Russian Journal of Nematology, 2017, 25 (1), 1 – 16 Intra-species variability of Xiphinema brevicolle Lordello & Costa, 1961 (Nematoda: Longidoridae) from China Eda Marie Barsalote1, Zhongling Tian1 and Jingwu Zheng1, 2 1Laboratory of Plant Nematology, Institute of Biotechnology, College of Agriculture & Biotechnology, Zhejiang University, 310058, Hangzhou, China 2Ministry of Agriculture Key Lab of Molecular Biology of Crop Pathogens and Insects, 310058, Hangzhou, China e-mail: [email protected] Accepted for publication 6 March 2017 Summary. During a survey of longidorids from natural vegetation in China, eight populations of Xiphinema brevicolle Lordello & Costa, 1961 were detected. Metric characters derived from females showed no significant difference among populations. Morphological characters are markedly similar in body length (1.8-2.2 mm), odontostyle (89-92 µm), lip width (10-12 µm), c’ ratio (0.8-1.1 µm) and position of vulva (49-51%). The 18S, 28S rDNA and cytochrome oxidase I (COI) region of the mitochondrial DNA were sequenced for the eight populations sampled from different localities. Phylogenetic relationships using 18S region suggest 98% similar identity to X. brevicolle (Japan), X. diffusum (China), X. taylori (Slovakia), X. incognitum (China), X. lambertii and X. inequali (Czech Republic). The 28S rDNA sequences are identical to X. brevicolle (Japan and Brazil) with 98% clade support. By contrast, mitochondrial COI analysis does not show heterogeneity between populations. COI sequence divergence of 6.09-6.95% between the studied populations is believed to be merely intraspecific variants of a single species; thus, the populations are considered to be conspecific. A combined morphological and molecular investigation was undertaken to emphasise the taxonomic standing of X. brevicolle from Asia. Key words: 18S, 28S rDNA, mitochondrial COI gene, molecular diagnosis, morphology, variation. Dagger nematodes of the genus Xiphinema are & Halbrendt, 1997). It is evident that Xiphinema ectoparasitic migratory nematodes that are world- americanum-group is composed of numerous wide in distribution (Weischer & Brown, 2000). species whose accurate naming remains ambiguous This genus comprises 234 valid species (Coomans (Luc et al., 1998). This is best illustrated in the case et al., 2001), which includes the Xiphinema of Xiphinema brevicolle Lordello & Costa, 1961, americanum-group that are widely distributed which has several junior synonyms (Coomans et al., around America, Europe and Asia (Halbrendt & 2001). Luc et al. (1998) suggested that X. diffusum Brown, 1992; Barsi & Lamberti, 2002) and was a junior synonym of X. brevicolle but later considered the putative vector of four Oliveira et al. (2005) re-established X. diffusum as a Nepoviruses (Brown et al., 1995; Taylor & valid species on the basis of molecular Brown, 1997). identification. Meanwhile, the taxonomic status of The Xiphinema americanum-group is a complex X. brevicolle occurring in European countries was group comprising 55 taxa (Gutiérrez-Gutiérrez et later separated as a new valid species, X. taylori al., 2012) in which nominal species have not yet (Lamberti et al., 1991), but others disagree and been satisfactorily resolved taxonomically due to continued to include the two species as junior controversies about species definition and synonyms of X. brevicolle. delineation. For example, Luc et al. (1998) listed 34 Lamberti et al. (1991) considered that X. putative species of the X. americanum-group, brevicolle was restricted to Brazil, but it is probably Coomans et al. (2001) reported 38 species, whilst in neighbouring Latin American countries like Barsi & Lamberti (2004) reported 50 putative Venezuela (Crozzoli et al., 1998) and Belize (Bridge species. These differences of species identification et al., 1996) and there are reports of the species are due to dissimilar insights of experts, some of occurring in Kenya (Coomans & Heyns, 1997), whom are able to delineate species using only minor Bulgaria (Peneva & Choleva, 1992), Russia morphometrical or morphological variations (Brown (Romanenko, 1981), Slovakia (Lisková, 1995) and 1 E.M. Barsalote et al. Fig. 1. Comparisons of diagnostic characters of Xiphinema brevicolle from China andd topotype population from Brazil, Taiwan and Japan. Table 1. Isolates, host, origin and corresponding sequence code of Xiphinema brevicolle populations from China. Sequence ID Species Code Location Host 18S D2-D3 cox1 mt Xiphinema brevicolle HZ-02 Zijingang, Hangzzhhou, CN Maple KY011962 KY011955 KY011949 Xiphinema brevicolle HZ-03 Botanic Garden, Hangzhou, CN Oleander KY011969 KY011959 KY011946 Xiphinema brevicolle HZ-06 Xixi Wetland, Hangzhou, CN Rubber tree KY011967 KY011958 KY011947 Xiphinema brevicolle WZ-02 Wenzhou, Zhejiang, CN Hoop pine KY011964 KY011961 KY011948 Xiphinema brevicolle SX-03 Shanxi, CN Locust tree KY011968 KY011957 KY011950 Xiphinema brevicolle SHD-02 Shandong, CN Chinese plum KY011966 KY011956 KY011952 Xiphinema brevicolle AH-08 Anhui, CN Loquat KY011963 KY011960 KY011953 Xiphinema brevicolle BJ-07 Beijing, CN