Genome-Wide CRISPR Screen Identifies Suppressors of Endoplasmic Reticulum Stress-Induced Apoptosis

Genome-wide CRISPR screen identifies suppressors of endoplasmic reticulum stress-induced apoptosis

Ronald A. Panganibana,1, Hae-Ryung Parka,1, Maoyun Suna, Maya Shumyatcherb, Blanca E. Himesb, and Quan Lua,c,2

aProgram in Molecular and Integrative Physiological Sciences, Department of Environmental Health, Harvard T.H. Chan School of Public Health, Boston, MA 02115; bDepartment of Biostatistics, Epidemiology, and Informatics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104; and cDepartment of Genetics & Complex Diseases, Harvard T.H. Chan School of Public Health, Boston, MA 02115

Edited by F. Ulrich Hartl, Max Planck Institute of Biochemistry, Martinsried, Germany, and approved May 24, 2019 (received for review April 12, 2019) Sensing misfolded proteins in the endoplasmic reticulum (ER), cells ER-associated protein degradation (ERAD) machinery, ER initiate the ER stress response and, when overwhelmed, undergo chaperones, and autophagy pathway genes (12–14), to allevi- apoptosis. However, little is known about how cells prevent ate ER stress. In addition, PERK-induced eIF2α phosphory- excessive ER stress response and cell death to restore homeostasis. lation attenuates global protein translation to prevent the Here, we report the identification and characterization of cellular introduction of additional misfolded proteins (8). Together, suppressors of ER stress-induced apoptosis. Using a genome-wide these responses relieve disturbances in the ER and help restore CRISPR library, we screen for genes whose inactivation further proteohomeostasis. increases ER stress-induced up-regulation of C/EBP homologous Sustained high levels of ER stress, however, trigger apoptosis — protein 10 (CHOP) the transcription factor central to ER stress- (15). The ER stress-induced apoptosis is largely mediated associated apoptosis. Among the top validated hits are two inter- through CHOP (C/EBP homologous protein, also known as acting components of the polycomb repressive complex (L3MBTL2 MGA DDIT3), the transcription factor that integrates signaling from [L(3)Mbt-Like 2] and [MAX gene associated]), and microRNA- all three branches of the ER stress pathway. XBP1s, ATF6(n), 124-3 (miR-124-3). CRISPR knockout of these genes increases CHOP and ATF4 all can bind to the CHOP promoter to increase its expression and sensitizes cells to apoptosis induced by multiple expression (16). Up-regulation of CHOP triggers apoptosis ER stressors, while overexpression confers the opposite effects. mainly by increasing the ratio of pro- vs. antiapoptotic proteins L3MBTL2 associates with the CHOP promoter in unstressed cells CELL BIOLOGY to repress CHOP induction but dissociates from the promoter in (16, 17). For example, CHOP increases the expression of the the presence of ER stress, whereas miR-124-3 directly targets the proapoptotic proteins BIM and PUMA, and, at the same time, IRE1 branch of the ER stress pathway. Our study reveals distinct down-regulates the expression of antiapoptotic Bcl-2 protein – mechanisms that suppress ER stress-induced apoptosis and may (18 20). These molecular events ultimately lead to the activa- lead to a better understanding of diseases whose pathogenesis tion of apoptotic caspases (e.g., caspase 3, 8, and 9) to cause cell is linked to overactive ER stress response. death (21). While the elaborate signaling pathways leading to ER stress- UPR (unfolded protein response) | proteotoxicity | environmental induced cell death have been well characterized, much less is toxicant | genetic screen known about how cells suppress excessive ER stress response to

aintaining protein homeostasis is critical for the fitness and Significance Msurvival of all living cells. Newly synthesized proteins in the endoplasmic reticulum (ER) must be correctly folded before Dysregulated endoplasmic reticulum (ER) stress response con- being transported to subcellular destinations. About 30% of all tributes to the pathogenesis of myriad diseases. The molecular newly synthesized proteins are misfolded (1), and exposure of pathways leading to ER stress-induced cell death are well char- cells to environmental proteotoxicants such as arsenic (As) fur- acterized; however, much less is known about how cells suppress ther increases protein misfolding (2, 3). Misfolded proteins are excessive ER stress response to avoid apoptosis and restore ho- nonfunctional, prone to aggregation, and often toxic to cells (4). meostasis. Using a CRISPR-based loss-of-function genetic screen, As a result, high levels of misfolded proteins contribute to the our study uncovered multiple suppressors of ER stress response. pathogenesis of multiple diseases, including type 2 diabetes, These suppressors include a polycomb protein complex that di- cancer, and most neurodegenerative disorders (5). rectly inhibits the expression of the transcriptional factor central As a major site of protein synthesis, the ER is capable of sensing to ER stress-induced cell death and a microRNA that targets IRE1, and responding to the accumulation of misfolded proteins, a a canonical ER stress pathway component. Our study reveals condition widely known as ER stress. The elaborate cellular regulatory mechanisms that ameliorate potentially damaging response to ER stress, also known as unfolded protein response stress response and provides potential therapeutic targets for (UPR), is mediated by three ER-resident transmembrane pro- pathologies whose etiology is linked to overactive ER stress teins: PERK, IRE1, and ATF6 (6). In the presence of ER stress, response. misfolded proteins bind and sequester the molecular chaperone Author contributions: R.A.P., H.-R.P., and Q.L. designed research; R.A.P. and H.-R.P. per- BiP/GRP78 away from PERK, IRE1, and ATF6, leading to ac- formed research; R.A.P., H.-R.P., M. Sun, M. Shumyatcher, B.E.H., and Q.L. contributed tivation of these three molecules and their respective down- new reagents/analytic tools; R.A.P., H.-R.P., M. Sun, M. Shumyatcher, B.E.H., and Q.L. stream signaling cascades (7). Activation of PERK induces analyzed data; and R.A.P., H.-R.P., and Q.L. wrote the paper. phosphorylation of eIF2α and up-regulation of ATF4, a potent The authors declare no conflict of interest. transcription factor (8). Activation of IRE1 triggers the cleavage This article is a PNAS Direct Submission. of XBP1 mRNA into its transcriptionally active spliced form Published under the PNAS license. XBP1s (9, 10). ATF6 activation results in translocation to the 1R.A.P. and H.-R.P. contributed equally to this work. Golgi, where it is cleaved by proteases into an active form 2To whom correspondence may be addressed. Email: [email protected]. ATF6(n), another potent transcription factor (11). As tran- This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. scriptional activators, ATF4, XBP1s, and ATF6(n) up-regulate 1073/pnas.1906275116/-/DCSupplemental. a myriad of UPR target genes, including antioxidant genes,

www.pnas.org/cgi/doi/10.1073/pnas.1906275116 PNAS Latest Articles | 1of10 Downloaded by guest on September 30, 2021 prevent unwanted apoptosis. In this study, using a genome-wide sociated with increased risk of developing ER stress-associated CRISPR loss-of-function screen coupled with a CHOP up- diseases (26, 27). As-treated cells were then subjected to regulation–based ER stress cell model, we identified and char- fluorescence-activated cell sorting (FACS) to isolate the bright acterized multiple genes, including members of polycomb repressive cell populations that express a high amount of mCherry (Fig. complex 1 (PRC.1), as well as microRNAs, as suppressors of ER 1A), as CRISPR knockout of genes that normally suppress stress response and associated cell death. Our study reveals CHOP up-regulation would lead to an increase in mCherry ex- distinct mechanisms that suppress ER stress response and apo- pression. To allow for identification of CRISPR cell populations ptosis, and provides insights into diseases whose pathogenesis is with increased intensity of fluorescence, we used a screen con- linked to abnormal ER stress response and cell death. dition (treatment of 5 μM As for 15 h) that initially induced a moderate increase (approximately two-fold) in the mean Results mCherry fluorescence. Sorted mCherry-bright cells were then Genome-Wide CRISPR Screen Identifies Suppressors of ER Stress allowed to repopulate once, followed by another round of ER Response. We previously developed an ER stress cell model that stress induction and cell sorting (SI Appendix, Fig. S2A). To harbors a fluorescence reporter (mCherry) under the control of minimize nonspecific bystander effect, we constructed a sub- the CHOP gene promoter (22). These CHOP-mCherry reporter CRISPR library using guides amplified from the genomic DNA cells respond in a dose-dependent manner to known ER stressors of cells isolated from the second-round sorting (SI Appendix, Fig. such as As and tunicamycin (Tm) (SI Appendix,Fig.S1A and B). S2B). Compared with vector control, the sublibrary cells We transduced the CHOP-mCherry reporter cells with a genome- exhibited greater mCherry fluorescence at basal levels. The wide lentiviral CRISPR-Cas9 knockout (KO) library that targets sublibrary cells were again subjected to As treatment and cell ∼19,000 protein-coding genes (six guide RNAs [gRNA] per gene) sorting (Fig. 1A and SI Appendix, Fig. S2C). After As treatment, and ∼1,800 miRNAs (four gRNAs per miRNA) (23). We used the there was even more improved separation in CHOP-mCherry lentiviral library at a relatively low multiplicity of infection (MOI = signals, suggesting that the screen selected the population of 0.3) to minimize superinfection of the reporter cells. After selec- cells with gRNAs conferring ER stress response suppression (SI tion for stable CRISPR viral integration, the final cellular library Appendix, Fig. S2C). In the final round of sorting, we isolated the contains an estimated ∼4 × 107 independent viral integration upper 50% mCherry-bright cells (SI Appendix, Fig. S2C). events. This represents about 300-fold coverage of ∼120,000 To identify gene hits whose CRISPR knockout leads to the CRISPR guides in the starting viral library. To identify suppres- phenotypic change (higher mCherry induction in response to ER sors of the ER stress response, the CRISPR KO library cells were stress), we extracted genomic DNA and PCR-amplified the treated with As, which as a ubiquitous metal toxicant activates all CRISPR guide sequences from the sorted population, along with three pathways of the ER stress response and induces apoptosis guide sequences from unsorted control library cells, for deep (24, 25). Moreover, chronic exposure to high levels of As found in sequencing. We analyzed sequencing data to identify guides and certain geographical areas in the world has been shown to be as- their corresponding target genes that were enriched in sorted

