Russian Journal of Nematology, 2017, 25 (1), 1 – 16

Intra-species variability of brevicolle Lordello & Costa, 1961 (Nematoda: ) from China Eda Marie Barsalote1, Zhongling Tian1 and Jingwu Zheng1, 2

1Laboratory of Plant Nematology, Institute of Biotechnology, College of Agriculture & Biotechnology, Zhejiang University, 310058, Hangzhou, China 2Ministry of Agriculture Key Lab of Molecular Biology of Crop Pathogens and Insects, 310058, Hangzhou, China e-mail: [email protected]

Accepted for publication 6 March 2017

Summary. During a survey of longidorids from natural vegetation in China, eight populations of Xiphinema brevicolle Lordello & Costa, 1961 were detected. Metric characters derived from females showed no significant difference among populations. Morphological characters are markedly similar in body length (1.8-2.2 mm), odontostyle (89-92 µm), lip width (10-12 µm), c’ ratio (0.8-1.1 µm) and position of vulva (49-51%). The 18S, 28S rDNA and cytochrome oxidase I (COI) region of the mitochondrial DNA were sequenced for the eight populations sampled from different localities. Phylogenetic relationships using 18S region suggest 98% similar identity to X. brevicolle (Japan), X. diffusum (China), X. taylori (Slovakia), X. incognitum (China), X. lambertii and X. inequali (Czech Republic). The 28S rDNA sequences are identical to X. brevicolle (Japan and Brazil) with 98% clade support. By contrast, mitochondrial COI analysis does not show heterogeneity between populations. COI sequence divergence of 6.09-6.95% between the studied populations is believed to be merely intraspecific variants of a single species; thus, the populations are considered to be conspecific. A combined morphological and molecular investigation was undertaken to emphasise the taxonomic standing of X. brevicolle from Asia. Key words: 18S, 28S rDNA, mitochondrial COI gene, molecular diagnosis, morphology, variation.

Dagger of the genus Xiphinema are & Halbrendt, 1997). It is evident that Xiphinema ectoparasitic migratory nematodes that are world- americanum-group is composed of numerous wide in distribution (Weischer & Brown, 2000). species whose accurate naming remains ambiguous This genus comprises 234 valid species (Coomans (Luc et al., 1998). This is best illustrated in the case et al., 2001), which includes the Xiphinema of Xiphinema brevicolle Lordello & Costa, 1961, americanum-group that are widely distributed which has several junior synonyms (Coomans et al., around America, Europe and Asia (Halbrendt & 2001). Luc et al. (1998) suggested that X. diffusum Brown, 1992; Barsi & Lamberti, 2002) and was a junior synonym of X. brevicolle but later considered the putative vector of four Oliveira et al. (2005) re-established X. diffusum as a Nepoviruses (Brown et al., 1995; Taylor & valid species on the basis of molecular Brown, 1997). identification. Meanwhile, the taxonomic status of The Xiphinema americanum-group is a complex X. brevicolle occurring in European countries was group comprising 55 taxa (Gutiérrez-Gutiérrez et later separated as a new valid species, X. taylori al., 2012) in which nominal species have not yet (Lamberti et al., 1991), but others disagree and been satisfactorily resolved taxonomically due to continued to include the two species as junior controversies about species definition and synonyms of X. brevicolle. delineation. For example, Luc et al. (1998) listed 34 Lamberti et al. (1991) considered that X. putative species of the X. americanum-group, brevicolle was restricted to Brazil, but it is probably Coomans et al. (2001) reported 38 species, whilst in neighbouring Latin American countries like Barsi & Lamberti (2004) reported 50 putative Venezuela (Crozzoli et al., 1998) and Belize (Bridge species. These differences of species identification et al., 1996) and there are reports of the species are due to dissimilar insights of experts, some of occurring in Kenya (Coomans & Heyns, 1997), whom are able to delineate species using only minor Bulgaria (Peneva & Choleva, 1992), Russia morphometrical or morphological variations (Brown (Romanenko, 1981), Slovakia (Lisková, 1995) and

1 E.M. Barsalote et al.

Fig. 1. Comparisons of diagnostic characters of Xiphinema brevicolle from China andd topotype population from Brazil, Taiwan and Japan. Table 1. Isolates, host, origin and corresponding sequence code of Xiphinema brevicolle populations from China.

Sequence ID Species Code Location Host 18S D2-D3 cox1 mt Xiphinema brevicolle HZ-02 Zijingang, Hangzzhhou, CN Maple KY011962 KY011955 KY011949 Xiphinema brevicolle HZ-03 Botanic Garden, Hangzhou, CN Oleander KY011969 KY011959 KY011946 Xiphinema brevicolle HZ-06 Xixi Wetland, Hangzhou, CN Rubber tree KY011967 KY011958 KY011947 Xiphinema brevicolle WZ-02 Wenzhou, Zhejiang, CN Hoop pine KY011964 KY011961 KY011948 Xiphinema brevicolle SX-03 Shanxi, CN Locust tree KY011968 KY011957 KY011950 Xiphinema brevicolle SHD-02 Shandong, CN Chinese plum KY011966 KY011956 KY011952 Xiphinema brevicolle AH-08 Anhui, CN Loquat KY011963 KY011960 KY011953 Xiphinema brevicolle BJ-07 Beijing, CN Chinese pine KY011965 KY011954 KY011951

China (Xu et al., 1995); detailed confirmatory 200 g was washed using the decanting and sieving identifications are needed. technique (Brown & Boag, 1988). Soil extracts were This study aimed to conduct morphologicall and allowed set aside for 24 h and suspensions molecular characterisations of populations of X. were collected the followinng day. Adult nematodes brevicolle from China and provide a DNA based were handpicked and mounted in distilled water on phylogeny using rDNA and mitochondrial COI ggene a temporary slide and heat killed for morphological (COI) sequences to provide a more robust examination and measurements of diagnostic framework to understand the similarities and/or characters. Photographs weere taken using a digital differences of X. brevicolle populations in China. camera (Leica DM5000B) and morphological measurements were obtaiined using specialised MATERIALS AND METHODS software (LAS; Leica Cammera AG). Morphometric values are given in µm unless noted otherwise. Nematode isolation and examination. Soil core DNA extraction. A single adult nematode was samples were collected beneath perennial trees handpicked and placed in a glass slide with 13 µl growing under natural vegetation in China (Table distilled H2O. The nematode was cut into fragments 1). The samples were mixed, and a sub sample of using a sterilised needle and fragmented pieces were

