US 200601 00218A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0100218 A1 Ibrahim et al. (43) Pub. Date: May 11, 2006

(54) PDE4B INHIBITORS Publication Classification (76) Inventors: Prabha N. Ibrahim, Mountain View, (51) Int. Cl. CA (US); Ryan Bremer, Albany, CA A6II 3 L/506 (2006.01) (US); Sam Gillette, Oakland, CA (US); A61K 31/4745 (2006.01) Hanna Cho, Oakland, CA (US); A61K 31/4709 (2006.01) Marika Nespi, Berkeley, CA (US); A61K 31/4439 (2006.01) Shumeye Mamo, Oakland, CA (US); A6II 3/423 (2006.01) Chao Zhang, Moraga, CA (US); Dean A6II 3/405 (2006.01) R. Artis, Kensington, CA (US); A6II 3 L/46 (2006.01) Byunghun Lee, Marina, CA (US); G06F 9/00 (2006.01) Rebecca Zuckerman, Alameda, CA C07D 471/02 (2006.01) (US) C07D 403/02 (2006.01) C07D 405/02 (2006.01) C07D 413/02 (2006.01) Correspondence Address: (52) U.S. Cl...... 514/256; 514/314: 514/406; FOLEY & LARDNER LLP 514/338; 514/375; 544/330; P.O. BOX 80278 546/113: 546/271.7: 546/277.4: SAN DIEGO, CA 92138-0278 (US) 548/216: 548/361.1 : 548/465; 702/19

(21) Appl. No.: 11/219,635 (57) ABSTRACT (22) Filed: Sep. 2, 2005 Compounds are described that are active on PDE4. Also described are crystal structures of PDE4B determined using Related U.S. Application Data X-ray crystallography, the use of PDE4B crystals and stru cural information for identifying molecular scaffolds, for (60) Provisional application No. 60/607,407, filed on Sep. developing ligands that bind to and modulate PDE4B, and 3, 2004. for identifying improved ligands based on known ligands. Ribbon Diagram of PDE4B dimer

Patent Application Publication May 11, 2006 Sheet 1 of 2 US 2006/01 00218A1 Fig. 1 Ribbon Diagram of PDE4B dimer

Patent Application Publication May 11, 2006 Sheet 2 of 2 US 2006/01 00218 A1 Fig. 2 Overlay of PDE4B structure with prior proposed PDE4B structure

US 2006/01 00218 A1 May 11, 2006

PDE4B INHIBITORS 3'-position with inversion of configuration at the phosphorus atom (Goldberg, et al., J. Biol. Chem., 255:10344-10347 CROSS-REFERENCE TO RELATED PATENT (1980); Burgers, et al., J. Biol. Chem., 254:9959-9961 APPLICATIONS (1979)). This apparently results from an in-line nucleophilic 0001) This application claims the benefit of U.S. Prov. attack by the OH of ionized H2O. It has been proposed that App. No. 60/607,407, filed Sep. 3, 2004, which is incorpo metals bound in the conserved metal binding motifs within rated herein by reference in its entirety and for all purposes. PDEs facilitate the production of the attacking OH (Fran cis, et al., J. Biol. Chem., 269:22477-22480 (1994)). The FIELD OF THE INVENTION kinetic properties of catalysis are consistent with a random order mechanism with respect to cyclic nucleotide and the 0002 This invention relates to the development of divalent cations(s) that are required for catalysis (Srivastava, ligands for phosphodiesterase PDE4, including for PDE4 et al., Biochem. J, 308:653-658 (1995)). The catalytic isoforms PDE4B and PDE4D, and to the use of crystal domains of all known mammalian PDEs contain two structures of PDE4B and/or PDE4D. Additionally, this sequences (HX HX. (E/D)) arranged in tandem, each of invention provides compounds with activity toward PDE4. which resembles the single Zn-binding site of metalloen and methods of use thereof. doproteases such as thermolysin (Francis, et al., J. Biol. Chem., 269:22477-22480 (1994)). PDE5 specifically binds BACKGROUND OF THE INVENTION Zn", and the catalytic activities of PDE4, PDE5, and PDE6 0003. The information provided is intended solely to are supported by submicromolar concentrations of Zn" assist the understanding of the reader. None of the informa (Francis, et al., J. Biol. Chem., 269:22477-22480 (1994): tion provided nor references cited is admitted to be prior art Percival, et al., Biochem. Biophys. Res. Commun., 241: 175 to the present invention. Each of the references cited is 180 (1997)). Whether each of the Zn-binding motifs binds incorporated herein in its entirety. Zn" independently or whether the two motifs interact to form a novel Zn'-binding site is not known. The catalytic 0004 Phosphodiesterases (PDEs) were first detected by mechanism for cleaving phosphodiester bonds of cyclic Sutherland and co-workers (Rall, et al., J. Biol. Chem., nucleotides by PDEs may be similar to that of certain 232:1065-1076 (1958), Butcher, et al., J. Biol. Chem., proteases for cleaving the amide ester of peptides, but the 237:1244-1250 (1962)). The superfamily of PDEs is subdi presence of two Zn" motifs arranged in tandem in PDEs is vided into two major classes, class I and class II (Charbon unprecedented. neau, H., Cyclic Nucleotide Phosphodiesterases. Structure, Regulation and Drug Action, Beavo, J., and Houslay, M.D., 0007. The group of Sutherland and Rall (Berthet, et al., J. eds) 267-296 John Wiley & Sons, Inc., New York (1990)), Biol. Chem., 229:351-361 (1957)), in the late 1950s, was the which have no recognizable sequence similarity. Class I first to realize that at least part of the mechanism(s) whereby includes all known mammalian PDEs and is comprised of 11 caffeine enhanced the effect of glucagon, a stimulator of identified families that are products of separate genes adenylyl cyclase, on cAMP accumulation and glycogenoly (Beavo, et al., Mol. Pharmacol., 46:399-405 (1994); Conti, sis in liver involved inhibition of cAMP PDE activity. Since et al., Endocr: Rev., 16:370-389 (1995); Degerman, et al., J. that time chemists have synthesized thousands of PDE Biol. Chem., 272:6823-6826 (1997); Houslay, M. D., Adv. inhibitors, including the widely used 3-isobutyl-1-methylx Enzyme Regul., 35:303-338 (1995); Bolger, G. B., Cell anthine (IBMX). Many of these compounds, as well as Signal, 6:851-859 (1994); Thompson, et al. Adv. Second caffeine, are non-selective and inhibit many of the PDE Messenger Phosphoprotein Res., 25: 165-184 (1992); Under families. One important advance in PDE research has been wood, et al., J. Pharmacol. Exp. Ther, 270:250-259 (1994): the discovery/design of family-specific inhibitors such as the Michaeli, et al., J. Biol. Chem., 268: 12925-12932 (1993); PDE4 inhibitor, rolipram, and the PDE5 inhibitor, sildenafil. Soderling, et al., Proc. Natl. Acad. Sci. U.S.A., 95.8991 0008 Precise modulation of PDE function in cells is 8996 (1998); Soderling, et al., J. Biol. Chem., 273:15553 critical for maintaining cyclic nucleotide levels within a 15558 (1998); Fisher, et al., J. Biol. Chem., 273:15559 narrow rate-limiting range of concentrations. Increases in 15564 (1998)). Some PDEs are highly specific for cGMP of 2-4-fold above the basal level will usually produce hydrolysis of cAMP (PDE4, PDE7, PDE8), some are highly a maximum physiological response. There are three general cGMP-specific (PDE5, PDE6, PDE9), and some have mixed schemes by which PDEs are regulated: (a) regulation by specificity (PDE1, PDE2, PDE3, PDE10, PDE11) (Conti, substrate availability, such as by stimulation of PDE activity Molecular Endocrinology, 14:1317-1327 (2000)). by mass action after elevation of cyclic nucleotide levels or by alteration in the rate of hydrolysis of one cyclic nucle 0005 All of the characterized mammalian PDEs are otide because of competition by another, which can occur dimeric, but the importance of the dimeric structure for with any of the dual specificity PDEs (e.g. PDE1, PDE2, function in each of the PDEs is unknown. Each PDE has a PDE3); (b) regulation by extracellular signals that alter conserved catalytic domain of ~270 amino acids with a high intracellular signaling (e.g. phosphorylation events, Ca", degree of conservation (25-30%) of amino acid sequence phosphatidic acid, inositol phosphates, protein-protein inter among PDE families, which is located carboxyl-terminal to actions, etc.) resulting, for example, in stimulation of PDE3 its regulatory domain. Activators of certain PDEs appear to activity by insulin (Degerman, et al., J. Biol. Chen., relieve the influence of autoinhibitory domains located 272:6823-6826 (1997)), stimulation of PDE6 activity by within the enzyme structures (Sonnenberg, et al., J. Biol. photons through the transducin System (Yamazaki, et al., J. Chem., 270:30989-31000 (1995); Jin, et al., J. Biol. Chem., Biol. Chem., 255:11619-11624 (1980)), which alters PDE6 267: 18929-18939 (1992)). interaction with this enzyme, or stimulation of PDE 1 0006 PDEs cleave the cyclic nucleotide phosphodiester activity by increased interaction with Ca"/calmodulin; (c) bond between the phosphorus and oxygen atoms at the feedback regulation, such as by phosphorylation of PDE1. US 2006/01 00218 A1 May 11, 2006

PDE3, or PDE4 catalyzed by PKA after cAmP elevation 0011 Inhibitors of the PDE4 enzymes have proposed (Conti, et al., Endocr: Rev., 16:370-389 (1995); Degerman, utility in the treatment of inflammatory diseases. Knockout et al., J. Biol. Chem., 272:6823-6826 (1997); Gettys, et al., of PDE4B results in viable mice (Jin and Conti (2002) Proc J. Biol. Chem. 262:333-339 (1987); Florio, et al, Biochem Natl Acad Sci U S A, 99, 7628-7633), while knockout of istry, 33:8948-8954 (1994)), by allosteric coMP binding to PDE4D results in reduced viability (Jin et al. (1999) Proc PDE2 to promote breakdown of cAMP or cGMP after cGMP Natl AcadSci USA, 96, 11998-12003). The PDE4D knock elevation, or by modulation of PDE protein levels, such as out genotype can be rescued by breeding onto other back the desensitization that occurs by increased concentrations ground mouse Strains. Airway epithelial cells from these of PDE3 or PDE4 following chronic exposure of cells to PDE4D knockout embryos display greatly reduced hyper cAMP-elevating agents (Conti, et al., Endocr: Rev., 16:370 sensitivity to adrenergic agonists, suggesting PDE4D as a 389 (1995), Sheth, et al., Throm. Haemostasis, 77:155-162 therapeutic target in airway inflammatory diseases (Hansen (1997)) or by developmentally related changes in PDE5 et al. (2000) Proc Natl Acad Sci USA, 97, 6751-6756). content. Other factors that could influence any of the three PDE4B-knockout mice have few symptoms and normal schemes outlined above are cellular compartmentalization airway hypersensitivity. Delgado et al., (Med Sci Monit, of PDEs (Houslay, M. D., Adv. Enzyme Regul, 35:303-338 2003, 9:BR252-259), report that in view of the increase in (1995)) effected by covalent modifications such as prenyla PDE4 activity described in blood mononuclear white cells of tion or by specific targeting sequences in the PDE primary patients with atopic dermatitis, and the putative relationship structure and perhaps translocation of PDEs between com between histamine and PDE4 in inflammatory cells, hista partments within a cell. mine up-regulates PDE4 activity in U-937 cells through H receptor stimulation and cAMP increase. 0009. Within the PDE superfamily, four (PDE2, PDE5, PDE6, and PDE10) of the 10 families contain highly c0MP 0012. By contrast, monocytes from the PDE4B knockout specific allosteric (non-catalytic) ccjMP-binding sites in mice exhibit a reduced response to LPS (Jin and Conti addition to a catalytic site of varying Substrate specificity. (2002) Proc Natl Acad Sci USA, 99, 7628-7633). This Each of the monomers of these dimeric coMP-binding suggests that a PDE4B compound with selectivity versus PDEs contains two homologous coMP-binding sites of PDE4D could exhibit anti-inflammatory activity with ~110 amino acids arranged in tandem and located in the reduced side-effects. amino-terminal portion of the protein (Charbonneau, H., 0013. Accordingly, there is a need in the art for more Cyclic Nucleotide Phosphodiesterases. Structure, Regula potent and specific inhibitors and modulators of PDE4 such tion and Drug Action, Beavo, J., and Houslay, M. D., eds) as PDE4B and PDE4D and methods for designing them. 267-296 (1990); McAllister-Lucas, et al., J. Biol. Chem., 270:30671-30679 (1995)). In PDE2, binding of the coMP to SUMMARY OF THE INVENTION these sites stimulates the hydrolysis of cAMP at the catalytic 0014. The present invention provides compounds active site (Beavo, et al., Mol. Pharmacol., 46:399-405 (1994)). on PDE4, e.g., PDE4B and/or PDE4D isoforms. In particu PDE2 hydrolyzes cGMP as well as cAMP, and cQMP lar, the invention provides compounds of Formula I, Ia, Ib, hydrolysis is stimulated by c0MP binding at the allosteric Ic, Id, and Ie as described below. Thus, the invention sites in accordance with positively cooperative kinetics provides compounds that can be used for therapeutic meth (Manganiello, et al., Cyclic Nucleotide Phosphodiesterases. ods involving modulation of PDE4, as well as providing Structure, Regulation, and Drug Action, Beavo, J., and molecular scaffolds for developing additional modulators of Houslay, M. D., eds, 61-85 John Wiley & Sons, Inc., New PDE4, and other PDEs. The invention further involves the York (1990)). This could represent a negative feedback use of structural information about PDE4B to derive addi process for regulation of tissue coMP levels (Manganiello, tional PDE4B modulators. et al., Cyclic Nucleotide Phosphodiesterases: Structure, Regulation, and Drug Action, Beavo, J., and Houslay, M.D., 0015. In one aspect, the invention provides compounds of eds, 61-85 John Wiley & Sons, Inc., New York (1990)), Formula I having the following structure: which occurs in addition to the cross-talk between cyclic nucleotide pathways represented by c0MP stimulation of cAMP breakdown. Binding of c(GMP to the allosteric sites of Formula I PDE6 has not been shown to affect catalysis, but this binding may modulate the interaction of PDE6 with the regulatory protein, transducin, and the inhibitory y subunit of PDE6 (Yamazaki, et al., Adv. Cyclic Nucleotide Protein Phospho rylation Res., 16:381-392 (1984)). 0010) The PDE4 subfamily is comprised of 4 members: PDE4A, PDE4B (SEQ ID NO:1), PDE4C, and PDE4D (SEQID NO:2) (Contietal. (2003) J Biol. Chem. 278:5493 wherein: 5496). The PDE4 enzymes display a preference for cAMP over cGMP as a substrate. These enzymes possess N-termi 0016 k is selected from the group consisting of nal regulatory domains that presumably mediate dimeriza CRR'R'', C(Z)R, C(Z)NR'R'', tion, which results in optimally regulated PDE activity. In - S(O)NR'R'', and S(O).R'': addition, activity is regulated via cAMP-dependent protein 0017 Z is O, S, or NR: kinase phosphorylation sites in this upstream regulatory 0018 t, u, v, w, x, and y are each independently N or domain. These enzymes are also rather ubiquitously CR', provided, however, that no more than one of u and expressed, but importantly in lymphocytes. t are N, and no more than two of V, w, x and y are N: US 2006/01 00218 A1 May 11, 2006

0019 A is selected from the group consisting of sub aralkyl, optionally substituted heteroaryl, optionally stituted aryl and substituted heteroaryl; substituted heteroaralkyl, -C(Z)R. —C(Z)NR'R'', 0020) R' at each occurrence is independently selected S(O)NR'R'', and S(O).R'; or from the group consisting of hydrogen, halogen, optionally substituted lower alkyl, optionally substi 0025) R' and R'' together with the nitrogen to which tuted lower alkenyl, optionally substituted lower alky they are attached form a 5-7 membered optionally nyl, optionally substituted cycloalkyl, optionally Sub substituted heterocycloalkyl or optionally substituted stituted cycloalkylalkyl, optionally substituted heteroaryl ring; heterocycloalkyl, optionally substituted heterocy 0026 R'' and R'' at each occurrence are indepen cloalkylakyl, optionally Substituted aralkyl, optionally dently selected from the group consisting of hydrogen, substituted heteroaralkyl, -C(Z)R. -OR. -SR, optionally substituted lower alkyl, optionally substi NR'R'', C(Z)NR'R', S(O)NR'R'', tuted lower alkenyl, provided, however, that when R' —S(O).R'', and A, provided, however, that at least one and/or R' are alkenyl, no alkene carbon thereof is R" is A: bound to nitrogen, optionally Substituted lower alkynyl, 0021 R and R7 are independently selected from the provided, however that when R'' and/or R' are alky group consisting of hydrogen, optionally substituted nyl, no alkyne carbon thereof is bound to nitrogen, lower alkyl, optionally substituted lower alkenyl, optionally substituted cycloalkyl, optionally substituted optionally substituted lower alkynyl, optionally substi cycloalkylalkyl, optionally substituted heterocy tuted cycloalkyl, optionally substituted cycloalkyla cloalkyl, optionally substituted heterocycloalkylalkyl, lkyl, optionally substituted heterocycloalkyl, optionally optionally substituted aryl, optionally substituted substituted heterocycloalkylakyl, optionally substituted aralkyl, optionally substituted heteroaryl, and option aryl, optionally Substituted aralkyl, optionally Substi ally substituted heteroaralkyl; or tuted heteroaryl, and optionally substituted het eroaralkyl, 0027) R' and R' together with the nitrogen to which 0022 Rat each occurrence is independently selected they are attached form a 5-7 membered optionally from the group consisting of —OR, optionally sub substituted heterocycloalkyl or optionally substituted stituted lower alkyl, optionally substituted lower alk heteroaryl ring; enyl, provided, however, that when R is alkenyl, no alkene carbon thereof is bound to C(Z), optionally 0028) R'' at each occurrence is independently selected substituted lower alkynyl, provided, however, that from the group consisting of optionally substituted when R is alkynyl, no alkyne carbon thereof is bound lower alkyl, optionally substituted lower alkenyl, pro to C(Z), optionally substituted cycloalkyl, optionally vided, however, that when R'' is alkenyl, no alkene substituted cycloalkylalkyl, optionally substituted het carbon thereof is bound to —S(O) , optionally sub erocycloalkyl, optionally Substituted heterocycloalky stituted lower alkynyl, provided, however, that when lalkyl, optionally substituted aryl, optionally substi R is alkynyl, no alkyne carbon thereof is bound to tuted aralkyl, optionally substituted heteroaryl, and —S(O) , optionally Substituted cycloalkyl, option optionally substituted heteroaralkyl; ally substituted cycloalkylalkyl, optionally substituted 0023 R at each occurrence is independently selected heterocycloalkyl, optionally substituted heterocy from the group consisting of hydrogen, optionally cloalkylalkyl, optionally Substituted aryl, optionally substituted lower alkyl, optionally substituted lower substituted aralkyl, optionally substituted heteroaryl, alkenyl, provided, however, that when R is alkenyl, no and optionally substituted heteroaralkyl: alkene carbon thereof is bound to O. Nor S, optionally 0029) R' is selected from the group consisting of substituted lower alkynyl, provided, however, that optionally substituted lower alkyl, optionally substi when R is alkynyl, no alkyne carbon thereof is bound tuted lower alkenyl, optionally substituted lower alky to O, N or S, optionally substituted cycloalkyl, option nyl, optionally substituted cycloalkyl, optionally Sub ally substituted cycloalkylalkyl, optionally substituted stituted cycloalkylalkyl, optionally substituted heterocycloalkyl, optionally substituted heterocy heterocycloalkyl, optionally substituted heterocy cloalkylalkyl, optionally Substituted aryl, optionally cloalkylalkyl, optionally Substituted aryl, optionally substituted aralkyl, optionally substituted heteroaryl, substituted aralkyl, optionally substituted heteroaryl, or and optionally substituted heteroaralkyl: optionally substituted heteroaralkyl; and 0024) R' and R'' at each occurrence are indepen 0030) all salts, prodrugs, tautomers and isomers dently selected from the group consisting of hydrogen, thereof. optionally substituted lower alkyl, optionally substi tuted lower alkenyl, provided, however, that when R' 0031. In one embodiment of the invention, no more than and/or R'' are alkenyl, no alkene carbon thereof is one of t, u, v, w, x, and y of Formula I is N. In one bound to nitrogen, optionally substituted lower alkynyl, embodiment, t is N or CH, provided that no more than one provided, however, that when R'' and/or R'' are alky oft, u, V, W, X, and y is N. In one embodiment, t, u, V, W, and nyl, no alkyne carbon thereof is bound to nitrogen, x are CR', and y is N or CR'; and in a further embodiment, optionally substituted cycloalkyl, optionally substituted t is CH. In one embodiment, t is N or CH, y is N or CH, cycloalkylalkyl, optionally substituted heterocy provided t and y are not both N, one of u, v, w, and X is C-A, cloalkyl, optionally substituted heterocycloalkylalkyl, and the others of u, v, w and X are CH, provided that the optionally substituted aryl, optionally substituted compound is not US 2006/01 00218 A1 May 11, 2006

In one embodiment of the invention, t is CH, y is N, one of u, V, W, and X is C-A, and the others of u, V, w and X are CH, provided that the compound is not

rN\, 2 N N

0032. Further to any of the above embodiments, A of Formula I is selected from the group consisting of Substi tuted phenyl, dialkoxyphenyl, pyrazole carboxylic ester, substituted pyridine, substituted pyrimidine, and substituted thienopyrimidine. In one embodiment, A has a structure of one of the following groups, in which the Squiggle line indicates the attachment to the bicyclic core structure of Formula I.