A Lentiviral CRISPR library Induction of ER stress by As treatment Cell sorting

Deep Sequencing to identify gene hits

mCherry Fluorescence CHOP-mCherry reporter cells Sublibrary B C D

10.0 ASMT miR-1285-2 miR-370

4 3 0.8 L3MBTL2 SLC52A1 miR-595 miR-124-3 3 miR-933 0.6 2 miR-1281 MB21D2 0.4 miR-551a 2 miR-1273g miR-492 0.2

Number of gRNAs 1 Number of gRNAs 1 Cumulative frequency 0.0

0 20 40 60 80 100 120 2 4 6 2 4 6 Counts by gene Log2 Fold Change Log2 Fold Change

Fig. 1. Identification of ER stress suppressors using genome-wide CRISPR screen. (A) Scheme of CRISPR screen. CHOP-mCherry reporter cells were transduced with lentiviruses produced from the genome-wide CRISPR library. Stably transduced reporter cells were treated with ER stress inducer As (5 μM) for 15 h, and strong responders with higher mCherry fluorescence (upper 10%) were isolated by FACS. The isolated cells were regrown for enrichment and subjected to another round of induction. At the end of the second round of induction and enrichment, the genomic DNA of the strong responders was extracted and the region harboring the gRNAs was amplified and cloned into a lentiviral vector to generate a CRISPR sublibrary. A new batch of reporter cells was transduced with the CRISPR sublibrary for another round of As treatment. Finally, the strong responders (50%) were FACS sorted and the genomic DNA was subjected to deep dequencing and bioinformatics analysis for the identification of target genes. (B) Cumulative frequencies of gRNAs from sorted and control (unsorted, original library) cells. (C and D) Plots showing fold change of gRNAs versus number of distinct gRNAs for protein-coding genes and miRNAs, respectively. Gene names of top hits are indicated.

2of10 | www.pnas.org/cgi/doi/10.1073/pnas.1906275116 Panganiban et al. Downloaded by guest on September 30, 2021 cells compared to control unsorted library cells. Deep sequenc- CHOP mRNA expression was also increased in L3MBTL2 ing results revealed a significant reduction in the diversity of knockout cells at both basal level and in response to As treatment gRNAs in the sorted population (Fig. 1B). Using criteria that (Fig. 2 C, Right). include greater than 2.5 log2 fold change and the presence of at We next tested whether L3MBTL2 KO cells exhibit enhanced least two enriched guides per gene, we identified a total of response to other ER stressors. We treated the KO reporter cells 361 hits, including 324 protein-coding genes and 37 miRNAs with thapsigargin (Tg) or Tm and measured mCherry expression. (Fig. 1 C and D and Datasets S1 and S2). Ontological analysis of In the presence of Tg or Tm, the CHOP-mCherry fluorescence the protein-coding hits using the NIH Database for Annotation, was greater in L3MBTL2 KO cells compared with controls (Fig. Visualization, and Integrated Discovery (DAVID) Functional 2D). On the other hand, while Tg treatment augmented the Annotation tool showed enrichment of genes that function expression of endogenous CHOP in KO cells, the levels of in apoptosis, proliferation, cell growth and size, and cellular spliced xBP1 and ATF4 mRNAs, which are upstream of CHOP responses to stress and other stimuli (Dataset S3). DAVID induction, did not significantly change between scramble and pathway analysis of target genes of miRNA hits with fold L3MBTL2 KO cells (SI Appendix, Fig. S4). These data indicate change greater than 10 revealed presence of gene sets involved that L3MBTL2 is likely a suppressor of general ER stress re- related to chaperone-mediated protein folding and cell death sponse induced by diverse stimuli. (Dataset S4). Loss of L3MBTL2 Sensitizes Cells to ER Stress-Induced Apoptosis. Up- Loss of L3MBTL2 Increases Basal and ER Stress-Induced CHOP regulation of CHOP is associated with induction of apoptotic cell Expression. Among the top protein-coding gene hits identified by death. We next examined whether loss of L3MBTL2 increases the screen are ASMT (acetylserotonin methyltransferase), SLC52A1 apoptosis in the presence of ER stress. We treated control and (solute carrier family 52 member 1), L3MBTL2 (lethal(3)malignant L3MBTL2 KO cells with As for 24 h and then measured cell death brain tumor-like 2), and MB21D2 (mab 21 domain containing 2). using annexin V/DAPI staining, which can differentiate early ap- Among the top hits, only MB21D2 has no annotated function. optotic (annexin V positive, DAPI negative), late apoptotic cells ASMT is an enzyme that catalyzes the final step in melatonin (annexin V and DAPI positive), and necrotic (annexin V negative, biosynthesis (28) while SLC52A1 is a transmembrane protein that DAPI positive) from live cells (negative for both annexin V and functions as a riboflavin transporter (29) and belongs to the solute DAPI) cells (34). In the absence of As treatment, no significant carrier (SLC) gene superfamily (30). On the other hand, L3MBTL2 difference in apoptosis was detected between KO and control cells

is a component of the polycomb repressive complex that possesses (Fig. 2 E, Upper). After exposure to As, as expected, there was CELL BIOLOGY transcriptional repressive activity (31). We proceeded to validate significant decrease in the percentage of live cells (negative for these top protein-coding gene hits by first generating individual annexin V and DAPI) for both control and L3MBTL2 knockout CRISPR gene knockouts in the CHOP-mCherry reporter cells. cells (Fig. 2 E, Lower). However, the percentage of live cells was For each of these gene hits, we transduced the reporter cells with significantly lower in L3MBTL2 knockout cells (∼40%) than in lentiviruses containing two independent CRISPR gRNAs. We then control cells (69.4%) (Fig. 2E). The cell death was mostly due to measured As-induced CHOP expression in the KO cells using apoptosis, as seen by greater percentage of late apoptotic cells flow cytometry. Only cells with gRNAs for two of the gene hits, (37.4%) in knockout cells than in scramble control cells (15.5%). SLC52A1 and L3MBTL2, showed higher mCherry expression, Similarly, L3MBTL2 CRISPR knockout cells exhibited more ap- both at basal level and in response to As treatment (SI Appendix, optosis induced by Tg and Tm than the scramble control cells (Fig. Fig. S3). This was not the case for either ASMT or MB21D2 KO 2 F and G and SI Appendix, Fig. S5). On the other hand, treatment cells. SLC52A1 KO cells showed modest shifts in mCherry fluo- with genotoxic stressors 5-fluorouracil or etoposide, which induce rescence compared with the more obvious increases in mCherry apoptosis via ER stress-independent pathways (35) did not result expression exhibited by L3MBTL2 KO cells after arsenic treat- in greater increase in apoptosis in L3MBTL2 KOs (SI Appendix, ment (SI Appendix,Fig.S3). The function of SLC52A1 in the ER Fig. S5). Together, these results show that loss of L3MBTL2 stress response is not clear, although there are reports suggesting renders cells more susceptible to apoptosis induced by ER stress that riboflavin deficiency causes ER stress (32, 33). Possibly, but likely not by other cellular stresses. SLC52A1 KO cells are deficient in riboflavin due to its impaired riboflavin transport system which causes ER stress and may ex- Loss of L3MBTL2-Interacting Protein, MGA, Increases CHOP Expression plain the increase, although modest, in CHOP expression. In ad- and Sensitizes Cells to ER Stress-Induced Apoptosis. L3MBTL2 belongs dition to SLC52A1, the screen has identified other members of to polycomb-group proteins (PcG), a family of proteins that com- the SLC superfamily (namely SLC1A6, SLC16A8, SLC22A10, monly assemble as a complex possessing chromatin remodeling SLC26A3, SLC3913, SLC44A2, SLC44A5,andSLCO1B3), al- activities (31). Interestingly, at least four other gene hits (MGA, though they were ranked lower using our priority criteria HDAC1, L3MBTL3,andSFMBT1) from our CRISPR screen are (Dataset S1). On the other hand, both gRNAs for L3MBTL2 KO members of the PcG family (Dataset S1). One of the hits, MGA, cells produced the most robust increase in mCherry expression (SI encodes a protein known to interact with L3MBTL2 as part of Appendix,Fig.S3D) both at basal and As-treated states. Thus, we PRC.1, which promotes a repressive chromatin environment to decided to further investigate L3MBTL2’s potential role as sup- facilitate transcriptional gene silencing (31, 36). We therefore pressor of the ER stress response. tested whether MGA, like L3MBTL2, also plays a role in sup- Both L3MBTL2 gRNAs led to efficient gene editing as evi- pressing ER stress-induced CHOP expression. We established denced by the T7E1 cleavage assay which detects mismatched MGA CRISPR KOs using the top two gRNAs identified by our DNAs such as indels (insertions or deletions) at the gRNA tar- screen. In the absence of a reliable antibody, the efficiency of MGA geting sites (Fig. 2A). Similarly, Western blotting showed sig- gRNA-induced gene editing was confirmed by T7E1 cleavage assay nificant reduction in L3MBTL2 protein expression in the reporter (SI Appendix,Fig.S6A). We then treated MGA KO cells with ER cells stably transduced with the CRISPR guide RNAs (Fig. 2B). stress inducers and assessed CHOP expression. Similar to The incomplete knockout of L3MBTL2 in the cells is likely be- L3MBTL2 KO cells, MGA KO cells exhibited higher CHOP- cause we used pooled stable cells rather than single clones. mCherry fluorescence and endogenous CHOP expression at both Compared with the control cells transduced with a scrambled the basal level and in response to As (SI Appendix,Fig.S6B). Tg gRNA, the L3MBTL2 KO cells exhibit higher mCherry at both andTmtreatmentsresultedinaugmented mCherry fluorescence in basal level and in response to As treatment (Fig. 2 C, Left). MGA KOs compared with scrambled control (SI Appendix,Fig. Consistent with augmented mCherry expression, the endogenous S6C). Consistent with higher CHOP expression and similar to