2 Xiphinema brevicolle variability in China pipetted up to 10 µl and transferred to an Eppendorf a BIO-RAD S1000 thermal cycler with the tube; 8 µl Mg+ free buffer and 2 µl proteinase K (600 following cycling conditions for nematode rRNA µg ml–1) were added to make a total volume of 20 µl. gene: one cycle of 94°C for 2 min, followed by 35 The Eppendorf tube was briefly centrrifuged for 2 min cycles of 94°C for 30 s, annealing temperature of at 15,520 g (Ye et al., 2004). The PCR tube was 57°C for 45 s, extension of 72°C for 3 min and a frozen at –70°C overnight and then incubated at 65°C final extension of 72°C for 10 min. PCR products for 1 h and 95°C for 15 min. The final DNA extract were analysed by electrophoresis on agarose gel was cooled down at 8°C and stored at –20°C until (100 V, 400 mA, 30 min) and visualisation was use. made by staining with DuRed 10,000x and observed PCR and sequencing. PCR amplification and under UV illumination. relevant thermal conditions of 18S, D2-D3 region DNA purification was done as described in the and mtDNA cytochrome oxidase I were all as Nucleic Acid Purification kit of AXYGEN and described by Sakai et al. (2011). PCR were carried sequencing was made by SAANGON Biotechnology out using different primers depending on the target Co., Shanghai, China. Sequences were BLAST and genes (Table 2). PCR mixes of 14.2 µl ddH2O, 2.5 aligned by Clustal_W program with default µl LA bufffeer, 2 µl dNTP, 1.5 µl each primers, 3 µl parameters (Thompson et al., 1994). Phylogenetic DNA template and 0.3 LA Taq were prepared to a analysis and model selectioon were performed using total volume of 25 µl. All PCR reactions were run in MEGA 5 (Tamura et al., 2011). The ML tree was

Fig. 2. Xiiphinema brevicolle juvenile stages. A-D: J1-J4 anterior region; E-H: J1-J4 tail region.

3 E.M. Barsalote et al.

Table 2. Primers used to amplify SSU, D2-D3 and cox1 mtDNA of Xiphinema brevicolle populations from China.

Region Primers Direction Sequence (5’-3’) Reference

18S 988F forward CTCAAAGATTAAGCCATGC Holterman et. al., 2006

18S 1912R reverse TTTACGGTCAGAACTAGGG Holterman et. al., 2006

D2-D3 D2A forward ACAAGTACCGTGAGGGAAAGTTG De Ley et al., 1999 D2-D3 D3B reverse TCGGAAGGAACCAGCTACTA De Ley et al., 1999 cox1 COIF forward GATTTTTTTGGKCATCCWGARG He et al., 2005

cox1 COIR reverse CWACATAATAAGTATCATG He et al., 2005

constructed using multiple aligned sequences of the populations reported by Lamberti et al. (1991), Luc COI region, where Hasegawa-Kishino-Yano model et al. (1998), Chen et al. (2005), Kumari et al. (Hasegawa et al., 1985) and heuristic search with (2010) and Sakai et al. (2011) (Table 4). Metric Close-Neighbor-Interchange (CNI) were employed characters of body lengtth, odontostyle length, with bootstraps value of 1000 replications. diameter of lip, guiding ring position from oral RESULTS aperture and tail length were close to previously Xiphinema brevicolle Lordello & Costa, 1961 described X. brevicolle populations. The adult females of X. brevicolle iin China coincides and (Figs 1-7, Tables 3 & 4) comes closest to populations described from Taiwan Remarks. The diagnostic characters of the (Zhao, 2013) and Japan (Sakai et al., 2012) (Fig. 1). population studied generally agree with the original Morphometrics of four juvenile stages were similar description of Lordello & Costa, 1961 and topotype in all obtained populations (Table 3), while general

Fig. 3. Xiphinema brevicolle. A-D: development and position of replacement odontostyle of J1, J2, J3 and J4, respectively; E-H: adult habitus.

4 Xiphinema brevicolle variability in China

Fig. 4. Photomicrographs of anterior region of Xiphinema brevicolle females. A-C: Hangzhou populations (HZ-02, HZ-03, HZ06); D: Wenzhou (WZ-01); E: Shanxi (SX-03); F: Shandong (SHD-02); G: Anhuii (AH-08); H: Beijing.

5 E.M. Barsalote et al.

Table 3. Morphometric of juvenile stages of Xiphinnema brevicolle populations from China ((all measurements in µm), mean ± standard deviation.