s O O le R-1 R15 N No N M US 2006/01 00218 A1 May 11, 2006

heterocycloalkyl, optionally substituted heterocy -continued cloalkylalkyl, optionally substituted aryl, optionally NH2 substituted aralkyl, optionally substituted heteroaryl. and optionally substituted heteroaralkyl: N N N N 0037) R' at each occurrence is independently selected from the group consisting of optionally substituted S 2 --- lower alkyl, optionally substituted lower alkenyl, optionally substituted lower alkynyl, optionally substi tuted cycloalkyl, optionally substituted cycloalkyla lkyl, optionally substituted heterocycloalkyl, optionally substituted heterocycloalkylalkyl, optionally substi O tuted aryl, optionally substituted aralkyl, optionally R7-O substituted heteroaryl, and optionally substituted het eroaralkyl, -C(Z)R, OR, -SR, -NR'R'', C(Z)NR'R', S(O)NR'R'', or S(O).R'': and 0038 all salts, prodrugs, tautomers and isomers thereof. 0039. Further to any of the above embodiments, k of wherein: compounds of Formula I is selected from the group con 0033) R' at each occurrence is independently selected sisting of CHR', C(Z)R, -C(Z)NR'R'', from the group consisting of optionally substituted S(O)NR'R'', and S(O).R', wherein R. R. R', lower alkyl, optionally substituted lower alkenyl, pro R'', and R' are selected from the group consisting of vided, however, that when R' is alkenyl, no alkene optionally substituted lower alkyl, aryl and heteroaryl, carbon thereof is bound to oxygen, optionally substi wherein aryl and heteroaryl are optionally substituted with tuted lower alkynyl, provided, however, that when R' 1-3 substituents selected from the group consisting of halo is alkynyl, no alkyne carbon thereof is bound to oxy gen, optionally substituted lower alkyl, optionally substi gen, optionally substituted cycloalkyl, optionally sub tuted lower alkoxy, optionally substituted lower thioalkyl, stituted cycloalkylalkyl, optionally substituted hetero optionally substituted aryloxy, optionally substituted het cycloalkyl, optionally substituted eroaryloxy, optionally substituted amino, optionally substi heterocycloalkylalkyl, optionally substituted aryl, tuted carboxyl, optionally substituted alkylsulfonylamino, optionally substituted aralkyl, optionally substituted cyano and nitro. heteroaryl, optionally substituted heteroaralkyl, 0040. In certain embodiments of the invention, the com C(Z)R, and C(Z)NR'R'; or pounds of Formula I have a structure of Formula la: 0034) both R's along with the oxygens to which they are bound combine to form a 5-7 membered optionally substituted heterocycloalkyl ring fused to the phenyl Formula Ia ring: 0035) R' at each occurrence is independently selected from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl, pro vided, however, that when R' is alkenyl, no alkene carbon thereof is bound to oxygen, optionally substi tuted lower alkynyl, provided, however, that when R' is alkynyl, no alkyne carbon thereof is bound to oxy gen, optionally substituted cycloalkyl, optionally sub whereint, V, w, x, y, k and A are as defined in Formula I stituted cycloalkylalkyl, optionally substituted hetero above; and all salts, prodrugs, tautomers and isomers cycloalkyl, optionally substituted thereof. heterocycloalkylalkyl, optionally substituted aryl, 0041). In one embodiment, A of compounds of Formula la optionally substituted aralkyl, optionally substituted has a structure of one of the following groups, in which the heteroaryl, optionally substituted heteroaralkyl, squiggle line indicates the attachment to the bicyclic core C(Z)R, and C(Z)NR'R'': structure of Formula Ia. 0036) R'7 at each occurrence is independently selected

from the group consisting of optionally substituted lower alkyl, optionally substituted lower alkenyl pro vided, however, that when R'' is alkenyl, no alkene carbon thereof is bound to N, O, or S, optionally substituted lower alkynyl, provided, however, that when R'' is alkynyl, no alkyne carbon thereof is bound to N, O, or S, optionally substituted cycloalkyl, option ally substituted cycloalkylalkyl, optionally substituted US 2006/01 00218 A1 May 11, 2006

embodiment, t is N or CH, y is N or CH, provided t and y -continued are not both N, and V, w, and X are CH. In another embodiment, t, V, W, X and y are CH. In another embodiment, t, V, w and X are CH, and y is N. In another embodiment, t and y are CH, one of V, w, and x is CR" and the others of v, w and X are CH. In another embodiment, t is CH, y is N, one of V, w, and X is CR" and the others of V, w and X are CH. Further to any of the above embodiments of Formula Ia, the compound is not

RI Y R1 1 I

O

O R17, R18 s 0043. In one emdodiment, k of compounds of Formula Ia o? 2 is selected from the group consisting of —CHR'. 1 \ N C(Z)R, C(Z)NR'R', S(O)NR'R'', and NS N —S(O).R'', wherein R. R. R. R', and R'' are selected N A from the group consisting of optionally substituted lower R17 alkyl, aryl and heteroaryl, wherein aryl and heteroaryl are optionally substituted with 1-3 substituents selected from NH2 the group consisting of halogen, optionally Substituted lower alkyl, optionally Substituted lower alkoxy, optionally Sub N N stituted lower thioalkyl, optionally substituted aryloxy, optionally substituted heteroaryloxy, optionally substituted S 2 --- amino, optionally Substituted carboxyl, optionally Substi tuted alkylsulfonylamino, cyano and nitro. 0044) In certain embodiments of the invention, the com pounds of Formula I have a structure of Formula Ib:

Formula Ib A

W

| 1N y/ tNN wherein R', R', R7 and R' are as defined in Formula I above. k 0042. In another embodiment of the invention, no more than one oft, V, w, x, and y is N. In one embodiment, t is N or CH, provided that no more than one of t, u, V, W, X, and wherein t, u, w, x, y, k and A are as defined in Formula I y is N. In one embodiment, t, u, V, W, and X are CR', and y above; and all salts, prodrugs, tautomers and isomers is N or CR'; and in a further embodiment, t is CH. In another thereof. embodiment, t is N or CH, y is N or CH, provided t and y are not both N, two of V, w, and X are CR', and the other of 0045. In one embodiment, Aof compounds of Formula Ib V, w and X is CH. In another embodiment, t is N or CH, y has a structure of one of the following groups, in which the is N or CH, provided t and y are not both N, one of V, w, and Squiggle line indicates the attachment to the bicyclic core X is CR" and the others of V, w and X are CH. In another structure of Formula Ib. US 2006/01 00218 A1 May 11, 2006

is N or CH, provided t and y are not both N, one ofu, w, and

X is CR" and the others of u, w and X are CH. In another embodiment, t is N or CH, y is N or CH, provided that tand y are not both N, and u, w, and X are CH. In another embodiment, t, u, W, X and y are CH. In another embodi ment, t is CH, y is N, one ofu, w, and x is CR" and the others ofu, w and X are CH. In another embodiment, t, u, w and X are CH and y is N. In another embodiment, t and y are CH, O O one of u, w, and x is CR" and the others of u, w and X are R 161 R 161 CH. Further to any of the above embodiments of Formula Ib, the compound is not O O

O O

S R71 O s O C s 161' 161'

\- N \- O O 0047. In one emdodiment of the invention, k of com R7, R18 s pounds of Formula Ib is selected from the group consisting o? 2 of CHR, C(Z)R, C(Z)NR2R3, | \ N S(O)NR'R'', and S(O).R'', wherein R. R. R', NS N R'', and R'' are selected from the group consisting of N A optionally substituted lower alkyl, aryl and heteroaryl, R17 wherein aryl and heteroaryl are optionally substituted with 1-3 Substituents selected from the group consisting of halo NH2 gen, optionally Substituted lower alkyl, optionally Substi tuted lower alkoxy, optionally substituted lower thioalkyl, N N optionally substituted aryloxy, optionally substituted het eroaryloxy, optionally Substituted amino, optionally Substi tuted carboxyl, optionally substituted alkylsulfonylamino, S 2 --- cyano and nitro. 0048. In certain embodiments, the compounds of For mula I have a structure of Formula Ic:

Formula Ic

wherein R', R', R7 and R' are as defined in Formula I above. 0046. In another embodiment of the invention, no more wherein t, u, V, x, y, k and A are as defined in Formula I than one of t, U. W, X, and y is N. In one embodiment, t is above; and all salts, prodrugs, tautomers and isomers N or CH, provided that no more than one of t, u, v, w, x, and thereof. y is N. In one embodiment, t, u, v. W. and X are CR', and y is N or CR'; and in a further embodiment, t is CH. In another 0049. In one embodiment, A of compounds of Formula Ic embodiment, t is N or CH, y is N or CH, provided t and y has a structure of one of the following groups, in which the are not both N, two of u, w, and X are CR', and the other of Squiggle line indicates the attachment to the bicyclic core u, w and x is CH. In another embodiment, t is N or CH, y structure of Formula Ic. US 2006/01 00218 A1 May 11, 2006

N or CH, provided t and y are not both N, one of u, V, and

X is CR" and the others of u, v and X are CH. In another embodiment, t is N or CH, y is N or CH, provided t and y are not both N, and u, V, and X are CH. In another embodi ment, t, u, V., X and y are CH. In another embodiment, t, u, V and X are CH and y is N. In another embodiment, t and y are CH, one of u, v, and X is CR" and the others of u, v and O O X are CH. In another embodiment, t is CH, one of u, v, and R 161 R 161 X is CR', the others of u, v, and X are CH, and y is N or CH, provided, however, that when the compound has the struc ture O O

OCH O HCO S R71 O s O C s 161' 161'

\- N \- O then R' is selected from the group consisting of hydrogen, F. O Cl, Br, optionally substituted lower alkyl, -C(Z)R, OR, R7, R18 s SR, C(Z)NR'R'', S(O)NR2R3, and o? 2 S(O).R. | \ N NS N 0051. In one emdodiment of the invention, k of com N A pounds of Formula Ib is selected from the group consisting R17 of CHR, C(Z)R, C(Z)NR2R3, S(O)NR'R'', and S(O).R'', wherein R. R. R', NH2 R'', and R' are selected from the group consisting of optionally substituted lower alkyl, aryl and heteroaryl, N N wherein aryl and heteroaryl are optionally substituted with 1-3 Substituents selected from the group consisting of halo S 2 --- gen, optionally Substituted lower alkyl, optionally Substi tuted lower alkoxy, optionally substituted lower thioalkyl, optionally substituted aryloxy, optionally substituted het eroaryloxy, optionally Substituted amino, optionally Substi tuted carboxyl, optionally substituted alkylsulfonylamino, cyano and nitro. 0052. In certain embodiments of the invention, the com pounds of Formula I have a structure of Formula Id:

Formula. Id A wherein R. R. R'7, and R' are as defined in Formula I N N above. 0050. In another embodiment of the invention, no more 4. N than one of t, u, v, x, and y is N. In one embodiment, t is N k or CH, provided that no more than one of t, u, V, W, X, and y is N. In one embodiment, t, u, V, W, and X are CR', and y is N or CR'; and in a further embodiment, t is CH. In another wherein k is as defined in Formula I above and A has a embodiment, t is N or CH, y is N or CH, provided t and y structure of one of the following groups, in which the are not both N, two of u, v, and X are CR', and the other of Squiggle line indicates the attachment to the bicyclic core u, v and X is CH. In another embodiment, t is N or CH, y is structure of Formula Id: US 2006/01 00218 A1 May 11, 2006

1-3 Substituents selected from the group consisting of halo

gen, optionally Substituted lower alkyl, optionally Substi tuted lower alkoxy, optionally substituted lower thioalkyl, optionally substituted aryloxy, optionally substituted het eroaryloxy, optionally Substituted amino, optionally Substi tuted carboxyl, optionally substituted alkylsulfonylamino, cyano and nitro. R 161 O R 161 O 0054. In certain embodiments of the invention, the com pounds of Formula I have a structure of Formula Ie:

O O Formula Ie

O

S

O s O s R71 C N 161' 161' N. )N. k

\- N \- O O wherein k and R' are as defined in Formula I above; and all R7, R18 s salts, prodrugs, tautomers and isomers thereof. o? 2 0055. In one embodiment of the invention, k of com | \ N pounds of Formula Ie is selected from the group consisting NS N of CHR'. C(Z)R, C(Z)NR'R'', N A S(O)NR'R'', and S(O).R'', wherein R. R. R', R17 R'', and R'' are selected from the group consisting of NH2 optionally substituted lower alkyl, aryl and heteroaryl, wherein aryl and heteroaryl are optionally substituted with N N 1-3 Substituents selected from the group consisting of halo gen, optionally Substituted lower alkyl, optionally Substi tuted lower alkoxy, optionally substituted lower thioalkyl, S 2 --- optionally substituted aryloxy, optionally substituted het eroaryloxy, optionally Substituted amino, optionally Substi tuted carboxyl, optionally substituted alkylsulfonylamino, cyano and nitro, further wherein R'' at each occurrence is independently selected from the group consisting of option ally substituted lower alkyl, optionally substituted cycloalkyl, optionally Substituted heterocycloalkyl, option ally substituted aryl, and optionally substituted heteroaryl, or each R', along with the oxygens to which they are bound combine to form a 5-7 membered optionally substituted heterocycloalkyl ring fused to the phenyl ring. In a further embodiment, when R' is optionally substituted lower alkyl, wherein R', R', R7 and R' are as defined in Formula I the alkyl is optionally substituted with 1-3 substituents above; and all salts, prodrugs, tautomers and isomers selected from the group consisting of fluoro, optionally thereof. substituted cycloalkyl, optionally substituted heterocy 0053. In one embodiment of the invention, k of com cloalkyl, optionally Substituted aryl and optionally Substi pounds of Formula Id is selected from the group consisting tuted heteroaryl. of CHR', C(Z)R, C(Z)NR'R'', S(O)NR'R'', and S(O).R'', wherein R. R. R', 0056. In certain embodiments of the invention involving R'', and R'' are selected from the group consisting of compounds of Formula I (for example, compounds of For optionally substituted lower alkyl, aryl and heteroaryl, mula Ia, Formula Ib, and Formula Ic), the bicyclic ring wherein aryl and heteroaryl are optionally substituted with structure shown in Formula I is one of the following: US 2006/01 00218 A1 May 11, 2006 10

CC).N. CO\ OC)N. N 1 \, y rry 0058. In particular embodiments of the invention, com N N N N Nan N pounds of Formula I (e.g., Formula Ia, Formula Ib, Formula Ic, Formula Id, and Formula Ie) have a substituent at the 21 N 2 1-position as a compound in the Examples; has a Substituent at the 3-position as a compound in the Examples; has a ry r \, r \, Substitutent at the 4-position as a compound in the N-N/ 's-N N-N? Examples; has a Substitutent at the 5-position as a compound in the Examples; has Substitutents at the 1- and 3-positions 21 N 21 N e N as a compound in the Examples; has substitutents at the 1 N N. N. y and 4-positions as a compound in the Examples; has Sub N N s N N N stitutents at the 1- and 5-positions as a compound in the Examples. N21 N 21 N 21 N 0059. In particular embodiments of the invention, one or X. ( ) ( ). more of the bicyclic structures shown above are embraced N N S. N s N by Formula I, e.g., any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, aN 2 2 29, 30, 31, 32, or 33 of the bicyclic core structures shown above are embraced by Formula I. N N NS N s N CC) CO, CO) 0060. In certain embodiments of the invention, A of 21 2 21 compounds of Formula I (e.g., Formula Ia, Formula Ib. Formula Ic, and Formula Id) is Substituted aryl (e.g. phenyl); O) Cy Cy substituted heteroaryl (such as 5- or 6-membered heteroaryl N N s N s N rings): aryl (e.g., phenyl) substituted with 1, 2, or 3 alkoxy 2N N N groups (such as methoxy, ethoxy, and propoxy); heteroaryl substituted with 1, 2, or 3 alkoxy groups: aryl substituted N2 \ r \ C \ with 1, 2, or 3 alkyl ether groups, alkylthioether groups, or S N Ns , 's-N? combinations thereof; heteroaryl substituted with 1, 2, or 3 alkyl ether groups, alkyl thioether groups, or combinations 21 21 21 thereof; dialkoxyphenyl; dialkylthiophenyl; dialkoxy het eroaryl; dialkylthio heteroaryl; disubstituted aryl (e.g., phe Sn O.N s O.N s O.N nyl) in which the substitutents may be the same or different, N N N e.g., hydroxyl, alkoxy, alkyl ester, —SH, thioether, thioester; N2 N 21 N 21 N disubstituted heteroaryl in which the substitutents may be the same or different, e.g., hydroxyl, alkoxy, alkyl ester, N N S. N s N —SH, thioether, thioester. In certain embodiments in which O) (CC) CO) an aryl or heteroaryl is disubstituted, the substitutents are on N21 N N21 N adjacent ring carbon atoms (e.g., catechols or catechol diethers), for 6-membered rings the two substituents may be N Cy O meta and para with respect to the linkage of the ring to the al y st y remainder of the molecule. In certain embodiments, A is N substituted aryl or substituted heteroaryl, with a substitution at the second atom away from the ring atom attached to the Nin N remainder of the molecule (e.g., the meta position for 6-membered rings), in certain embodiments, that is the only Substitution on the aryl or heteroaryl group. 0057 For compounds of Formula I, ring positions are 0061. In certain embodiments of the invention, k of specified as shown in the following indole core, but as used compounds of Formula I (e.g., Formula Ia, Formula Ib. Formula Ic, Formula Id and Formula Ie) comprises option herein, the corresponding numbering also applies to each of ally substituted aryl: optionally substituted heteroaryl; the other bicyclic core structures shown above. Reference to optionally substituted napthyl: optionally substituted bicy a bicyclic core as in Formula I or indication that a compound clic heteroaryl; napthyl substituted with alkoxy or alkylthio; includes a bicyclic core as in Formula I and phrases of heteroaryl substituted with alkoxy or alkylthio. For example similar import refer to a bicyclic structure or moiety as R. R. R. R. R', R' or R'' in k is a group so specified. described herein for embodiments of the invention embrac In particular embodiments of the preceding, the alkyl moiety ing compounds of Formula I. is methyl, ethyl, or propyl. US 2006/01 00218 A1 May 11, 2006

0062. In particular embodiments, the combination of A used herein, the term “mammal’ indicates any mammalian and k embraces any A (as specified in 0039) and any k (as species, and include without limitation, stock animals (e.g., specified in 0040), e.g., A is substituted phenyl and k sheep,goats, cattle), domesticated animals (e.g., dogs, cats), comprises optionally substituted napthyl: A is substituted 5 research animals (e.g., rats, mice), other primates, and or 6-membered heteroaryl and k comprises optionally Sub humans. stituted napthyl; A is Substituted phenyl and k comprises 0068. In another related aspect, compounds of Formula I, optionally substituted bicyclic heteroaryl; A is substituted 5 Ia, Ib, Ic, Id, or Ie can be used in the preparation of a or 6-membered heteroaryl and k comprises optionally Sub medicament for the treatment in a subject in need thereof of stituted bicyclic heteraryl, and the like. a PDE4-mediated disease or condition (or a disease or 0063. In certain embodiments of the invention, com condition mediated by a PDE4 isoform (e.g., a PDE4B- or pounds are excluded where N, O, S or C(Z) would be bound PDE4D-mediated disease or condition), or a disease or to a carbon that is also bound to N, O, S, or C(Z) or would condition in which modulation of PDE4 provides a thera be bound to an alkene carbon atom of an alkenyl group or peutic benefit. bound to an alkyne atom of an alkynyl group; accordingly, 0069. In another aspect, the invention provides a method in certain embodiments compounds are excluded from the of treating or prophylaxis of a disease or condition in a present invention in which are included linkages such as mammal in need thereof where the disease or condition is a PDE4-mediated disease or condition or a disease or condi tion in which PDE4 modulation provides a therapeutic benefit, by administering to the mammal a therapeutically effective amount of a compound of Formula I, Ia, Ib, Ic, Id, or Ie, a prodrug of Such compound, or a pharmaceutically acceptable salt of Such compound or prodrug. The com pound can be employed alone or can be part of a pharma ceutical composition. 0070. In aspects and embodiments of the invention involving treatment or prophylaxis of a disease or condition, 0064. Thus, in a first aspect, the invention provides a the disease or condition is, for example without limitation, novel compound of Formulae I, Ia, Ib, Ic, Id, or Ie as an acute or chronic pulmonary disease such as obstructive described herein. diseases (e.g. asthma, chronic obstructive pulmonary disease (COPD), cystic fibrosis), interstitial lung diseases (e.g. idio 0065. An additional aspect of this invention provides pathic pulmonary fibrosis, sarcoidosis), vascular lung dis compositions, which include pharmaceutical formulations, eases (e.g. pulmonary hypertension), bronchitis, allergic that include a therapeutically effective amount of a com bronchitis, or emphysema. Additional diseases or conditions pound of Formula I, Ia, Ib, Ic, Id, or Ie (or a compound contemplated for treatment by embodiments of the present within a Sub-group of compounds within any of those invention include, for example without limitation, CNS generic formulae) and at least one pharmaceutically accept diseases Such as Alzheimer's disease, Parkinson's disease able carrier, excipient or diluent. and Huntington's chorea; inflammatory autoimmune dis 0066. In particular embodiments, the composition eases such as multiple Sclerosis, rheumatoid arthritis and includes a plurality of different pharmacalogically active Crohn's disease as well as other inflammatory disorders, compounds, which can be a plurality of compounds of Such as cerebral ischemia, inflammatory bowel disease, Formula I and can also include other compounds in com ulcerative colitis, and atopic dermatitis; bone disease, Such bination with one or more compounds of Formula I. The as osteoporosis, osteopetrosis, and Paget’s disease; cancers, term "other compounds' in this context denotes compounds Such as diffuse large-cell B cell lymphoma, chronic lym that are given to a Subject in an effective amount to prevent, phocytic leukemia, acute lymphoblastic leukemia; Severe alleviate, or ameliorate one or more symptoms of a disease Acute Respiratory Syndrome; and pre-term labor. Specific or medical condition, and/or to prolong the Survival of the diseases or disorders which might be treated or prevented Subject being treated, wherein the disease or medical con include those described herein, and in the references cited dition is as listed herein. therein. 0067. In a related aspect, the invention provides kits that 0071. In certain embodiments involving the compounds include a composition as described herein. In particular of the invention and the use thereof, the compound is embodiments, the composition is packaged, e.g., in a vial, specific for PDE4B, or an isoform thereof, e.g., PDE4B or bottle, or flask, which may be further packaged, e.g., within PDE4D. In certain embodiments of aspects involving com a box, envelope, or bag; the composition is a pharmaceutical pounds of Formula I, Ia, Ib, Ic, Id, or Ie, the compound is composition approved by the U.S. Food and Drug Admin specific for both PDE4B and PDE4D, specific for PDE4B, istration or similar regulatory agency for administration to a or specific for PDE4D. Such specificity means that the mammal, e.g., a human; the composition is a pharmaceutical compound has at least 5-fold greater activity (preferably at composition approved for administration to a mammal, e.g., least 5-, 10-, 20-, 50-, or 100-fold greater activity, or more) a human, for a PDE4-mediated disease or condition; the kit on PDE4B and/or PDE4D than other enzymes, or on PDE4B includes written instructions or other indication that the relative to PDE4D, or PDE4D relative to PDE4B, where the composition is suitable or approved for administration to a activity is determined using a suitable assay, e.g., any assay mammal, e.g., a human, for a PDE4-mediated disease or known to one skilled in the art or as described herein. condition; the composition is packaged in unit does or single 0072. In certain embodiments, a compound of the inven dose form, e.g., single dose pills, capsules, or the like. As tion has an ICs of less than 100 nM, less than 50 nM, less US 2006/01 00218 A1 May 11, 2006