Panganiban et al. PNAS Latest Articles | 3of10 Downloaded by guest on September 30, 2021 A D F Scramble L3MBTL2 KO

Scramble L3MBTL2 gRNA1 L3MBTL2 gRNA2 - Tg Size (kb) - + - + - + - + T7E1 1 10 * 15 mCherry mCherry 0.5 * 8 10 6 *

4 Annexin V 5 * + Tg B MW 2 Relative expression Relative (kDa) expression Relative 0 0 80 L3MBTL2 Control Tg Control Tm

40 -actin DAPI E Scramble L3MBTL2 KO G Scramble L3MBTL2 KO C Scramble L3MBTL2 gRNA1 L3MBTL2 gRNA2 - As - Tm * 10 20 mCherry CHOP * 8 15 6 * 10 4 Annexin V * Annexin V 2 5 + As + Tm Relative expression Relative expression Relative 0 0 Control As Control As

DAPI DAPI

Fig. 2. Loss of L3MBTL2 increases CHOP expression and sensitizes cells to ER stress-induced apoptosis. (A) Analysis of CRISPR knockout using the T7E1 assay. L3MBTL2 knockout cells were generated using the top two gRNAs identified in the CRISPR screen. DNA cleavage indicating mismatch and mutation induced by the two gRNAs targeting L3MBTL2 was detected by T7E1 assay. (B) Western blot analysis showing significant reduction in the levels of L3MBTL2 in CHOP- mCherry reporter cells transduced with lentiviruses containing gRNAs targeting L3MBTL2.(C)LossofL3MBTL2 increases the mean CHOP-mCherry fluorescence and endogenous CHOP mRNA expression as assessed by flow cytometry (16 h, 5 μM As) and qRT-PCR (6 h, 5 μM As), respectively. β-Actin was used as the internal control for qRT-PCR. Error bars = SEM (n = 3); *P < 0.05. (D)LossofL3MBTL2 in reporter cells further increases the mean CHOP-mCherry flourescence in Tg (8 h, 100 nM) or Tm (16 h, 500 ng/mL)-treated cells as assessed by flow cytometry. DMSO and water were used as vehicle controls for Tg and Tm, respectively. Error bars = SEM (n = 3); *P < 0.05. (E–G)LossofL3MBTL2 sensitizes cells to ER stress-induced apoptosis. (E) Representative Annexin V and DAPI staining of scrambled control or L3MBTL2 KO cells in the absence (−As, Upper) or presence of As treatment (+As, Lower). Scrambled control and L3MBTL2 KO cells were treated with 50 μM As or water for 24 h and harvested for Annexin V/DAPI staining analysis to determine the percentage of apoptotic cells. (F and G) Representative Annexin V and DAPI staining of scrambled control of L3MBTL2 KO cells treated with 1 μMTgand1μg/mL Tm for 24 h. Annexin V positive cells, which are shown in the Upper quadrant of each graph, make up the apoptotic populations.

L3MBTL2 KOs, MGA KO cells were more susceptible to either We next examined whether the association of L3MBTL2 with As- or Tg-induced apoptosis (∼1.5- and ∼1.25-folds, respectively) the CHOP promoter is modulated by ER stress. We treated cells compared with similarly treated scrambled control (SI Appendix, with Tg for 8 h and assessed the binding of L3MBTL2 with the Fig. S6 D and E). Together our data collectively suggest that the CHOP promoter using ChIP analysis. As shown in Fig. 3C,Tg two interacting PRC.1 components (L3MBTL2 and MGA) play a treatment resulted in diminished L3MBTL2 occupancy. We next role in protecting cells from ER stress-induced apoptosis. tested whether such dissociation happens before CHOP up- regulation. Tg did not affect the levels of L3MBTL2 but in- L3MBTL2 Associates with CHOP Promoter to Repress Its Transcription duced the expression of CHOP starting at 2 h posttreatment (Fig. and This Association Is Abrogated by ER Stress. As part of the 3D). We reasoned that ER stress would lead to dissociation of PRC.1 complex, L3MBTL2 possesses transcriptional repressive L3MBTL2 from the CHOP promoter before Tg-induced CHOP activity and is associated with repressive chromatin structure (37, protein expression. We thus performed ChIP at 1 h post-Tg 38). As our collective results suggest that L3MBTL2 suppresses treatment. As shown in Fig. 3E the association of L3MBTL2 with ER stress-induced apoptosis by repressing CHOP, we hypothe- the CHOP promoter was greatly diminished before Tg-induced sized that L3MBTL2 associates with the promoter region of CHOP induction, suggesting that L3MBTL2 may contribute to CHOP to inhibit its up-regulation. We also hypothesized that ER stress-mediated apoptosis via transcriptional repression of α such association, if any, would be diminished in the presence of CHOP. We also used Sal003, a selective chemical blocker of eIF2 dephosphorylation that causes CHOP up-regulation, to investigate ER stress. To test this hypothesis, we pulled down the L3MBTL2 L3MBTL2-mediated transcriptional repression of CHOP. As shown protein and the associated chromatin from cells using the in Fig. 3 F and G, Sal003 treatment increased both CHOP-mCherry chromatin immunoprecipitation (ChIP) technique. We then fluorescence (Fig. 3F) and endogenous CHOP expression (Fig. performed qRT-PCR using primers spanning several regions of 3G). Moreover, treatment with Sal003 led to diminished L3MBTL2 the CHOP gene promoter (Fig. 3A) to determine L3MTBL2 as- association on CHOP promoter as shown by our ChIP analysis sociation. We found that under basal, unstressed conditions, (Fig. 3H). L3MBTL2 coimmunoprecipitates mostly with the CHOP promoter sequences (region B) that harbor known binding sites for L3MBTL2 Mitigates ER Stress-Induced Apoptosis by Repressing CHOP. CEBP and ATF transcriptional activators, and to some extent also As our CRISPR screen utilized an ER stress cell model that is the region with putative AP-1 binding site (Fig. 3B). based on CHOP up-regulation and as L3MBTL2 suppresses

4of10 | www.pnas.org/cgi/doi/10.1073/pnas.1906275116 Panganiban et al. Downloaded by guest on September 30, 2021 A B 256 C D CHOP gene promoter IgG - + Tg MW 64 L3MBTL2 0 1 2 3 hr A B C D (kDa) R R R R L3MBTL2 16 30 CEBP/ATF AP-1 ERSE CHOP 4 D IgG AF BF CF F 80 L3MBTL2 1 Relative expression expression Relative Input -actin 0.25 40 ABCD

MW E F G (kDa) H 1.5 5 2 mCherry 80 L3MBTL2 * * 4 * 1.0 40 p-eIF2 1 3 40 eIF2 2 0.5 1 30 1 CHOP Relative expression Relative expression Relative Relative expression Relative -actin 0.0 0 40 0 Control Tg Control Sal003 Control Sal003

? ? I J K L3MBTL2 MGA CHOP

Scramble/WT gRNA/WT WT CHOP-KO WT CHOP-KO Scramble/CHOP-KO gRNA/CHOP-KO 4 *

? ? CELL BIOLOGY MW ER stress (kDa) L3MBTL2 MGA gRNA gRNA gRNA gRNA gRNA gRNA Scramble Scramble Scramble 3 ns Scramble 80 L3MBTL2 2 ATF4 30 CHOP CHOP 1 40 -actin Apoptosis (Fold change) Apoptosis 0 Control Tm Control Tm Apoptosis

Fig. 3. L3MBTL2 associates with the CHOP promoter to repress its induction. (A) Schematic drawing of the CHOP promoter. Primer pairs covering different regions of the promoter are indicated. (B) ChIP analysis showing binding of L3MBTL2 to the CHOP promoter region. After chromatin extraction, L3MBTL2 was pulled down and PCR using primers targeting different regions of the CHOP promoter was performed. (C) Representative gel image of ChIP analysis after 8 h post-Tg treatment (100 nM) HEK293T cells were treated with either 100 nM Tg or DMSO 8 h and harvested for ChIP analysis. Primers spanning the promoter region where L3MBTL2 associates the strongest as determined in B were used for PCR. (D) Time course of induction of CHOP protein after Tg (100 nM) treatment as assessed by Western blotting. (E) ChIP analysis in the presence of Tg at 1 h post-Tg treatment. Data represent a representative experiment. Erros bars = SEM (n = 2–3), *P < 0.05. (F) CHOP-mCherry fluorescence in the presence of 10 μM Sal003 or vehicle control as assessed by flow cytometry. *P < 0.05. (G) Western blot analysis showing up-regulation of CHOP in the presence of 10 μM Sal003. (H) ChIP analysis showing reduced association of L3MBTL2 on the CHOP promoter in 20 μM Sal003-treated cells compared with vehicle control. Data represent a representative experiment, Error bars = SEM (n = 2–3), *P < 0.05. (I) Western blot analysis of the expression of CHOP in L3MBTL2 KO or scrambled control in CHOP KO or CHOP WT MEF cells treated with Tm (100 ng/mL, 12 h). (J) Relative apoptosis in L3MTBL2 KO versus scrambled control cells after treatment with Tm (100 ng/mL, 20 h). APC-annexin V/DAPI staining was used to detect apoptosis. *P < 0.05. (K) Proposed model of L3MBTL2-mediated CHOP suppression. In normal conditions, L3MBTL2, together with MGA and other polycomb groups of proteins, occupies the promoter region of the CHOP gene to suppress the latter’s transcription. In the presence of ER stress, the transcription factors (e.g., ATF4) bind to the CHOP promoter region, displacing L3MBTL2 and the polycomb complex, resulting in increased transcription of the CHOP gene.

