 5-pinnatifid in ovate- included. In previous studies, D. maximowicziana was shown triangular shape, scales in broadly lanceolate or subu- to be related to sect. Nothoperanema or Acrophorus (Ebihara late shape, and hair-like scales on the adaxial lamina surfaces 600 SYSTEMATIC BOTANY [Volume 41

Fig. 3. Perispore morphology of Dryopteris peranema (A, sect. Peranema), D. pseudocaenopteris (B, sect. Diacalpe), D. paleolata (C, sect. Acrophorus), D. squamiseta (D, sect. Nothoperanema), D. hypolepioides (E), D. maximowicziana (F), D. scabrosa (G), D. manipurensis (H), and D. apiciflora (I, sect. Dryopsis). Scale bars = 5 μm.

(Fig. 1A). This combination of character states does not Morphological comparisons for other informative characters appear in other Dryopteris species, and thus, can provide the distinguishing sections are shown in Table 2. morphological basis to distinguish the Nothoperanema clade from the other clades in Dryopteris. In addition, perispores in Taxonomic Treatment the Nothoperanema clade are folded and are morphologically different from the spiny perispores of the Dryopsis clade Using current phylogenetic and morphological evidence, (Fig. 3; Holttum and Edwards 1986; Tryon and Lugardon we established two new sections in subgenus Nothoperanema 1991; Chen 2007; Lu et al. 2007; Wang and Dai 2010; Ding to accommodate certain Dryopsis species and Stenolepia, and et al. 2013). Among Dryopteris species, the inferior indusium this revised framework treats subgenus Nothoperanema as a in the Nothoperanema clade is unique and appears only in natural lineage. In addition to Dryopteris maximowicziana and sect. Acrophorus, Diacalpe, and Peranema. Our phylogeny D. sphaeropteroides, we recognized an additional four species revealed the monophyly of the clade comprising these three from subg. Erythrovariae sect. Dryopsis (total 21 species sensu sections (Fig. 2), and further implies a single evolutionary Zhang 2012) and transferred them to the new section under transition from superior to inferior indusia in the genus subg. Nothoperanema based on their diagnostic morphological Dryopteris. A similar transition in indusium position also characteristics. Like D. maximowicziana and D. manipurensis, occurred in (Moran et al. 2014). Except for sect. they all have characteristics, such as 2-pinnate-pinnatifid to tri- Nothoperanema, the members in the Nothoperanema clade pinnate in ovate-triangular shape, less densely scaled have a non-confluent groove at each axis-junction (Fig. 1D). costae, and much broader scales on basal stipes, differing from However, this character is homoplastic in Dryopteris, as it also the remaining Dryopsis members which have bipinnate, lanceo- appears in subg. Erythrovariae sect. Dryopsis (Zhang 2012). late fronds [except for Dryopteris ×holttumii (= Dryopsis 06 U TA. EIINO UG OHPRNM 601 NOTHOPERANEMA SUBG. OF REVISION AL.: ET KUO 2016]

Table 2. Morphological comparisons among sections under subg. Nothoperanema.

Section/ Characters Nothoperanema Shiehia Stenolepia Acrophrous Diacalpe Peranema Morphology of Subulate to lanceolate, Lanceolate to ovate-lanceolate, Lanceolate to broadly Ovate-lanceolate to Lanceolate to broadly Subulate to ovate-lanceolate, scales on brown to dark brown, light brown to reddish lanceolate, brown to ovate, reddish brown lanceolate, castaneous light brown to dark brown, basal stipe entire brown, entire dark brown, entire or castaneous, entire, to dark red, entire margins entire or with undulate, or toothed some clavate, short hairs Patterns of Patent Patent or nearly so at least Appressed, ascending Appressed, ascending or Appressed, ascending or Patent or nearly so scales relative on half lower portions or sometimes reflexed sometimes reflexed sometimes reflexed to axis surfaces of stipes Frond outline Ovate or ovate-triangular Ovate or ovate-triangular Ovate or ovate-triangular Ovate or ovate-triangular Ovate or oblong-ovate Ovate or oblong-ovate Frond dissection 3-pinnate to 4-pinnatifid 3-pinnatifid to 4-pinnatifid 3-pinnate to 5-pinnatifid 3-pinnatifid to 4-pinnate 3-pinnate to 4-pinnatifid 3-pinnate to 4-pinnatifid Axis dromy Catadromous except Catadromous except the Poecilodromous; Catadromous or nearly Catadromous except Catadromous except the the most proximal most proximal pairs of anadromy, catadromy isodromous except the most proximal most proximal pairs of pairs of pinna pinna (anadromous) or isodromy the most proximal pairs of pinna pinna (anadromous) (anadromous) pairs of pinna (anadromous) (anadromous) Frond indument Subulate to lanceolate Lanceolate scales, contorted Linear-lanceolate small Subulate ctenitis hairs Lanceolate small scales, Subulate to lanceolate scales, scales, subulate subulate ctenitis hairs, scales, contorted and short conical setae; contorted subulate subulate