Characters J1 J2 J3 J4

N 3 4 4 7

L 650±18 (642-668) 860±30 (830-890) 1200±30.2 (1180-12300) 1300±89.6 (1282-1395) a 28.8±2.2 (26.3-30.4) 31.9±0.5 (31.3-32.4) 36.1±1.7 (35.2-38.7) 40±2.8 (36.9-42.8) b 3.8±0.7 (3.4-4.6) 4.1±0.3 (3.9-4.4) 4.9±0.7 (4.3-5.5) 4.8±0.6 (4.2-5.8) c 19.2±2 (16.8-20.5) 24.7±0.2 (24.6-24.8) 33.5±0.9 (32.6-34.8) 41.4±1.6 (39.9-43.5) c’ 2.2±0.2 (2-2.5) 1.9±0.17 (1.8-2.2) 1.7±0.03 (1.62-1.69) 1.4±0.04 (1.4-1.5) Odontostyle 42.8±0.5 (42.4-43.4) 48.6±1.1 (47.5-49.7) 61.2±2.5 (58.6-63.8) 72.8±2.8 (70.5-77.1) Odontophore 32.8±4.5 (29.8-38) 34.6±3.1 (31.1-37.2) 40.8±2.3 (38.6-43.9) 43.9±1.6 (41.1-45.1) Replacement odontostyle 46.5±2.8 (44.4-49.6) 59.4±1.4 (58.1-61) 72.6±4.5 (67.3-77.6) 86.8±1.9 (84.2-89) Tail length 34.4±3.8 (32.2-38.8) 34.6±1.4 (33.7-36.2) 34.4±1.9 (32.8-37) 32.2±0.7 (31.2-33.1) Lip width 8.8±0.06 (8.8-8.9) 9.9±0.5 (9.5-10.4) 10.7±0.2 (10.5-11.1) 11±0.5 (10.8-11.9) Width at anus 15.4±29.4 (14-16.3) 17.8±0.8 (17.1-18.7) 20.7±1.4 (19.7-22.8) 23.2±0.6 (21.9-23.9) Width at base of pharynx 22.8±1.8 (21.5-24.9) 26.9±0.9 (26.1-27.8) 31.9±2.4 (29.4-34.8) 33.6±3.9 (29.8-38.4)

Fig. 5. Photomicrographs of posterior region of Xiphinema brevicolle females. A-C: Hanngzhou populations (HZ-02, HZ-03, HZ06); D: Wenzhou (WZ-01); E: Shanxi (SX-03); F: Shandong (SHD-02); G: Anhui (AH-08); H: Beijing (BJ- 07).

6 Xiphinema brevicolle variability in China

et , 2013 2013 , Ilex tree) 50.5) 50.5) 66.9) 66.9) (40.5- (55.3- Japan Japan 41±3.2 41±3.2 (Yacca (25-32) (25-32) 6.6±0.7 6.6±0.7 crenata Zhao Zhao (1.8-2.0) (6.1-7.4) al. 27.3±2.0 27.3±2.0 1.9±0.11 1.9±0.11 60.9±5.8

, ne) Vitis Vitis 95.3) 95.3) 49.1) 49.1) 2010 2010 et al. (74.8- (41.3- Czech (21-28) (21-28) vinifera 25±1.78 25±1.78 2.1±128 2.1±128 (1.8-2.2) Kumari (5.9-7.7) (grapevi 6.8±0.51 6.8±0.51 Republic 84.2±5.73 84.2±5.73 45.7±3.81

, Topotypes

– 27 27 68 68 45 45 1.8 1.8 nax New (Five 2009 2009 Shah et.al. (25-30) (25-30) (58-77) (58-77) (41-48) (41-48) fingers) (1.7-1.9) Zealand Zealand

arboreus Pseudopa

et , al. (5-7) 6±0.5 6±0.5 2005 2005 25±2.0 25±2.0 (20-27) (20-27) (67-89) (67-89) (42-52) (42-52) 1.8±0.1 1.8±0.1 longana longana (1.5-2.1) 76.9±6.5 76.9±6.5 46.5±2.9 46.5±2.9 Chen Euphoria (Longan)

32.1) 32.1) 50.1) 50.1) (24.1- (40.7- Coffea

1961) 2.1±0.1 2.1±0.1 6.4±0.6 6.4±0.6 arabica arabica (Coffee) (1.8-2.2) (5.6-7.7) 26.8±2.0 26.8±2.0 44.5±2.3 44.5±2.3 77.8±0.6 77.8±0.6 (60.3-94) (60.3-94) & Costa, Holotype (Lordello

China and topotype populations from females sp. (4-7) pine) 42±4.3 42±4.3 61±1.7 61±1.7 (60-63) (60-63) 5.3±0.8 5.3±0.8 (1.8-2.0) 25.3±2.2 25.3±2.2 (Chinese (21.7-27) (21.7-27) (39.7-48) (39.7-48) Pinus 1.9±0.080 1.9±0.080

a 27.5) 27.5)

61.2) (23.3- (43.1- Anhui Beijing Brazil Taiwan Taiwan Anhui Beijing Brazil (4.8-6) (61-64) (61-64) 5.9±1.1 5.9±1.1 (1.8-2.1) 26.1±1.9 26.1±1.9 1.9±0.17 1.9±0.17 51.5±5.8 51.5±5.8 62.4±2.1 62.4±2.1 japonica japonica (Loquat) Eriobotry

g (5-7) 34.1) 34.1) Xiphinema brevicolle (26.4- mume plum) 61±2.0 61±2.0 (60-64) (60-64) Prunus 5.5±1.3 29.1±2.5 29.1±2.5 1.9±0.12 1.9±0.12 47.3±4.9 47.3±4.9 (Chinese (1.8+2.2) (40.8-57) (40.8-57) Shandon

China tree) (5-6) 28.9) 28.9) 44.2) 44.2) (27.6- (42.9- (60-64) (60-64) 5.1±0.1 5.1±0.1 (Locust 28.3±0.9 28.3±0.9 43.5±0.9 43.5±0.9 60.9±3.1 60.9±3.1 Gleditsia tricantho s (1.89-2.2) (1.89-2.2) 1.9±0.075

a Present study amii 30.5) 30.5) 42.3) 42.3) pine) (27.3- (32.0- (Hoop (Hoop (4.8-6) (60-63) (60-63) (1.7-1.9) 1.8±0.12 1.8±0.12 35.4±4.7 35.4±4.7 5.33±0.6 5.33±0.6 61.1±2.1 61.1±2.1 Araucari cunningh 28.9±1.03 28.9±1.03 Wenzhou Shanxi brevicolle, Xiphinema

a u tree) (5-6) 38±5.9 38±5.9 (60-65) (60-65) 5.4±1.6 (1.7-2.0) 29.2±3.5 29.2±3.5 1.9±0.16 1.9±0.16 62.3±2.5 62.3±2.5 (Rubber ulmoides (27.2-30) (27.2-30) (32.2-43) (32.2-43) Hangzho Eucommi

u Acer (5-6) olium 28±3.1 28±3.1 (27-34) (27-34) (41-48) (41-48) (60-64) (60-64) 5.5±2.2 5.5±2.2 (Maple) 1.9±0.28 1.9±0.28 43.9±4.6 43.9±4.6 63.5±2.9 63.5±2.9 coriaceif Hangzho (1.8-1.92)

u r)