CHOP expression, we next examined whether L3MBTL2 miti- L3MBTL2 knockout in CHOP-KO MEFs in the presence of ER gates ER stress-induced apoptosis via CHOP. To this end, we stress (Fig. 3J). This result indicates that L3MBTL2’srolein used an existing mouse embryonic fibroblast (MEF) cell line that attenuating apoptosis is mediated through CHOP. lacks CHOP (CHOP-KO) (39) as well as the corresponding wild- Conversely, L3MBTL2 overexpression diminished CHOP type (WT) MEFs. We established L3MBTL2 CRISPR KO as expression and mitigated apoptosis (∼1.75-fold) in Tm-treated well as L3MBTL2-overexpressing MEFs and characterized WT MEFs (SI Appendix,Fig.S7A). On the other hand, no their responses to ER stress. We hypothesized that L3MBTL2 difference in apoptosis was again observed between control and inactivation or overexpression would cause augmentation of or L3MBTL2-overexpessing MEF cells in CHOP KO background confer protection to ER stress-induced apoptosis in WT cells after Tm treatment (SI Appendix,Fig.S7B). Taken together, the but would not alter the response in CHOP-KO cells. As shown results of our experiments on L3MBTL2 KO and L3MBTL2- in Fig. 3I, knockout of L3MBTL2 in WT MEF cells led to −/− greater CHOP expression as well as augmented apoptosis overexpressing MEF cells in CHOP background imply that (approximately two-fold) in the presence of ER stress com- L3MBTL2 suppresses ER stress-induced apoptosis by repressing pared with control. These data confirmed the results of our the induction of CHOP. Taken together, our results support a aforementioned experiments that were conducted on the ER model in which L3MBTL2, likely in a complex with MGA and stress cell model (Fig. 2) in yet another cell line. However, no other PRC.1 proteins, associates with the CHOP promoter to re- difference in apoptosis was observed in scrambled control and press CHOP expression in healthy, unstressed cells. This association

Panganiban et al. PNAS Latest Articles | 5of10 Downloaded by guest on September 30, 2021 is abrogated in the presence of ER stress to allow CHOP ex- MiR-124-3 Inhibits ER Stress by Directly Targeting IRE1. To in- pression and eventually lead to apoptosis (Fig. 3K). vestigate the mechanism underlying CHOP suppression by miR- 124-3, we assessed the effect of miR-124-3 on the three branches MiR-124-3 Inhibits CHOP Expression and ER Stress-Induced Apoptosis. of the ER stress pathway (IRE1α, ATF6, and PERK). XBP1s, In addition to protein-coding hits, our CRISPR screen also ATF6(n), and ATF4 all can bind to the CHOP promoter to in- identified multiple microRNAs as potential ER stress suppres- crease its expression (16). Therefore, we examined the expres- sors (Fig. 1D and Dataset S2). To validate the top microRNA sion of XBP1, ATF6, and eIF2α, and their corresponding active hits, we generated CRISPR-mediated knockouts of individual forms: spliced XBP1 (XBP1s), ATF6(n), and phosphorylated microRNAs (two gRNAs each) in the CHOP-mCherry reporter eIF2α (p-eIF2α). As shown in Fig. 5A, miR-124-3 mimic signif- cells, which were then exposed to As and measured for mCherry icantly down-regulated IRE1α protein expression. In addition, expression by flow cytometry. Among the top microRNAs miR-124-3 mimic decreased the expression of the spliced XBP1 identified, miR-370 and miR-124-3 knockouts showed consistent (XBP1s) at basal conditions while miR-124-3 mimic did not seem increase in mCherry fluorescence after As exposure (SI Appen- to affect the expression of the unspliced form of XBP1 (XBP1u) dix, Fig. S8). Because the extent of increase in mCherry ex- (Fig. 5A). MiR-124-3 mimic also down-regulated the expression α α pression was highest for miR-124-3 gRNAs (SI Appendix, Fig. of ATF6(n) (Fig. 5A). Expression of ATF6, p-eIF2 , and eIF2 S8I), we focused on miR-124-3 for further characterization. was not affected by miR-124-3 mimic transfection (Fig. 5A). Both gRNAs targeting miR-124-3 induced efficient gene Consistent with the Western blot result, miR-124-3 mimic sig- editing in the CHOP-mCherry reporter cells as shown by the nificantly decreased the level of ERN1 (the gene encoding IRE1) and XBP1s transcript (Fig. 5B). Conversely, miRNA-124-3 KO T7E1 cleavage assay (Fig. 4A). Consistent with this, qRT-PCR cells have greater ERN1 and XBP1s expression (Fig. 5C). showed that miR-124-3 expression was suppressed by more than Although miR-124-3 mimic may down-regulate the ATF6 90% by miR-124-3 gRNAs compared with the scrambled control pathway, we focused on the IRE1 pathway for further validation (Fig. 4B). MiR-124-3 KO cells had higher CHOP-mCherry because TargetScan predicts that ERN1 has a potential miR-124- fluorescence as well as endogenous CHOP expression than 3 targeting site in its 3′-untranslated region (UTR). To test control cells in response to As (Fig. 4 C and D). Conversely, whether miR-124-3 suppresses IRE1 expression by directly tar- overexpression of miR-124-3 by mimic transfection resulted in geting the 3′-UTR of ERN1, we fused either the wild type or a decreased ER stress-induced CHOP-mCherry fluorescence (Fig. mutant form (in which we changed two nucleotides in the pu- 4E) and decreased endogenous CHOP expression (Fig. 4F). tative miR-124-3 targeting sequence through site-directed mu- Similarly, miR-124-3 knockout increased Tg-induced CHOP tagenesis) of the ERN1 3′-UTR to the luciferase reporter gene expression and the basal CHOP expression compared with (Fig. 5D). We then cotransfected the luciferase constructs scramble control, whereas overexpression of miR-124 down- (wild type or mutant) with either miR-124-3 or control mimics regulated Tg-induced CHOP expression (SI Appendix, Fig. S9). (scramble) into HEK293T cells and measured the luciferase Consistent with the effect on CHOP expression, miR-124- activity. As shown in Fig. 5E, miR-124-3 mimic reduced the lu- 3 knockout cells exhibited increased apoptosis in response to As ciferase activity of the wild-type 3′-UTR construct by over 50%. (Fig. 4G). However, such repression by miR-124-3 mimics was largely

1.5 A B miR-124 E Scramble miR-124 mimic G 6 * 1.0 mCherry Scramble miR-124 KO Scramble gRNA1 gRNA2 Size (kb) - + - + - + 4 T7E1 0.5 0.5 -As

0.3 expression Relative * * 2 0.0 Relative expression

gRNA1 gRNA2 0 Scramble Control As

Scramble Scramble Scramble miR-124 mimic C miR-124 gRNA1 D miR-124 gRNA1 F miR-124 gRNA2 miR-124 gRNA2 Annexin V 2.5 * 15 4 * +As mCherry CHOP * CHOP 2.0 3 10 1.5 * 2 1.0 5 1 0.5 DAPI Relative expression Relative Relative expression Relative Relative expression Relative 0.0 0 0 Control As Control As Control As

Fig. 4. MiR-124-3 inhibits ER stress-induced CHOP expression and its knockout augments ER stress-induced apoptosis. (A) DNA cleavage indicating mismatch and mutation induced by the two gRNAs targeting miR-124-3 was validated by T7E1 assay. (B) Suppression of miR-124-3 expression by two gRNAs was validated by qRT-PCR. (C and D) Knockout of miR-124-3 increases As (5 μM)-induced CHOP-mCherry fluorescence and endogenous CHOP expression compared with scrambled control as measured by flow cytometry. (E and F) Transfection of miR-124-3 mimic to CHOP-mCherry reporter cells suppresses As (5 μM)- induced CHOP-mCherry fluorescence and endogenous CHOP expression compared with scrambled control as measured by flow cytometry. (G) MiR-124-3 KO cells (by gRNA1) showed augmented apoptotic cells compared scrambled control in the presence of As, as measured by Annexin V staining and subsequent flow cytometry. Scrambled control and miR -124 KO were treated with 50 μM As or water for 24 h and harvested for Annexin V/DAPI staining analysis to determine the percentage of apoptotic cells. Annexin V positive.cells, which are shown in the Upper quadrant of each graph, make up the apoptotic populations. n = 3 experiments. Triplicates were done for each condition. *P < 0.05.