ctenitis hairs, ctenitis hairs, and and slightly longer subulate ctenitis hairs, often with a cordate, ctenitis hairs, short and short conical setae short conical setae setae or hair-like scales and short conical brown large scale at conical setae setae base of each junction of pinna and pinnule Grooves on the Most of axis-junctions Not confluent at each Not confluent at each Not confluent at each Not confluent at each Not confluent at each adaxial surfaces clearly confluent axis-junctions axis-junctions axis-junctions axis-junctions axis-junctions of rachis, costae and costules Sori Orbicular; subterminal Orbicular; subterminal Semi-globose; dorsal Semi-globose; subterminal Globose; dorsal on Globose, with long thin on veinlets on veinlets on veinlets on veinlets medium or basal stalk; dorsal on veinlets portion of veinlets Indusia Orbicular-reniform, Orbicular-reniform, Spathulate-ligulate to Semi-circular or cup-shaped, Globose, inferior, Globose, inferior, terminal superior, attached superior, attached by nearly orbicular, lateral, inferior, attached by attached by broad on thin stalk, enveloping by sinus, entire; sinus, entire or eroded attached by a gradually broad base, enclosing base, enclosing sori sori when young, 2 or rarely exindusiate narrowed base on the sori when young; when young, 2 or 3 valves from top elevated receptacles receptacle elevated 3 valves from top when mature under the sori when mature Perispore Bearing reticulate Bearing non-reticulate folds Bearing reticulate folds Bearing reticulate folds Bearing reticulate folds Bearing reticulate folds folds 602 SYSTEMATIC BOTANY [Volume 41

×fauriei)] and narrow scales at the stipe bases (Holttum and Included Species—At least six species belong to this section. Edwards 1986). In addition, the evidence from the perispore 1. Dryopteris manipurensis (Bedd.) C. Chr., Index Fil. [C. Chr.] 276. morphology supports D. scabrosa and D. obtusiloba as distinct 1905. Phegopteris manipurensis Bedd., Suppl. Ferns Brit. Ind. from species in sect. Dryopsis (Fig. 3G–I; Holttum and Edwards 83. 1892. Ctenitis manipurensis (Bedd.) Ching, Bull. Fan 1986; Tryon and Lugardon 1991). Mem. Inst. Biol. Bot. 8: 297. 1938. Dryopsis manipurensis Dryopteris Adans. subgenus Nothoperanema Tagawa section (Bedd.) Holttum et P. J. Edwards, Kew Bull. 41(1): 200. 1986. Shiehia L. Y. Kuo et Y. H. Chang, sect. nov—TYPE: Polypodium manipurense (Bedd.) Bedd., J. Bot. 26: 235. 1888. Dryopteris maximowicziana (Miq.) C. Chr. Dryopteris copelandii Christ, Philipp. J. Sci., ser. C. 2: 216. 1907. Diagnosis—Most similar to and easily confused with Ctenitis copelandii (Christ) Copel., Gen. Fil. [Copel.] 124. 1947. Dryopteris subg. Nothoperanema sect. Nothoperanema, but dif- Distribution—This species is mainly distributed in India fers by having lanceolate to ovate-lanceolate scales on stipes (Assam), Nepal, Papua New Guinea, and the Philippines (Luzon). and rachises (vs. subulate to linear-lanceolate scales), scales 2. Dryopteris maximowicziana (Miq.) C. Chr., Acta Horti somewhat patent usually restricted to the lower half of stipes Gothob. 1: 63. 1924. Aspidium maximowiczianum Miq., (vs. scales often patent throughout stipes and rachises), and Ann. Mus. Bot. Lugduno-Batavi 3(6): 178. 1867. Ctenitis non-confluent junctions of the adaxial lamina axis grooves maximowicziana (Miq.) Ching, Bull. Fan Mem. Inst. Biol. (vs. all axial junctions confluent). In addition, they are mor- Bot. 8(5): 294. 1938. Dryopsis maximowicziana (Miq.) phologically different from Dryopteris subg. Erythrovariae sect. Holttum et P. J. Edwards, Kew Bull. 41(1): 197. 1986. Dryopsis by 2-pinnate-pinnatifid to tripinnate fronds in ovate- triangular shape, subulate to broadly lanceolate and some- Dryopteris aureovestita Rosenst., Hedwigia 56(5): 343. 1915. what patent scales on stipe bases (vs. narrowly lanceolate and Ctenitis aureovestita (Rosenst.) Ching, Bull. Fan Mem. non-patent scales), less densely scaly costae (vs. densely scaly Inst. Biol. Bot. 8(5): 295. 1938. costae, especially on abaxial surface), short, conical, multi- Nephrodium matsumurae Makino, Bot. Mag. Tokyo 13(147): seriate setae persistent on both sides (or at least the adaxial 63. 1899. Dryopteris matsumurae (Makino) C. Chr., Index side) of the laminae (vs. without such setae), and perispore Fil. [C. Chr.] 5: 277. 1905. with non-reticulate folds (vs. with spiny perispore). Morphology—Medium- to large-sized terrestrial ferns. Ctenitis whankanshanensis Ching et C. H. Wang, Acta stout and short, erect, prostrate or obliquely ascend- Phytotax. Sin. 19(1): 123. 