(5-6) 29±3.3 29±3.3 (27-31) (27-31) (39-46) (39-46) (60-63) (60-63) 5.4±1.9 5.4±1.9 Nerium indicum (1.8-2.1) 1.8±0.57 1.8±0.57 40.8±7.9 40.8±7.9 61.2±1.6 61.2±1.6 Hangzho (Oleande

of measurements . Comparisons of morphometric

a Tail length N L (mm) 25 17 16 13 17 12 14 19 17 12 7 25 22 Table 4 origins. different from Populations Hosts Locality b

c

7 E.M. Barsalote et al.

146) 90.6) 90.6) 53.6) 53.6) 56.7) 56.7) (141- (86.7- (50.3- (50.8- 42±2.0 42±2.0 27±1.6 27±1.6 (38-46) (38-46) (24-30) (24-30) (12-13) (12-13) (67-83) (67-83) (29-32) (29-32) (35-40) (35-40) 1.0±0.1 1.0±0.1 142±2.7 142±2.7 (0.9-1.1) 89.2±2.2 89.2±2.2 50.5±0.2 50.5±0.2 53.9±2.7 53.9±2.7 12.5±0.4 12.5±0.4 76.5±3.8 76.5±3.8 30.4±0.8 30.4±0.8 37.9±1.2

149) 149) 0.88) 0.88) (140- 50±1.0 50±1.0 (40-50) (40-50) (85-92) (85-92) (27-32) (27-32) (48-51) (48-51) (54-62) (54-62) (11-14) (11-14) (75-80) (75-80) (30-32) (30-32) (47-52) (47-52) 0 (0.66- 45±4.11 45±4.11 88±2.09 88±2.09 29±2.16 29±2.16 57±2.66 57±2.66 12±0.87 12±0.87 79±2.07 79±2.07 31±0.82 31±0.82 49±1.92 49±1.92

0.77±0.1 145±3.02 145±3.02

– 90 90 52 52 50 50 75 75 0.9 0.9 142 (49-55) (49-55) (44-54) (44-54) (70-80) (70-80) 135-155 135-155 (84-100) (84-100) (0.7-1.0)

– – – – – 163) 163) (50-56) (50-56) 25±1.0 25±1.0 (22-28) (22-28) (53-62) (53-62) 45 (151- (92-103) (92-103) (0.9-1.1) 157.3±3. 98.2±3.3 98.2±3.3 59.2±1.7 59.2±1.7 0.96±.06 0.96±.06 53.6±1.3

108) 108) 29.4) 29.4) 12.3) 12.3) 92.3) 92.3) 31.8) 31.8) 45.3) (21.8- (10.6- (72.3- (27.1- (35.3- 168.3) 168.3) 57±2.9 57±2.9 53±0.9 53±0.9 (51-54) (51-54) .1 (156- .1 2 (84.7- (0.9-1.1) 46.6±3.4 46.6±3.4 26.6±1.7 26.6±1.7 101.9±7. 11.5±0.5 11.5±0.5 86.3±5.6 86.3±5.6 1.0±0.06 1.0±0.06 29.8±1.5 29.8±1.5 39.4±2.9 39.4±2.9 (39.4-50) (39.4-50) (48.8-60) (48.8-60) 158.9±10

148) 148) 55.1) 55.1) 52.4) 52.4) 95.1) 95.1) 12.6) 12.6) 38.1) 38.1) 55.8) 55.8) 1±0.1 1±0.1 (48.8- (48.9- (88.8- (10.4- (31.2- (41.7- 50±1.5 50±1.5 77±3.0 77±3.0 (0.9-1.1) 143.6±5. 49.1±1.2 49.1±1.2 26.6±2.8 26.6±2.8 51.8±2.5 51.8±2.5 91.1±3.5 91.1±3.5 11.4±0.7 11.4±0.7 32.6±5.1 32.6±5.1 49.7±5.6 0 (140.2- (44-54.7) (44-54.7) (25.6-30) (25.6-30) (73-81.3) (73-81.3)

150) 150) 51.4) 51.4) 29.3) 29.3) 58.4) 58.4) 11.6) 11.6) 36.9) 36.9) 50.8) (40.1- (24.7- (51.8- (10.8- (28.1- (39.1- 49±1.1 49±1.1 31±4.1 31±4.1 3 (137- (88-94) (88-94) 1.1±0.1 1.1±0.1 (1.0-1.2) 45.9±5.7 45.9±5.7 144.2±6. 54.4±2.5 54.4±2.5 89.8±5.2 89.8±5.2 11.3±0.3 11.3±0.3 75.1±4.2 75.1±4.2 47.1±2.7 47.1±2.7 27.4±1.8 27.4±1.8 (47-53.1) (47-53.1) (66-79.8)

145) 145) 54.3) 54.3) 50.8) 50.8) 91.4) 91.4) 12.1) 12.1) 79.2) 79.2) 30.9) 30.9) 51.7) 51.7) 29.6) 29.6) (47.9- (47.6- (88.1- (10.1- (69.5- (27.9- (46.5- (25.3- (1-1.2) 90±1.9 90±1.9 6 (137- 1.1±0.1 1.1±0.1 45.1±1.0 45.1±1.0 140.8±4. 50.8±2.1 50.8±2.1 49.7±1.0 49.7±1.0 11.3±0.8 11.3±0.8 75.9±3.2 75.9±3.2 29.8±1.0 29.8±1.0 49.5±0.9 49.5±0.9 27.7±1.5 (40-46.3) (40-46.3)