6of10 | www.pnas.org/cgi/doi/10.1073/pnas.1906275116 Panganiban et al. Downloaded by guest on September 30, 2021 A C Scramble miR-124 gRNA1 miR-124 gRNA2 allows known transcriptional activators of CHOP (e.g., ATF4) to 6 * bind to the promoter, in turn tipping the balance in favor of MW * CHOP up-regulation (Fig. 3K). The precise mechanism for the (kDa) 4 reduced L3MBTL2 occupancy at the CHOP promoter during ER 110 IRE1 stress, however, remains to be determined. One possibility is that 60 XBP1s 2 transcriptional activators compete with and displace L3MBTL2

40 XBP1u Relative expression from the CHOP promoter under ER stress conditions as indicated 0 60 ATF6(n) ERN1 XBP1s by the results of our ChIP experiments. It has been reported that D L3MBTL2 sumoylation facilitates repression of its target genes 100 ATF6 SV40 Luciferase (43). Conceivably, L3MBTL2 sumoylation may be regulated by 40 p-eIF2 ER stress to allow for CHOP induction. Finally, as L3MBTL2 and 40 eIF2 MGA can exist in a complex and colocalize in target loci (44), their interaction may be disrupted by ER stress to relieve CHOP 40 -actin suppression. Our study also identifies a microRNA (miR-124-3) as a suppressor of the IRE1 branch of the ER stress pathway. Micro- B E 150 Scramble miR-124 mimic * RNAs have emerged as key regulators of ER homeostasis, stress 100 response, and UPR signaling (45, 46). For example, over- 1.5 expression of the miR-23a, -27a, and 24-2 cluster and miR- * * 50 122 has led to induction of CHOP, ATF4, and subsequent cell 1.0 death (47, 48). In addition, IRE1 mediates the induction of miR- Luciferase activity (%) Luciferase activity 0 346 while degrading premiRs-17, -34a, -96, and -125b (49–51). 0.5 ic e ic ′ im MiR-1291 has been shown to bind to 3 -UTR of ERN1 gene,

Relative expression m Scramble Scrambl resulting in reduced IRE1 expression in hepatoma cells (52). 0.0 -124 -124 mim iR iR ERN1 XBP1s m m Although miR-1291 reduced XBP1 splicing, it failed to attenuate Tm-induced CHOP activation. Our study showed that miR-124- WT Mutant 3 suppresses the IRE1 signaling pathway by direct binding to the

′ CELL BIOLOGY Fig. 5. MiR-124-3 directly targets IRE1. (A) MiR-124-3 mimic suppresses As- sequence in the 3 -UTR of the ERN1 gene, leading to decreased stimulated IRE1α and XBP1s expression. HEK293T cells were transfected with XBP1 splicing and CHOP activation in As- or Tg-treated cells. scramble or miR-124-3 mimic, then exposed to As (5 μM) for 24 h. (B) MiR- Furthermore, miR-124-3 KO leads to increased activation of 124-3 mimic suppresses mRNA expression of ERN1 (the gene encoding IRE1) IRE1 signaling with increased XBP1 splicing, augmented CHOP and XBP1s.(C) MiR-124-3 KOs increase ERN1 and XBP1s mRNA expression. activation, and increased apoptotic cell death. Our study dem- (D) Sequences of wild-type or mutant 3′-UTR of ERN1 in the downstream of onstrates that miR-124-3 protects against ER stress-mediated the firefly luciferase gene. (E) MiR-124-3 binds to 3′-UTR of ERN1, the gene ′ cell death by attenuating CHOP activation potentially through encoding IRE1. HEK293T cells were transfected with pMirTarget ERN3 -UTR or inhibiting the IRE1/XBP1 pathway. Although the IRE1/XBP1 pMirTarget ERN3′-UTR mutant in the presence of scramble or miR-124-3 mimic. n = 3 experiments. Triplicates were done for each condition. *P < 0.05. UPR branch may regulate the induction of CHOP (16), PERK is known to be dominant in the activation of CHOP (6, 53). In addition, activation of IRE1/XBP1 signaling mainly activates abolished for the mutant construct that contains the altered miR- proadaptive pathways such as up-regulation of target genes for 124-3 binding site, indicating that the site in the ERN1 3′-UTR is ER chaperones and ER-associated degradation components required for the inhibitory effect of miR-124-3. Together, these (54). Moreover, miR-124-3 has been predicted to target more data showed that miR-124-3 directly targets the 3′-UTR of than 1,800 genes based on TargetScan database, suggesting that ERN1 (IRE1) to inhibit its expression. there are likely other mechanisms by which miR-124-3 suppresses the ER stress response. Discussion The present study is a genome-wide CRISPR-based knockout The ER stress response is aimed at restoring protein homeostasis screen specifically aimed at identifying suppressors of the ER and promoting cell survival but in excessive ER stress conditions, stress response in mammalian cells. We used a reporter cell line can lead to cell death. While the ER stress pathways are well that was specifically designed to identify regulators of CHOP, characterized, much less is known about how cells suppress the allowing us to infer that the identified genes also suppress ER ER stress response to avoid apoptosis and help restore homeo- stress-induced cell death. However, because our screen did not include a control arm in which the effect of gene deletion itself stasis. Using a CRISPR-based loss-of-function genetic screen, we (without any chemical stressor) could have been observed on the identified multiple suppressors of the ER stress response that reporter, it is difficult to know for the full screen (outside of the protect cells from apoptosis by targeting key players at multiple validated and characterized hits) which gene hits affect ER ho- steps of the UPR. These include members of polycomb-group meostasis vs. arsenic-induced stress. Further studies are needed proteins that directly inhibit the expression of the transcriptional to determine whether hits other than L3MBTL2, MGA,ormiR- factor central to ER stress-induced cell death and a microRNA 124 suppress basal ER stress response in untreated cells to that targets IRE1, a canonical ER stress pathway component. Our maintain ER homeostasis. A recent study using a CRISPR in- study reveals regulatory mechanisms that ameliorate potentially terference (CRISPRi) screen identified genes whose repression damaging stress response and provides insights into pathologies perturbs ER homeostasis and revealed how the three branches of linked to excessive ER stress and apoptosis. the ER stress pathway monitor distinct types of stress (55). We The expression of transcription factors mediating cell death have found some overlaps in the present screen with that of the such as CHOP is tightly regulated and maintained at basal levels CRISPRi screen. For example, the CRISPRi screen identified to prevent unwanted cell death (16, 40–42). Our results suggest UFM1, a uniquitin-like protein involved in proper maintenance that L3MBTL2, possibly in a complex with MGA, binds to the of ER homeostasis, while our present study uncovered UFSP1, a CHOP promoter to repress CHOP expression in healthy, un- protease that has been reported to activate UFM1. Each screen stressed cells. In the presence of ER stress, L3MBTL2 associa- has also identified a member of the HSP-40 chaperone family— tion with the CHOP promoter region is diminished. This potentially DNAJ19 (CRISPRi screen) or DNAJC15 (present study). These