1981. ing. Fronds tufted; stipe covered with scales; scales somewhat Distribution—This species has a restricted distribution whitish-brown or pale-brown to brown, sometimes trans- in S and SW China, , and Taiwan. lucent, lanceolate to ovate-lanceolate, apex acuminate, thin, 3. Dryopteris obtusiloba (Baker) Kuntze, Revis. Gen. Pl. 2: 813. entire, gradually shortened and attenuate distally. Laminae 1891. Nephrodium obtusilobum Baker, Syn. Fil. [Hook. & large, broadly ovate to ovate-triangular, 2-pinnate-pinnatifid Baker] 284. 1867. Aspidium obtusilobum Prantl, Verh. to tripinnate, usually herbaceous or chartaceous; all pinnae Zool. Bot. Ges. 31. 119. 1882, non Fée 1857. Ctenitis catadromous except the most proximal pair, which is anadro- ferruginea (Bedd.) Ching var. obtusiloba (Baker) Sledge, mous; the most proximal pinnae usually largest, elliptic or Kew Bull. 27: 409. 1972. Ctenitis obtusiloba (Baker) Ching, subtriangular; stipes and rachises grooved adaxially, costae Bull. Fan Mem. Inst. Biol. Bot. 8: 296. 1938. Dryopsis and costules with shallow grooves on the adaxial surfaces, obtusiloba (Baker) Holttum et P. J. Edwards, Kew Bull. most axial junctions tending to be closed near their bases (i.e. 41(1): 202. 1986. Dryopteris peranemiformis C. Chr. subsp. adaxial sulci on rachis-costa, costa-costa and costa-costule obtusiloba (Baker) C. Chr., Index Fil. [C. Chr.] 284. 1905. junctions not open to receive one another); catenate hairs Dryopteris zeylanica Alderw., Malayan Ferns 203. 1909, (ctenitis hairs) abundant on stalks of pinnae and margins of nom. superfl. Lastrea obtusiloba (Baker) Bedd., Ferns Brit. grooves but absent inside the grooves, often mixed with a Ind. t. 296. 1868, non (Fée) T. Moore 1858. variable number of small, subulate or narrow-lanceolate Distribution—This species is endemic to Sri Lanka. scales; 2- or 3-cell wide hair-like scales present on both sides 4. Dryopteris peranemiformis C. Chr., Index Fil. [C. Chr.] 284. or only adaxial side of junctions of costae, costules and vein- 1905. Lastrea ferruginea Bedd., Ferns S. India t. 100. 1863, lets; short erect glands, if present (only found in D. scabrosa), nom. inval., non (Fée) T. Moore 1858. Nephrodium located between veins on abaxial surface of pinnae. Venation ferrugineum (Bedd.) Baker, Syn. Fil. [Hook. & Baker] 283. free, veins not reaching margin. Sori orbicular, dorsal on the 1867, nom. inval. Ctenitis ferruginea (Bedd.) Ching, Bull. veins, one row on both sides of the costae; indusia superior, Fan Mem. Inst. Biol. Bot. 8: 296. 1938, nom. inval. orbicular-reniform, light brown to dark brown, persistent or Dryopsis ferruginea (Baker) Holttum et P. J. Edwards, Kew fugacious. bilateral, monolete, ellipsoid to spheroidal, Bull. 41(1): 201. 1986, nom. inval. Dryopteris ferruginea perispore folded without reticulation. (Baker) Kuntze, Revis. Gen. Pl. 2: 812. 1891, nom. inval. Chromosome Number—The haploid count is n = 41 (for D. maximowicziana; Hirabayashi 1969; Iwatsuki 1995). Distribution—This species is endemic to S India. Distribution Range—The new section of ca. six species 5. Dryopteris scabrosa (Kunze) Kuntze, Revis. Gen. Pl. 2: 813. occurs in S and SW China, India, Japan, Nepal, Papua New 1891. Aspidium scabrosum Kunze, Linnaea 24: 286. 1851. Ctenitis scabrosa (Kunze) Ching, Bull. Fan Mem. Inst. Guinea, the Philippines, Sri Lanka, and Taiwan (cf. Holttum Biol. Bot. 8: 292. 1938. Dryopsis scabrosa (Kunze) Holttum and Edwards 1986; Zhang et al. 2013). et P. J. Edwards, Kew Bull. 41(1): 199. 1986. Lastrea Note—This new section is named after Prof. Wang- scabrosa T. Moore, Index Fil. [T. Moore] 103. 1858. Chueng Shieh, a retired pteridologist at National Chung Hsing Universtiy, for his dedication to promoting the knowl- Polypodium nigrescens Bedd., Ferns S. India t. 169. 1864, non edge of native ferns and lycophytes of Taiwan. Blume 1828. 2016] KUO ET AL.: REVISION OF SUBG. NOTHOPERANEMA 603

Distribution—This species is endemic to S India. Dryopteris, the new combination based on A. triste Blume was 6. Dryopteris sphaeropteroides (Baker) C. Chr., Index Fil. [C. Chr.] blocked by D. tristis (Kunze) Kuntze (Revis. Gen. Pl. 2: 814. 5: 293. 1905. Polypodium sphaeropteroides Baker, Bull. Misc. 1891). Thus, D. hypolepioides Rosenst. (Repert. Spec. Nov. Inform. Kew 1895(99): 55. 1895. Aspidium sphaeropteroides Regni Veg. 12: 175. 1913), which is one of the two earliest (Baker) Christ, Bull. Acad. Int. Géogr. Bot. 16: 119. 1906. published taxa and recently regarded as a of A. triste Athyrium sphaeropteroides (Baker) C. Chr., Acta Horti (Chang et al. 2013), was chosen to be the replacement name. Gothob. 1(2): 77. 1924. Ctenitis sphaeropteroides (Baker) However, judging from the somewhat variable characters, Ching, Bull. Fan Mem. Inst. Biol. Bot. 8(5): 295. 1938. such as plant size (from 13 cm to 100 cm tall), lamina shape Dryopsis sphaeropteroides (Baker) Holttum et P. J. Edwards, (from subtriangular-triangular to ovate-lanceolate), lamina dis- Kew Bull. 41(1): 199. 