147) 147) 48.8) 48.8) 56.3) 56.3) 12.5) 12.5) 78.3) 78.3) 34.1) 34.1) 49.6) (46.3- (55.1- (11.4- (75.3- (30.1- (41.6- 3 (139- (26-31) (26-31) 0.9±0.1 0.9±0.1 (0.9-1.1) 47.1±1.1 47.1±1.1 55.7±0.8 55.7±0.8 12.0±0.8 12.0±0.8 145.9±1. 49.9±2.2 49.9±2.2 90.2±5.7 90.2±5.7 76.8±2.1 76.8±2.1 32.1±2.8 32.1±2.8 46.3±1.8 46.3±1.8 30.8±0.8 30.8±0.8 (48-50.6) (48-50.6) (87.6-96)

52) 52) 143) 143) 54.7) 54.7) 12.6) 12.6) 53.5) 53.5) 91.5) 91.5) 83.8) 83.8) 30.1) 30.1) (10.8- (49.1- (87.9- (51.3- (73.9- (29-32) (29-32) 1.1±0.1 1.1±0.1 6 (44.1- 0 (25.7- (0.8-1.1) 49.6±2.5 49.6±2.5 11.9±0.8 11.9±0.8 141.7±2. 50.1±0.8 50.1±0.8 89.3±1.3 89.3±1.3 52.4±1.6 52.4±1.6 80.2±3.5 80.2±3.5 31.6±4.9 31.6±4.9 49.52±5. 28.31±2. mm): mean ± standard deviation (range). 7 (138.5-

(44.6-52)

149) 90±2.1 90±2.1 6 (139- (41-52) (41-52) (49-52) (49-52) (89-91) (89-91) (46-56) (46-56) (72-75) (72-75) (24-31) (24-31) (11-13) (11-13) (39-51) (39-51) (26-30) (26-30) 0.8±0.7 0.8±0.7 75±0.01 75±0.01 (0.8-1.1) 49.5±1.7 49.5±1.7 50.1±1.8 50.1±1.8 53.2±3.2 53.2±3.2 143.2±4. 30.4±0.9 30.4±0.9 12.1±1.4 12.1±1.4 49.8±1.4 49.8±1.4 27.6±2.7

148) 148) 89±1.6 89±1.6 6 (137- (41-51) (41-51) (50-58) (50-58) (75-80) (75-80) (87-91) (87-91) (28-35) (28-35) (10-12) (10-12) (43-53) (43-53) (26-35) (26-35) 0.8±0.6 0.8±0.6 (0.8-1.2) 47.1±3.3 47.1±3.3 53.1±3.6 53.1±3.6 78.9±2.8 78.9±2.8 30.3±4.2 30.3±4.2 142.1±5. 11.5±1.5 11.5±1.5 48.8±3.2 48.8±3.2 30.0±4.8

146) (1-1.2) 5 (137- (45-51) (45-51) (47-55) (47-55) (69-75) (69-75) (49-52) (49-52) (86-90) (86-90) (47-53) (47-53) (27-31) (27-31) 1.1±0.7 1.1±0.7 49.1±1.2 49.1±1.2 51.1±6.1 51.1±6.1 74.3±1.9 74.3±1.9 50.1±2.1 50.1±2.1 89.6±1.4 89.6±1.4 29.4±2.4 29.4±2.4 140.7±4. 11.2±0.6 49.6±4.2 49.6±4.2 29.1±2.7 29.1±2.7 (28.7-32) (28.7-32) (10-11.8)

Width at vulva Table 4. (continued). c’ in µm (except L Note: Measurements Odontopho re Guide ring anterior to V Odontostyl e Width at guide ring Total stylet Lip width Width at pharynx Width at anus

8 Xiphinema brevicolle variability in China

Fig. 6. Morphology of odontophore flange of Xipiphinema brevicolle females. A-C: Hangzhou populations (HZ-02, HZ-03, HZ06); D: Wenzhou (WZ-01); E: Shanxi (SX-03); F: Shandong (SHD-02); G: Anhuii (AH-08); H: Beijing. morphology between developmental stages diiffers (10-12 µm). Anterior region rounded and slightly in tail appearing elongate conical in J1 and becomes expanded (Fig. 4) separated from the rest of the short rounded conoid when reaching to adult (Fig. body by a shallow depression, basal bulb tubular 2). Additionally, the position of the replacement and reproductive system amphidelphic. Tail shape odontostyle is embedded in the wall of odontophore appears consistently conical to rounded with a in J1 with its length more or equal to the functional slightly curve tail terminus (Fig. 5). odontostyle of succeeding stage (Fig. 3A-D). Minor Ribosomal products of 18S and 28S region overlap in the range of morphometric among indicated a fragment length of approximately 1330- populations were not considered significant, thus 1501 bp and 790-832 bp, resspectively. The obtained suggesting that specimens examined belong to the amplicons of the 18S region (KY011962- same group; this is supported by the phylogenetic KY011969) were sequencee in both directions and DNA information. showed 99% sequence similarity to X. brevicolle The X. brevicolle population from China showed populations reported from Japan (AB604340, similar metric characters in body length of 1.8-2.2 AB604341), China (KP793045, KP793044 and µm, tail conoid (25-29 µm) with rounded terminus KP793043) and several relaated species, X. diffusum, (Fig. 5), odontostyle (89-92 µm) long with furcate X. incognitum, X. taylori,, X. lamberti and X. base and well-developed odontophore flange (Fig. inequale. Partial 28S rDNA (KY011954 - Japan 6), vulva a transverse slit (Fig. 7) and located 49- (KR095280, AB675668 and AB635401), 51% at mid-body (Fig. 3E-H), vagina extending KY011960) showed 98% siimmilar identity to Taiwan almost 1/2 of body diameter (Fig. 7), labial width (KF430800), Brazil (AY6011605) and New Zealand

9 E.M. Barsalote et al.

Fig. 7. Shape and orientation of female vulva and vagina. A-C: Hangzhou populations ((HZ-02, HZ-03, HZ06); D: Wenzhou (WZ-02); E: Shanxi (SX-03); F: Shandongg (SHD-02); G: Anhui (AH-08); H: Beijing (BJ-07).