Panganiban et al. PNAS Latest Articles | 7of10 Downloaded by guest on September 30, 2021 genes may play roles in suppressing ER stress response through identified by our screen will advance our understanding of the their chaperone activities (56). Furthermore, some of the other ER stress response and provide potential therapeutic targets for hits identified by our screen have known roles in protecting cells pathologies whose etiology is linked to overactive ER stress re- from protein aggregation. For example, HSPB9 is a member of sponse and apoptosis. the heat-shock protein family possessing chaperone activity (57) while UBE3C and UBE2B are enhancers of proteasome activity Methods that is essential in eliminating aggregated proteins (58, 59) Cell Culture and Chemicals. HEK293T cells and MEFs were cultured in DMEM (Dataset S1). While these proteins may not act directly on any of (Life Technologies) with 10% FBS and antibiotics (penicillin and streptomycin; the ER stress pathways or on CHOP itself, their absence could Life Technologies). The mCherry reporter cell line driven by the CHOP pro- result in accumulation of misfolded proteins and ER stress. moter was established as described previously (22). Sodium arsenite, thap- The ER stress response is an elaborate cellular response with sigargin, tunicamycin, etoposide, and 5-fluorouracil were purchased from Sigma-Aldrich. potent cell damaging consequences; it is not surprising that the results of our screen reveal many potential ER stress suppres- Establishment of Lentiviral CRISPR Knockout Library in CHOP-mCherry Reporter sors. Our screen has also identified genes, other than L3MBTL2 Cells. The CRISPR knockout library containing ∼120,000 gRNAs individually and MGA, that likewise have known DNA-binding and tran- cloned into lentiCRISPRv2 vector was obtained from Addgene. The library scriptional repression activities (Dataset S1). These genes, which contains six distinct gRNAs targeting each protein-coding gene and four dis- include E2F6, OMG, SCA1, MPHOSPH8, L3MBTL3, and oth- tinct gRNAs for each of the miRNAs (23). After amplification of the library ers, may be the subject of follow-up studies to characterize which DNA, lentiviruses were produced in HEK293T cells using the packaging plas- step(s) of the ER stress response pathways they act on or mids pVSVg and psPAX2 (Addgene) (69). The resulting lentiviral library was whether they also interact with canonical members of the PRC.1. used to transduce the CHOP-mCherry reporter cells at a relatively low MOI of 0.3 and in the presence of polybrene (8 μg/mL) for 24 h. Cells with stable viral This would allow mapping of the suppressors of the UPR and μ would increase our understanding of this important cellular re- integration were selected for 7 d using puromycin at 1 g/mL. The cells were allowed to grow in fresh media for an additional 9 d to expand the library. sponse. In addition to the aforementioned genes, interestingly, some of the top hits from our screen include genes with known FACS-Based Screen. The reporter cells containing the CRISPR library were roles in the nervous system but have not been largely explored in treated with 5 μM sodium arsenite for 15 h and then subjected to FACS using the context of ER stress. These include OMG, KCNJ14, NTS, the BD FACSAria Sorter (BD Biosciences). The upper 10% (fluorescence in- and SEMA6D. OMG (oligodendrocyte myelin glycoprotein) tensity) of the mCherry-positive cell population was isolated, recovered, and contributes to myelination in the nervous system (60), KCNJ14 allowed to repopulate for 4 d. The sorted reporter cells were treated again (Potassium Voltage-Gated Channel Subfamily J Member 14) is with 5 μM As and the upper 10% of the bright population was isolated. The believed to influence the excitability of motor neurons (61), NTS genomic region containing the CRISPR guides was PCR-amplified and then (Neurotensin) is a secreted tridecapeptide that may function as a subcloned into the lentiCRISPRv2 plasmid to generate a sublibrary. For PCR neuromodulator or a neurotransmitter (62), and SEMA6D amplification the following conditions were used: initial denaturation at 98 °C for 4 min, 98 °C for 20 s, 30 cycles at 60 °C for 20 s, 72 °C for 30 s, and (Semaphorin 6D) is highly expressed in the brain and is believed final extension at 72 °C for 3 min. The primers used were “forward: 5′- to play a role in axon guidance (63). As many neurological dis- AACGGATCGGCACTGCGTGC and reverse: 5′- TGTGGGCGATGTGCGCTCTG.” eases exhibit heightened ER stress, the potential roles of these For subcloning, the PCR products and lentiCRISPRv2 plasmid were digested genes in protecting the nervous system from ER stress-mediated using EcoR1 and KpnI (New England Biolabs) restriction enzymes and apoptosis is an attractive area for future studies. Furthermore, as transformed into XL10-Gold Ultracompetent Cells (Agilent Technologies). miR-124-3 is also highly abundant in the nervous system and is Lentiviruses made from the sublibrary were then used to transduce into dysregulated in many neurological disorders (64), whether these CHOP-mCherry reporter cells, which were subjected to a new round of As hits act independently of or cooperate with miR-124-3 to prevent treatment and sorting. In the final round of FACS, the upper 50% of the development of ER stress-related neurological disorders is mCherry-positive As-treated population was isolated for deep sequencing an important aspect of future studies. and identification of target genes. Dysregulated ER stress response contributes to the patho- Deep Sequencing and Data Analysis. Genomic DNA was extracted from the final genesis of multiple diseases such as diabetes, cancer, and neu- sorted cell population and used for PCR to amplify the CRIPSR guides as pre- rological disorders. A primary mechanism of the pathogenesis of viously described (23). Deep sequencing was perfomed using an Illumina HiSeq many ER stress-related diseases is CHOP-mediated cell death 2500 instrument in Rapid Run mode (150-bp paired end) at the Bauer Core (15, 16, 65, 66). Our findings suggest that CHOP elevation in ER Facility at Harvard University. Sample raw reads were demultiplexed using the stress-related diseases could result from the loss of transcrip- fastq-multx function of the ea-utils package (v1.1.2) (70). Because some barc- tional repressive activity by the PRC.1 on CHOP. Conceivably, odes were not 5′ anchored, we recursively demultiplexed reads after trimming changes in the expression of members of PRC.1 caused by single one base pair from the 5′ end until the entire gRNA sequence could not be nucleotide polymorphisms may contribute to the molecular captured (i.e., allowing for 20 bp to remain). Primer sequences from 5′ ′ mechanisms of ER stress-related diseases in susceptible pop- (TCTTGTGGAAAGGACGAAACACCG) and 3 (GTTTTAGAGCTAGAAATAG- ulations by favoring CHOP up-regulation and sensitizing cells CAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAG- TCGGTGCTTTTTTGAATTCGCTAGC) ends were trimmed from reads using to ER stress-induced apoptosis. Indeed, studies have linked cutadapt v1.9 while allowing for overhang. Next, reads were aligned to L3MBTL2 gene variants with neuroticism (67) and schizophre- the Human GeCKOv2 library available at Addgene (http://www.addge- nia (68), neurological disorders believed to be associated with ne.org/crispr/libraries/geckov2/) using Bowtie 2 v2.1.0 while allowing for a heightened ER stress. In addition, miR-124-3 is highly expressed single base mismatch (71). The total number of reads mapping to each in the brain and is believed to play a role in many neurodegen- gRNA guide was obtained with the samtools (v0.1.19) idxstats function erative diseases (64). Genetic variants on the PRC.1 or miR-124- (72), and raw gRNA counts were normalized to the total number of 3 genes may provide a potential mechanistic link between ER mapped reads for each sample in R. Per-gene results were obtained by stress-induced cell death and neurological disorders. taking the mean of normalized gRNA counts corresponding to each gene. In summary, we uncovered multiple suppressors of ER stress- Gene-level results were ranked by the fold change of the mean for both sorted population samples to the control sample. The number of gRNAs induced apoptosis using a CRISPR-based loss-of-function ge- per gene with fold change greater than two was also recorded. netic screen. These suppressors include members of a polycomb protein complex that inhibit the expression of the transcriptional Pathway Analysis. DAVID was used to perform gene functional annotation clus- factor central to ER stress-induced cell death, and a microRNA tering using default options and annotation categories (Disease: OMIM_DISEASE; that targets IRE1, a canonical ER stress pathway component. Functional Categories: COG_ONTOLOGY, SP_PIR_KEYWORDS, UP_SEQ_FEATURE; Further characterization of these genes as well as additional hits Gene_Ontology: GOTERM_BP_FAT, GOTERM_CC_FAT, GOTERM_MF_FAT;

8of10 | www.pnas.org/cgi/doi/10.1073/pnas.1906275116 Panganiban et al. Downloaded by guest on September 30, 2021 Pathway: BBID, BIOCARTA, KEGG_PATHWAY; and Protein_Domains: INTERPRO, slight modification (Biolegend). Staining with annexin V (4.5 ng/μL) conju- PIR_SUPERFAMILY, SMART) (73). Genes predicted to be targets of top miRNAs gated to either FITC or APC and DAPI (2 μg/mL) was performed in annexin V (fold-change >10) were obtained from TargetScan (74) and used for the binding buffer at a concentration of 0.25–1.0 × 107 cells/mL. Flow cytometry enrichment analysis corresponding to the miRNA CRISPR screen. was performed using the DXP11 Analyzer (Cytek) on 20,000 events and analyzed using FlowJo software. Generation of Individual CRISPR Knockout Cells. To validate top hits from the screen, CRISPR knockout cells for individual genes or miRNAs were generated ChIP. ChIP using anti-L3MBTL2 antibody (PA5-28549, Thermo Fisher Scientific) using specific guides (top two different guides for each gene or miRNA) from the was performed using the ChIP-It Express Enzymatic Kit (Active Motif) pooled library list. Guides were cloned into lentiCRISPRv2 vector containing according to the manufacturer’s protocol. qRT-PCR analysis was performed hSpCas9 cassette (Addgene) as previously described (69). In brief, oligonucleo- to determine enrichment of CHOP promoter regions after immunoprecipi- tides targeting the site sequence were synthesized with 3 bp NGG PAM se- tation with the L3MBTL2 antibody. The percentage input method was used ′ quence flanking the 3 end, annealed, and cloned into the BsmBI-digested to determine relative expression. lentiCRISPRv2 vector. The resulting plasmids were transformed into Stbl3 bac- teria (Life Technologies) and purified using Miniprep Kit (Qiagen). Lentiviruses MiR-124-3 Mimic Transfection. HEK293T cells plated at a density of 1 × 105 cells were produced by cotransfecting the lentiCRISPRv2 containing gRNAs with the per well in 12-well plates were transfected with scramble control (AllStars packaging plasmids pVSVg and psPAX2 (Addgene) in HEK293T cells. Lentiviral Negative Control siRNA, Qiagen) or miR-124-3 mimic (Syn-hsa-mir-124-3p, Qiagen; transduction in CHOP-mCherry cells was performed in the presence of poly- 5 pmol/well) using Lipofectamine RNAiMAX Transfection Reagent (Thermo brene (8 μg/μL) for 24 h. Selection was performed using puromycin (Life Tech- Fisher Scientific). After incubation for 4 h, the medium was replaced for fresh nologies) in a similar manner as described in the CRISPR knockout viral library medium, and cells were incubated for an additional 20 h. Cells were then ex- transduction. The T7E1 assay was performed to determine knockout efficiency. For the T7E1 assay, the genomic region harboring the target of gRNAs was first posed to As for 6 h (for qRT-PCR) or 24 h (for Western blot analysis). Total RNAs PCR-amplified and subjected to denaturing and reannealing temperatures or cell lysates were collected for qRT-PCR and Western blot analysis, respectively. (95°Cfor2min,rampdownat−2°C/sto85°C,rampdownat−0.1°C/sto25°C, ′ ERN1 ′ and stopped at 16 °C). The T7E1 (New England Biolabs) cleavage reaction was Cloning of 3 -UTR of and Luciferase Assay. The 3 -UTR of ERN1 was PCR- then performed at 37 °C for 20 min. The PCR products were visualized using amplified using primers with EcoRI or NotI sites (forward primer: 5′-ATA- 1.5% agarose gel. The gRNA sequences are tabulated in SI Appendix, Table S3. TATGAATTCGCGAGGGCGGCCCCTCTGTTC-3′,reverseprimer:5′-TGCTTA GCGGCCGCAGCCTCTTGTTCCACCGGCCT-3′) and cloned into the pMirTarget qRT-PCR. Total RNA was extracted using RNEasy Kit (Qiagen) and reverse vector (Origene). The cloning was confirmed by restriction enzyme digestion transcribed to cDNA using Oligo-dT and SuperScript II Kit (Life Technologies). (EcoRI and NotI) and direct DNA sequencing. Site mutagenesis on the se- For miRNAs, total RNA was extracted using miRNEasy Kit (Qiagen). Reverse quence of 3′-UTR of ERN1 was performed using the QuikChange Site-Directed transcription and PCR were performed using miScript PCR Starter Kit Mutagenesis Kit (Agilent Technologies) following the manufacturer’s protocol CELL BIOLOGY (Qiagen). qPCR was performed using SYBR green (Qiagen) using specific primers (forward primer: 5′-CAGAGCAGGCAGCTCAATTCACTTGGTTTGGGAAGC-3′,re- for each gene or miRNA. The [delta][delta]Ct method was used to compare verse primer: 5′-GCTTCCCAAACCAAGTGAATTGAGCTGCCTGCTCTG-3′). relative amounts of transcripts between different genes. β-Actin was used as HEK293T cells were transfected with pMirTarget ERN1 3′-UTR or pMir- internal control. RNU6B (RNU6-2) was used as internal control for miRNAs. Target ERN1 3′-UTR mutant in the presence of scramble or miR-124–3 mimic using Lipofectamine 2000 (Thermo Fisher Scientific). pRL CMV control vector Flow Cytometry Assay. Following experimental treatments, cells were har- (1 ng) was cotransfected as an internal control. After a 4-h incubation, the vested at indicated timepoints and resuspended in 300 μL regular medium. medium was replaced with fresh medium, and cells were incubated for 20 h. Flow cytometry was performed using DXP11 analyzer (Cytek) on 20,000 events Luciferase activity was quantified using the Dual-Luciferase Reporter Assay and the mean of the fluorescence on the YeFL2 channel corresponding to System following the manufacturer’s protocol (Promega). Firefly luciferase mCherry fluorescence was determined using FlowJo software. activity by pMirTarget vector was normalized to Renilla luciferase activity.