1986. Phegopteris sphaeropterodes section (ranging from tripinnatilobate to pentapinnatifid), (Baker) Christ, Bull. Herb. Boissier 7(1): 14. 1899. shape and texture of indusia (broad-ovate to orbicular with Distribution—This species is endemic to SW China. membranaceous texture for the Philippine materials vs. small, Dryopteris Adans. subgenus Nothoperanema Tagawa sec- narrow, spathulate-ligulate with rigid texture according to the tion Stenolepia (Alderw.) L.Y. Kuo et Y. H. Chang, comb. description of type protolog), occurrence of glandular hairs et stat. nov.; Stenolepia Alderw. Bull. Dép. Agric. Indes on abaxial surface of fronds (cf. Johns et al. 2006), types of Néerl. 27: 45. 1909-TYPE: Dryopteris hypolepioides Rosenst. substrate on which they grow (from loam to limestone), and habitat ecology (from the grounds under the forest canopies Diagnosis—Somewhat resembling Dryopteris subg. at middle elevations to the exposed summit areas at high alti- Nothoperanema sect. Diacalpe, but differing by its indusia. tudes), some cryptic species might possibly be included Sect. Stenolepia has spathulate-ligulate to nearly orbicular, therein. Hence, intensive sampling from the whole range of and laterally attached indusia, while sect. Diacalpe has globose the species is necessary for further phylogenetic analyses. and inferior indusia (Table 2). Included Species—Only one species, Dryopteris hypolepioides Morphology—Small to somewhat large terrestrial ferns. Rosenst., is recognized currently. However, two uncertain taxa scaly, ascending to erect. Fronds clustered; stipes documented in Johns et al. (2006) are also listed below. densely covered by broad lanceolate scales but gradually 1. Dryopteris hypolepioides Rosenst., Repert. Spec. Nov. Regni thinning to smaller, lanceolate, linear or filiform Veg. 12: 175. 1913. distally; larger scales often inserted on dark warts and thus the axes usually dark-verrucate; laminae decompound, Aspidium triste Blume, Enum. Pl. Javae 2: 169. 1828. Alsophila usually tri- to quadripinnate, rarely pentapinnatifid in larger tristis (Blume) Blume ex T. Moore, Index Fil. 58. 1857. individuals; the dromy (dissection pattern) of pinnae poecilo- Cystopteris tristis (Blume) Mett., Ann. Mus. Bot. dromous (viz. anadromy, catadromy or even isodromy could Lugduno-Batavi. 1: 241. 1864. Cyathea tristis (Blume) be found in all pinnae of the same frond; cf. Kramer 1987); Domin, Pteridophyta 263. 1929. tristis (Blume) adaxial surface of rachises, costae and costules grooved but Racib., Pterid. Buit. 1: 131. 1898. Lastrea tristis (Blume) T. not confluent at most junctions; uniseriate ctenitis hairs and Moore, Index Fil. 107. 1858. Stenolepia tristis (Blume) multiseriate hair-like scales present on both sides of lamina Alderw., Bull. Dep. Agric. Indes Neerl. 27: 46, t. 7. 1909. axes (Fig. 1D), but much more plentiful on the adaxial sides; Dryopteris alpina Rosenst., Repert. Spec. Nov. Regni Veg. 12: short, conical, reddish-brown setae present on the adaxial side of junctions of veinlets; small oval glandular hairs present or 173. 1913. absent — if present, persistent on abaxial surface of costae Athyrium atropurpureum Copel., Philipp. J. Sci. 12: 59. 1917. and veins; terminal segments of lateral pinnae usually obtuse to subacute, sinuate to pinnatifid. Venation abaxially dark, Distribution—It is the same as the distribution range of clearly visible; veins free, pinnately branching, simple or once this section. — to twice forked, veinlet tips almost reaching the margin. Sori Uncertain Taxa semi-globose, dorsal on a vein or veinlet or at the forking of a 1. Dryopteris speciosissima Copel., Univ. Calif. Publ. Bot. 18: vein; receptacles elevated; indusiium is attached by a gradu- 219. 1942; Ctenitis speciosissima (Copel.) Copel., Gen. Fil. ally narrowed base on the elevated receptacle under the [Copeland] 125. 1947; Stenolepia speciosissima (Copel.) sorus, spathulate-ligulate to approximately orbicular, usually Holttum ex P. J. Edwards, Guide Alpine Subalpine Fl. fugacious. Spores bilateral, monolete, ellipsoid, the surface Mount Jaya [R. J. Johns & al.] 88. 2006. with prominent, coarse folds. Distribution—This taxon is currently only known from Distribution Range—This species occurs in central, eastern Indonesia (Prov. Papua; type locality). and northern Malesia [incl. Borneo, Indonesia, New Guinea 2. “Stenolepia” sp. 1, R. J. Johns & P. J. Edwards in R. J. Johns (incl. Papua New Guinea), and the Philippines] (cf. Kramer et al. Guide Alpine Subalpine Fl. Mount Jaya [R. J. Johns et al. 1990; Chang et al. 2013). et al.] 86, f. 12.3.2. 2006. Note—Sect. Stenolepia is a monotypic taxon, and only the type species (Aspidium triste Blume) is recognized (cf. Kramer Distribution—This taxon is currently only known from et al. 1990). When the type species was transferred to the genus Indonesia (Prov. Papua).