(FM211649) populations. The COI sequences loci (18S and D2-D3 region) showed that X. (KY011946-KY011953) showed separate vaariant brevicolle China were iidentical to other X. groups with COI variation of 6.09-6.65% between americanum-group populatiions (Figs 8 & 9). This populations; despite the sequence difference, alll are result was comparable to LLazarova et al. (2006), apparently clustered in the same clade group of X. who utilised 18S rDNA to characterise Xiphinema brevicolle Japan (AB675669-AB675673). species and showed that the 18S region was homogenous for the X. ammericanum-group. It is DISCUSSION believed that the discriminatory power using rDNA was insufficient to separraate species with very Regardless of the geographic location of the minute morphological diifferences and cannot isolated populations, the morphological and metric provide useful phylogenetic information. However, measurements do not show any signiffiicant the result of COI region indicated that X. brevicolle differences, although there are some minor overlaps China has 6.09-6.65% COI differences, but the of morphological characters (Table 4). The small variations between populatioons were assumed to be variation observed does not indicate a separation simply intraspecific variants of a single species (Fig. among populations. This is possibly explained by 10). Similar results obtained from the evaluation of Luc et al. (1998) suggesting that X. brevicolle is a Sakai et al. (2012) with COI variations of X. parthenogenic species that can easily colonise new brevicolle Japan reached 7.2-7.6%. In addition, areas and has a single widespread population with comparable ranges of COI divergence were reported little variation and no differences in morphology, in L. helveticus with 7.3% and X. diversicaudatum and probably also in genetic structure. Given the with 9.5% (Orlando et al.,, 2016). There are few minimal variation in morphology and morphometric published data on intrasspecific variability in characters of X. brevicolle to other X. americanum nematodes using COI gene; Blouin et al. (1998) noted species, molecular methods were used to determine that COI divergence betweeen closely related species species differences among this complex group. In was approximately 10-20%, so within this range the this study, the use of nucleotide sequences of two populations are still assumed to be conspecific.

10 Xiphinema brevicolle variability in China

Fig. 8. Phylogenetic relationships of Xiphinema brevicolle populations from China as inferred by Maximum Likelihood using 18S rDNA region. Bootstrap values are shown in branches.

11 E.M. Barsalote et al.

Fig. 9. Maximum Likelihood tree of Xiphinema brevicolle from China using D2-D3 expansion segment of 28S rDNA region. Bootstrap values are shown in branches.

12 Xiphinema brevicolle variability in China

Fig. 10. Maximum Likelihood analysis of aligned mtDNA sequences. The analysis iinvolved COI sequence of Xiphinema americanum group reported by (Orlando et al., 2016) and closest X. brevicolle from Japan (Sakai et al., 2012). The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown above the branches.

Phylogenetically, based on COI sequence, X. a different branch as compared to X. brevicolle brevicolle China was separated from other members Asian isolates; this may be explained by the of X. americanum-group populations. There was an diffef rences in fragment length amplified by the apparent simmilarity of X. brevicolle China annd X. diffef rent primers used. Sakkai et al. (2011) and the brevicolle Japan clustered at 98% support. A raange present study used forward and reverse primers of 4.17-5.58% COI sequence divergence was noted COIF1-COIR1 and COIF-COIR, as used by He et between China and Japan populations. Taking into al. (2005), where both primers can amplify >1 kb account the 10-20% COI divergence rule to bp. The longer COI length of the Japan population determine conspecificity, the clade group (886 bp) and the China population (856 bp) comprising the majority of X. brevicolle populations compared to X. brevicollle Russia (KX263107- from Asia can be assumed to be conspecific. KX263106) having only 369 bp could be a possible However, the recently reported X. brevicolle by reason for their distant phyllogenetic separation. By Orlando et al. (2016) from Russia clearly clusteer in contrast, COI variation of sub-clade X. diffusum is