Western Blotting. Western blotting was performed as previously described Statistical Analysis. Statistical analysis was performed with GraphPad Prizm (22) using the following antibodies: anti-CHOP (mouse mAb, 2895), anti- version 6 (La Jolla, CA). Data were analyzed by Student’s t test, one-way α α IRE1 (rabbit mAb, 3294), anti-XBP1s (rabbit mAb, 12782), anti-eIF1 (rab- analysis of variance (ANOVA), or two-way ANOVA as appropriate. If signif- α bit mAb, 5324), and anti-phosphorylated-eIF2 (rabbit mAb, 3398) from Cell icant effects were detected, the ANOVA was followed by Tukey’s post hoc Signaling; anti-ATF6 (rabbit pAb, TA306287) from Origene; anti-L3MBTL2 comparison of means. A P < 0.05 was considered statistically different. Data –β (rabbit pAb, 39569) was from Active Motif (Carlsbad, CA); and anti -actin were expressed as means ± SEM. (mouse mAb, sc-8432) from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). All antibodies were diluted 1:1,000-fold (exception: β-actin, 1:3,000). For ACKNOWLEDGMENTS. We thank Dr. Hanno Hock (Massachusetts General immunoblot quantitation, chemiluminescence was captured with an Alpha Hospital) for providing us with the plasmids used for establishing MEF Innotech Fluorchem Imager and analyzed with AlphaEaseFC software. overexpressing L3MBTL2 and the corresponding control. This work was sup- ported by National Institutes of Health R01grants (R01ES02230 and Annexin V and DAPI Staining. The annexin V/DAPI staining was used to de- R01ES029097) and in part by a pilot grant from the Harvard National In- termine cell death posttreatment according to manufacturer’s protocol with stitute of Environmental Health Sciences Center (P30ES000002).

1. U. Schubert et al., Rapid degradation of a large fraction of newly synthesized proteins 10. M. Calfon et al., IRE1 couples endoplasmic reticulum load to secretory capacity by by proteasomes. Nature 404, 770–774 (2000). processing the XBP-1 mRNA. Nature 415,92–96 (2002). 2. T. Jacobson et al., Arsenite interferes with protein folding and triggers formation of 11.K.Haze,H.Yoshida,H.Yanagi,T.Yura,K.Mori,Mammaliantranscription protein aggregates in yeast. J. Cell Sci. 125, 5073–5083 (2012). factor ATF6 is synthesized as a transmembrane protein and activated by pro- 3. D. Ramadan, P. C. Rancy, R. P. Nagarkar, J. P. Schneider, C. Thorpe, Arsenic(III) teolysis in response to endoplasmic reticulum stress. Mol. Biol. Cell 10, 3787– species inhibit oxidative protein folding in vitro. Biochemistry 48,424–432 3799 (1999). (2009). 12. M. Ogata et al., Autophagy is activated for cell survival after endoplasmic reticulum 4. T. Marquardt, A. Helenius, Misfolding and aggregation of newly synthesized proteins stress. Mol. Cell. Biol. 26, 9220–9231 (2006). in the endoplasmic reticulum. J. Cell Biol. 117, 505–513 (1992). 13. A. Avivar-Valderas et al., PERK integrates autophagy and oxidative stress responses to 5. S. A. Oakes, F. R. Papa, The role of endoplasmic reticulum stress in human pathology. promote survival during extracellular matrix detachment. Mol. Cell. Biol. 31, 3616– Annu. Rev. Pathol. 10, 173–194 (2015). 3629 (2011). 6. I. Tabas, D. Ron, Integrating the mechanisms of apoptosis induced by endoplasmic 14. B. B. Chandrika et al., Endoplasmic reticulum stress-induced autophagy provides cy- reticulum stress. Nat. Cell Biol. 13, 184–190 (2011). toprotection from chemical hypoxia and oxidant injury and ameliorates renal 7. D. Ron, P. Walter, Signal integration in the endoplasmic reticulum unfolded protein ischemia-reperfusion injury. PLoS One 10, e0140025 (2015). response. Nat. Rev. Mol. Cell Biol. 8, 519–529 (2007). 15. R. Sano, J. C. Reed, ER stress-induced cell death mechanisms. Biochim. Biophys. Acta 8. H. P. Harding, Y. Zhang, D. Ron, Protein translation and folding are coupled by an 1833, 3460–3470 (2013). endoplasmic-reticulum-resident kinase. Nature 397, 271–274 (1999). 16. S. Oyadomari, M. Mori, Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell 9. H. Yoshida, T. Matsui, A. Yamamoto, T. Okada, K. Mori, XBP1 mRNA is induced by Death Differ. 11, 381–389 (2004). ATF6 and spliced by IRE1 in response to ER stress to produce a highly active tran- 17. I. Kim, W. Xu, J. C. Reed, Cell death and endoplasmic reticulum stress: Disease rele- scription factor. Cell 107, 881–891 (2001). vance and therapeutic opportunities. Nat. Rev. Drug Discov. 7, 1013–1030 (2008).