Chinese pine KY011965 KY011954 KY011951 China (Xu et al., 1995); detailed confirmatory 200 g was washed using the decanting and sieving identifications are needed. technique (Brown & Boag, 1988). Soil extracts were This study aimed to conduct morphologicall and allowed set aside for 24 h and nematode suspensions molecular characterisations of populations of X. were collected the followinng day. Adult nematodes brevicolle from China and provide a DNA based were handpicked and mounted in distilled water on phylogeny using rDNA and mitochondrial COI ggene a temporary slide and heat killed for morphological (COI) sequences to provide a more robust examination and measurements of diagnostic framework to understand the similarities and/or characters. Photographs weere taken using a digital differences of X. brevicolle populations in China. camera (Leica DM5000B) and morphological measurements were obtaiined using specialised MATERIALS AND METHODS software (LAS; Leica Cammera AG). Morphometric values are given in µm unless noted otherwise. Nematode isolation and examination. Soil core DNA extraction. A single adult nematode was samples were collected beneath perennial trees handpicked and placed in a glass slide with 13 µl growing under natural vegetation in China (Table distilled H2O. The nematode was cut into fragments 1). The samples were mixed, and a sub sample of using a sterilised needle and fragmented pieces were 2 Xiphinema brevicolle variability in China pipetted up to 10 µl and transferred to an Eppendorf a BIO-RAD S1000 thermal cycler with the tube; 8 µl Mg+ free buffer and 2 µl proteinase K (600 following cycling conditions for nematode rRNA µg ml–1) were added to make a total volume of 20 µl. gene: one cycle of 94°C for 2 min, followed by 35 The Eppendorf tube was briefly centrrifuged for 2 min cycles of 94°C for 30 s, annealing temperature of at 15,520 g (Ye et al., 2004). The PCR tube was 57°C for 45 s, extension of 72°C for 3 min and a frozen at –70°C overnight and then incubated at 65°C final extension of 72°C for 10 min. PCR products for 1 h and 95°C for 15 min. The final DNA extract were analysed by electrophoresis on agarose gel was cooled down at 8°C and stored at –20°C until (100 V, 400 mA, 30 min) and visualisation was use. made by staining with DuRed 10,000x and observed PCR and sequencing. PCR amplification and under UV illumination. relevant thermal conditions of 18S, D2-D3 region DNA purification was done as described in the and mtDNA cytochrome oxidase I were all as Nucleic Acid Purification kit of AXYGEN and described by Sakai et al. (2011). PCR were carried sequencing was made by SAANGON Biotechnology out using different primers depending on the target Co., Shanghai, China. Sequences were BLAST and genes (Table 2). PCR mixes of 14.2 µl ddH2O, 2.5 aligned by Clustal_W program with default µl LA bufffeer, 2 µl dNTP, 1.5 µl each primers, 3 µl parameters (Thompson et al., 1994). Phylogenetic DNA template and 0.3 LA Taq were prepared to a analysis and model selectioon were performed using total volume of 25 µl. All PCR reactions were run in MEGA 5 (Tamura et al., 2011). The ML tree was Fig. 2. Xiiphinema brevicolle juvenile stages. A-D: J1-J4 anterior region; E-H: J1-J4 tail region. 3 E.M. Barsalote et al. Table 2. Primers used to amplify SSU, D2-D3 and cox1 mtDNA of Xiphinema brevicolle populations from China. Region Primers Direction Sequence (5’-3’) Reference 18S 988F forward CTCAAAGATTAAGCCATGC Holterman et. al., 2006 18S 1912R reverse TTTACGGTCAGAACTAGGG Holterman et. al., 2006 D2-D3 D2A forward ACAAGTACCGTGAGGGAAAGTTG De Ley et al., 1999 D2-D3 D3B reverse TCGGAAGGAACCAGCTACTA De Ley et al., 1999 cox1 COIF forward GATTTTTTTGGKCATCCWGARG He et al., 2005 cox1 COIR reverse CWACATAATAAGTATCATG He et al., 2005 constructed using multiple aligned sequences of the populations reported by Lamberti et al. (1991), Luc COI region, where Hasegawa-Kishino-Yano model et al. (1998), Chen et al. (2005), Kumari et al. (Hasegawa et al., 1985) and heuristic search with (2010) and Sakai et al. (2011) (Table 4). Metric Close-Neighbor-Interchange (CNI) were employed characters of body lengtth, odontostyle length, with bootstraps value of 1000 replications. diameter of lip, guiding ring position from oral RESULTS aperture and tail length were close to previously Xiphinema brevicolle Lordello & Costa, 1961 described X. brevicolle populations. The adult females of X. brevicolle iin China coincides and (Figs 1-7, Tables 3 & 4) comes closest to populations described from Taiwan Remarks. The diagnostic characters of the (Zhao, 2013) and Japan (Sakai et al., 2012) (Fig. 1). population studied generally agree with the original Morphometrics of four juvenile stages were similar description of Lordello & Costa, 1961 and topotype in all obtained populations (Table 3), while general Fig. 3. Xiphinema brevicolle. A-D: development and position of replacement odontostyle of J1, J2, J3 and J4, respectively; E-H: adult habitus. 4 Xiphinema brevicolle variability in China Fig. 4. Photomicrographs of anterior region of Xiphinema brevicolle females.