Key to Sections of Subg. NOTHOPERANEMA

1. Indusia superior (above sori), flat, reniform; scales on stipes, at least the basal portion, often patent or not ...... 2 2. Scales on stipes and rachises lanceolate to ovate-lanceolate, patent on basal portion of stipes or not; grooves of rachis, costae and costules not confluent at junctions ...... sect. Shiehia 2. Scales on stipes and rachises subulate to linear lanceolate, usually patent throughout; grooves of rachis, costae and costules confluent at junctions (Fig. 1C) ...... sect. Nothoperanema 604 SYSTEMATIC BOTANY [Volume 41

1. Indusia lateral (spathulate-ligulate to approximately orbicular) or inferior (beneath sori; globose or semi-globose); scales on stipes and rachises appressed, ascending or sometimes reflexed, except sect. Peranema ...... 3 3. Indusia lateral (attached by a gradually narrowed base on the elevated receptacle under sorus), spathulate-ligulate to approximately orbicular, often fugacious; scales on stipes mostly appressed ...... sect. Stenolepia 3. Indusia inferior (beneath sori), globose or semi-globose; the positions of scales on stipes relative to stipe surface in various ways ...... 4 4. Sori stalked; indusia globose (Fig. 1F); scales on stipes and rachises mostly patent ...... sect. Peranema 4. Sori sessile; indusia globose or semi-globose; scales on stipes and rachises appressed, ascending or sometimes reflexed ...... 5 5. A large, membranaceous, cordate or ovate-lanceolate, often persistent scale usually present at each junction of pinna and pinnule on abaxial surface (Fig. 1B); indusia membranaceous, semi-globose ...... sect. Acrophorus 5. Leaf axes of every without a large cordate or ovate-lanceolate scale; indusia leathery, globose (Fig. 1E) ...... sect. Diacalpe

Acknowledgments. The authors thank Wan-Yu Zhang for help with Li, F.-W., L.-Y. Kuo, Y.-M. Huang, W.-L. Chiou, and C.-N. Wang. 2010. the initial work on Dryopteridaceae matK; Atsushi Ebihara, Carl Rothfels, Tissue-direct PCR, a rapid and extraction-free method for barcoding Cheng-Wei Chen, Fay-Wei Li, Tian-Chuan Hsu, and Yea-Chen Liu for of ferns. Molecular Ecology Resources 10: 92–95. providing materials; Pi-Fong Lu for providing photos; Mark P. Simmons Liu, H.-M., X.-C. Zhang, W. Wang, Y.-L. Qiu, and Z.-D. Chen. 2007. and two anonymous reviewers for providing comments and suggestions Molecular phylogeny of the fern family Dryopteridaceae inferred on the manuscript. This research is supported by the Taiwan Ministry of from chloroplast rbcL and atpB genes. International Journal of Plant Science and Technology for WLC (100-2923-B-054-001-MY3) and the Sciences 168: 1311–1323. Department of Science and Technology of Philippines for VBA. Lu, J.-M., D.-Z. Li, and D. Wu. 2007. Spore morphology of the family Dryopteridaceae. Acta Botanica Yunnanica 29: 397–408. McKeown, M., M. Sundue, and D. Barrington. 2012. Phylogenetic analyses place the Australian monotypic Revwattsia in Dryopteris (Dryopteridaceae). Literature Cited PhytoKeys 14: 43–56. Moran, R. C., P. H. Labiak, J. G. Hanks, and J. Prado. 2014. The phylo- Akaike, H. 1974. A new look at the statistical model identification. IEEE genetic relationship of brauniana and Tectaria nicotianifolia, Transactions on Automatic Control 19: 716–723. and the recognition of Hypoderris (Tectariaceae). Systematic Botany Chang, Y.-H., L.-Y. Kuo, W.-L. Chiou, C.-W. Chen, H.-M. Chang, and V. B. 39: 384–395. Amoroso. 2013. Stenolepia Alderw. (Dryopteridaceae), a fern genus Posada, D. 2008. jModelTest: Phylogenetic model averaging. Molecular new to the Philippines. Philippine Journal of Science 142: 83–88. Biology and Evolution 25: 1253–1256. Chen, N.-C. 2007. Scanning electron microscopic studies on the spores of Rambaut, A. and A. J. Drummond. 