than 20 nM, less than 10 nM, less than 5 nM, or less than 1 Formula I. In addition, structural information about one or or nM with respect to at least one of PDE4B and PDE4D as more other PDEs can be utilized, e.g., PDE5A, PDE4D. determined in a generally accepted PDE4 activity assay. In one embodiment, a compound of Formula I, Ia, Ib, Ic, Id, or 0078. The invention also provides a method for devel Ie will have an ICs of less than 100 nM, less than 50 nM, oping ligands binding to a PDE4B, where the method less than 20 nM, less than 10 nM, less than 5 nM, or less than includes identifying as molecular scaffolds one or more 1 nM with respect to PDE4B. In one embodiment, a com compounds that bind to a binding site of the PDE; deter pound of Formula I, Ia, Ib, Ic, Id, or Ie, will have an ICs of mining the orientation of at least one molecular scaffold in less than 100 nM, less than 50 nM, less than 20 nM, less than co-crystals with the PDE: identifying chemical structures of 10 nM, less than 5 nM, or less than 1 nM with respect to one or more of the molecular scaffolds, that, when modified, PDE4D. In one embodiment, a compound of Formula I, Ia, alter the binding affinity or binding specificity or both Ib, Ic, Id, or Ie will have an ICs of less than 100 nM, less between the molecular scaffold and the PDE; and synthe than 50 nM, less than 20 nM, less than 10 nM, less than 5 sizing a ligand in which one or more of the chemical nM, or less than 1 nM with respect to both PDE4B and structures of the molecular scaffold is modified to provide a PDE4D. Further to any of the above embodiments, a com ligand that binds to the PDE with altered binding affinity or pound of the invention will be a specific inhibitor of either binding specificity or both. Such a scaffold can, for example, PDE4B or PDE4D, such that the ICs for one of PDE4B and be a compound of Formula I, include a scaffold core as in PDE4D will be at least about 5-fold, also 10-fold, also Formula I, or include a bicyclic core as in Formula I. 20-fold, also 50-fold, or at least about 100-fold less than the 0079. In an alternative embodiment, the invention pro ICs for the other of PDE4B and PDE4D. vides a method for developing or identifying ligands binding 0073. In certain embodiments of the invention, the com to a PDE4B. The method comprises determining the orien pounds of Formula I, Ia, Ib, Ic, Id, or Ie, with activity on tation of at least one molecular scaffold in co-crystals with PDE4 will also have desireable pharmacologic properties. In the PDE wherein the molecular scaffold is contained with particular embodiments the desired pharmacologic property one or more compounds that bind to a binding site of the is any one or more of serum half-life longer than 2 hr (also PDE: identifying chemical structures of one or more of the longer than 4 hr, also longer than 8 hr), aqueous solubility, molecular scaffolds, that, when modified, alter the binding and oral bioavailability more than 10% (also more than affinity or binding specificity or both between the molecular 20%). scaffold and the PDE; and modifying the chemical structures so identified to provide a ligand that binds to the PDE with 0074 The identification of compounds of Formula I with altered binding affinity or binding specificity or both. Such activity on PDE4, or on isoforms thereof such as PDE4B or a scaffold can, for example, be a compound of Formula I, PDE4D, also provides a method for identifying or develop include a scaffold core as in Formula I, or include a bicyclic ing additional compounds with activity on PDE4 (or on the core as in Formula I. respective PDE4 isoform), e.g., improved modulators, by determining whether any of a plurality of test compounds of 0080. In a related aspect, the invention provides a method Formula I with activity on PDE4 provides an improvement for developing ligands specific for PDE4 (or a PDE4 iso in one or more desired pharmacologic properties relative to form such as PDE4B or PDE4D), where the method a reference compound with activity on PDE4, and selecting involves determining whether a derivative of a compound a compound if any, that has an improvement in the desired that binds to a plurality of phosphodiesterases has greater pharmacologic property, thereby providing an improved specificity for the particular phosphodiesterase than the modulator. In certain embodiments, the desired pharmaco parent compound with respect to other phosphodiesterases. logic property is at least 2-fold, 4-fold, 6-fold, 8-fold, In one embodiment, the plurality of phosphodiesterases 10-fold, 20-fold, 50-fold, 100-fold, or more than 100-fold, comprises PDE4B and PDE4D. In another embodiment, the greater activity on PDE4B than on PDE4D. In further plurality of phosphodiesterases comprises PDE4B and embodiments, the desired pharmacologic property is an ICso PDE5A. In a further embodiment, the compound that binds of less than 10 uM, less than 1 uM, less than 100 nM, less to a plurality of phosphodiesterases binds to PDE4B with an than 10 nM, or less than 1 nM. affinity at least 2-fold, e.g., 4-fold, 6-fold, 8-fold, 10-fold, 20-fold, 50-fold, or 100-fold, greater than for binding to any 0075. In particular embodiments of the invention of the plurality of phosphodiesterases. In yet another embracing modulator development, the desired pharmaco embodiment, the compound that binds to a plurality of logic property is serum half-life longer than 2 hr (or longer phosphodiesterases, binds weakly, wherein “weakly' indi than 4 hr or longer than 8 hr), aqueous solubility, oral cates that the ICso of the compound is greater than 1 JuM. bioavailability more than 10% (or oral bioavailability more e.g., 2 uM, 5uM, 10 uM, 20 uM, 50 uM, 100 uM, 200 uM, than 20%). 500 uM, 1 mM, or greater. 0.076 Also in particular embodiments of the invention 0081. In another aspect, the invention provides a method embracing modulator development, the reference compound for obtaining improved ligands binding to PDE4B, where is a compound of Formula I. The process can be repeated the method involves identifying a compound that binds to multiple times, i.e., multiple rounds of preparation of deriva that particular PDE, determining whether that compound tives and/or selection of additional related compounds and interacts with one or more conserved active site residues, evaluation of such further derivatives of related compounds, and determining whether a derivative of that compound e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more additional rounds. binds to that PDE with greater affinity or greater specificity 0077. In additional aspects, structural information about or both than the parent binding compound. Binding with PDE4B is utilized, e.g., in conjunction with compounds of greater affinity or greater specificity or both than the parent Formula I or a molecular scaffold or scaffold core of compound indicates that the derivative is an improved US 2006/01 00218 A1 May 11, 2006

ligand. This process can also be carried out in Successive e.g., having atomic coordinates as described in Tables 1, 2, rounds of selection and derivatization and/or with multiple and 3. The crystalline form can contain one or more heavy parent compounds to provide a compound or compounds metal atoms, for example, atoms useful for X-ray crystal with improved ligand characteristics. Likewise, the deriva lography. The crystal can also include a binding compound tive compounds can be tested and selected to give high in a co-crystal, e.g., a binding compound that interacts with selectivity for that PDE, or to give cross-reactivity to a one more more conserved active site residues in the PDE, or particular set of targets, for example to a Subset of phos any two, any three, any four, any five, any six of those phodiesterases that includes PDE4B and/or PDE4D. In residues, and can, for example, be a known PDE inhibitor. particular embodiments, known PDE4B inhibitors can be Such PDE crystals can be in various environments, e.g., in used, and derivatives with greater affinity and/or greater a crystallography plate, mounted for X-ray crystallography, specificity can be developed, preferably using PDE4B and/ and/or in an X-ray beam. The PDE may be of various forms, or PDE4D structure information; greater specificity for e.g., a wild-type, variant, truncated, and/or mutated form as PDE4B relative to PDE4D is developed. described herein. 0082 For Formula I, there are multiple scaffold cores 0088. The invention further provides co-crystals of described by Formula I. Such a scaffold core includes a PDE4B, which may be a reduced length PDE, e.g., a bicyclic core as described above for Formula I, with an phosphodiesterase domain, and a PDE4B binding com attached aryl or heteroaryl group of Substituent group A as pound. In certain embodiments, the binding compound specified above. Thus, for each of the bicyclic cores shown within the crystal interacts with one or more conserved above, there are corresponding scaffold cores for each of the PDE4B active site residues. Advantageously, such co-crys positions of A, and for each aryl and heteroaryl group that tals are of Sufficient size and quality to allow structural is the initial moiety of A linked to the bicyclic core. determination of the PDE to at least 3 Angstroms, 2.5 Angstroms, 2.0 Angstroms, 1.8 Angstroms, 1.7 Angstroms, 0083. In another aspect, structural information about 1.5 Angstroms, 1.4 Angstroms, 1.3 Angstroms, or 1.2 Ang PDE4B can also be used to assist in determining a structure stroms. The co-crystals can, for example, be in a crystal for another phosphodiesterase by creating a homology lography plate, be mounted for X-ray crystallography and/or model from an electronic representation of a PDE4B struc in an X-ray beam. Such co-crystals are beneficial, for ture. Such homology model is then equated with the struc example, for obtaining structural information concerning ture of the other phosphodiesterase. interaction between the PDE and binding compounds. 0084 Typically, creating such a homology model 0089. In particular embodiments, the binding compound involves identifying conserved amino acid residues between the known PDE having known structures, e.g., PDE4B, and includes the bicyclic core or scaffold core structure as in the other phosphodiesterase of interest (e.g., PDE5A); trans Formula I, or is a compound of Formula I. ferring the atomic coordinates of a plurality of conserved 0090 PDE4B binding compounds can include com amino acids in the known structure to the corresponding pounds that interact with at least one of conserved active site amino acids of the other phosphodiesterase to provide a residues in the PDE, or any 2, 3, 4, 5, or 6 of those residues. rough structure of that phosphodiesterase; and constructing Exemplary compounds that bind to PDE4B include com structures representing the remainder of the other phos pounds described in references cited herein. phodiesterase using electronic representations of the struc 0091 Likewise, in additional aspects, methods for tures of the remaining amino acid residues in the other obtaining PDE4B crystals and co-crystals are provided. In phosphodiesterase. In particular, for PDE4B, coordinates one aspect, a method for obtaining a crystal of PDE4B from Table 1 and 2 can be used. Conserved residues in a phosphodiesterase domain is provided by subjecting PDE4B binding site can be used. protein at 5-20 mg/ml, e.g., 8-12 mg/ml, to crystallization 0085 To assist in developing other portions of the phos conditions substantially equivalent to 30% PEG 400, 0.2M phodiesterase structure, the homology model can also uti MgCl, 0.1M Tris pH 8.5, 1 mM binding compound, at 4 lize, or be fitted with, low resolution X-ray diffraction data C.; or 20% PEG 3000, 0.2M Ca(OAc), 0.1M Tris pH 7.0, from one or more crystals of the phosphodiesterase, e.g., to 1 mM binding compound, 15.9 mg/ml protein at 4° C.; or assist in linking conserved residues and/or to better specify 1.8M-2.0M ammonium sulphate, 0.1 M CAPS pH 10.0- coordinates for terminal portions of a polypeptide. 10.5, 0.2M lithium sulphate. 0086) The PDE4B structural information used can be for 0092 Crystallization conditions can be initially identified a variety of different variants, including full-length wild using a screening kit, such as a Hampton Research (River type, naturally-occurring variants (e.g., allelic variants and side, Calif.) Screening kit 1. Conditions resulting in crystals splice variants), truncated variants of wild type or naturally can be selected and crystallization conditions optimized occuring variants, and mutants of full-length or truncated based on the demonstrated crystallization conditions. To wild-type or naturally-occurring variants (that can be assist in Subsequent crystallography, the PDE can be seleno mutated at one or more sites). For example, in order to methionine labeled. Also, as indicated above, the PDE may provide a PDE4B structure closer to a variety of other be any of various forms, e.g., truncated to provide a phos phosphodiesterase structures, a mutated PDE4B that phodiesterase domain, which can be selected to be of various includes a mutation to a conserved residue in a binding site lengths. can be used. 0093. In another aspect, the identification of compounds 0087. In another aspect, the invention provides a crystal active on PDE4B (such as compounds developed using comprising a crystalline form of PDE4B, which may be a methods described herein) makes it possible for one to reduced length PDE4B such as a phosphodiesterase domain, modulate the PDE activity by contacting PDE with a com US 2006/01 00218 A1 May 11, 2006

pound that binds to PDE and interacts with one more form of PDE4B; the electronic representation includes rep conserved active site residues. The compound is preferably resentations coordinates of conserved residues as in Table 1 provided at a level sufficient to modulate the activity of the or 2. PDE by at least 10%, more preferably at least 20%, 30%, 0099. In yet another aspect, the structural and sequence 40%, or 50%. In many embodiments, the compound will be information of PDE4B can be used in a homology model for at a concentration of about 1 uM, 100 uM, or 1 mM, or in another PDE. It is helpful if high resolution structural a range of 1-100 nM, 100-500 nM, 500-1000 nM, 1-100 uM, information for PDE4B is used for such a model, e.g., at 100-500 uM, or 500-1000 uM. least 1.7, 1.5, 1.4, 1.3, or 1.2 Angstrom resolution. 0094. In a related aspect, the invention provides a method 0100. In still another aspect, the invention provides an for treating a subject Suffering from a disease or condition electronic representation of a modified PDE4B crystal struc characterized by abnormal PDE4 activity (e.g., abnormal ture, that includes an electronic representation of the atomic PDE4B, PDE4D activity), where the method involves coordinates of a modified PDE4B based on the atomic administering to the Subject a compound identified by a coordinates of Table 1 and/or 2. In an exemplary embodi method as described herein. ment, atomic coordinates of one of the listed tables can be 0.095 Because crystals of PDE4B have been developed modified by the replacement of atomic coordinates for a and analyzed, and binding modes of ligands determined in conserved residue with atomic coordinates for a different Such crystals, another aspect of the invention provides an amino acid. Modifications can include Substitutions, dele electronic representation of these PDEs (which may be a tions (e.g., C-terminal and/or N-terminal detections), inser reduced length PDE), for example, an electronic represen tions (internal, C-terminal, and/or N-terminal) and/or side tation containing atomic coordinate representations for chain modifications. PDE4B corresponding to the coordinates listed for PDE4B 0101. In another aspect, the PDE4B structural informa in Table 1 and 2, or a schematic representation Such as one tion provides a method for developing useful biological showing secondary structure and/or chain folding, and may agents based on PDE4B, by analyzing a PDE4B structure to also show conserved active site residues. The PDE may be identify at least one sub-structure for forming the biological wild type, an allelic variant, a mutant form, or a modifed agent. Such Sub-structures can include epitopes for antibody form, e.g., as described herein. In particular, the PDE may formation, and the method includes developing antibodies consist essentially of a PDE4B phosphodiesterase domain. against the epitopes, e.g., by injecting an epitope presenting composition in a mammal Such as a rabbit, guinea pig, pig, 0096. The electronic representation can also be modified goat, or horse. The Sub-structure can also include a mutation by replacing electronic representations of particular residues site at which mutation is expected to or is known to alter the with electronic representations of other residues. Thus, for activity of the PDE4B, and the method includes creating a example, an electronic representation containing atomic mutation at that site. Still further, the sub-structure can coordinate representations corresponding to the coordinates include an attachment point for attaching a separate moiety, for PDE4B listed in Tables 1 or 2 can be modified by the for example, a peptide, a polypeptide, a solid phase material replacement of coordinates for a particular conserved resi (e.g., beads, gels, chromatographic media, slides, chips, due in a binding site by a different amino acid. Following a plates, and well Surfaces), a linker, and a label (e.g., a direct modification or modifications, the representation of the label such as a fluorophore or an indirect label, such as biotin overall structure can be adjusted to allow for the known or other member of a specific binding pair). The method can interactions that would be affected by the modification or include attaching the separate moiety. modifications. In most cases, a modification involving more than one residue will be performed in an iterative manner. 0102) In another aspect, the invention provides a method for identifying potential PDE4B binding compounds by 0097. In addition, an electronic representation of a fitting at least one electronic representation of a compound PDE4B binding compound or a test compound in the in an electronic representation of the PDE binding site. The binding site can be included, e.g., a non-hydrolyzable cAMP representation of the binding site may be part of an elec analog or a compound including the core structure of tronic representation of a larger portion(s) or all of a PDE sildenafil. molecule or may be a representation of only the catalytic domain or of the binding site or active site. The electronic 0098. Likewise, in a related aspect, the invention pro representation may be as described above or otherwise vides an electronic representation of a portion of PDE4B, described herein. For PDE4B the electronic representation which can be a binding site (which can be an active site) or includes representations of coordinates according to Tables phosphodiesterase domain, for example, PDE4B residues 1 and/or 2 (in particular residues with coordinates differing 152-528 of JC1519 (SEQ ID NO:1), or other phosphodi signficantly from the previously proposed PDE4B struc esterase domain described herein. A binding site or phos phodiesterase domain can be represented in various ways, ture). In certain embodiments, the compound complexed e.g., as representations of atomic coordinates of residues with PDE4B is an anlog of c(GMP which is non-hydrolyz around the binding site and/or as a binding site Surface able. contour, and can include representations of the binding 0103) In particular embodiments, the method involves character of particular residues at the binding site, e.g., fitting a computer representation of a compound from a conserved residues. The binding site preferably includes no computer database with a computer representation of the more than 1 heavy metal atom; a binding compound or test active site of the PDE, and involves removing a computer compound Such as a compound including the core structure representation of a compound complexed with the PDE of Formula I may be present in the binding site; the binding molecule and identifying compounds that best fit the active site may be of a wild type, variant, mutant form, or modified site based on favorable geometric fit and energetically US 2006/01 00218 A1 May 11, 2006 favorable complementary interactions as potential binding binding of the modified compound to PDE4B. The linker compounds. In particular embodiments, the compound is a can be attached to an attachment component as described known PDE4B inhibitor, e.g., as described in a reference above. cited herein, or a derivative thereof. 0.111) Another aspect of the invention provides a modified 0104. In other embodiments, the method involves modi PDE4B polypeptide that includes a modification that makes fying a computer representation of a compound complexed the modified PDE4B more similar than native PDE4B to with the PDE molecule, by the deletion or addition or both another phosphodiesterase, and can also include other muta of one or more chemical groups; fitting a computer repre tions or other modifications. In various embodiments, the sentation of a compound from a computer database with a polypeptide includes a full-length PDE4B polypeptide, computer representation of the active site of the PDE includes a modified PDE4B binding site, includes at least molecule; and identifying compounds that best fit the active 20, 30, 40, 50, 60, 70, or 80 contiguous amino acid residues site based on favorable geometric fit and energetically derived from PDE4B including a conserved site. favorable complementary interactions as potential binding 0112 Still another aspect of the invention provides a compounds. In certain embodiments, the fitting comprises method for developing a ligand for a phosphodiesterase that determining whether potential binding compounds interact includes conserved residues matching any one, 2, 3, 4, 5, or with one or more of conserved PDE4B active site residues. 6 of conserved PDE4B active site residues respectively, by 0105. In still other embodiments, the method involves determining whether a compound binds to the phosphodi removing a computer representation of a compound com esterase and interacts with Such active site residues in a plexed with the PDE, and searching a database for com PDE4B crystal or a PDE4B binding model having coordi pounds having structural similarity to the complexed com nates as in Table 1 and/or 2. The method can also include pound using a compound searching computer program or determining whether the compound modulates the activity replacing portions of the complexed compound with similar of the phosphodiesterase. Preferably the phosphodiesterase chemical structures using a compound construction com has at least 50, 55, 60, or 70% identity over an equal length puter program. phosphodiesterase domain segment. In certain embodi ments, the compound is a compound of Formula I. 0106 Fitting a compound can include determining 0113. In yet another aspect, the invention provides a whether a compound will interact with one or more con method for developing or identifying a ligand for a phos served active site residues for the PDE. Compounds selected phodiesterase wherein the phosphodiesterase comprises for fitting or that are complexed with the PDE can, for conserved residues matching one or more PDE4B active site example, be a known PDE4B inhibitor compound, or a residues. The method comprises determining whether a compound including the core structure of Such compound. PDE4B binding compound binds to said phosphodiesterase, 0107. In another aspect, the invention provides a method and determining whether the PDE4B binding compound for attaching a PDE4B binding compound to an attachment interacts with one or more conserved PDE4B active site component without Substantially changing the binding of the residues in a crystal structure. In a further embodiment, the binding compound to PDE4B, as well as a method for method comprises determining whether a PDE4B binding identifying attachment sites on a PDE4B binding compound. compound which binds to the phosphodiesterase interacts The method involves identifying energetically allowed sites with one or more conserved PDE4B active site residues in for attachment of an attachment component for the binding a crystal structure. compound bound to a binding site of PDE4B; and attaching 0114. In particular embodiments, determining includes the compound or a derivative thereof to the attachment computer fitting the compound in a binding site of the component at the energetically allowed site. In this context, phosphodiesterase and/or the method includes forming a “Substantially changing the binding denotes a change in co-crystal of the phosphodiesterase and the compound. Such IC, after attachment of less than 3 log units, e.g., 1 nM to 1 co-crystals can be used for determining the binding orien LM. In certain embodiments, the binding compound is a tation of the compound with the phosphodiesterase and/or compound of Formula I. provide structural information on the phosphodiesterase, 0108 Attachment components can include, for example, e.g., on the binding site and interacting amino acid residues. linkers (including traceless linkers) for attachment to a solid Such binding orientation and/or other structural information phase or to another molecule or other moiety. Such attach can be accomplished using X-ray crystallography. ment can be formed by Synthesizing the compound or 0115 The invention also provides compounds that bind derivative on the linker attached to a solid phase medium, to and/or modulate (e.g., inhibit) PDE4B phosphodiesterase e.g., in a combinatorial synthesis of a plurality of com activity e.g., compounds identified by the methods described pounds. Likewise, the attachment to a solid phase medium herein. Accordingly, in aspects of the invention involving can provide an affinity medium (e.g., for affinity chroma PDE4B binding compounds, molecular scaffolds, and tography). ligands or modulators, the compound is a weak binding compound; a moderate binding compound; a strong binding 0109 The attachment component can also include a compound; the compound interacts with one or more con label, which can be a directly detectable label such as a served active site residues in the PDE; the compound is a fluorophore, or an indirectly detectable such as a member of small molecule; the compound binds to a plurality of dif a specific binding pair, e.g., biotin. ferent phosphodiesterases (e.g., at least 2, 3, 4, 5, 7, 10, or 0110. The ability to identify energentically allowed sites more different phosphodiesterases). In particular, the inven on a PDE4B binding compound, also, in a related aspect, tion provides compounds identified or selected. provides modified binding compounds that have linkers 0116. In yet another embodiment, the invention provides attached, preferably at an energetically allowed site for a method for identifying a compound having selectivity US 2006/01 00218 A1 May 11, 2006 between PDE4B and PDE4D by utilizing particular differ the previously reported PDE4B crystal structure, and shows ential sites. The method involves analyzing whether a com significant structure differences. pound differentially interacts in PDE4B and PDE4D in at least one of the differential sites, where a differential inter DETAILED DESCRIPTION OF THE action is indicative of such selectivity. The differential sites PREFERRED EMBODIMENTS are identified from crystal structure comparison. The term 0.122 Table 1 provides atomic coordinates for human “differential site' denotes a site, i.e., a location, where the PDE4B phosphodiesterase domain including residues 155 chemical features of PDE4B and PDE4D interact differently 507. In this table, the various columns have the following with the compound. The term “chemical feature' is under content, beginning with the left-most column: stood by those of skill in the art to denote structural and chemical properties responsible for chemical reactivity 0123 ATOM: Refers to the relevant moiety for the (including binding) and include without limitation hydrogen table row; bond donor or acceptors, hydrophobic/lipophilic sites, posi tively ionizable sites, negatively ionizable sites, charge 0.124. Atom number: Refers to the arbitrary atom num density, electronegativity, and the like. ber designation within the coordinate table; 0117. In particular embodiments, the analyzing includes 0.125 Atom Name: Identifier for the atom present at fitting an electronic representation of the compound in the particular coordinates; electronic representations of binding sites of PDE4B and 0.126 Chain ID: Chain ID refers to one monomer of PDE4D, and determining whether the compound differen the protein in the crystal, e.g., chain 'A', or to other tially interacts based on said fitting; the method involves compound present in the crystal, e.g., HOH for water, selecting an initial compound that binds to both PDE4B and and L for a ligand or binding compound. Multiple PDE4D, fitting an electronic representation of the initial copies of the protein monomers will have different compound in electronic representations of binding sites of chain Ids; PDE4B and PDE4D, modifying the electronic representa tion of the initial compound with at least one moiety that 0127. Residue Number: The amino acid residue num interacts with at least differentials site, and determining ber in the chain; whether the modified compound differentially binds to 0128 X, Y, Z: Respectively are the X, Y, and Z PDE4B and PDE4D: the modified compound binds differ coordinate values; entially to a greater extent than does the initial compound; the method also includes assaying a compound that differ 0.129 Occupancy: Describes the fraction of time the entially interacts for differential activity on PDE4B and atom is observed in the crystal. For example, occu PDE4D; the initial compound includes the sildenafil scaffold pancy=1 means that the atom is present all the time; structure; the initial compound can include the sildenafil occupancy=0.5 indicates that the atom is present in the core. Sildenafil is 1-4-ethoxy-3-(6,7-dihydro-1-methyl-7- location 50% of the time; oxo-3-propyl-1H-pyrazolo 4,3-dipyrimidin-5-yl)phenylsul 0.130 B-factor: A measure of the thermal motion of the fonyl-4-methylpiperazine. In certain emboidments, the atom; binding compound is a compound of Formula I. 0131 Element: Identifier for the element. 0118. In the various aspects described above that involve atomic coordinates for PDE4B in connection with binding 0.132 Table 2 provides atomic coordinate data for compounds, the coordinates provided in Tables 1 or 2 can be PDE4B phosphodiesterase domain co-crystal with 4-(3,4- used. Those coordinates can then be adjusted using conven dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine 50. tional modeling methods to fit compounds having structures 0.133 Table 3 provides amino acid and nucleic acid different from sildenafil, and can thus be used for develop sequences for PDE4B phosphodiesterase domain as used in ment of different PDE4B modulators, relative to currently the work described herein. described PDE4B modulators. PDE4B crystal coordinates provided herein can be used instead of the previously 0.134 Table 4 shows the alignment of the phosphodi described PDE4B structure coordinate because the present esterase domains of PDE4B and PDE4D, with 3 regions that structure coordinates correct apparent errors in the previ can be exploited for designing selective ligands indicated by ously described structure (e.g., as shown by the structure filled squares beneath the regions. overlay in FIG. 4), and thus are better adapted for PDE4B 0.135 Table 5 provides activity of exemplary compounds ligand development and other uses of PDE4B structure of Formula I in assays that assess inhibition of PDE4B or information Such as the uses described herein. PDE4D as described in Examples 145-147. 0119) Additional aspects and embodiments will be appar 0.136. As used herein the following definitions apply ent from the following Detailed Description and from the unless otherwise indicated: claims. 0.137 "Halo' or “halogen’ alone or in combination BRIEF DESCRIPTION OF THE DRAWINGS means all halogens, that is, chloro (Cl), fluoro (F), bromo (Br), or iodo (I). 0120 FIG. 1 shows a ribbon diagram schematic repre sentation of PDE4B phosphodiesterase domain having the 0.138) “Hydroxyl refers to the group —OH. sequence in Table 3. 0139) “Thiol’ or “mercapto' refers to the group —SH. 0121 FIG. 2 shows an overlay of ribbon diagram sche 0140 “Alkyl alone or in combination means an matic representations of the present PDE4B structure and alkane-derived radical containing from 1 to 20, preferably 1 US 2006/01 00218 A1 May 11, 2006