13 E.M. Barsalote et al. estimated as 28.3-32.7%, so if we follow the 20% BROWN, D.J.F. & BOAG, B. 1988. An examination of COI divergence approach of Blouin et al. (1998), methods used to extract virus-vector nematodes then variation between X. brevicolle China and X. (Nematoda: Longidoridae and Trichodoridae) from diffusum is above 20%, thus recognising the two as soil samples. Nematologia Mediterranea 16: 93-99. valid species. This is supported by Oliveira et al. BROWN, D.J.F. & HALBRENDT, J.M. 1997. Identification (2005), who discriminated X. brevicolle and X. of Xiphinema species. In: An Introduction to Virus- diffusum as separate species from two different Vector Nematodes and their Associated Viruses groups, supporting the nomenclature of Lamberti et (M.S.N.A. Santos, I.M.O. Abrantes, D.J.F. Brown & al. (1991). R.J.V.C.M. Lemos Eds). pp. 177-223. Coimbra, In conclusion, justifications of X. brevicolle from Portugal, Centro de Sistematica e Ecologia, Asia are still debatable; it remains a taxonomic issue Universidade de Coimbra. whether X. brevicolle reported from China, Japan BROWN, D.J.F., ROBERTSON, W.M. & TRUDGILL, D.L. and Taiwan are conspecific to X. brevicolle type and 1995. Transmission of viruses by plant nematodes. topotype populations reported from different part of Annual Review of Phytopathology 33: 223-249. the world. Kumari et al. (2010) emphasised that the CHEN, D.-Y., NI, H.-F., YEN, J.-H., CHENG, Y.-H. & integrated approach, combining rDNA-based TSAY, T.-T. 2005. Differentiation of the Xiphinema sequence and morphological data, is important to americanum-group nematodes X. brevicollum, X. delimit species of X. americanum-group. The use of incognitum, X. diffusum and X. oxycaudatum in COI analysis also provides adequate information for Taiwan by morphometrics and nuclear ribosomal species delineation (He et al., 2005; Lazarova et al., DNA sequences. Nematology 7: 713-725. 2006; Kumari et al., 2010; Gutiérrez-Gutiérrez et COOMANS, A. & HEYNS, J. 1997. Three species of the al., 2011; Sakai et al., 2011;). Moreover, the use of Xiphinema americanum-group (Nematoda: COI gene sequences are useful references for future Longidoridae) from Kenya. Nematologica 43: 259-274. taxonomic analysis of complex nematode groups, COOMANS, A., HUYS, R., HEYS, J. & LUC, M. 2001. and are essential for the study of co-speciation Character analysis, phylogeny and biogeography of between nematode and their bacterial the genus Xiphinema Cobb, 1913 (Nematoda: endosymbionts (Orlando et al., 2016). Longidoridae). Annales du Musée Royal de l’Afrique Centrale (Tervuren, Belgique) 287: 1-239. ACKNOWLEDGEMENTS CROZZOLI, R., LAMBERTI, F., GRECO, N. & RIVAS, D. 1998. Plant-parasitic nematodes associated with citrus This research was supported by the National in Venezuela. Nematologia Mediterranea 26: 31-58. Natural Science Foundation of China (project nos DE LEY, P., FELIX, M.-A., FRISSE, L.M., NADLER, S.A., 31371921 and 31772137). The authors thank Dr STERNBERG, P.W. & THOMAS, W.K. 1999. Molecular Sergei Subbotin for reviewing the manuscript and and morphological characterisation of two H. Zhu, R. Cai and X. Li for helping with the reproductively isolated species with mirror-image sampling. anatomy (Nematoda: Cephalobidae). Nematology 1: 591-612. REFERENCES GUTIÉRREZ-GUTIÉRREZ, C., CASTILLO, P., CANTALAPIEDRA-NAVARRETE, C., LANDA, B.B., BARSI, L. & LAMBERTI, F. 2002. Morphometrics of three DERYCKE, S. & PALOMARES-RIUS, J.E. 2011. Genetic putative species of the Xiphinema americanum group structure of Xiphinema pachtaicum and X. index (Nematoda: ) from the territory of the populations based on mitochondrial DNA variation. former Yugoslavia. Nematologia Mediterranea 30: 59- Phytopathology 101: 1168-1175. 72. GUTIÉRREZ-GUTIÉRREZ, C., CANTALAPIEDRA- BARSI, L. & LAMBERTI, F. 2004. Xiphinema parasimile NAVARRETE, C., DECRAEMER, W., VOVLAS, N., sp. n. from Serbia and X. simile, first record from PRIOR, T., PALOMARES-RIUS, J.E. & CASTILLO, P. Bosnia and Herzegovina (Nematoda, Dorylaimida). 2012. Phylogeny, diversity, and species delimitation Nematologia Mediterranea 32: 101-109. in some species of Xiphinema americanum-group BLOUIN, M.S., YOWELL, C.A., COURTNEY, C.H. & DAME, complex (Nematoda: Longidoridae), as inferred from J.B. 1998. Substitution bias, rapid saturation, and the nuclear and mitochondrial DNA sequences and use of mtDNA for nematode systematics. Molecular morphology. European Journal of Plant Pathology Biology and Evolution 15: 1719-1727. 134: 561-597. BRIDGE, J., HUNT, D.J. & HUNT, P. 1996. Plant-parasitic HALBRENDT, J.M. & BROWN, D.J.F. 1992. Morphometric nematodes of crops in Belize. Nematropica 26: 111- evidence for three juvenile stages in some species of 119.