2013. Tracer v1.6. Available from Dryopteridoideae from Taiwan. Master Thesis. Kaohsiung: National http://tree.bio.ed.ac.uk/software/tracer/. Sun Yat-sen University. Ronquist, F. and J. P. Huelsenbeck. 2003. MrBayes 3: Bayesian phylo- Chen, C.-W., Y.-M. Huang, L.-Y. Kuo, Y.-H. Chang, Y.-C. Liu, and W.-L. genetic inference under mixed models. Bioinformatics 19: 1572–1574. Chiou. 2013. A new vittarioid fern species, Haplopteris heterophylla Rothfels, C. J., A. Larsson, L.-Y. Kuo, P. Korall, W.-L. Chiou, and K. M. (Pteridaceae). Systematic Botany 38: 901–909. Pryer. 2012. Overcoming deep roots, fast rates, and short internodes Ching, R.-C. 1940. On natural classification of the family . to resolve the ancient rapid radiation of eupolypod II ferns. System- Sunyatsenia 5: 201–268. atic Biology 61: 490–509. Ching, R.-C. 1966. Three new fern genera. Zhiwu Fenlei Xuebao 11: 17–19. Sessa, E. B., E. A. Zimmer, and T. J. Givnish. 2012. Unraveling reticulate Ding, H.-H., P. Wang, and S.-Y. Dong. 2013. Dryopsis (Dryopteridaceae), evolution in North American Dryopteris (Dryopteridaceae). BMC a fern genus new to Vietnam. Taiwania 58: 80–84. Evolutionary Biology 12: 104. Ebihara, A. 2011. RbcL phylogeny of Japanese pteridophyte flora and Shinohara, W., N. Nakato, Y. Yatabe-Kakugawa, T. Oka, J. K. Kim, N. implications on infrafamilial systematics. Bulletin of the National Murakami, H. Noda, and N. Sahashi. 2013. The use of matK in Museum of Nature and Science. Series B. Botany 37: 63–74. Ophioglossaceae phylogeny and the determination of Mankyua Felsenstein, J. 1985. Confidence limits on phylogenies: An approach chromosome number shed light on chromosome number evolution using the bootstrap. Evolution 39: 783–791. in Ophioglossaceae. Systematic Botany 38: 564–570. Geiger, J. M. O. and T. A. Ranker. 2005. Molecular and Swofford, D. L. 2003. PAUP*. Phylogenetic analysis using parsimony historical biogeography of Hawaiian Dryopteris (Dryopteridaceae). (* and other methods). Version 4.0b10. Sunderland: Sinauer Associates. and Evolution 34: 392–407. Taberlet, P., L. Gielly, G. Pautou, and J. Bouvet. 1991. Universal primers Hall, T. 1999. BioEdit: A user-friendly biological sequence alignment for amplification of three non-coding regions of chloroplast DNA. editor and analysis program for Windows 95/98/NT. Nucleic Acids Plant Molecular Biology 17: 1105–1109. Symposium Series 41: 95–98. Tagawa, M. 1938. Nothoperanema Tagawa, a new subgenus of Dryopteris Hirabayashi, H. 1969. Chromosome numbers in several species of the Adans. Acta Phytotaxonomica et Geobotanica 7: 198–200. Aspidiaceae. Shokubutsu Kenkyu Zasshi 44: 113–119. Tryon, A. F. and B. Lugardon. 1991. Dryopteridaceae. Pp. 416–501 in Holttum, R. and P. J. Edwards. 1986. Studies in the fern-genera allied to Spores of the Pteridophyta. New York: Springer-Verlag Press. Tectaria II. Dryopsis, a new genus. Kew Bulletin 41: 171–204. Wang, C.-N., M. Möller, and Q. C. B. Cronk. 2004. Phylogenetic position Iwatsuki, K. 1995. Dryopteridaceae. Pp. 120–173 in Flora of Japan, Volume of Titanotrichum oldhamii (Gesneriaceae) inferred from four different 1, Pteridophyta and Gymnospermae. Tokyo: Kodansha. gene regions. Systematic Botany 29: 407–418. Johns, R. J., P. J. Edwards, T. M. A. Utteridge, and H. C. F. Hopkins. 2006. Wang, Q.-X. and X.-L. Dai. 2010. Spores of (Filicales) from Genus Stenolepia. Pp. 86–88 in A guide to the alpine and dubalpine Flora China. Beijing: Science Press. of Mount Jaya. London: Kew Publishing. Widén, C.-J., C. R. Fraser-Jenkins, T. Reichstein, and J. Sarvela. 2001. A Kramer, K. U. 1987. A brief survey of the dromy in fern leaves, with an survey of phenolic compounds in Dryopteris and related genera. expanded terminology. Botanica Helvetica 97: 219–228. Part III. Annales Botanici Fennici 38: 99–138. Kramer, K. U., R. E. Holttum, R. C. Moran, and A. R. Smith. 