to 15, carbon atoms (unless specifically defined). It is a double bond is not such as to confer aromaticity to the ring. straight chain alkyl or branched alkyl, and includes a straight Carbon to carbon double bonds may be either contained chain or branched alkyl group that contains or is interrupted within a cycloalkyl portion, with the exception of cyclopro by a cycloalkyl portion. The straight chain or branched alkyl pyl, or within a straight chain or branched portion. Examples group is attached at any available point to produce a stable of alkenyl groups include ethenyl, propenyl, isopropenyl, compound. Examples of this include, but are not limited to, butenyl, cyclohexenyl, cyclohexenylalkyl and the like. 4-(isopropyl)-cyclohexylethyl or 2-methyl-cyclopropylpen “Optionally substituted alkenyl' denotes alkenyl or alkenyl tyl. In many embodiments, an alkyl is a straight or branched that is independently substituted with 1 to 3 groups or alkyl group containing from 1-15, 1-8, 1-6, 1-4, or 1-2, substituents as defined in O110 attached at any available carbon atoms, such as methyl, ethyl, propyl, isopropyl. point to produce a stable compound. butyl, t-butyl and the like. “Optionally substituted alkyl denotes alkyl or alkyl that is independently substituted with 0144). “Lower alkenyl refers to an alkenyl group having 1 to 3 groups or Substituents selected from the group 1-6 carbon atoms. “Optionally substituted lower alkenyl consisting of halo, hydroxy, optionally Substituted lower denotes lower alkenyl or lower alkenyl that is substituted alkoxy, optionally Substituted acyloxy, optionally Substi with 1 to 3 groups or substituents as defined in O110 tuted aryloxy, optionally substituted heteroaryloxy, option attached at any available point to produce a stable com ally substituted cycloalkyloxy, optionally substituted hetero pound. cycloalkyloxy, thiol, optionally substituted lower alkylthio. 0145 “Alkynyl alone or in combination means a optionally substituted arylthio, optionally substituted het straight or branched hydrocarbon containing 2-20, prefer eroarylthio, optionally substituted cycloalkylthio, optionally ably 2-17, more preferably 2-10, even more preferably 2-8. substituted heterocycloalkylthio, optionally substituted most preferably 2-4, carbon atoms containing at least one, alkylsulfinyl, optionally substituted arylsulfinyl, optionally preferably one, carbon to carbon triple bond. Examples of substituted heteroarylsulfinyl, optionally substituted alkynyl groups include ethynyl, propynyl, butynyl and the cycloalkylsulfinyl, optionally substituted heterocycloalkyl like. “Optionally substituted alkynyl' denotes alkynyl or sulfinyl, optionally substituted alkylsulfonyl, optionally sub alkynyl that is independently substituted with 1 to 3 groups stituted arylsulfonyl, optionally substituted heteroarylsulfo or substituents as defined in 0110 attached at any available nyl, optionally Substituted cycloalkylsulfonyl, optionally point to produce a stable compound. substituted heterocycloalkylsulfonyl, optionally substituted amino, optionally Substituted amido, optionally Substituted 0146 “Lower alkynyl refers to an alkynyl group having amidino, optionally Substituted urea, optionally Substituted 1-6 carbon atoms. “Optionally substituted lower alkynyl' aminosulfonyl, optionally Substituted alkylsulfonylamino, denotes lower alkynyl or lower alkynyl that is substituted optionally Substituted arylsulfonylamino, optionally Substi with 1 to 3 groups or substituents as defined 0110 attached tuted heteroarylsulfonylamino, optionally substituted at any available point to produce a stable compound. cycloalkylsulfonylamino, optionally Substituted heterocy 0147 “Alkoxy” or “lower alkoxy' denotes the group cloalkylsulfonylamino, optionally Substituted alkylcarbony —OR", wherein R is alkyl or lower alkyl, respectively. lamino, optionally Substituted arylcarbonylamino, option “Optionally substituted alkoxy” or “optionally substituted ally Substituted heteroarylcarbonylamino, optionally lower alkoxy' denotes alkoxy or lower alkoxy in which R' Substituted cycloalkylcarbonylamino, optionally Substituted is optionally substituted alkyl or optionally substituted lower heterocycloalkylcarbonylamino, optionally Substituted car alkyl, respectively. boxyl, optionally substituted acyl, optionally substituted cycloalkyl, optionally Substituted heterocycloalkyl, option 0148 “Acyloxy” denotes the group —OC(O)R, wherein ally substituted aryl, optionally substituted heteroaryl, nitro, R is hydrogen, lower alkyl, cycloalkyl, heterocycloalkyl, and cyano, attached at any available point to produce a aryl, or heteroaryl. "Optionally substituted acyloxy' denotes stable compound. acyloxy in which Rb is hydrogen, optionally substituted 0141 “Lower alkyl refers to an alkyl group having 1-6 lower alkyl, optionally Substituted cycloalkyl, optionally carbon atoms. “Optionally substituted lower alkyl denotes substituted heterocycloalkyl, optionally substituted aryl, or lower alkyl or lower alkyl that is independently substituted optionally substituted heteroaryl. with 1 to 3 groups or substituents as defined in 101101 0149) “Aryloxy” denotes the group – OR, wherein R is attached at any available point to produce a stable com aryl. “Optionally substituted aryloxy' denotes aryloxy or pound. aryloxy in which R is optionally substituted aryl. 0142 "Lower alkylene' refers to a divalent alkane-de 0150 “Heteroaryloxy” denotes the group —OR, rived radical containing 1-6 carbon atoms, straight chain or wherein R is heteroaryl. "Optionally substituted heteroary branched, from which two hydrogen atoms are taken from loxy” denotes heteroaryloxy in which R is optionally sub the same carbon atom or from different carbon atoms. stituted heteroaryl. Examples of lower alkylene include, but are not limited to, —CH2—, —CH2CH2—, and —CH2CH(CH)—. 0151. “Cycloalkyloxy” denotes the group —OR, wherein R is cycloalkyl. "Optionally substituted cycloalky 0143 “Alkenyl alone or in combination means a loxy' denotes cycloalkyloxy in which R is optionally sub straight, branched, or cyclic hydrocarbon containing 2-20. stituted cycloalkyl. preferably 2-17, more preferably 2-10, even more preferably 2-8, most preferably 2-4, carbon atoms and at least one, 0152) “Heterocycloalkyloxy” denotes the group —OR, preferably 1-3, more preferably 1-2, most preferably one, wherein R is heterocycloalkyl. "Optionally substituted het carbon to carbon double bond. In the case of a cycloalkenyl erocycloalkyloxy” denotes heterocycloalkyloxy in which R' group, conjugation of more than one carbon to carbon is optionally substituted heterocycloalkyl. US 2006/01 00218 A1 May 11, 2006

0153 “Alkylthio’ or “lower alkylthio’ denotes the group 0.163 “Optionally substituted sulfonyl denotes the —OR, wherein R is alkyl or lower alkyl, respectively. group —S(O).RY, wherein RY is optionally substituted “Optionally substituted alkylthio’ or “optionally substituted lower alkyl, optionally Substituted cycloalkyl, optionally lower alkylthio’ denotes alkylthio or lower alkylthio in substituted heterocycloalkyl, optionally substituted aryl, or which R is optionally substituted alkyl or optionally sub optionally substituted heteroaryl. stituted lower alkyl, respectively. 0.164 “Optionally substituted aminosulfonyl' denotes 0154) “Arylthio” denotes the group - SR", wherein R is the group —S(O)NR'R'', wherein R* and R are indepen aryl. “Optionally substituted arylthio’ denotes arylthio in dently hydrogen, optionally substituted lower alkyl, option which R" is optionally substituted aryl. ally substituted cycloalkyl, optionally substituted heterocy cloalkyl, optionally substituted aryl, or optionally 0155) “Heteroarylthio” denotes the group—SR, wherein substituted heteroaryl, or R* and R together with the nitro R is heteroaryl. "Optionally substituted heteroarylthio” gen to which they are attached form a 5-7 membered denotes heteroarylthio in which R is optionally substituted optionally substituted heterocycloalkyl or optionally substi heteroaryl. tuted heteroaryl ring. 0156 “Cycloalkylthio” denotes the group –SR, 0.165 “Carboxyl” denotes the group –C(O)OR, wherein R is cycloalkyl. "Optionally substituted cycloalky wherein R is hydrogen, lower alkyl, cycloalkyl, heterocy lthio” denotes cycloalkylthio in which R is optionally sub cloalkyl, aryl, or heteroaryl. “Optionally substituted car stituted cycloalkyl. boxyl denotes carboxyl wherein R is hydrogen, optionally O157) “Heterocycloalkylthio’ denotes the group –SR, substituted lower alkyl, optionally substituted cycloalkyl, wherein R is heterocycloalkyl. "Optionally substituted het optionally substituted heterocycloalkyl, optionally substi erocycloalkylthio" denotes heterocycloalkylthio in which R', tuted aryl, or optionally substituted heteroaryl. is optionally substituted heterocycloalkyl. 0166 “Aryl refers to a ring system-containing aromatic hydrocarbon Such as phenyl or naphthyl, which may be 0158 “Acyl' denotes groups - C(O)R, wherein R is optionally fused with a cycloalkyl of preferably 5-7, more hydrogen, lower alkyl, cycloalkyl, heterocycloalkyl, aryl, or preferably 5-6, ring members. “Optionally substituted aryl heteroaryl. “Optionally substituted acyl denotes acyl in denotes aryl or aryl that is substituted with 1 to 3 groups or which R" is hydrogen, optionally substituted lower alkyl, substituents as defined in 0110), optionally substituted optionally substituted cycloalkyl, optionally substituted het lower alkyl, optionally substituted lower alkenyl, or option erocycloalkyl, optionally Substituted aryl, or optionally Sub ally substituted lower alkynyl, attached at any available stituted heteroaryl. point to produce a stable compound. A “substituted aryl is 0159 “Optionally substituted amino” denotes the group aryl that is substituted with 1 to 3 groups or substituents as - NR"R", wherein R" and R" are independently hydrogen, defined in 0110), or optionally substituted lower alkyl, optionally substituted lower alkyl, optionally substituted optionally substituted lower alkenyl, or optionally substi cycloalkyl, optionally Substituted heterocycloalkyl, option tuted lower alkynyl, attached at any available point to ally substituted aryl, optionally substituted heteroaryl, produce a stable compound. optionally substituted acyl, or optionally substituted sulfo 0167 “Aralkyl” refers to the group -R" Ar wherein nyl, or, R" and R" together with the nitrogen to which they Ar is an aryl group and R" is lower alkylene. “Optionally are attached form a 5-7 membered optionally substituted substituted aralkyl denotes aralkyl or aralkyl in which the heterocycloalkyl or optionally substituted heteroaryl ring. lower alkylene group is optionally substituted with 1 to 3 0160 “Optionally substituted amido” denotes the group groups or substituents as defined in O110 attached at any —C(O)NR'RP, wherein RandRP are independently hydro available point to produce a stable compound, and in which gen, optionally Substituted lower alkyl, optionally Substi the aryl group is optionally substituted with 1 to 3 groups or tuted cycloalkyl, optionally substituted heterocycloalkyl, substituents as defined in 0110), optionally substituted optionally substituted aryl, or optionally substituted het lower alkyl, optionally substituted lower alkenyl, or option eroaryl, or R and RP together with the nitrogen to which ally substituted lower alkynyl, attached at any available they are attached form a 5-7 membered optionally substi point to produce a stable compound. tuted heterocycloalkyl or optionally substituted heteroaryl 0168 “Heteroaryl alone or in combination refers to a r1ng. monocyclic aromatic ring structure containing 5 or 6 ring 0161 “Optionally substituted amidino denotes the atoms, or a bicyclic aromatic group having 8 to 10 atoms, group –C(=NR)NR'R', wherein R, R', and R are inde containing one or more, preferably 1-4, more preferably 1-3, pendently hydrogen or optionally Substituted lower alkyl. even more preferably 1-2, heteroatoms independently selected from the group consisting of O, S, and N. Het 0162 “Optionally substituted urea' denotes the group eroaryl is also intended to include oxidized S or N, such as - NRC(O)NR'R'', wherein R is hydrogen or optionally Sulfinyl, Sulfonyl, and N-oxide of a tertiary ring nitrogen. A substituted lower alkyl, and R and RY are independently carbon or nitrogen atom is the point of attachment of the hydrogen, optionally Substituted lower alkyl, optionally Sub heteroaryl ring structure Such that a stable aromatic ring is stituted cycloalkyl, optionally substituted heterocycloalkyl, retained. Examples of heteroaryl groups include, but are not optionally substituted aryl or optionally substituted het limited to, pyridinyl, pyridazinyl, pyrazinyl, quinaoxalyl, eroaryl, or R and R together with the nitrogen to which indolizinyl, benzobthienyl, quinazolinyl, purinyl, indolyl, they are attached form a 5-7 membered optionally substi quinolinyl, pyrimidinyl, pyrrolyl, oxazolyl, thiazolyl, thie tuted heterocycloalkyl or optionally substituted heteroaryl nyl, isoxazolyl, Oxathiadiazolyl, isothiazolyl, tetrazolyl, imi r1ng. dazolyl, triazinyl, furanyl, benzofuryl, and indolyl. “Option US 2006/01 00218 A1 May 11, 2006

ally substituted heteroaryl includes heteroaryl or heteroaryl tuted lower alkynyl, attached at any available carbon or that is substituted with 1 to 3 groups or substituents as nitrogen to produce a stable compound. defined in 0110), optionally substituted lower alkyl, option ally substituted lower alkenyl, or optionally substituted 0.173) “Heterocycloalkylalkyl” refers to the group-R- lower alkynyl, attached at any available carbon or nitrogen Het wherein Het is a heterocycloalkyl group, and R is a to produce a stable compound. “Substituted heteroaryl lower alkylene group. “Optionally substituted heterocy denotes heteroaryl that is substituted with 1 to 3 groups or cloalkylalkyl denotes heterocycloalkylalkyl or heterocy substituents as defined in 0110), or optionally substituted cloalkylalkyl in which the lower alkylene group is optionally lower alkyl, optionally substituted lower alkenyl, or option substituted with 1 to 3 groups or substituents as defined in ally substituted lower alkynyl, attached at any available 0110), attached at any available point to produce a stable carbon or nitrogen to produce a stable compound compound, and in which the heterocycloalkyl group is optionally substituted with 1 to 3 groups or substituents as 0169) “Heteroaralkyl” refers to the group -R-HetAr defined in 0110), optionally substituted lower alkyl, option wherein HetAr is a heteroaryl group, and R is lower ally substituted lower alkenyl, or optionally substituted alkylene. “Optionally substituted heteroaralkyl denotes lower alkynyl, attached at any available point to produce a heteroaralkyl or heteroaralkyl in which the lower alkylene stable compound. group is optionally Substituted with 1 to 3 groups or Sub stituents as defined in O110), attached at any available point 0.174 “Optionally substituted alkylsulfinyl' denotes the to produce a stable compound, and in which the heteroaryl group —S(O)R, wherein R is optionally substituted group is optionally Substituted with 1 to 3 groups or Sub lower alkyl. stituents as defined in 0110), optionally substituted lower 0175 “Optionally substituted arylsulfinyl' denotes the alkyl, optionally substituted lower alkenyl, or optionally group S(O)R", wherein R" is optionally substituted aryl. substituted lower alkynyl, attached at any available point to produce a stable compound. 0176 "Optionally substituted heteroarylsulfinyl' denotes the group –S(O)R’s, wherein R is optionally substituted 0170 “Cycloalkyl refers to saturated or unsaturated, heteroaryl. non-aromatic monocyclic, bicyclic or tricyclic carbon ring systems of 3-8, more preferably 3-6, ring members per ring, 0177) “Optionally substituted cycloalkylsulfinyl' denotes Such as cyclopropyl, cyclopentyl, cyclohexyl, adamantyl, the group —S(O)R", wherein R" is optionally substituted and the like. "Optionally substituted cycloalkyl denotes cycloalkyl. cycloalkyl or cycloalkyl that is substituted with 1 to 3 groups (0178) "Optionally substituted heterocycloalkylsulfinyl” or substituents as defined in 0110), optionally substituted denotes the group —S(O)R", wherein R" is optionally sub lower alkyl, optionally substituted lower alkenyl, or option stituted heterocycloalkyl. ally substituted lower alkynyl, attached at any available carbon or nitrogen to produce a stable compound. (0179) “Optionally substituted alkylsulfonyl” denotes the group - S(O).R, wherein R is optionally substituted 0171 “Cycloalkylalkyl refers to the group -R-Cyc lower alkyl. wherein Cyc is a cycloalkyl group, and R is a lower alkylene group. "Optionally substituted cycloalkylalkyl 0180 “Optionally substituted arylsulfonyl denotes the denotes cycloalkylalkyl or cycloalkylalkyl in which the group —S(O).R, wherein R is optionally substituted lower alkylene group is optionally substituted with 1 to 3 aryl. groups or substituents as defined in O110), attached at any available point to produce a stable compound, and in which 0181 “Optionally substituted heteroarylsulfonyl the cycloalkyl group is optionally substituted with 1 to 3 denotes the group - S(O).R", wherein R' is optionally groups or substituents as defined in 0110), optionally sub substituted heteroaryl. stituted lower alkyl, optionally substituted lower alkenyl, or 0182 “Optionally substituted cycloalkylsulfonyl optionally Substituted lower alkynyl, attached at any avail denotes the group —S(O).R", wherein R" is optionally able point to produce a stable compound. substituted cycloalkyl. 0172 “Heterocycloalkyl refers to a saturated or unsat 0183 “Optionally substituted heterocycloalkylsulfonyl urated non-aromatic cycloalkyl group having from 5 to 10 denotes the group —S(O).R", wherein R" is optionally atoms in which from 1 to 3 carbon atoms in the ring are substituted heterocycloalkyl. replaced by heteroatoms of O. S or N, and are optionally fused with benzo or heteroaryl of 5-6 ring members. Het 0.184 “Optionally substituted alkylsulfonylamino” erocycloalkyl is also intended to include oxidized S or N. denotes the group - NRS(O).RPP, wherein RPP is option Such as Sulfinyl, Sulfonyl and N-oxide of a tertiary ring ally substituted lower alkyl, and R is hydrogen or option nitrogen. The point of attachment of the heterocycloalkyl ally substituted lower alkyl. ring is at a carbon or nitrogen atom Such that a stable ring 0185 “Optionally substituted arylsulfonylamino” is retained. Examples of heterocycloalkyl groups include, but are not limited to, morpholino, tetrahydrofuranyl, dihy denotes the group - NRS(O),R, wherein R is option dropyridinyl, piperidinyl, pyrrolidinyl, piperazinyl, dihy ally substituted aryl, and R is hydrogen or optionally drobenzofuryl, and dihydroindolyl. “Optionally substituted substituted lower alkyl. heterocycloalkyl denotes heterocycloalkyl or heterocy 0186 "Optionally substituted heteroarylsulfonylamino” cloalkyl that is substituted with 1 to 3 groups or substituents denotes the group —NRS(O).R, wherein R is option as defined in 0110), optionally substituted lower alkyl, ally substituted heteroaryl, and R is hydrogen or optionally optionally substituted lower alkenyl, or optionally substi substituted lower alkyl. US 2006/01 00218 A1 May 11, 2006 20