14 Xiphinema brevicolle variability in China

Xiphinema americanum sensu lato. Journal of (Nematoda: Longidoridae) based on ribosomal DNA Nematology 24: 305-309. species. Annals of Applied Biology 146: 281-288. HASEGAWA, M., KISHINO, H. & YANO, T. 1985. Dating of ORLANDO, V., CHITAMBAR, J.J., DONG, K., CHIZHOV, the human-ape splitting by a molecular clock of V.N., MOLLOV, D., BERT, W. & SUBBOTIN, S.A. 2016. mitochondrial DNA. Journal of Molecular Evolution Molecular and morphological characterisation of 22: 160-174. Xiphinema americanum-group species (Nematoda: HE, Y., JONES, J., ARMSTRONG, M., LAMBERTI, F. & Dorylaimida) from California (USA) and other MOENS, M. 2005. The mitochondrial genome of regions, and co-evolution of bacteria from the genus Xiphinema americanum sensu stricto (Nematoda: Candidatus Xiphinematobacter with nematodes. ): considerable economization in the length Nematology 18: 1015-1043. and structural feature encoded genes. Journal of PENEVA, V. & CHOLEVA, B. 1992. Nematodes of the Molecular Evolution 61: 819-833. family Longidoridae from forest nurseries in Bulgaria. HOLTERMAN, M., VAN DER WURFF, A., VAN DEN ELSEN, II. The genus Xiphinema Cobb, 1913. Helminthology S., VAN MEGEN, H., BONGERS, T., HOLOVACHOV, O., 32: 46-58. BAKKER, J. & HELDER, J. 2006. Phylum-wide analysis ROMANENKO, N.D. 1981. [A finding of a new species of of SSU rDNA reveals deep phylogenetic relationships nematode Xiphinema paramonovi n. sp. (Nematoda, among nematodes and accelerated evolution towards Longidoridae) from the territory of the Soviet Union]. crown clades. Molecular Biology and Evolution 23: In: Abstracts of the 1st Conference on Plant, Insect, 1792-1800. Soil and Fresh-Water Nematodes. pp. 68-69. KUMARI, S., DECRAEMER, W. & DE LUCA, F. 2010. Tashkent, Uzbek SSR (in Russian). Molecular characterization of Xiphinema brevicollum SAKAI, H., TAKEDA, A. & MIZUKUBO, T. 2011. First report (Nematoda: Longodoridae) from the Czech Republic. of Xiphinema brevicolle Lordello et Costa, 1961 European Journal of Plant Pathology 128: 243-250. (Nematoda, Longidoridae) in Japan. Zookeys 135: 21-40. LAMBERTI, F., CIANCIO, A., AGOSTINELLI, A. & COIRO, SAKAI, H., TAKEDA, A. & MIZUKUBO, T. 2012. Intra- M.I. 1991. Relationship between Xiphinema specific variation of Xiphinema brevicolle Lordello et brevicolle and X. diffusum with a redescription of X. Costa, 1961 (Nematoda: Longidoridae) in Japan. brevicolle and descriptions of three new species of Japanese Journal of Nematology 42: 1-7. Xiphinema (Nematoda: Dorylaimida). Nematologia SHAH, F.A., BELL, N.L. & BULMAN, S.R. 2009. Mediterranea 19: 311-326. Morphological and molecular confirmation of LAZAROVA, S.S., MALLOCH, G., OLIVEIRA, C.M.G., Xiphinema brevicollum, a nematode from the virus- HÜBSCHEN, J. & NEILSON, R. 2006. Ribosomal and vectoring X. americanum group, from New Zealand. mitochondrial DNA analyses of Xiphinema Australasian Plant Pathology 38: 500-504. americanum-group populations. Journal of TAMURA, K., PETERSON, D., PETERSON, N., STECHER, G., Nematology 38: 404-410. NEI, M. & KUMAR, S. 2011. MEGA 5: molecular LISKOVÁ, M. 1995. Faunistic and ecological notes on evolutionary genetics analysis using maximum Xiphinema (Nematoda: Dorylaimida) in Slovakia. likelihood, evolutionary distance, and maximum Biologia (Bratislava) 50: 125-131. parsimony methods. Molecular Biology and Evolution LORDELLO, L.G.E. & COSTA, C.P. 1961. A new nematode 28: 2731-2739. parasite of coffee roots in Brazil. Revista Brasileira TAYLOR, C.E. & BROWN, D.J.F. 1997. Nematode Vectors de Biologia 21: 363-366. of Plant Viruses. UK, CAB International. 286 pp. LUC, M. & DOUCET, M.E. 1990. La familia Longidoridae THOMPSON, J.D., HIGGINS, D.G. & GIBSON, T.J. 1994. Thorne, 1935 (Nemata) en Argentina: 1. Distribucion. Clustal W: improving the sensitivity of progressive Revista de Ciencias Agropecuarias 7: 19-25. multiple sequence alignments through sequence LUC, M., COOMANS, A., LOOF, P.A.A. & BAUJARD, P. weighting, position-specific gap penalties and weight 1998. The Xiphinema americanum-group (Nematoda: matrix choice. Nucleic Acids Research 22: 4673- Longidoridae): 2. Observations on Xiphinema 4680. brevicollum Lordello & da Costa, 1961 and comments WEISCHER, B. & BROWN, D.J.F. 2000. An Introduction to on the group. Fundamental and Applied Nematology Nematodes. General Nematology: a Student’s 21: 475-490. Textbook. Bulgaria, Pensoft Publishers. 122 pp. OLIVEIRA, C.M.G., FENTON, B., MALLOCH, G., BROWN, XU, T.H., FU, P. & CHENG, H.R. 1995. [A taxonomic D.J.F. & NEILSON, R. 2005. Development of species- study of species Xiphinema from seven provinces of specific primers for the ectoparasitic nematode China (Nematoda: Longidoridae)]. Journal of Nanjing species Xiphinema brevicolle, X. diffusum, X. Agricultural University – Nan Jin Nong Ye Da Xe elongatum, X. ifacolum and X. longicaudatum Xue Bao 18: 37-42 (in Chinese).

15 E.M. Barsalote et al.

YE, W., SZALANSKI, A.L. & ROBBINS, R.T. 2004. ZHAO, L. 2013. [Molecular characteristics of Xiphinema Phylogenetic relationships and genetic variation in brevicollum based on the rDNA D2-D3 sequences]. Longidorus and Xiphinema species (Nematoda: Plant Quarantine – Zhi Wu Jian Yi 18: 1-5 (in Longidoridae) using ITS1 sequence of nuclear Chinese). ribosomal DNA. Journal of Nematology 36: 14-19.

E.M. Barsalote, Zh. Tian and J. Zheng. Внутривидовая изменчивость Xiphinema brevicolle Lordello & Costa, 1961 (Nematoda: Longidoridae) Китая. Резюме. При изучении фауны лонгидорид в природных экосистемах Китая было выявлено восемь популяций Xiphinema brevicolle Lordello & Costa, 1961. Оценка морфометрических показателей самок не выявила серьезных различий между популяциями. Морфологические особенности были сходными в длине тела (1.8-2.2 мм), длине одонтостиля (89-92 мкм), ширине губного отдела (10-12 мкм), индексу c’ (0.8-1.1) и положении вульвы (49-51%). Были получены последовательности 18S, 28S рДНК а также митохондриального гена цитохромоксидазы I (COI) для всех восьми популяций из различных местностей. Анализ филогенетических отношений рибосомальной последовательности 18S выявил 98% сходство с X. brevicolle (Японияn), X. diffusum (Китай), X. taylori (Словакия), X. incognitum (Китай), X. lambertii и X. inequali (Чешская Республика). Последовательности 28S rDNA были идентичны X. brevicolle (Япония и Бразилия) при 98% поддержке группы. Анализ гена COI у изученных популяций выявил различия на уровне 6.09- 6.95% между изученными популяциями, что рассматривается как внутривидовая изменчивость. Таким образом, сделан вывод о принадлежности всех обнаруженных популяций к одному виду – X. brevicolle. Предпринятое изучение X. brevicolle морфологическими и молекулярными методами позволяет оценить таксономическую структуру этого вида в Азии.

16