1990. Wu, S.-H. and R.-C. Ching. 1991. Peranemaceae and Dryopteridaceae. Dryopteridaceae. Pp. 101–144 in The families and genera of vascular Pp. 403–439 in Fern families and genera of China. Beijing: Science Press. , volume 1, ed. K. Kubitzki. Berlin, Heidelberg: Springer Yang, Z. and B. Rannala. 1997. Bayesian phylogenetic inference using Berlin Heidelberg. DNA sequences: A Markov Chain Monte Carlo method. Molecular Kuo, L.-Y., F.-W. Li, W.-L. Chiou, and C.-N. Wang. 2011. First insights into Biology and Evolution 14: 717–724. fern matK phylogeny. Molecular Phylogenetics and Evolution 59: 556–566. Zhang, L.-B. 2012. Reducing the fern genus Dryopsis to Dryopteris and the Li, C.-X. and S.-G. Lu. 2006. Phylogenetic analysis of Dryopteridaceae systematics and nomenclature of Dryopteris subgenus Erythrovariae based on chloroplast rbcL sequences. Zhiwu Fenlei Xuebao 44: 503–515. section Dryopsis (Dryopteridaceae). Phytotaxa 27: 17–27. 2016] KUO ET AL.: REVISION OF SUBG. NOTHOPERANEMA 605

Zhang, L.-B. and H.-M. Liu. 2014. Dryopteris damingshanensis KU500288, KU500313, KU500211, KU500263, KU500237, KU500186. (Dryopteridaceae): A new fern in subgenus Nothoperanema from Dryopteris labordei (Christ) C. Chr., ZWY44 (TAIF), Taipei (Taiwan), Guangxi, China. Novon 23: 119–122. KU500295, KU500320, KU500218, KU500270, KU500244, KU500193. Zhang, L.-B. and L. Zhang. 2012. The inclusion of Acrophorus, Diacalpe, Dryopteris leiboensis Li-Bing Zhang, Dong3748 (IBSC), Sichuan (China), -, -, -, Nothoperanema, and Peranema in Dryopteris: The molecular phylogeny, KJ196610, KJ196610, KJ196687. Dryopteris manipurensis (Bedd.) C. Chr., systematics, and nomenclature of Dryopteris subg Nothoperanema. Taxon Liu9544 (TAIF), Luzon (the Philippines), KU500289, KU500314, KU500212, 61: 1199–1216. KU500264, KU500238, KU500187. Dryopteris mariformis Rosenst., Dong3768 Zhang, L.-B., L. Zhang, S.-Y. Dong, E. B. Sessa, X.-F. Gao, and A. Ebihara. 2012. (IBSC), Sichuan (China), -, -, -, KJ196604, KJ196604, KJ196686. Dryopteris Molecular circumscription and major evolutionary lineages of the fern maximowicziana Koidz., Kuo2406 (TAIF), Miaoli (Taiwan), KU500290, genus Dryopteris (Dryopteridaceae). BMC Evolutionary Biology 12: 180. KU500315, KU500213, KU500265, KU500239, KU500188. Dryopteris Zhang, L.-B., S.-G. Wu, J.-Y. Xiang, F.-W. Xing, H. He, F.-G. Wang, S.-G. nodosa (C. Presl) Li-Bing Zhang, Kuo2703 (TAIF), Mindanao (the Philippines), Lu, S.-Y. Dong, D. S. Barrington, K. Iwatsuki, M. J. M. Christenhusz, KU500281, KU500306, KU500204, KU500256, KU500230, KU500179. J. T. Mickel, M. Kato, and M. G. Gilbert. 2013. Dryopteridaceae. Dryopteris pallida Fomin, Raesaenen (H), Epirus (), -, -, -, -, -, FR731988; Pp. 541–724 in , Vol. 2–3 (Pteridophytes). Beijing: Science AFSSE,unknown,-,-,-,JQ941649,-,-.Dryopteris paleolata (Pic. Serm.) Li-Bing Press; St. Louis: Missouri Botanical Garden Press. Zhang, Kuo806 (TAIF), Hunan (China), KU500282, KU500307, KU500205, Zwickl, D. J. 2006. Genetic algorithm approaches for the phylogenetic analysis KU500257, KU500231, KU500180. Dryopteris peranema Li-Bing Zhang, of large biological sequence datasets under the maximum likelihood crite- Kuo2401 (TAIF), Chiai (Taiwan), KU500283, KU500308, KU500206, rion. Ph. D. Thesis. Austin: The University of Texas. KU500258, KU500232, KU500181. Dryopteris polita Rosenst., Dong718 (IBSC, PE), Hainan (China), -, -, -, KJ196593, KJ196593, KJ196700. Dryopteris pseudocaenopteris (Kunze) Li-Bing Zhang, Wade1800 (TAIF), Java Appendix 1. Voucher specimens and GenBank accession numbers for (Indonesia), KU500286, KU500311, KU500209, KU500261, KU500235, cpDNA sequences used in this study. Information