0187 “Optionally substituted cycloalkylsulfonylamino” 5 nM, or less than 1 nM with respect to one or more PDE4 denotes the group —NRS(O).Rf, wherein R is option as determined in a generally accepted PDE4 activity assay. ally substituted cycloalkyl, and R is hydrogen or option 0196) As used herein, the term “PDE4-mediated” disease ally substituted lower alkyl. or condition and like terms refer to a disease or condition in 0188 “Optionally substituted heterocycloalkylsulfony which the biological function of PDE4 affects the develop lamino” denotes the group - NRS(O).R", wherein R" is ment and/or course of the disease or condition, and/or in optionally substituted heterocycloalkyl, and R is hydrogen which modulation of PDE4 alters the development, course, or optionally substituted lower alkyl. and/or symptoms of the disease or condition. Similarly, the phrase “PDE4 modulation provides a therapeutic benefit 0189 “Optionally substituted alkylcarbonylamino” indicates that modulation of the level of activity of PDE4 in denotes the group - NRC(O)R", wherein R" is option a subject indicates that such modulation reduces the severity ally substituted lower alkyl, and R is hydrogen or option and/or duration of the disease, reduces the likelihood or ally substituted lower alkyl. delays the onset of the disease or condition, and/or causes an 0.190 “Optionally substituted arylcarbonylamino” improvement in one or more symptoms of the disease or denotes the group - NRC(O)RY, wherein RY is option condition. In some cases the disease or condition may be ally substituted aryl, and R is hydrogen or optionally mediated by one of the the PDE4 isoforms, e.g., PDE4B, substituted lower alkyl. PDE4C, or PDE4D. 0191) “Optionally substituted heteroarylcarbonylamino” 0197). In the present context, the term “therapeutically denotes the group - NRC(O)RY, wherein RY is option effective' indicates that the materials or amount of material ally substituted heteroaryl, and R is hydrogen or optionally is effective to prevent, alleviate, or ameliorate one or more substituted lower alkyl. symptoms of a disease or medical condition, and/or to prolong the Survival of the Subject being treated. 0192 “Optionally substituted cycloalkylcarbonylamino” denotes the group - NRC(O)R^*, wherein R^* is option 0198 The term “pharmaceutically acceptable' indicates ally substituted cycloalkyl, and R is hydrogen or option that the indicated material does not have properties that ally substituted lower alkyl. would cause a reasonably prudent medical practitioner to avoid administration of the material to a patient, taking into 0193 “Optionally substituted heterocycloalkylcarbony consideration the disease or conditions to be treated and the lamino” denotes the group —NRC(O)R’, wherein R is respective route of administration. For example, it is com optionally substituted heterocycloalkyl, and R is hydrogen monly required that such a material be essentially sterile, or optionally substituted lower alkyl. e.g., for injectibles. 0194 As used herein, the terms “composition' and 0199 The term “pharmaceutically acceptable metabo “pharmaceutical composition” refer to a preparation that lite' refers to a pharmacologically acceptable product, includes a therapeutically significant quantity of an active which may be an active product, produced through metabo agent, that is prepared in a form adapted for administration lism of a specified compound (or salt thereof) in the body of to a Subject. Thus, the preparation does not include any a Subject or patient. Metabolites of a compound may be component or components in Such quantity that a reasonably identified using routine techniques known in the art, and prudent medical practitioner would find the preparation their activities determined using tests such as those unsuitable for administration to a normal Subject. In many described herein. For example, in Some compounds, one or cases, such a pharmaceutical composition is a sterile prepa more alkoxy groups can be metabolized to hydroxyl groups ration. while retaining pharmacologic activity and/or carboxyl groups can be esterified, e.g., glucuronidation. In some 0.195 As used herein in connection with PDE4 modulat ing compound, binding compounds or ligands, the term cases, there can be more than one metabolite, where an “specific for PDE4 phosphodiesterase”, “specific for PDE4” intermediate metabolite(s) is further metabolized to provide and terms of like import mean that a particular compound an active metabolite. For example, in Some cases a deriva binds to PDE4 to a statistically greater extent than to other tive compound resulting from metabolic glucuronidation phosphodiesterases that may be present in a particular may be inactive or of low activity, and can be further organism, e.g., at least 2, 3, 4, 5, 10, 20, 50, 100, or metabolized to provide an active metabolite. 1000-fold. Also, where biological activity other than binding 0200 “A pharmaceutically acceptable salt' is intended to is indicated, the term “specific for PDE4' indicates that a mean a salt that retains the biological effectiveness of the particular compound has greater biological activity associ free acids and bases of the specified compound and that is ated with binding PDE4 than to other phosphodiesterases not biologically or otherwise unacceptable. A compound of (e.g., at a level as indicated for binding specificity). Prefer the invention may possess a Sufficiently acidic, a sufficiently ably, the specificity is also with respect to other biomol basic, or both functional groups, and accordingly react with ecules (not limited to phosphodiesterases) that may be any of a number of inorganic or organic bases, and inorganic present from an organism. Such binding and/or activity and organic acids, to form a pharmaceutically acceptable specificity may be for a PDE4 isoform, e.g., PDE4A, salt. Exemplary pharmaceutically acceptable salts include PDE4B, PDE4C, PDE4D, such that the specificity is also those salts prepared by reaction of the compounds of the with respect to the other PDE4 isoforms. In the context of present invention with a mineral or organic acid or an ligands interacting with PDE4, the terms “activity on', inorganic base, such as salts including sodium, chloride, “activity toward, and like terms mean that such ligands Sulfates, pyrosulfates, bisulfates, Sulfites, bisulfites, phos have ICso less than 10 uM, less than 1 uM, less than 100 nM, phates, monohydrogenphosphates, dihydrogenphosphates, less than 50 nM, less than 20 nM, less than 10 nM, less than metaphosphates, pyrophosphates, chlorides, bromides, US 2006/01 00218 A1 May 11, 2006

iodides, acetates, propionates, decanoates, caprylates, acry one structural difference, e.g., by having one or more Sub lates, formates, isobutyrates, caproates, heptanoates, propi stituents added and/or removed and/or substituted, and/or by olates, oxalates, malonates. Succinates, Suberates, sebacates, having one or more atoms Substituted with different atoms. fumarates, maleates, butyne-1,4 dioates, hexyne-1,6-dio Unless clearly indicated to the contrary, the term "deriva ates, benzoates, chlorobenzoates, methylbenzoates, dini tive' does not mean that the derivative is synthesized using trobenzoates, hydroxybenzoates, methoxybenzoates, phtha the parent compound as a starting material or as an inter lates, Sulfonates, Xylenesulfonates, phenylacetates, mediate, although in some cases, the derivative may be phenylpropionates, phenylbutyrates, citrates, lactates, synthesized from the parent. gamma.-hydroxybutyrates, glycollates, tartrates, methane 0205 Thus, the term “parent compound” refers to a Sulfonates, propanesulfonates, naphthalene-1-sulfonates, reference compound for another compound, having struc naphthalene-2-sulfonates, and mandelates. tural features continued in the derivative compound. Often 0201 The terms “PDE4B phosphodiesterase” and but not always, a parent compound has a simpler chemical “PDE4B' mean an enzymatically active phosphodiesterase structure than the derivative. that contains a portion with greater than 90% amino acid 0206 By “chemical structure' or “chemical substruc sequence identity to amino acid residues 152-528 (S152 ture' is meant any definable atom or group of atoms that S528) with reference to GenBank polypeptide sequence constitute a part of a molecule. Normally, chemical Sub JC1519 (SEQID NO:1) of native PDE4B as shown in Table structures of a scaffold or ligand can have a role in binding 4, for a maximal alignment over an equal length segment; or of the scaffold or ligand to a target molecule, or can that contains a portion with greater than 90% amino acid influence the three-dimensional shape, electrostatic charge, sequence identity to at least 200 contiguous amino acids and/or conformational properties of the scaffold or ligand. from amino acid residues 152-528 of JC1519 (SEQ ID NO: 1) of native PDE4B that retains binding to natural 0207. The term “binds' in connection with the interaction PDE4B ligand. Preferably the sequence identity is at least between a target and a potential binding compound indicates 95, 97,98, 99, or even 100%. Preferably the specified level that the potential binding compound associates with the of sequence identity is over a sequence at least 300 con target to a statistically significant degree as compared to tiguous amino acid residues in length. The sequence repre association with proteins generally (i.e., non-specific bind sented by amino acid residues 152-528 of JC1519 (SEQ ID ing). Thus, the term “binding compound” refers to a com NO: 1) is also available as S324 to S700 of NP 002591 pound that has a statistically significant association with a (SEQ ID NO:3, encoded by NM 002600, SEQID NO:4), target molecule. Preferably a binding compound interacts S309 to S685 of AAB96381 (SEQ ID NO:5), and S194 to with a specified target with a dissociation constant (k) of 1 S570 of AAA35643 (SEQID NO:6). Therefore, amino acid mM or less. A binding compound can bind with “low residues identified in one of the listed sequences can also be affinity”, “very low affinity”, “extremely low affinity”, expressed as the matching amino acid residue in any other “moderate affinity”, “moderately high affinity', or “high of the listed sequences or other matching sequence. affinity” as described herein. 0202) The term “PDE4B phosphodiesterase domain' 0208. In the context of compounds binding to a target, the refers to a reduced length PDE4B (i.e., shorter than a term “greater affinity’ indicates that the compound binds full-length PDE4B by at least 100 amino acids that includes more tightly than a reference compound, or than the same the phosphodiesterase, catalytic region in PDE4B. Highly compound in a reference condition, i.e., with a lower dis preferably for use in this invention, the phosphodiesterase Sociation constant. In particular embodiments, the greater domain retains phosphodiesterase activity, preferably at affinity is at least 2, 3, 4, 5, 8, 10, 50, 100, 200, 400, 500, least 50% the level of phosphodiesterase activity as com 1000, or 10,000-fold greater affinity. pared to the native PDE4B, more preferably at least 60, 70. 0209 Also in the context of compounds binding to a 80, 90, or 100% of the native activity. biomolecular target, the term “greater specificity' indicates that a compound binds to a specified target to a greater extent 0203 As used herein, the terms “ligand’ and “modula than to another biomolecule or biomolecules that may be tor' are used equivalently to refer to a compound that present under relevant binding conditions, where binding to modulates the activity of a target biomolecule, e.g., an such other biomolecules produces a different biological enzyme Such as a kinase or phosphodiesterase. Generally a activity than binding to the specified target. Typically, the ligand or modulator will be a small molecule, where “small specificity is with reference to a limited set of other bio molecule refers to a compound with a molecular weight of molecules, e.g., in the case of PDE4B, other phosphodi 1500 daltons or less, or preferably 1000 daltons or less, 800 esterases (e.g., PDE5A) or other PDE4 isoforms (e.g., daltons or less, or 600 daltons or less. Thus, an “improved PDE4D) or even other type of enzymes. In particular ligand is one that possesses better pharmacological and/or embodiments, the greater specificity is at least 2, 3, 4, 5, 8, pharmacokinetic properties than a reference compound, 10, 50, 100, 200, 400, 500, or 1000-fold greater specificity. where “better can be defined by a person for a particular biological system or therapeutic use. In terms of the devel 0210. As used in connection with binding of a compound opment of ligands from scaffolds, a ligand is a derivative of with a target, the term “interact indicates that the distance a scaffold. from a bound compound to a particular amino acid residue will be 5.0 angstroms or less. In particular embodiments, the 0204. In the context of binding compounds, molecular distance from the compound to the particular amino acid scaffolds, and ligands, the term "derivative' or "derivative residue is 4.5 angstroms or less, 4.0 angstroms or less, or 3.5 compound” refers to a compound having a chemical struc angstroms or less. Such distances can be determined, for ture that contains a common core chemical structure as a example, using co-crystallography, or estimated using com parent or reference compound, but differs by having at least puter fitting of a compound in an active site. US 2006/01 00218 A1 May 11, 2006 22

0211 Reference to particular amino acid residues in 0216 By “orientation', in reference to a binding com PDE4B polypeptide residue number is defined by the num pound bound to a target molecule is meant the spatial bering corresponding to NCBI protein sequence accession relationship of the binding compound (which can be defined number JC1519 (SEQID NO:1), as described, for example, by reference to at least some of its consitituent atoms) to the in McLaughlin et al., J. Biol. Chem. 268 (9), 6470-6476 binding pocket and/or atoms of the target molecule at least (1993); Obernolte et al., Gene 129 (2), 239-247 (1993); and partially defining the binding pocket. Bolger et al., Mol. Cell. Biol. 13 (10), 6558-6571 (1993). As 0217. In the context of target molecules in this invention, indicated above, alternate numbering from other matching the term "crystal” refers to a regular assemblage of a target PDE4B sequences can also be used. molecule of a type suitable for X-ray crystallography. That 0212. By “molecular scaffold' or “scaffold' is meant a is, the assemblage produces an X-ray diffraction pattern simple target binding molecule to which one or more addi when illuminated with a beam of X-rays. Thus, a crystal is tional chemical moieties can be covalently attached, modi distinguished from an aggolmeration or other complex of fied, or eliminated to form a plurality of molecules with target molecule that does not give a diffraction pattern. common structural elements. The moieties can include, but are not limited to, a halogen atom, a hydroxyl group, a 0218. By “co-crystal' is meant a complex of the com methyl group, a nitro group, a carboxyl group, or any other pound, molecular scaffold, or ligand bound non-covalently type of molecular group including, but not limited to, those to the target molecule and present in a crystal form appro recited in this application. Molecular scaffolds bind to at priate for analysis by X-ray or protein crystallography. In least one target molecule, preferably to a plurality of mol preferred embodiments the target molecule-ligand complex ecules in a protein family, and the target molecule can can be a protein-ligand complex. preferably be a enzyme, receptor, or other protein. Preferred 0219. The phrase “alter the binding affinity or binding characteristics of a scaffold can include binding at a target specificity' refers to changing the binding constant of a first molecule binding site Such that one or more Substituents on compound for another, or changing the level of binding of a the scaffold are situated in binding pockets in the target first compound for a second compound as compared to the molecule binding site; having chemically tractable struc level of binding of the first compound for third compounds, tures that can be chemically modified, particularly by Syn respectively. For example, the binding specificity of a com thetic reactions, so that a combinatorial library can be easily pound for a particular protein is increased if the relative level constructed; having chemical positions where moieties can of binding to that particular protein is increased as compared be attached that do not interfere with binding of the scaffold to binding of the compound to unrelated proteins. to a protein binding site, such that the scaffold or library members can be modified to form ligands, to achieve 0220. As used herein in connection with test compounds, additional desirable characteristics, e.g., enabling the ligand binding compounds, and modulators (ligands), the term to be actively transported into cells and/or to specific organs, “synthesizing” and like terms means chemical synthesis or enabling the ligand to be attached to a chromatography from one or more precursor materials. column for additional analysis. Thus, a molecular scaffold is 0221) The phrase “chemical structure of the molecular an identified target binding molecule prior to modification to scaffold is modified’ means that a derivative molecule has a improve binding affinity and/or specificity, or other phar chemical structure that differs from that of the molecular macalogic properties. scaffold but still contains common core chemical structural 0213) The term “scaffold core” refers to the core structure features. The phrase does not necessarily mean that the of a molecular scaffold onto which various substituents can molecular scaffold is used as a precursor in the synthesis of be attached. Thus, for a number of scaffold molecules of a the derivative. particular chemical class, the scaffold core is common to all 0222 By “assaying is meant the creation of experimen the scaffold molecules. In many cases, the scaffold core will tal conditions and the gathering of data regarding a particu consist of or include one or more ring structures. lar result of the experimental conditions. For example, 0214 By “binding site' is meant an area of a target enzymes can be assayed based on their ability to act upon a molecule to which a ligand can bind non-covalently. Binding detectable Substrate. A compound or ligand can be assayed sites embody particular shapes and often contain multiple based on its ability to bind to a particular target molecule or binding pockets present within the binding site. The par molecules. ticular shapes are often conserved within a class of mol 0223. By a “set of compounds is meant a collection of ecules, such as a molecular family. Binding sites within a compounds. The compounds may or may not be structurally class also can contain conserved structures such as, for related. example, chemical moieties, the presence of a binding pocket, and/or an electrostatic charge at the binding site or 0224. As used herein, the term “modulating or “modu Some portion of the binding site, all of which can influence late” refers to an effect of altering a biological activity, the shape of the binding site. especially a biological activity associated with a particular 0215 By “binding pocket' is meant a specific volume biomolecule such as PDE4 or an isoform thereof, e.g., within a binding site. A binding pocket can often be a PDE4B. For example, an agonist or antagonist of a particu particular shape, indentation, or cavity in the binding site. lar biomolecule modulates the activity of that biomolecule, Binding pockets can contain particular chemical groups or e.g., an enzyme. structures that are important in the non-covalent binding of 0225. The term “PDE4 activity” refers to a biological another molecule Such as, for example, groups that contrib activity of PDE4, particularly including phosphodiesterase ute to ionic, hydrogen bonding, or van der Waals interactions activity. Similar terms apply to the particular PDE4 iso between the molecules. forms, e.g., PDE4A, PDE4B, PDE4C, and PDE4D. US 2006/01 00218 A1 May 11, 2006

0226. In the context of the use, testing, or screening of pulmonary hypertension), bronchitis, allergic bronchitis, and compounds that are or may be modulators, the term “con emphysema. Additional diseases or conditions contemplated tacting” means that the compound(s) are caused to be in for treatment by embodiments of the present invention Sufficient proximity to a particular molecule, complex, cell, include for example, without limitation, CNS diseases such tissue, organism, or other specified material that potential as Alzheimer's disease, Parkinson's disease and Hunting binding interactions and/or chemical reaction between the ton's chorea; inflammatory autoimmune diseases such as compound and other specified material can occur. multiple sclerosis, rheumatoid arthritis and Crohn's disease as well as other inflammatory disorders, such as cerebral I. General ischemia, inflammatory bowel disease, ulcerative colitis, 0227. The present invention provides compounds of For and atopic dermatitis; bone disease, Such as osteoporosis, mula that are inhibitors of PDE4B, and methods for the use osteopetrosis, and Paget’s disease; cancers, such as diffuse of PDE4B phosphodiesterase structures, structural informa large-cell B cell lymphoma, chronic lymphocytic leukemia, tion, and related compositions for developing improved acute lymphoblastic leukemia; Severe Acute Respiratory compounds with those structures that modulate PDE4B Syndrome; and pre-term labor. phosphodiesterase activity. II. Crystalline PDE4B 0228) A number of patent publications have concerned 0235 Crystalline PDE4B includes native crystals, phos PDE4 inhibitors and their use. Most such publications have phodiesterase domain crystals, derivative crystals and co focused on PDE4D. For example, Marfat et al., U.S. Pat. No. crystals. The native crystals generally comprise Substantially 6,559,168 describes PDE4 inhibitors, especially PDE4D pure polypeptides corresponding to PDE4B in crystalline inhibitors, and cites additional patent publications that form. PDE4B phosphodiesterase domain crystals generally describe additional PDE4 inhibitors. Such additional publi comprise substantially pure PDE4B phosphodiesterase cations include Marfat et al., WO 98/45268; Saccoomano et domain in crystalline form. In connection with the devel al., U.S. Pat. No. 4,861,891; Pon, U.S. Pat. No. 5,922,557: opment of inhibitors of PDE4B phosphodiesterase function, and Eggleston, WO 99/20625. it is advantageous to use PDE4B phosphodiesterase domain 0229 Ait Ikhlefet al., U.S. Patent Publ. 20030064374, respectively for structural determination, because use of the application Ser. No. 10/983,754 describes compounds active reduced sequence simplifies structure determination. To be on PDE4B and their use in treatment of neurotoxicity, useful for this purpose, the phosphodiesterase domain including treatment in neurodegenerative diseases such as should be active and/or retain native-type binding, thus Alzheimers disease, Parkinson's disease, multiple Sclerosis, indicating that the phosphodiesterase domain takes on Sub Huntington's chorea, and cerebral ischemia. stantially normal 3D structure. 0236. It is to be understood that the crystalline phos 0230 All of the cited references above are incorporated phodiesterases and phosphodiesterase domains of the inven herein by reference in their entireties, including without tion are not limited to naturally occurring or native phos limitation for the descriptions of inhibitors and their uses as phodiesterase. Indeed, the crystals of the invention include well as for assays, syntheses, and for identification and crystals of mutants of native phosphodiesterases. Mutants of preparation of the PDEs and derivatives. native phosphodiesterases are obtained by replacing at least 0231 Exemplary Diseases Associated with PDE4B. one amino acid residue in a native phosphodiesterase with a 0232 Modulation of PDE4B has been correlated with different amino acid residue, or by adding or deleting amino treatment of a number of different diseases and conditions. acid residues within the native polypeptide or at the N- or A number of patent publications have described PDE4 C-terminus of the native polypeptide, and have Substantially inhibitors and their use. Most such publications have the same three-dimensional structure as the native phos focused on PDE4D. For example, Marfat et al., U.S. Pat. No. phodiesterase from which the mutant is derived. 6,559,168 describes PDE4 inhibitors, especially PDE4D 0237 By having substantially the same three-dimen inhibitors, and cites additional patent publications that sional structure is meant having a set of atomic structure describe additional PDE4 inhibitors. Such additional publi coordinates that have a root-mean-square deviation of less cations include Marfat et al., WO 98/45268; Saccoomano et than or equal to about 2 A when superimposed with the al., U.S. Pat. No. 4,861,891; Pon, U.S. Pat. No. 5,922,557: atomic structure coordinates of the native phosphodiesterase and Eggleston, WO 99/20625. from which the mutant is derived when at least about 50% to 100% of the Co. atoms of the native phosphodiesterase 0233 Ait Ikhlefet al., U.S. Patent Publ. 20030064374, domain are included in the Superposition. application Ser. No. 10/983,754 describes compounds active 0238 Amino acid substitutions, deletions and additions on PDE4B and their use in treatment of neurotoxicity, which do not significantly interfere with the three-dimen including treatment in neurodegenerative diseases such as sional structure of the phosphodiesterase will depend, in Alzheimers disease, Parkinson's disease, multiple Sclerosis, part, on the region of the phosphodiesterase where the Huntington's chorea, and cerebral ischemia. substitution, addition or deletion occurs. In highly variable 0234 Thus, PDE4B modulators can be used for treate regions of the molecule, non-conservative Substitutions as ment or prophylaxis of Such conditions correlated with well as conservative substitutions may be tolerated without PDE4 and in particular PDE4B. Additional conditions that significantly disrupting the three-dimensional, structure of can be treated include, without limitation, an acute or the molecule. In highly conserved regions, or regions con chronic pulmonary disease Such as obstructive diseases (e.g. taining significant secondary structure, conservative amino asthma, chronic obstructive pulmonary disease (COPD), acid substitutions are preferred. Such conserved and variable cystic fibrosis), interstitial lung diseases (e.g. idiopathic regions can be identified by sequence alignment of PDE4B pulmonary fibrosis, sarcoidosis), vascular lung diseases (e.g. with other phosphodiesterases. US 2006/01 00218 A1 May 11, 2006 24