Panganiban et al. PNAS Latest Articles | 9of10 Downloaded by guest on September 30, 2021 18. K. D. McCullough, J. L. Martindale, L. O. Klotz, T. Y. Aw, N. J. Holbrook, Gadd153 44. B. Stielow, F. Finkernagel, T. Stiewe, A. Nist, G. Suske, MGA, L3MBTL2 and sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and per- E2F6 determine genomic binding of the non-canonical Polycomb repressive complex turbing the cellular redox state. Mol. Cell. Biol. 21, 1249–1259 (2001). PRC1.6. PLoS Genet. 14, e1007193 (2018). 19. H. Puthalakath et al., ER stress triggers apoptosis by activating BH3-only protein Bim. 45. S. E. Logue, P. Cleary, S. Saveljeva, A. Samali, New directions in ER stress-induced cell Cell 129, 1337–1349 (2007). death. Apoptosis 18, 537–546 (2013). 20. Z. Galehdar et al., Neuronal apoptosis induced by endoplasmic reticulum stress is 46. M. Maurel, E. Chevet, Endoplasmic reticulum stress signaling: The microRNA con- regulated by ATF4-CHOP-mediated induction of the Bcl-2 homology 3-only member nection. Am. J. Physiol. Cell Physiol. 304, C1117–C1126 (2013). PUMA. J. Neurosci. 30, 16938–16948 (2010). 47. F. Yang et al., Modulation of the unfolded protein response is the core of microRNA- 21. T. Momoi, Caspases involved in ER stress-mediated cell death. J. Chem. Neuroanat. 28, 122-involved sensitivity to chemotherapy in hepatocellular carcinoma. Neoplasia 13, 101–105 (2004). 590–600 (2011). 22. R. S. Oh et al., Functional RNA interference (RNAi) screen identifies system A neutral 48. R. Chhabra, R. Dubey, N. Saini, Gene expression profiling indicate role of ER stress in amino acid transporter 2 (SNAT2) as a mediator of arsenic-induced endoplasmic re- miR-23a∼27a∼24-2 cluster induced apoptosis in HEK293T cells. RNA Biol. 8, 648–664 ticulum stress. J. Biol. Chem. 287, 6025–6034 (2012). (2011). 23. O. Shalem et al., Genome-scale CRISPR-Cas9 knockout screening in human cells. Sci- 49. R. Bartoszewski et al., The unfolded protein response (UPR)-activated transcription ence 343,84–87 (2014). factor X-box-binding protein 1 (XBP1) induces microRNA-346 expression that targets 24. C. Li et al., Unfolded protein response signaling and MAP kinase pathways underlie the human antigen peptide transporter 1 (TAP1) mRNA and governs immune regu- – pathogenesis of arsenic-induced cutaneous inflammation. Cancer Prev. Res. (Phila.) 4, latory genes. J. Biol. Chem. 286, 41862 41870 (2011). α 2101–2109 (2011). 50. A. G. Lerner et al., IRE1 induces thioredoxin-interacting protein to activate the 25. A. M. Bolt, F. Zhao, S. Pacheco, W. T. Klimecki, Arsenite-induced autophagy is asso- NLRP3 inflammasome and promote programmed cell death under irremediable ER – ciated with proteotoxicity in human lymphoblastoid cells. Toxicol. Appl. Pharmacol. stress. Cell Metab. 16, 250 264 (2012). α 264, 255–261 (2012). 51. J. P. Upton et al., IRE1 cleaves select microRNAs during ER stress to derepress – 26. M. Argos et al., Arsenic exposure from drinking water, and all-cause and chronic- translation of proapoptotic Caspase-2. Science 338, 818 822 (2012). disease mortalities in Bangladesh (HEALS): A prospective cohort study. Lancet 376, 52. M. Maurel, N. Dejeans, S. Taouji, E. Chevet, C. F. Grosset, MicroRNA-1291-mediated α – 252–258 (2010). silencing of IRE1 enhances Glypican-3 expression. RNA 19, 778 788 (2013). 27. M. M. Wu, T. L. Kuo, Y. H. Hwang, C. J. Chen, Dose-response relation between arsenic 53. C. Xu, B. Bailly-Maitre, J. C. Reed, Endoplasmic reticulum stress: Cell life and death – concentration in well water and mortality from cancers and vascular diseases. Am. J. decisions. J. Clin. Invest. 115, 2656 2664 (2005). 54. S. G. Fonseca, J. Gromada, F. Urano, Endoplasmic reticulum stress and pancreatic β-cell Epidemiol. 130, 1123–1132 (1989). death. Trends Endocrinol. Metab. 22, 266–274 (2011). 28. S. J. Donohue, P. H. Roseboom, H. Illnerova, J. L. Weller, D. C. Klein, Human 55. B. Adamson et al., A multiplexed single-cell CRISPR screening platform enables sys- hydroxyindole-O-methyltransferase: Presence of LINE-1 fragment in a cDNA clone tematic dissection of the unfolded protein response. Cell 167, 1867–1882.e21 (2016). and pineal mRNA. DNA Cell Biol. 12, 715–727 (1993). 56. P. T. Cherian et al., Increased circulation and adipose tissue levels of DNAJC27/RBJ in 29. Y. Yao et al., Identification and comparative functional characterization of a new obesity and type 2-diabetes. Front. Endocrinol. (Lausanne) 9, 423 (2018). human riboflavin transporter hRFT3 expressed in the brain. J. Nutr. 140, 1220–1226 57. G. Kappé et al., The human genome encodes 10 alpha-crystallin-related small heat (2010). shock proteins: HspB1-10. Cell Stress Chaperones 8,53–61 (2003). 30. L. He, K. Vasiliou, D. W. Nebert, Analysis and update of the human solute carrier (SLC) 58. B. W. Chu et al., The E3 ubiquitin ligase UBE3C enhances proteasome processivity by gene superfamily. Hum. Genomics 3, 195–206 (2009). ubiquitinating partially proteolyzed substrates. J. Biol. Chem. 288, 34575–34587 31. J. Qin et al., The polycomb group protein L3mbtl2 assembles an atypical PRC1-family (2013). complex that is essential in pluripotent stem cells and early development. Cell Stem 59. A. Braganza et al., UBE3B is a calmodulin-regulated, mitochondrion-associated Cell 11, 319–332 (2012). E3 ubiquitin ligase. J. Biol. Chem. 292, 2470–2484 (2017). 32. K. C. Manthey, Y. C. Chew, J. Zempleni, Riboflavin deficiency impairs oxidative folding 60. P. Vourc’h, C. Andres, Oligodendrocyte myelin glycoprotein (OMgp): Evolution, and secretion of apolipoprotein B-100 in HepG2 cells, triggering stress response sys- structure and function. Brain Res. Brain Res. Rev. 45, 115–124 (2004). tems. J. Nutr. 135, 978–982 (2005). 61. C. Töpert et al., Kir2.4: A novel K+ inward rectifier channel associated with moto- 33. K. C. Manthey, R. Rodriguez-Melendez, J. T. Hoi, J. Zempleni, Riboflavin deficiency neurons of cranial nerve nuclei. J. Neurosci. 18, 4096–4105 (1998). causes protein and DNA damage in HepG2 cells, triggering arrest in G1 phase of the 62. F. St-Gelais, C. Jomphe, L. E. Trudeau, The role of neurotensin in central nervous cell cycle. J. Nutr. Biochem. 17, 250–256 (2006). system pathophysiology: What is the evidence? J. Psychiatry Neurosci. 31, 229–245 34. I. Vermes, C. Haanen, H. Steffens-Nakken, C. Reutelingsperger, A novel assay for (2006). apoptosis. Flow cytometric detection of phosphatidylserine expression on early ap- 63. X. Qu et al., Identification, characterization, and functional study of the two novel – optotic cells using fluorescein labelled Annexin V. J. Immunol. Methods 184,3951 human members of the semaphorin gene family. J. Biol. Chem. 277, 35574–35585 (1995). (2002). 35. S. D. Der, Y. L. Yang, C. Weissmann, B. R. Williams, A double-stranded RNA-activated 64. Y. Sun, Z. M. Luo, X. M. Guo, D. F. Su, X. Liu, An updated role of microRNA-124 in protein kinase-dependent pathway mediating stress-induced apoptosis. Proc. Natl. central nervous system disorders: A review. Front. Cell. Neurosci. 9, 193 (2015). – Acad. Sci. U.S.A. 94, 3279 3283 (1997). 65. T. Nakamura et al., Double-stranded RNA-dependent protein kinase links pathogen 36. L. Morey, K. Helin, Polycomb group protein-mediated repression of transcription. sensing with stress and metabolic homeostasis. Cell 140, 338–348 (2010). – Trends Biochem. Sci. 35, 323 332 (2010). 66. H. Tsukano et al., The endoplasmic reticulum stress-C/EBP homologous protein 37. P. Trojer et al., L3MBTL2 protein acts in concert with PcG protein-mediated mono- pathway-mediated apoptosis in macrophages contributes to the instability of ath- – ubiquitination of H2A to establish a repressive chromatin structure. Mol. Cell 42, 438 erosclerotic plaques. Arterioscler. Thromb. Vasc. Biol. 30, 1925–1932 (2010). 450 (2011). 67. M. T. Lo et al., Genome-wide analyses for personality traits identify six genomic loci 38. J. Y. Yoo et al., Histone deacetylase 3 is selectively involved in L3MBTL2-mediated and show correlations with psychiatric disorders. Nat. Genet. 49, 152–156 (2017). transcriptional repression. FEBS Lett. 584, 2225–2230 (2010). 68. Schizophrenia Working Group of the Psychiatric Genomics Consortium, Biological 39. H. Zinszner et al., CHOP is implicated in programmed cell death in response to im- insights from 108 schizophrenia-associated genetic loci. Nature 511, 421–427 (2014). paired function of the endoplasmic reticulum. Genes Dev. 12, 982–995 (1998). 69. N. E. Sanjana, O. Shalem, F. Zhang, Improved vectors and genome-wide libraries for 40. C. F. Calkhoven, G. Ab, Multiple steps in the regulation of transcription-factor level CRISPR screening. Nat. Methods 11, 783–784 (2014). and activity. Biochem. J. 317, 329–342 (1996). 70. E. Aronesty, Comparison of sequencing utility programs. Open Bioinf. J. 7,1–8 (2013). 41. T. Okada, H. Yoshida, R. Akazawa, M. Negishi, K. Mori, Distinct roles of activating 71. B. Langmead, S. L. Salzberg, Fast gapped-read alignment with Bowtie 2. Nat. Methods transcription factor 6 (ATF6) and double-stranded RNA-activated protein kinase-like 9, 357–359 (2012). endoplasmic reticulum kinase (PERK) in transcription during the mammalian un- 72. H. Li et al.; 1000 Genome Project Data Processing Subgroup, The sequence alignment/ folded protein response. Biochem. J. 366, 585–594 (2002). map format and SAMtools. Bioinformatics 25, 2078–2079 (2009). 42. D. Ron, J. F. Habener, CHOP, a novel developmentally regulated nuclear protein that 73. W. Huang, B. T. Sherman, R. A. Lempicki, Systematic and integrative analysis of large dimerizes with transcription factors C/EBP and LAP and functions as a dominant- gene lists using DAVID bioinformatics resources. Nat. Protoc. 4,44–57 (2009). negative inhibitor of gene transcription. Genes Dev. 6, 439–453 (1992). 74. B. P. Lewis, C. B. Burge, D. P. Bartel, Conserved seed pairing, often flanked by 43. C. Stielow et al., SUMOylation of the polycomb group protein L3MBTL2 facilitates adenosines, indicates that thousands of human genes are microRNA targets. Cell 120, repression of its target genes. Nucleic Acids Res. 42, 3044–3058 (2014). 15–20 (2005).

10 of 10 | www.pnas.org/cgi/doi/10.1073/pnas.1906275116 Panganiban et al. Downloaded by guest on September 30, 2021