is presented in the KU500184. Dryopteris rubiginosa (Brack.) Kuntze, Ranker1883 (COLO), following order: taxon name, collection number (deposited herbarium), locality, Hawaii (U. S. A.), KU500278, KU500303, KU500201, KU500253, chlL, ndhF, ndhF-trnN IGS, matK, rps16-matK IGS, trnL-L-F. KU500227, KU500176. Dryopteris shikokiana (Makino) C. Chr., TNS: 762596 (TNS), Kagoshima Pref. (Japan), KU500277, KU500302, KU500200, Arachniodes quadripinnata (Hayata) Seriz., Kuo484 (TAIF), Nantou KU500252, KU500226, KU500175. Dryopteris sparsa (D. Don) Kuntze, (Taiwan), KU500274, KU500299, KU500197, KU500249, KU500223, LJM179, unknown, -, -, -, -, -, DQ514499; Liu481 (TAIF), Taipei (Taiwan), KU500172. (Ait.) Kuntze, M. Gibby & A. M. Paul 26 -, -, -, JF303946, -, -. Dryopteris squamiseta (Hook.) Kuntze, Janssen2714 (P), (BM), unknown, KU500291, KU500316, KU500214, KU500266, KU500240, Le Maido (Reunion), KU500279, KU500304, KU500202, KU500254, KU500189. Dryopteris annamensis (Tagawa) Li-Bing Zhang, Wade1048 KU500228, KU500177. Dryopteris transmorrisonensis Hayata, FWL945 (TAIF), Tam Dao (Vietnam), KU500285, KU500310, KU500208, KU500260, (TAIF), Nantou (Taiwan), KU500297, KU500322, KU500220, KU500272, KU500234, KU500183. Dryopteris apiciflora (Wall.) Kuntze, Dong 843 KU500246, KU500195. Dryopteris varia (L.) Kuntze, ZWY39 (TAIF), Taipei (IBSC), Yunnan (China), -, -, -, KJ196541, KJ196541, KJ196641. Dryopteris (Taiwan), KU500294, KU500319, KU500217, KU500269, KU500243, christensenae (Ching) Li-Bing Zhang, Liu9365 (TAIF), Yunnan (China), KU500192. Dryopteris wuzhaohongii Li-Bing Zhang, Lu28385 (TAIF), KU500287, KU500312, KU500210, KU500262, KU500236, KU500185. Taoyaun (Taiwan), KU500280, KU500305, KU500203, KU500255, (D. C. Eaton) Kuntze, LJM178, unknown, -, -, -, -, -, KU500229, KU500178. Dryopteris zhuweimingii Li-Bing Zhang, FWL967 DQ514496; Kuo709 (TAIF), Hunan (China), -, -, -, KU500248, KU500222, -. (TAIF), Luzon (the Philippines), KU500284, KU500309, KU500207, (C. Presl) Fraser-Jenk. & Jermy, Kuo467 (TAIF), Nantou KU500259, KU500233, KU500182. Polystichum fraxinellum (Christ) Diels, (Taiwan), KU500298, KU500323, KU500221, KU500273, KU500247, Kuo429 (TAIF), Hualien (Taiwan), KU500275, KU500300, KU500198, KU500196. Dryopteris filix-mas (L.) Schott, EBS32 (WIS), unknown, -, -, -, KU500250, KU500224, KU500173. JN189075, -, JQ941611. (L.) Schott, EBS47 (WIS), unknown, -, -, -, JQ941603, -, JN189080. Dryopteris glabra var. glabra (Brack.) Kuntze, Geiger35 (COLO), Hawaii (U. S. A.), KU500292, KU500317, Appendix 2. The materials used in perispore morphology examination. KU500215, KU500267, KU500241, KU500190. Dryopteris hawaiiensis (Hillebr.) W. J. Rob., Geiger7 (COLO), Hawaii (U. S. A.), KU500293, KU500318, Dryopteris maximowicziana (Miq.) C. Chr., TAIF168096 (TAIF). KU500216, KU500268, KU500242, KU500191. Dryopteris hendersonii (Bedd.) Dryopteris pseudocaenopteris (Kunze) Li-Bing Zhang, TAIF413562 (TAIF). C. Chr., TNS: 763159 (TNS), Kagoshima Pref. (Japan), KU500276, KU500301, Dryopteris squamiseta (Hook.) Kuntze, TAIF371738 (TAIF). Dryopteris KU500199, KU500251, KU500225, KU500174. Dryopteris heterolaena C. Chr., paleolata (Pic. Serm.) Li-Bing Zhang, TAIF152938 (TAIF). Dryopteris Dong3684 (IBSC), Guangdong (China), -, -, -, KJ196553, KJ196553, KJ196623. manipurensis (Bedd.) C. Chr., TAIF303278 (TAIF). Dryopteris scabrosa Dryopteris holttumii Li-Bing Zhang, Hsu5840 (TAIF), Taitong (Taiwan), (Kunze) Kuntze, TAIF288655 (TAIF). Dryopteris hypolepioides Rosenst., KU500296, KU500321, KU500219, KU500271, KU500245, KU500194. Dryopteris CHY20121216-017 (TAIF). Dryopteris apiciflora (Wall.) Kuntze, TAIF279875 hypolepioides Rosenst., Kuo2701 (TAIF), Mindanao (the Philippines), (TAIF). Dryopteris peranema Li-Bing Zhang, TAIF180482 (TAIF).