0239 Conservative amino acid substitutions are well structures of protein molecules arise from crystals grown known in the art, and include Substitutions made on the basis from a concentrated aqueous solution of that protein. The of similarity in polarity, charge, solubility, hydrophobicity, process of X-ray crystallography can include the following hydrophilicity and/or the amphipathic nature of the amino steps: acid residues involved. For example, negatively charged amino acids include aspartic acid and glutamic acid; posi 0246 (a) synthesizing and isolating (or otherwise tively charged amino acids include lysine and arginine; obtaining) a polypeptide; amino acids with uncharged polar head groups having 0247 (b) growing a crystal from an aqueous solution similar hydrophilicity values include the following: leucine, comprising the polypeptide with or without a modula isoleucine, Valine; glycine, alanine; asparagine, glutamine: tor, and serine, threonine; phenylalanine, tyrosine. Other conserva tive amino acid substitutions are well known in the art. 0248 (c) collecting X-ray diffraction patterns from the crystals, determining unit cell dimensions and symme 0240 Forphosphodiesterases obtained in whole or in part try, determining electron density, fitting the amino acid by chemical synthesis, the selection of amino acids available for substitution or addition is not limited to the genetically sequence of the polypeptide to the electron density, and encoded amino acids. Indeed, the mutants described herein refining the structure. may contain non-genetically encoded amino acids. Conser 0249 Production of Polypeptides Vative amino acid Substitutions for many of the commonly known non-genetically encoded amino acids are well known 0250) The native and mutated phosphodiesterase in the art. Conservative substitutions for other amino acids polypeptides described herein may be chemically synthe can be determined based on their physical properties as sized in whole or part using techniques that are well-known compared to the properties of the genetically encoded amino in the art (see, e.g., Creighton (1983) Biopolymers 22(1):49 acids. 58). 0241. In some instances, it may be particularly advanta 0251 Alternatively, methods which are well known to geous or convenient to Substitute, delete and/or add amino those skilled in the art can be used to construct expression acid residues to a native phosphodiesterase in order to vectors containing the native or mutated phosphodiesterase provide convenient cloning sites in cDNA encoding the polypeptide coding sequence and appropriate transcrip tional/translational control signals. These methods include polypeptide, to aid in purification of the polypeptide, and for in vitro recombinant DNA techniques, synthetic techniques crystallization of the polypeptide. Such substitutions, dele and in Vivo recombination/genetic recombination. See, for tions and/or additions which do not substantially alter the example, the techniques described in Maniatis, T (1989). three dimensional structure of the native phosphodiesterase Molecular cloning. A laboratory Manual. Cold Spring Har domain will be apparent to those of ordinary skill in the art. bor Laboratory, New York. Cold Spring Harbor Laboratory 0242. It should be noted that the mutants contemplated Press; and Ausubel, F. M. et al. (1994) Current Protocols in herein need not all exhibit phosphodiesterase activity. Molecular Biology. John Wiley & Sons, Secaucus, N.J. Indeed, amino acid substitutions, additions or deletions that interfere with the phosphodiesterase activity but which do 0252) A variety of host-expression vector systems may be not significantly alter the three-dimensional structure of the utilized to express the phosphodiesterase coding sequence. domain are specifically contemplated by the invention. Such These include but are not limited to microorganisms such as bacteria transformed with recombinant bacteriophage DNA, crystalline polypeptides, or the atomic structure coordinates plasmid DNA or cosmid DNA expression vectors containing obtained therefrom, can be used to identify compounds that the phosphodiesterase domain coding sequence; yeast trans bind to the native domain. These compounds can affect the formed with recombinant yeast expression vectors contain activity of the native domain. ing the phosphodiesterase domain coding sequence; insect 0243 The derivative crystals of the invention can com cell systems infected with recombinant virus expression prise a crystalline phosphodiesterase polypeptide in covalent vectors (e.g., baculovirus) containing the phosphodiesterase association with one or more heavy metal atoms. The domain coding sequence; plant cell Systems infected with polypeptide may correspond to a native or a mutated phos recombinant virus expression vectors (e.g., cauliflower phodiesterase. Heavy metal atoms useful for providing mosaic virus, CaMV; tobacco mosaic virus, TMV) or trans derivative crystals include, by way of example and not formed with recombinant plasmid expression vectors (e.g., limitation, gold, mercury, selenium, etc. Ti plasmid) containing the phosphodiesterase domain cod 0244. The co-crystals of the invention generally comprise ing sequence; or animal cell systems. The expression ele a crystalline phosphodiesterase domain polypeptide in asso ments of these systems vary in their strength and specifici ciation with one or more compounds. The association may ties. be covalent or non-covalent. Such compounds include, but 0253 Depending on the host/vector system utilized, any are not limited to, cofactors, Substrates, Substrate analogues, of a number of Suitable transcription and translation ele inhibitors, allosteric effectors, etc. ments, including constitutive and inducible promoters, may be used in the expression vector. For example, when cloning III. Three Dimensional Structure Determination Using in bacterial systems, inducible promoters such as p, of X-Ray Crystallography bacteriophage W. plac, ptrp, ptac (ptrp-lac hybrid promoter) 0245 X-ray crystallography is a method of solving the and the like may be used; when cloning in insect cell three dimensional structures of molecules. The structure of systems, promoters such as the baculovirus polyhedrin pro a molecule is calculated from X-ray diffraction patterns moter may be used; when cloning in plant cell systems, using a crystal as a diffraction grating. Three dimensional promoters derived from the genome of plant cells (e.g., heat US 2006/01 00218 A1 May 11, 2006 shock promoters; the promoter for the small subunit of 0261 Generally, co-crystallization of phosphodiesterase RUBISCO; the promoter for the chlorophyll a?b binding and binding compound can be accomplished using condi protein) or from plant viruses (e.g., the S RNA promoter tions identified for crystallizing the corresponding phos of CaMV; the coat protein promoter of TMV) may be used; phodiesterase without binding compound. It is advantageous when cloning in mammalian cell systems, promoters derived if a plurality of different crystallization conditions have been from the genome of mammalian cells (e.g., metallothionein identified for the phosphodiesterase, and these can be tested promoter) or from mammalian viruses (e.g., the adenovirus to determine which condition gives the best co-crystals. It late promoter; the vaccinia virus 7.5K promoter) may be may also be benficial to optimize the conditions for co used; when generating cell lines that contain multiple copies crystallization. Alternatively, new crystallization conditions of the phosphodiesterase domain DNA, SV40-, BPV- and can be determined for obtaining co-crystals, e.g., by Screen EBV-based vectors may be used with an appropriate select ing for crystallization and then optimizing those conditions. able marker. Exemplary co-crystallization conditions are provided in the 0254 Exemplary methods describing methods of DNA Examples. manipulation, vectors, various types of cells used, methods 0262 Determining Unit Cell Dimensions and the Three of incorporating the vectors into the cells, expression tech Dimensional Structure of a Polypeptide or Polypeptide niques, protein purification and isolation methods, and pro Complex tein concentration methods are disclosed in detail in PCT 0263. Once the crystal is grown, it can be placed in a publication WO 96/18738. This publication is incorporated glass capillary tube or other mounting device and mounted herein by reference in its entirety, including any drawings. onto a holding device connected to an X-ray generator and Those skilled in the art will appreciate that such descriptions an X-ray detection device. Collection of X-ray diffraction are applicable to the present invention and can be easily patterns are well documented by those in the art. See, e.g., adapted to it. Ducruix and Geige, (1992), IRL Press, Oxford, England, and references cited therein. A beam of X-rays enters the crystal 0255) Crystal Growth and then diffracts from the crystal. An X-ray detection 0256 Crystals are grown from an aqueous solution con device can be utilized to record the diffraction patterns taining the purified and concentrated polypeptide by a emanating from the crystal. Although the X-ray detection variety of techniques. These techniques include batch, liq device on older models of these instruments is a piece of uid, bridge, dialysis, vapor diffusion, and hanging drop film, modern instruments digitally record X-ray diffraction methods. McPherson (1982) John Wiley, New York; scattering. X-ray sources can be of various types, but McPherson (1990) Eur: J. Biochem. 189:1-23; Webber advantageously, a high intensity source is used, e.g., a (1991) Adv. Protein Chem. 41:1-36, incorporated by refer synchrotron beam source. ence herein in their entireties, including all figures, tables, 0264 Methods for obtaining the three dimensional struc and drawings. ture of the crystalline form of a peptide molecule or mol 0257 The native crystals of the invention are, in general, ecule complex are well known in the art. See, e.g., Ducruix grown by adding precipitants to the concentrated Solution of and Geige, (1992), IRL Press, Oxford, England, and refer the polypeptide. The precipitants are added at a concentra ences cited therein. The following are steps in the process of tion just below that necessary to precipitate the protein. determining the three dimensional structure of a molecule or Water is removed by controlled evaporation to produce complex from X-ray diffraction data. precipitating conditions, which are maintained until crystal 0265 After the X-ray diffraction patterns are collected growth ceases. from the crystal, the unit cell dimensions and orientation in 0258 For crystals of the invention, exemplary crystalli the crystal can be determined. They can be determined from zation conditions are described in the Examples. Those of the spacing between the diffraction emissions as well as the ordinary skill in the art will recognize that the exemplary patterns made from these emissions. The unit cell dimen crystallization conditions can be varied. Such variations may sions are characterized in three dimensions in units of be used alone or in combination. In addition, other crystal Angstroms (one A=10" meters) and by angles at each lization conditions may be found, e.g., by using crystalliza vertices. The symmetry of the unit cell in the crystals is also tion screening plates to identify such other conditions. Those characterized at this stage. The symmetry of the unit cell in alternate conditions can then be optimized if needed to the crystal simplifies the complexity of the collected data by provide larger or better quality crystals. identifying repeating patterns. Application of the symmetry and dimensions of the unit cell is described below. 0259 Derivative crystals of the invention can be obtained 0266 Each diffraction pattern emission is characterized by soaking native crystals in mother liquor containing salts as a vector and the data collected at this stage of the method of heavy metal atoms. It has been found that soaking a native determines the amplitude of each vector. The phases of the crystal in a solution containing about 0.1 mM to about 5 mM vectors can be determined using multiple techniques. In one thimerosal, 4-chloromeruribenzoic acid or KAu(CN) for method, heavy atoms can be soaked into a crystal, a method about 2 hr to about 72 hr provides derivative crystals suitable called isomorphous replacement, and the phases of the for use as isomorphous replacements in determining the vectors can be determined by using these heavy atoms as X-ray crystal structure. reference points in the X-ray analysis. (Otwinowski, (1991), 0260 Co-crystals of the invention can be obtained by Daresbury, United Kingdom, 80-86). The isomorphous soaking a native crystal in mother liquor containing com replacement method usually utilizes more than one heavy pound that binds the phosphodiesterase, or can be obtained atom derivative. by co-crystallizing the phosphodiesterase polypeptide in the 0267 In another method, the amplitudes and phases of presence of a binding compound. vectors from a crystalline polypeptide with an already US 2006/01 00218 A1 May 11, 2006 26 determined structure can be applied to the amplitudes of the IV. Structures of PDE4B vectors from a crystalline polypeptide of unknown structure 0272 High-resolution three-dimensional structures and and consequently determine the phases of these vectors. This atomic structure coordinates of crystalline PDE4B phos second method is known as molecular replacement and the phodiesterase domain and PDE4B phosphodiesterase protein structure which is used as a reference must have a domain co-complexed with exemplary binding compounds closely related structure to the protein of interest. (Naraza are described. The methods used to obtain the structure (1994) Proteins 11:281-296). Thus, the vector information coordinates are provided in the examples. The atomic struc from a phosphodiesterase of known structure, such as those ture coordinates of crystalline PDE4B phosphodiesterase reported herein, are useful for the molecular replacement domain are listed in Table 1. Co-crystal coordinates can be analysis of another phosphodiesterase with unknown struc used in the same way, e.g., in the various aspects described ture. herein, as coordinates for the protein by itself, but can be 0268. Once the phases of the vectors describing the unit advantageous because Such co-crystals demonstrate or con cell of a crystal are determined, the vector amplitudes and firm the binding mode of binding compound, and can also phases, unit cell dimensions, and unit cell symmetry can be include shifts of protein atoms in response to the presence of used as terms in a Fourier transform function. The Fourier the binding compound. transform function calculates the electron density in the unit cell from these measurements. The electron density that 0273 Those having skill in the art will recognize that describes one of the molecules or one of the molecule atomic structure coordinates as determined by X-ray crys complexes in the unit cell can be referred to as an electron tallography are not without error. Thus, it is to be understood density map. The amino acid structures of the sequence or that generally any set of structure coordinates obtained for the molecular structures of compounds complexed with the crystals of PDE, whether native crystals, phosphodiesterase crystalline polypeptide may then be fitted to the electron domain crystals, derivative crystals or co-crystals, that have density using a variety of computer programs. This step of a root mean square deviation (“r.m.S.d.) of less than or the process is sometimes referred to as model building and equal to about 1.5 A when superimposed, using backbone can be accomplished by using computer programs such as atoms (N. C. C and O), on the structure coordinates listed in a coordinate table herein are considered to be identical Turbo/FRODO or “O'”. (Jones (1985) Methods in Enzymol with the structure coordinates listed in that table when at ogy 115:157-171). least about 50% to 100% of the backbone atoms of the 0269. A theoretical electron density map can then be crystallized protein are included in the Superposition. calculated from the amino acid structures fit to the experi mentally determined electron density. The theoretical and V. Uses of the Crystals and Atomic Structure Coordinates experimental electron density maps can be compared to one 0274 The crystals of the invention, and particularly the another and the agreement between these two maps can be atomic structure coordinates obtained therefrom, have a described by a parameter called an R-factor. A low value for wide variety of uses. For example, the crystals described an R-factor describes a high degree of overlapping electron herein can be used as a starting point in any of the methods density between a theoretical and experimental electron of use for phosphodiesterases known in the art or later density map. developed. Such methods of use include, for example, 0270. The R-factor is then minimized by using computer identifying molecules that bind to the native or mutated programs that refine the theoretical electron density map. A catalytic domain of phosphodiesterases. The crystals and computer program such as X-PLOR can be used for model structure coordinates are particularly useful for identifying refinement by those skilled in the art. (Brunger (1992) ligands that modulate phosphodiesterase activity as an Nature 355:472-475.) Refinement may be achieved in an approach towards developing new therapeutic agents. In iterative process. A first step can entail altering the confor particular, the crystals and structural information are useful mation of atoms defined in an electron density map. The in methods for ligand development utilizing molecular scaf conformations of the atoms can be altered by simulating a folds. rise in temperature, which will increase the vibrational 0275. The structure coordinates described herein can be frequency of the bonds and modify positions of atoms in the used as phasing models for determining the crystal struc structure. At a particular point in the atomic perturbation tures of additional phosphodiesterases, as well as the struc process, a force field, which typically defines interactions tures of co-crystals of Such phosphodiesterases with ligands between atoms in terms of allowed bond angles and bond Such as inhibitors, agonists, antagonists, and other mol lengths, Van der Waals interactions, hydrogen bonds, ionic ecules. The structure coordinates, as well as models of the interactions, and hydrophobic interactions, can be applied to three-dimensional structures obtained therefrom, can also be the system of atoms. Favorable interactions may be used to aid the elucidation of solution-based structures of described in terms of free energy and the atoms can be native or mutated phosphodiesterases, such as those moved over many iterations until a free energy minimum is obtained via NMR. achieved. The refinement process can be iterated until the R-factor reaches a minimum value. VI. Electronic Representations of Phosphodiesterase Struc 0271 The three dimensional structure of the molecule or tures molecule complex is described by atoms that fit the theo 0276 Structural information of phosphodiesterases or retical electron density characterized by a minimum portions of phosphodiesterases (e.g., phosphodiesterase R-value. A file can then be created for the three dimensional active sites) can be represented in many different ways. structure that defines each atom by coordinates in three Particularly useful are electronic representations, as Such dimensions. An example of Such a structural coordinate file representations allow rapid and convenient data manipula is shown in Table 1. tions and structural modifications. Electronic representa US 2006/01 00218 A1 May 11, 2006 27 tions can be embedded in many different storage or memory 0283. A structural representation can also be a schematic media, frequently computer readable media. Examples representation. For example, a schematic representation can include without limitations, computer random access represent secondary and/or tertiary structure in a schematic memory (RAM), floppy disk, magnetic hard drive, magnetic manner. Within Such a schematic representation of a tape (analog or digital), compact disk (CD), optical disk, polypeptide, a particular amino acid residue(s) or group(s) CD-ROM, memory card, digital video disk (DVD), and on a residue(s) can be included, e.g., conserved residues in others. The storage medium can be separate or part of a a binding site, and/or residue(s) or group(s) that may interact computer system. Such a computer system may be a dedi with binding compounds. Electronic structural representa cated, special purpose, or embedded system, such as a tions can be generated, for example, from atomic coordinate computer system that forms part of an X-ray crystallography information using computer programs designed for that system, or may be a general purpose computer (which may function and/or by constructing an electronic representation have data connection with other equipment such as a sensor with manual input based on interpretation of another form of device in an X-ray crystallographic system. In many cases, structural information. Physical representations can be cre the information provided by such electronic representations ated, for example, by printing an image of a computer can also be represented physically or visually in two or three generated image or by constructing a 3D model. An example dimensions, e.g., on paper, as a Visual display (e.g., on a of Such a printed representation is the ribbon diagram computer monitor as a two dimensional or pseudo-three presented in FIG. 2. dimensional image) or as a three dimensional physical model. Such physical representations can also be used, alone VII. Structure Determination for Phosphodiesterases with or in connection with electronic representations. Exemplary Unknown Structure Using Structural Coordinates useful representations include, but are not limited to, the 0284 Structural coordinates, such as those set forth in following: Table 1, can be used to determine the three dimensional 0277 Atomic Coordinate Representation structures of phosphodiesterases with unknown structure. The methods described below can apply structural coordi 0278. One type of representation is a list or table of nates of a polypeptide with known structure to another data atomic coordinates representing positions of particular set, such as an amino acid sequence, X-ray crystallographic atoms in a molecular structure, portions of a structure, or diffraction data, or nuclear magnetic resonance (NMR) data. complex (e.g., a co-crystal). Such a representation may also Preferred embodiments of the invention relate to determin include additional information, for example, information ing the three dimensional structures of modified phosphodi about occupancy of particular coordinates. One Such atomic esterases, other native phosphodiesterases, and related coordinate representation contains the coordinate informa polypeptides. tion of Table 1 in electronic form. 0279 Energy Surface or Surface of Interaction Repre 0285) Structures Using Amino Acid Homology sentation 0286 Homology modeling is a method of applying struc 0280 Another representation is an energy surface repre tural coordinates of a polypeptide of known structure to the sentation, e.g., of an active site or other binding site, amino acid sequence of a polypeptide of unknown structure. representing an energy Surface for electronic and steric This method is accomplished using a computer representa interactions. Such a representation may also include other tion of the three dimensional structure of a polypeptide or features. An example is the inclusion of representation of a polypeptide complex, the computer representation of amino particular amino acid residue(s) or group(s) on a particular acid sequences of the polypeptides with known and amino acid residue(s), e.g., a residue or group that can unknown structures, and standard computer representations participate in H-bonding or ionic interaction. Such energy of the structures of amino acids. Homology modeling gen Surface representations can be readily generated from atomic erally involves (a) aligning the amino acid sequences of the coordinate representations using any of a variety of available polypeptides with and without known structure; (b) trans computer programs. ferring the coordinates of the conserved amino acids in the known structure to the corresponding amino acids of the 0281 Structural Representation polypeptide of unknown structure; refining the Subsequent 0282 Still another representation is a structural represen three dimensional structure; and (d) constructing structures tation, i.e., a physical representation or an electronic repre of the rest of the polypeptide. One skilled in the art recog sentation of Such a physical representation. Such a structural nizes that conserved amino acids between two proteins can representation includes representations of relative positions be determined from the sequence alignment step in step (a). of particular features of a molecule or complex, often with 0287. The above method is well known to those skilled in linkage between structural features. For example, a structure the art. (Greer (1985) Science 228:1055; Blundell et al. can be represented in which all atoms are linked; atoms other A (1988) Eur: J. Biochem. 172:513. An exemplary computer than hydrogen are linked; backbone atoms, with or without program that can be utilized for homology modeling by representation of Sidechain atoms that could participate in those skilled in the art is the Homology module in the Insight significant electronic interaction, are linked; among others. II modeling package distributed by Accelery's Inc. However, not all features need to be linked. For example, for structural representations of portions of a molecule or com 0288 Alignment of the amino acid sequence is accom plex, structural features significant for that feature may be plished by first placing the computer representation of the represented (e.g., atoms of amino acid residues that can have amino acid sequence of a polypeptide with known structure significant binding interation with a ligand at a binding site. above the amino acid sequence of the polypeptide of Those amino acid residues may not be linked with each unknown structure. Amino acids in the sequences are then other. compared and groups of amino acids that are homologous US 2006/01 00218 A1 May 11, 2006 28

(e.g., amino acid side chains that are similar in chemical 0294 Structures Using NMR Data nature—aliphatic, aromatic, polar, or charged) are grouped 0295 Structural coordinates of a polypeptide or polypep together. This method will detect conserved regions of the tide complex derived from X-ray crystallographic tech polypeptides and account for amino acid insertions or dele tions. Such alignment and/or can also be performed fully niques can be applied towards the elucidation of three computationally using sequence alignment and analysis dimensional structures of polypeptides from nuclear mag netic resonance (NMR) data. This method is used by those software. skilled in the art. (Wuthrich, (1986), John Wiley and Sons, 0289 Once the amino acid sequences of the polypeptides New York: 176-199: Pflugrath et al. (1986) J. Mol. Biol. with known and unknown structures are aligned, the struc 189:383-386; Kline et al. (1986).J. Mol. Biol. 189:377-382.) tures of the conserved amino acids in the computer repre While the secondary structure of a polypeptide is often sentation of the polypeptide with known structure are trans readily determined by utilizing two-dimensional NMR data, ferred to the corresponding amino acids of the polypeptide the spatial connections between individual pieces of sec whose structure is unknown. For example, a tyrosine in the ondary structure are not as readily determinable. The coor amino acid sequence of known structure may be replaced by dinates defining a three-dimensional structure of a polypep a phenylalanine, the corresponding homologous amino acid tide derived from X-ray crystallographic techniques can in the amino acid sequence of unknown structure. guide the NMR spectroscopist to an understanding of these 0290 The structures of amino acids located in non spatial interactions between secondary structural elements in conserved regions are to be assigned manually by either a polypeptide of related structure. using standard peptide geometries or molecular simulation 0296. The knowledge of spatial interactions between techniques, such as molecular dynamics. The final step in the secondary structural elements can greatly simplify Nuclear process is accomplished by refining the entire structure Overhauser Effect (NOE) data from two-dimensional NMR using molecular dynamics and/or energy minimization. The experiments. Additionally, applying the crystallographic homology modeling method is well known to those skilled coordinates after the determination of secondary structure by in the art and has been practiced using different protein NMR techniques only simplifies the assignment of NOEs molecules. For example, the three dimensional structure of relating to particular amino acids in the polypeptide the polypeptide corresponding to the catalytic domain of a sequence and does not greatly bias the NMR analysis of serine/threonine protein kinase, myosin light chain protein polypeptide structure. Conversely, using the crystallo kinase, was homology modeled from the cAMP-dependent graphic coordinates to simplify NOE data while determining protein kinase catalytic subunit. (Knighton et al. (1992) secondary structure of the polypeptide would bias the NMR Science 258:130-135.) analysis of protein structure. 0291 Structures Using Molecular Replacement VIII. Structure-Based Design of Modulators of Phosphodi 0292 Molecular replacement is a method of applying the esterase Function Utilizing Structural Coordinates X-ray diffraction data of a polypeptide of known structure to 0297 Structure-based modulator design and identifica the X-ray diffraction data of a polypeptide of unknown tion methods are powerful techniques that can involve sequence. This method can be utilized to define the phases searches of computer databases containing a wide variety of describing the X-ray diffraction data of a polypeptide of potential modulators and chemical functional groups. The unknown structure when only the amplitudes are known. computerized design and identification of modulators is X-PLOR is a commonly utilized computer software package useful as the computer databases contain more compounds used for molecular replacement. Britinger (1992) Nature than the chemical libraries, often by an order of magnitude. 355:472-475. AMORE is another program used for molecu For reviews of structure-based drug design and identification lar replacement. Navaza (1994) Acta Crystallogr. A50: 157 (see Kuntz et al. (1994), Acc. Chem. Res. 27:117: Guida 163. Preferably, the resulting structure does not exhibit a (1994) Current Opinion in Struc. Biol. 4: 777; Colman root-mean-square deviation of more than 3 A. (1994) Current Opinion in Struc. Biol. 4: 868). 0293. A goal of molecular replacement is to align the positions of atoms in the unit cell by matching electron 0298 The three dimensional structure of a polypeptide diffraction data from two crystals. A program Such as defined by structural coordinates can be utilized by these X-PLOR can involve four steps. A first step can be to design methods, for example, the structural coordinates of determine the number of molecules in the unit cell and Table 1. In addition, the three dimensional structures of define the angles between them. A second step can involve phosphodiesterases determined by the homology, molecular rotating the diffraction data to define the orientation of the replacement, and NMR techniques described herein can also molecules in the unit cell. A third step can be to translate the be applied to modulator design and identification methods. electron density in three dimensions to correctly position the 0299 For identifying modulators, structural information molecules in the unit cell. Once the amplitudes and phases for a native phosphodiesterase, in particular, structural infor of the X-ray diffraction data is determined, an R-factor can mation for the active site of the phosphodiesterase, can be be calculated by comparing electron diffraction maps cal used. However, it may be advantageous to utilize structural culated experimentally from the reference data set and information from one or more co-crystals of the phosphodi calculated from the new data set. An R-factor between esterase with one or more binding compounds. It can also be 30-50% indicates that the orientations of the atoms in the advantageous if the binding compound has a structural core unit cell are reasonably determined by this method. A fourth in common with test compounds. step in the process can be to decrease the R-factor to roughly 20% by refining the new electron density map using iterative 0300. Design by Searching Molecular Data Bases refinement techniques described herein and known to those 0301 One method of rational design searches for modu or ordinary skill in the art. lators by docking the computer representations of com US 2006/01 00218 A1 May 11, 2006 29 pounds from a database of molecules. Publicly available would note that the method can be performed by skipping databases include, for example: parts (d) and (e) and screening a database of many com pounds. 0302) a) ACD from Molecular Designs Limited 0319 Structure-based design and identification of modu 0303 b) NCI from National Cancer Institute lators of phosphodiesterase function can be used in conjunc 0304 c) CCDC from Cambridge Crystallographic Data tion with assay screening. As large computer databases of Center compounds (around 10,000 compounds) can be searched in a matter of hours or even less, the computer-based method 0305 d) CAST from Chemical Abstract Service can narrow the compounds tested as potential modulators of 0306 e) Derwent from Derwent Information Limited phosphodiesterase function in biochemical or cellular 0307 f) Maybridge from Maybridge Chemical Company assayS. LTD 0320 The above descriptions of structure-based modu lator design are not all encompassing and other methods are 0308 g) Aldrich from Aldrich Chemical Company reported in the literature and can be used, e.g.: 0309 h) Directory of Natural Products from Chapman & 0321 (1) CAVEAT: Bartlett et al., (1989), in Chemical Hall and Biological Problems in Molecular Recognition, 0310. One such database (ACD distributed by Molecular Roberts, S. M.: Ley, S.V.: Campbell, M. M. eds.; Royal Designs Limited Information Systems) contains compounds Society of Chemistry: Cambridge, pp. 182-196. that are synthetically derived or are natural products. Meth ods available to those skilled in the art can convert a data set 0322 (2) FLOG: Miller et al., (1994), J. Comp. Aided represented in two dimensions to one represented in three Molec. Design 8:153. dimensions. These methods are enabled by Such computer 0323 (3) PRO Modulator: Clark et al., (1995), J. programs as CONCORD from Tripos Associates or DE Comp. Aided Molec. Design 9:13. Converter from Molecular Simulations Limited. 0324 (4) MCSS: Miranker and Karplus, (1991), Pro 0311 Multiple methods of structure-based modulator teins. Structure, Function, and Genetics 11:29. design are known to those in the art. (Kuntz et al., (1982), J. Mol. Biol. 162: 269; Kuntz et aZ., (1994), Acc. Chern. 0325 (5) AUTODOCK: Goodsell and Olson, (1990), Res. 27:117: Meng et al., (1992), J. Compt. Chem. 13:505; Proteins. Structure, Function, and Genetics 8:195. Bohm, (1994), J. Comp. Aided Molec. Design 8: 623.) 0326 (6) GRID: Goodford, (1985), J. Med. Chem. 0312. A computer program widely utilized by those 28:849. skilled in the art of rational modulator design is DOCK from 0327 Design by Modifying Compounds in Complex the University of California in San Francisco. The general with PDE4B methods utilized by this computer program and programs like it are described in three applications below. More 0328. Another way of identifying compounds as potential detailed information regarding some of these techniques can modulators is to modify an existing modulator in the be found in the Accelery's User Guide, 1995. A typical polypeptide active site. For example, the computer repre computer program used for this purpose can perform a sentation of modulators can be modified within the computer processes comprising the following steps or functions: representation of a PDE4B active site. Detailed instructions for this technique can be found, for example, in the Accel 0313 (a) remove the existing compound from the erys User Manual, 1995 in LUDI. The computer represen protein; tation of the modulator is typically modified by the deletion of a chemical group or groups or by the addition of a 0314 (b) dock the structure of another compound into chemical group or groups. the active-site using the computer program (Such as DOCK) or by interactively moving the compound into 0329. Upon each modification to the compound, the the active-site; atoms of the modified compound and active site can be shifted in conformation and the distance between the modu 0315 (c) characterize the space between the com lator and the active-site atoms may be scored along with any pound and the active-site atoms; complementary interactions formed between the two mol ecules. Scoring can be complete when a favorable geometric 0316 (d) search libraries for molecular fragments fit and favorable complementary interactions are attained. which (i) can fit into the empty space between the Compounds that have favorable scores are potential modu compound and the active-site, and (ii) can be linked to the compound; and lators. 0330. Design by Modifying the Structure of Compounds 0317 (e) link the fragments found above to the com that Bind PDE4B pound and evaluate the new modified compound. 0331 A third method of structure-based modulator 0318 Part (c) refers to characterizing the geometry and design is to screen compounds designed by a modulator the complementary interactions formed between the atoms building or modulator searching computer program. of the active site and the compounds. A favorable geometric Examples of these types of programs can be found in the fit is attained when a significant Surface area is shared Molecular Simulations Package, Catalyst. Descriptions for between the compound and active-site atoms without form using this program are documented in the Molecular Simu ing unfavorable steric interactions. One skilled in the art lations User Guide (1995). Other computer programs used in US 2006/01 00218 A1 May 11, 2006 30 this application are ISIS/HOST, ISIS/BASE, ISIS/DRAW) a number of hydrogen bond donors and acceptors below 5 or from Molecular Designs Limited and UNITY from Tripos below 4: a polar surface area of less than 50 A; binding at Associates. protein binding sites in an orientation so that chemical 0332 These programs can be operated on the structure of substituents from a combinatorial library that are attached to a compound that has been removed from the active site of the scaffold can be projected into pockets in the protein the three dimensional structure of a compound-phosphodi binding site; and possessing chemically tractable structures esterase complex. Operating the program on Such a com at its substituent attachment points that can be modified, pound is preferable since it is in a biologically active thereby enabling rapid library construction. conformation. 0343 By “clog P” is meant the calculated log P of a 0333. A modulator construction computer program is a compound, “P” referring to the partition coefficient between computer program that may be used to replace computer octanol and water. representations of chemical groups in a compound com 0344) The term “Molecular Polar Surface Area (PSA)” plexed with a phosphodiesterase or other biomolecule with refers to the sum of surface contributions of polar atoms groups from a computer database. A modulator searching (usually oxygens, nitrogens and attached hydrogens) in a computer program is a computer program that may be used molecule. The polar surface area has been shown to correlate to search computer representations of compounds from a well with drug transport properties, such as intestinal computer data base that have similar three dimensional absorption, or blood-brain barrier penetration. structures and similar chemical groups as compound bound 0345 Additional useful chemical properties of distinct to a particular biomolecule. compounds for inclusion in a combinatorial library include 0334. A typical program can operate by using the fol the ability to attach chemical moieties to the compound that lowing general steps: will not interfere with binding of the compound to at least one protein of interest, and that will impart desirable prop 0335 (a) map the compounds by chemical features erties to the library members, for example, causing the Such as by hydrogen bond donors or acceptors, hydro library members to be actively transported to cells and/or phobic/lipophilic sites, positively ionizable sites, or organs of interest, or the ability to attach to a device Such as negatively ionizable sites; a chromatography column (e.g., a streptavidin column 0336 (b) add geometric constraints to the mapped through a molecule Such as biotin) for uses such as tissue features; and and proteomics profiling purposes. 0337 (c) search databases with the model generated in 0346 A person of ordinary skill in the art will realize (b). other properties that can be desirable for the scaffold or library members to have depending on the particular require 0338 Those skilled in the art also recognize that not all ments of the use, and that compounds with these properties of the possible chemical features of the compound need be can also be sought and identified in like manner. Methods of present in the model of (b). One can use any subset of the selecting compounds for assay are known to those of ordi model to generate different models for data base searches. nary skill in the art, for example, methods and compounds 0339) Modulator Design Using Molecular Scaffolds described in U.S. Pat. Nos. 6,288,234, 6,090,912, 5,840,485, 0340. The present invention can also advantageously each of which is hereby incorporated by reference in its utilize methods for designing compounds, designated as entirety, including all charts and drawings. molecular scaffolds, that can act broadly across families of 0347 In various embodiments, the present invention pro molecules and/or for using a molecular scaffold to design vides methods of designing ligands that bind to a plurality of ligands that target individual or multiple members of those members of a molecular family, where the ligands contain a families. Such design using molecular scaffolds is described common molecular scaffold. Thus, a compound set can be in Hirth and Milburn, U.S. patent application Ser. No. assayed for binding to a plurality of members of a molecular 10/377,268, which is incorporated herein by reference in its family, e.g., a protein family. One or more compounds that entirety. Such design and development using molecular bind to a plurality of family members can be identified as scaffolds is described, in part, below. molecular scaffolds. When the orientation of the scaffold at the binding site of the target molecules has been determined 0341 In preferred embodiments, the molecules can be and chemically tractable structures have been identified, a proteins and a set of chemical compounds can be assembled set of ligands can be synthesized starting with one or a few that have properties such that they are 1) chemically molecular scaffolds to arrive at a plurality of ligands, designed to act on certain protein families and/or 2) behave wherein each ligand binds to a separate target molecule of more like molecular scaffolds, meaning that they have the molecular family with altered or changed binding affinity chemical Substructures that make them specific for binding or binding specificity relative to the scaffold. Thus, a plu to one or more proteins in a family of interest. Alternatively, rality of drug lead molecules can be designed to preferen molecular scaffolds can be designed that are preferentially tially target individual members of a molecular family based active on an individual target molecule. on the same molecular scaffold, and act on them in a specific 0342 Useful chemical properties of molecular scaffolds a. can include one or more of the following characteristics, but IX. Binding Assays are not limited thereto: an average molecular weight below about 350 daltons, or between from about 150 to about 350 0348 The methods of the present invention can involve daltons, or from about 150 to about 300 daltons; having a assays that are able to detect the binding of compounds to a clogP below 3: a number of rotatable bonds of less than 4: target molecule. Such binding is at a statistically significant US 2006/01 00218 A1 May 11, 2006

level, preferably with a confidence level of at least 90%, 0351. By “background signal' in reference to a binding more preferably at least 95, 97, 98, 99% or greater confi assay is meant the signal that is recorded under standard dence level that the assay signal represents binding to the conditions for the particular assay in the absence of a test target molecule, i.e., is distinguished from background. compound, molecular scaffold, or ligand that binds to the Preferably controls are used to distinguish target binding target molecule. Persons of ordinary skill in the art will from non-specific binding. The assays of the present inven realize that accepted methods exist and are widely available tion can also include assaying compounds for low affinity for determining background signal. binding to the target molecule. A large variety of assays indicative of binding are known for different target types and 0352 By “standard deviation' is meant the square root of can be used for this invention. Compounds that act broadly the variance. The variance is a measure of how spread out a across protein families are not likely to have a high affinity distribution is. It is computed as the average squared devia against individual targets, due to the broad nature of their tion of each number from its mean. For example, for the binding. Thus, assays described herein allow for the iden numbers 1, 2, and 3, the mean is 2 and the variance is: tification of compounds that bind with low affinity, very low affinity, and extremely low affinity. Therefore, potency (or binding affinity) is not the primary, nor even the most (1-2) + (2-2)+(3-2) = 0.667 important, indicia of identification of a potentially useful 2 3 binding compound. Rather, even those compounds that bind with low affinity, very low affinity, or extremely low affinity can be considered as molecular scaffolds that can continue 0353 To design or discover scaffolds that act broadly to the next phase of the ligand design process. across protein families, proteins of interest can be assayed 0349. By binding with “low affinity” is meant binding to against a compound collection or set. The assays can pref the target molecule with a dissociation constant (k) of erably be enzymatic or binding assays. In some embodi greater than 1 M under standard conditions. By binding ments it may be desirable to enhance the solubility of the with “very low affinity” is meant binding with a k of above compounds being screened and then analyze all compounds about 100 uM under standard conditions. By binding with that show activity in the assay, including those that bind with “extremely low affinity” is meant binding at a k of above low affinity or produce a signal with greater than about three about 1 mM under standard conditions. By “moderate affin times the standard deviation of the background signal. The ity” is meant binding with a k of from about 200 nM to assays can be any Suitable assay Such as, for example, about 1 uM understandard conditions. By “moderately high binding assays that measure the binding affinity between two affinity” is meant binding atak of from about 1 nM to about binding partners. Various types of Screening assays that can 200 nM. By binding at “high affinity” is meant binding at a be useful in the practice of the present invention are known k of below about 1 nM under standard conditions. For in the art, such as those described in U.S. Pat. Nos. 5,763, example, low affinity binding can occur because of a poorer 198, 5,747,276, 5,877,007, 6,243,980, 6,294,330, and 6,294, fit into the binding site of the target molecule or because of 330, each of which is hereby incorporated by reference in its a smaller number of non-covalent bonds, or weaker covalent entirety, including all charts and drawings. bonds present to cause binding of the scaffold or ligand to 0354) In various embodiments of the assays at least one the binding site of the target molecule relative to instances compound, at least about 5%, at least about 10%, at least where higher affinity binding occurs. The standard condi about 15%, at least about 20%, or at least about 25% of the tions for binding are at pH 7.2 at 37° C. for one hour. For compounds can bind with low affinity. In general, up to example, 100 ul/well can be used in HEPES 50 mM buffer about 20% of the compounds can show activity in the at pH 7.2, NaCl 15 mM, ATP 2 uM, and bovine serum screening assay and these compounds can then be analyzed albumin 1 ug?well, 37° C. for one hour. directly with high-throughput co-crystallography, computa 0350 Binding compounds can also be characterized by tional analysis to group the compounds into classes with their effect on the activity of the target molecule. Thus, a common structural properties (e.g., structural core and/or “low activity” compound has an inhibitory concentration shape and polarity characteristics), and the identification of (ICs) or excitation concentration (ECso) of greater than 1 common chemical structures between compounds that show uM under standard conditions. By “very low activity” is activity. meant an ICs or ECso of above 100 LM under standard 0355 The person of ordinary skill in the art will realize conditions. By “extremely low activity” is meant an ICs or that decisions can be based on criteria that are appropriate ECs of above 1 mM under standard conditions. By “mod for the needs of the particular situation, and that the deci erate activity” is meant an ICs or ECs of 200 nM to 1 LM sions can be made by computer Software programs. Classes under standard conditions. By “moderately high activity” is can be created containing almost any number of scaffolds, meant an ICs or ECs of 1 nM to 200 nM. By “high and the criteria selected can be based on increasingly activity” is meant an ICs or ECso of below 1 nM under exacting criteria until an arbitrary number of scaffolds is standard conditions. The ICso (or ECso) is defined as the concentration of compound at which 50% of the activity of arrived at for each class that is deemed to be advantageous. the target molecule (e.g., enzyme or other protein) activity Surface Plasmon Resonance being measured is lost (or gained) relative to activity when 0356) Binding parameters can be measured using surface no compound is present. Activity can be measured using plasmon resonance, for example, with a BIAcore(R) chip methods known to those of ordinary skill in the art, e.g., by (Biacore, Japan) coated with immobilized binding compo measuring any detectable product or signal produced by nents. Surface plasmon resonance is used to characterize the occurrence of an enzymatic reaction, or other activity by a microscopic association and dissociation constants of reac protein being measured. tion between an SFv or other ligand directed against target US 2006/01 00218 A1 May 11, 2006 32 molecules. Such methods are generally described in the each target molecule very quickly using robotic handling following references which are incorporated herein by ref systems and automated analysis of results. erence. Vely F. et al., (2000) BIAcore(R) analysis to test 0360. As used herein, “high throughput screening” or phosphopeptide-SH2 domain interactions, Methods in “HTS’ refers to the rapid in vitro screening of large numbers Molecular Biology. 121:313-21; Liparoto et al., (1999) of compounds (libraries); generally tens to hundreds of Biosensor analysis of the interleukin-2 receptor complex, thousands of compounds, using robotic screening assays. Journal of Molecular Recognition. 12:316-21; Lipschultz et Ultra high-throughput Screening (uFITS) generally refers to al., (2000) Experimental design for analysis of complex the high-throughput screening accelerated to greater than kinetics using Surface plasmon resonance, Methods. 100,000 tests per day. 20(3):310-8; Malmqvist., (1999) BIACORE: an affinity bio sensor system for characterization of biomolecular interac 0361) To achieve high-throughput screening, it is advan tions, Biochemical Society Transactions 27:335-40; Alfthan, tageous to house samples on a multicontainer carrier or (1998) Surface plasmon resonance biosensors as a tool in platform. A multicontainer carrier facilitates measuring reac antibody engineering, Biosensors & Bioelectronics. 13:653 tions of a plurality of candidate compounds simultaneously. 63; Fivash et al., (1998) BIAcore for macromolecular inter Multi-well microplates may be used as the carrier. Such action, Current Opinion in Biotechnology.9:97-101; Price et multi-well microplates, and methods for their use in numer al.; (1998) Summary report on the ISOBMTD-4 Workshop: ous assays, are both known in the art and commercially analysis of 56 monoclonal antibodies against the MUC1 available. mucin. Tumour Biology 19 Suppl 1:1-20; Malmqvist et al. 0362 Screening assays may include controls for pur (1997) Biomolecular interaction analysis: affinity biosensor poses of calibration and confirmation of proper manipulation technologies for functional analysis of proteins, Current of the components of the assay. Blank wells that contain all Opinion in Chemical Biology. 1:378-83; O'Shannessy et al., of the reactants but no member of the chemical library are (1996) Interpretation of deviations from pseudo-first-order usually included. As another example, a known inhibitor (or kinetic behavior in the characterization of ligand binding by activator) of an enzyme for which modulators are sought, biosensor technology, Analytical Biochemistry. 236:275-83: can be incubated with one sample of the assay, and the Malmborg et al., (1995) BIAcore as a tool in antibody resulting decrease (or increase) in the enzyme activity used engineering, Journal of Immunological Methods. 183:7-13; as a comparator or control. It will be appreciated that Van Regenmortel, (1994) Use of biosensors to characterize modulators can also be combined with the enzyme activators recombinant proteins, Developments in Biological Stan or inhibitors to find modulators which inhibit the enzyme dardization. 83:143-51; and O'Shannessy, (1994) Determi activation or repression that is otherwise caused by the nation of kinetic rate and equilibrium binding constants for presence of the known the enzyme modulator. Similarly, macromolecular interactions: a critique of the Surface plas when ligands to a sphingolipid target are sought, known mon resonance literature, Current Opinions in Biotechnol ligands of the target can be present in control/calibration ogy: 5:65-71. assay wells. 0357 BIAcore(R) uses the optical properties of surface 0363 Measuring Enzymatic and Binding Reactions Dur plasmon resonance (SPR) to detect alterations in protein ing Screening Assays concentration bound to a dextran matrix lying on the Surface of a gold/glass sensor chip interface, a dextran biosensor 0364 Techniques for measuring the progression of enzy matrix. In brief, proteins are covalently bound to the dextran matic and binding reactions, e.g., in multicontainer carriers, matrix at a known concentration and a ligand for the protein are known in the art and include, but are not limited to, the is injected through the dextran matrix. Near infrared light, following. directed onto the opposite side of the sensor chip Surface is 0365 Spectrophotometric and spectrofluorometric assays reflected and also induces an evanescent wave in the gold are well known in the art. Examples of Such assays include film, which in turn, causes an intensity dip in the reflected the use of colorimetric assays for the detection of peroxides, light at a particular angle known as the resonance angle. If as described in Gordon, A. J. and Ford, R. A., (1972) The the refractive index of the sensor chip Surface is altered (e.g., Chemist's Companion: A Handbook Of Practical Data, by ligand binding to the bound protein) a shift occurs in the Techniques, And References, John Wiley and Sons, N.Y., resonance angle. This angle shift can be measured and is Page 437. expressed as resonance units (RUs) such that 1000 RUs is equivalent to a change in Surface protein concentration of 1 0366 Fluorescence spectrometry may be used to monitor ng/mm. These changes are displayed with respect to time the generation of reaction products. Fluorescence method along the y-axis of a sensorgram, which depicts the asso ology is generally more sensitive than the absorption meth ciation and dissociation of any biological reaction. odology. The use of fluorescent probes is well known to those skilled in the art. For reviews, see Bashford et al., 0358 High Throughput Screening (HTS) Assays (1987) Spectrophotometry and Spectrofluorometry: A Prac 0359 HTS typically uses automated assays to search tical Approach, pp. 91-114, IRL Press Ltd.; and Bell, (1981) through large numbers of compounds for a desired activity. Spectroscopy. In Biochemistry, Vol. I, pp. 155-194, CRC Typically HTS assays are used to find new drugs by screen Press. ing for chemicals that act on a particular enzyme or mol 0367. In spectrofluorometric methods, enzymes are ecule. For example, if a chemical inactivates an enzyme it exposed to Substrates that change their intrinsic fluorescence might prove to be effective in preventing a process in a cell when processed by the target enzyme. Typically, the Sub which causes a disease. High throughput methods enable strate is nonfluorescent and is converted to a fluorophore researchers to assay thousands of different chemicals against through one or more reactions. As a non-limiting example, US 2006/01 00218 A1 May 11, 2006

SMase activity can be detected using the Amplex(R) Red including fluoresceinthiocarbanyl gentamicin. Additional reagent (Molecular Probes, Eugene, Oreg.). In order to fluorophores may be prepared using methods well known to measure sphingomyelinase activity using Amplex(R) Red, the the skilled artisan. following reactions occur. First, SMase hydrolyzes sphin 0372 Exemplary normal-and-polarized fluorescence gomyelin to yield ceramide and phosphorylcholine. Second, readers include the POLARIONR) fluorescence polarization alkaline phosphatase hydrolyzes phosphorylcholine to yield system (Tecan AG, Hombrechtikon, Switzerland). General choline. Third, choline is oxidized by choline oxidase to multiwell plate readers for other assays are available, such betaine. Finally, H2O, in the presence of horseradish per as the VERSAMAXTM reader and the SPECTRAMAXOR) oxidase, reacts with Amplex(R) Red to produce the fluores multiwell plate spectrophotometer (both from Molecular cent product, Resorufin, and the signal therefrom is detected Devices). using spectrofluorometry. 0373 Fluorescence resonance energy transfer (FRET) is 0368 Fluorescence polarization (FP) is based on a another useful assay for detecting interaction and has been decrease in the speed of molecular rotation of a fluorophore described. See, e.g., Heim et al., (1996) Curr. Biol. 6:178 that occurs upon binding to a larger molecule. Such as a 182: Mitra et al., (1996) Gene 173:13-17; and Selvin et al., receptor protein, allowing for polarized fluorescent emission (1995) Meth. Enzymol. 246:300-345. FRET detects the by the bound ligand. FP is empirically determined by transfer of energy between two fluorescent Substances in measuring the vertical and horizontal components of fluo close proximity, having known excitation and emission rophore emission following excitation with plane polarized wavelengths. As an example, a protein can be expressed as light. Polarized emission is increased when the molecular a fusion protein with green fluorescent protein (GFP). When rotation of a fluorophore is reduced. A fluorophore produces two fluorescent proteins are in proximity, such as when a a larger polarized signal when it is bound to a larger protein specifically interacts with a target molecule, the molecule (i.e. a receptor), slowing molecular rotation of the resonance energy can be transferred from one excited mol fluorophore. The magnitude of the polarized signal relates ecule to the other. As a result, the emission spectrum of the quantitatively to the extent of fluorescent ligand binding. sample shifts, which can be measured by a fluorometer, Such Accordingly, polarization of the “bound” signal depends on as a FMAX multiwell fluorometer (Molecular Devices, maintenance of high affinity binding. Sunnyvale Calif.). 0369 FP is a homogeneous technology and reactions are 0374 Scintillation proximity assay (SPA) is a particularly very rapid, taking seconds to minutes to reach equilibrium. useful assay for detecting an interaction with the target The reagents are stable, and large batches may be prepared, molecule. SPA is widely used in the pharmaceutical industry resulting in high reproducibility. Because of these proper and has been described (Hanselman et al., (1997) J. Lipid ties, FP has proven to be highly automatable, often per Res. 38:2365-2373; Kahl et al., (1996) Anal. Biochem. formed with a single incubation with a single, premixed, 243:282-283: Undenfriend et al., (1987) Anal. Biochem. tracer-receptor reagent. For a review, see Owickiet al., 161:494-500). See also U.S. Pat. Nos. 4,626,513 and 4,568, (1997), Application of Fluorescence Polarization Assays in 649, and European Patent No. 0,154,734. One commercially High-Throughput Screening, Genetic Engineering News, available system uses FLASHPLATER scintillant-coated 17:27. plates (NEN Life Science Products, Boston, Mass.). 0370 FP is particularly desirable since its readout is 0375. The target molecule can be bound to the scintillator independent of the emission intensity (Checovich, W. J., et plates by a variety of well known means. Scintillant plates al., (1995) Nature 375:254-256: Dandliker, W. B., et al., are available that are derivatized to bind to fusion proteins (1981) Methods in Enzymology 74:3-28) and is thus insen such as GST. His6 or Flag fusion proteins. Where the target sitive to the presence of colored compounds that quench molecule is a protein complex or a multimer, one protein or fluorescence emission. FP and FRET (see below) are well subunit can be attached to the plate first, then the other Suited for identifying compounds that block interactions components of the complex added later under binding between sphingolipid receptors and their ligands. See, for conditions, resulting in a bound complex. example, Parker et al., (2000) Development of high through 0376. In a typical SPA assay, the gene products in the put Screening assays using fluorescence polarization: expression pool will have been radiolabeled and added to the nuclear receptor-ligand-binding and kinase/phosphatase wells, and allowed to interact with the solid phase, which is assays, J Biomol Screen 5:77-88. the immobilized target molecule and Scintillant coating in 0371 Fluorophores derived from sphingolipids that may the wells. The assay can be measured immediately or be used in FP assays are commercially available. For allowed to reach equilibrium. Either way, when a radiolabel example, Molecular Probes (Eugene, Oreg.) currently sells becomes sufficiently close to the Scintillant coating, it pro sphingomyelin and one ceramide flurophores. These are, duces a signal detectable by a device such as a TOPCOUNT respectively, N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a NXTR microplate scintillation counter (Packard BioScience diaza-S-indacene-3-pentanoyl)sphingosyl phosphocholine Co., Meriden Conn.). If a radiolabeled expression product (BODIPYR FL C5-sphingomyelin); N-(4,4-difluoro-5,7- binds to the target molecule, the radiolabel remains in dimethyl-4-bora-3a,4a-diaza-S-indacene-3-dodecanoyl)sph proximity to the Scintillant long enough to produce a detect ingosyl phosphocholine (BODIPYR FL C12-sphingomy able signal. elin); and N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza 0377. In contrast, the labeled proteins that do not bind to S-indacene-3-pentanoyl)sphingosine (BODIPYR FL the target molecule, or bind only briefly, will not remain near C5-ceramide). U.S. Pat. No. 4,150,949, (Immunoassay for the Scintillant long enough to produce a signal above back gentamicin), discloses fluorescein-labelled gentamicins, ground. Any time spent near the Scintillant caused by US 2006/01 00218 A1 May 11, 2006 34 random Brownian motion will also not result in a significant affinity. Libraries of candidate compounds can be assayed by amount of signal. Likewise, residual unincorporated radio many different assays, Such as those described above, e.g., label used during the expression step may be present, but a fluorescence polarization assay. Libraries may consist of will not generate significant signal because it will be in chemically synthesized peptides, peptidomimetics, or arrays Solution rather than interacting with the target molecule. of combinatorial chemicals that are large or Small, focused These non-binding interactions will therefore cause a certain or nonfocused. By “focused it is meant that the collection level of background signal that can be mathematically of compounds is prepared using the structure of previously removed. If too many signals are obtained, salt or other characterized compounds and/or pharmacophores. modifiers can be added directly to the assay plates until the 0384 Compound libraries may contain molecules iso desired specificity is obtained (Nichols et al., (1998) Anal. lated from natural sources, artificially synthesized mol Biochem. 257:112-119). ecules, or molecules synthesized, isolated, or otherwise 0378 Assay Compounds and Molecular Scaffolds prepared in Such a manner So as to have one or more 0379 Preferred characteristics of a scaffold include being moieties variable, e.g., moieties that are independently iso of low molecular weight (e.g., less than 350 Da, or from lated or randomly synthesized. Types of molecules in com about 100 to about 350 daltons, or from about 150 to about pound libraries include but are not limited to organic com 300 daltons). Preferably clog P of a scaffold is from -1 to 8, pounds, polypeptides and nucleic acids as those terms are more preferably less than 6, 5, or 4, most preferably less than used herein, and derivatives, conjugates and mixtures 3. In particular embodiments the clogP is in a range -1 to an thereof. upper limit of 2, 3, 4, 5, 6, or 8; or is in a range of 0 to an 0385 Compound libraries of the invention may be pur upper limit of 2, 3, 4, 5, 6, or 8. Preferably the number of chased on the commercial market or prepared or obtained by rotatable bonds is less than 5, more preferably less than 4. any means including, but not limited to, combinatorial Preferably the number of hydrogen bond donors and accep chemistry techniques, fermentation methods, plant and cel tors is below 6, more preferably below 5. An additional lular extraction procedures and the like (see, e.g., Cwirla et criterion that can be useful is a polar Surface area of less than al., (1990) Biochemistry, 87, 6378-6382; Houghten et al., 5. Guidance that can be useful in identifying criteria for a (1991) Nature, 354, 84-86; Lan et al., (1991) Nature, 354, particular application can be found in Lipinski et al., (1997) 82-84: Brenner et al., (1992) Proc. Natl. Acad. Sci. USA, 89, Advanced Drug Delivery Reviews 233-25, which is hereby 5381-5383; R. A. Houghten, (1993) Trends Genet., 9, 235 incorporated by reference in its entirety. 239; E. R. Felder, (1994) Chimia, 48, 512-541; Gallop et al., 0380 A scaffold may preferably bind to a given protein (1994).J. Med. Chem., 37, 1233-1251; Gordon et al., (1994) binding site in a configuration that causes Substituent moi J. Med. Chem., 37, 1385-1401; Carell et al., (1995) Chem. eties of the scaffold to be situated in pockets of the protein Biol., 3, 171-183; Madden et al., Perspectives in Drug binding site. Also, possessing chemically tractable groups Discovery and Design 2, 269-282: Lebl et al., (1995) that can be chemically modified, particularly through syn Biopolymers, 37 177-198); small molecules assembled thetic reactions, to easily create a combinatorial library can around a shared molecular structure; collections of chemi be a preferred characteristic of the scaffold. Also preferred cals that have been assembled by various commercial and can be having positions on the scaffold to which other noncommercial groups, natural products; extracts of marine moieties can be attached, which do not interfere with bind organisms, fungi, bacteria, and plants. ing of the scaffold to the protein(s) of interest but do cause 0386 Preferred libraries can be prepared in a homog the scaffold to achieve a desirable property, for example, enous reaction mixture, and separation of unreacted reagents active transport of the scaffold to cells and/or organs, from members of the library is not required prior to screen enabling the scaffold to be attached to a chromatographic ing. Although many combinatorial chemistry approaches are column to facilitate analysis, or another desirable property. based on Solid state chemistry, liquid phase combinatorial A molecular scaffold can bind to a target molecule with any chemistry is capable of generating libraries (Sun C M., affinity, Such as binding at high affinity, moderate affinity, (1999) Recent advances in liquid-phase combinatorial low affinity, very low affinity, or extremely low affinity. chemistry, Combinatorial Chemistry & High Throughput 0381 Thus, the above criteria can be utilized to select Screening. 2:299-318). many compounds for testing that have the desired attributes. 0387 Libraries of a variety of types of molecules are Many compounds having the criteria described are available prepared in order to obtain members therefrom having one in the commercial market, and may be selected for assaying or more preselected attributes that can be prepared by a depending on the specific needs to which the methods are to variety of techniques, including but not limited to parallel be applied. array synthesis (Houghton, (2000) Annu Rev Pharmacol 0382 A“compound library” or “library” is a collection of Toxicol 40:273-82, Parallel array and mixture-based syn different compounds having different chemical structures. A thetic combinatorial chemistry; Solution-phase combinato compound library is screenable, that is, the compound rial chemistry (Merritt, (1998) Comb Chem High Through library members therein may be subject to Screening assays. put Screen 1(2):57-72, Solution phase combinatorial In preferred embodiments, the library members can have a chemistry, Coe et al., (1998-99) Mol Divers, 4(1):31-8, molecular weight of from about 100 to about 350 daltons, or Solution-phase combinatorial chemistry, Sun, (1999) Comb from about 150 to about 350 daltons. Examples of libraries Chem High Throughput Screen 2C6):299-318, Recent are provided aove. advances in liquid-phase combinatorial chemistry); synthe sis on soluble polymer (Gravert et al., (1997) Curr Opin 0383 Libraries of the present invention can contain at Chem Biol 1(1): 107-13, Synthesis on soluble polymers: new least one compound than binds to the target molecule at low reactions and the construction of Small molecules); and the US 2006/01 00218 A1 May 11, 2006

like. See, e.g., Dolle et al., (1999) J Comb Chem 1(4): 235 internalizing human antibodies from phage libraries. Source 82, Comprehensive survey of cominatorial library synthesis: Journal of Molecular Biology. 301:1149-61; Amersdorfer P. 1998. Freidinger R. M., (1999) Nonpeptidic ligands for Marks J. D., (2001) Phage libraries for generation of anti peptide and protein receptors, Current Opinion in Chemical botulinum scFv antibodies, Methods in Molecular Biology. Biology; and Kundu et al., Prog Drug Res; 53:89-156, 145:219-40; Hughes-Jones N. C. Bye J. M. Gorick B D. Combinatorial chemistry: polymer Supported synthesis of Marks J. D. Ouwehand W H., (1999) Synthesis of Rh Fv peptide and non-peptide libraries). Compounds may be phage-antibodies using VH and VL germline genes, British clinically tagged for ease of identification (Chabala, (1995) Journal of Haematology. 105:811-6; McCall AM. Amoroso Curr Opin Biotechnol 6(6):633-9, Solid-phase combinato A R. Sautes C. Marks J. D. Weiner L. M., (1998) Character rial chemistry and novel tagging methods for identifying ization of anti-mouse Fc gamma RII single-chain Fv frag leads). ments derived from human phage display libraries, Immu 0388. The combinatorial synthesis of carbohydrates and notechnology. 4:71-87; Sheets MD. Amersdorfer P. Finnern libraries containing oligosaccharides have been described R. Sargent P. Lindquist E. Schier R. Hemingsen G. Wong C. (Schweizer et al., (1999) Curr Opin Chem Biol 3(3):291-8, Gerhart J. C. Marks J. D. Lindquist E., (1998) Efficient Combinatorial synthesis of carbohydrates). The synthesis of construction of a large nonimmune phage antibody library: natural-product based compound libraries has been the production of high-affinity human single-chain antibod described (Wessjohann, (2000) Curr Opin Chem Biol ies to protein antigens (published erratum appears in Proc 4(3):303-9, Synthesis of natural-product based compound Natl AcadSci USA 1999 96:795), Proc Natl AcadSci USA libraries). 95:6157-62). 0393 Focused or smart chemical and pharmacophore 0389 Libraries of nucleic acids are prepared by various libraries can be designed with the help of sophisticated techniques, including by way of non-limiting example the strategies involving computational chemistry (e.g., Kundu ones described herein, for the isolation of aptamers. Librar B. Khare S K. Rastogi S.K., (1999) Combinatorial chemis ies that include oligonucleotides and polyaminooligonucle try: polymer Supported synthesis of peptide and non-peptide otides (Markiewicz et al., (2000) Synthetic oligonucleotide libraries, Progress in Drug Research 53:89-156) and the use combinatorial libraries and their applications, Farmaco. of structure-based ligands using database searching and 55:174-7) displayed on streptavidin magnetic beads are docking, de novo drug design and estimation of ligand known. Nucleic acid libraries are known that can be coupled binding affinities (Joseph-McCarthy D., (1999) Computa to parallel sampling and be deconvoluted without complex tional approaches to structure-based ligand design, Pharma procedures such as automated mass spectrometry (Enjalbal cology & Therapeutics 84:179-91; Kirkpatrick D L. Watson C. Martinez J. Aubagnac J. L. (2000) Mass spectrometry in S. Ulhaq S., (1999) Structure-based drug design: combina combinatorial chemistry, Mass Spectrometry Reviews. torial chemistry and molecular modeling, Combinatorial 19:139-61) and parallel tagging. (Perrin D M. Nucleic acids Chemistry & High Throughput Screening. 2:211-21; Eliseev for recognition and catalysis: landmarks, limitations, and AV. Lehn J. M., (1999) Dynamic combinatorial chemistry: looking to the future, Combinatorial Chemistry & High evolutionary formation and screening of molecular libraries, Throughput Screening 3:243-69). Current Topics in Microbiology & Immunology 243:159-72; 0390 Peptidomimetics are identified using combinatorial Bolger et al., (1991) Methods Enz. 203:21-45; Martin, chemistry and solid phase synthesis (Kim H. O. Kahn M., (1991) Methods Enz. 203:587-613: Neidle et al., (1991) (2000) A merger of rational drug design and combinatorial Methods Enz. 203:433-458; U.S. Pat. No. 6,178,384). chemistry: development and application of peptide second X. Crystallography ary structure mimetics, Combinatorial Chemistry & High Throughput Screening 3:167-83; al-Obeidi, (1998) Mol Bio 0394 After binding compounds have been determined, technol 9(3):205-23, Peptide and peptidomimetric libraries. the orientation of compound bound to target is determined. Molecular diversity and drug design). The synthesis may be Preferably this determination involves crystallography on entirely random or based in part on a known polypeptide. co-crystals of molecular scaffold compounds with target. Most protein crystallographic platforms can preferably be 0391 Polypeptide libraries can be prepared according to designed to analyze up to about 500 co-complexes of various techniques. In brief phage display techniques can be compounds, ligands, or molecular scaffolds bound to protein used to produce polypeptide ligands (Gram H., (1999) Phage targets due to the physical parameters of the instruments and display in proteolysis and signal transduction, Combinato convenience of operation. If the number of scaffolds that rial Chemistry & High Throughput Screening. 2:19-28) that have binding activity exceeds a number convenient for the may be used as the basis for synthesis of peptidomimetics. application of crystallography methods, the scaffolds can be Polypeptides, constrained peptides, proteins, protein placed into groups based on having at least one common domains, antibodies, single chain antibody fragments, anti chemical structure or other desirable characteristics, and body fragments, and antibody combining regions are dis representative compounds can be selected from one or more played on filamentous phage for selection. of the classes. Classes can be made with increasingly 0392 Large libraries of individual variants of human exacting criteria until a desired number of classes (e.g., 500) single chain FV antibodies have been produced. See, e.g., is obtained. The classes can be based on chemical structure Siegel R. W. Allen B. Pavlik P. Marks J. D. Bradbury A., similarities between molecular scaffolds in the class, e.g., all (2000) Mass spectral analysis of a protein complex using possess a pyrrole ring, benzene ring, or other chemical single-chain antibodies selected on a peptide target: appli feature. Likewise, classes can be based on shape character cations to functional genomics, Journal of Molecular Biol istics, e.g., space-filling characteristics. ogy 302:285-93; Poul M A. Becerril B. Nielsen U B. 0395. The co-crystallography analysis can be performed Morisson P. Marks J. D., (2000) Selection of tumor-specific by co-complexing each scaffold with its target at concen US 2006/01 00218 A1 May 11, 2006 36 trations of the scaffold that showed activity in the screening plexed target and compound from a set of coordinates assay. This co-complexing can be accomplished with the use provided can be used to illustrate and study how a compound of low percentage organic solvents with the target molecule is oriented when bound to a target. (e.g., QUANTAR), and then concentrating the target with each of the scaffolds. Accelerys, San Diego, Calif.). Thus, the existence of binding In preferred embodiments these solvents are less than 5% pockets at the binding site of the targets can be particularly organic solvent such as dimethyl sulfoxide (DMSO), etha useful in the present invention. These binding pockets are nol, methanol, or ethylene glycol in water or another aque revealed by the crystallographic structure determination and ous solvent. Each scaffold complexed to the target molecule show the precise chemical interactions involved in binding can then be screened with a suitable number of crystalliza the compound to the binding site of the target. The person of tion screening conditions at both 4 and 20 degrees. In ordinary skill will realize that the illustrations can also be preferred embodiments, about 96 crystallization screening used to decide where chemical groups might be added, conditions can be performed in order to obtain sufficient substituted, modified, or deleted from the scaffold to information about the co-complexation and crystallization enhance binding or another desirable effect, by considering conditions, and the orientation of the scaffold at the binding where unoccupied space is located in the complex and which site of the target molecule. Crystal structures can then be chemical Substructures might have Suitable size and/or analyzed to determine how the bound scaffold is oriented charge characteristics to fill it. The person of ordinary skill physically within the binding site or within one or more will also realize that regions within the binding site can be binding pockets of the molecular family member. flexible and its properties can change as a result of scaffold 0396. It is desirable to determine the atomic coordinates binding, and that chemical groups can be specifically tar of the compounds bound to the target proteins in order to geted to those regions to achieve a desired effect. Specific determine which is a most suitable scaffold for the protein locations on the molecular scaffold can be considered with family. X-ray crystallographic analysis is therefore most reference to where a suitable chemical substructure can be preferable for determining the atomic coordinates. Those attached and in which conformation, and which site has the compounds selected can be further tested with the applica most advantageous chemistry available. tion of medicinal chemistry. Compounds can be selected for 04.01. An understanding of the forces that bind the com medicinal chemistry testing based on their binding position pounds to the target proteins reveals which compounds can in the target molecule. For example, when the compound most advantageously be used as scaffolds, and which prop binds at a binding site, the compound's binding position in erties can most effectively be manipulated in the design of the binding site of the target molecule can be considered ligands. The person of ordinary skill will realize that steric, with respect to the chemistry that can be performed on ionic, hydrogen bond, and other forces can be considered for chemically tractable structures or sub-structures of the com their contribution to the maintenance or enhancement of the pound, and how Such modifications on the compound might target-compound complex. Additional data can be obtained interact with structures or Sub-structures on the binding site with automated computational methods, such as docking of the target. Thus, one can explore the binding site of the and/or Free Energy Perturbations (FEP), to account for other target and the chemistry of the scaffold in order to make energetic effects such as desolvation penalties. The com decisions on how to modify the scaffold to arrive at a ligand pounds selected can be used to generate information about with higher potency and/or selectivity. This process allows the chemical interactions with the target or for elucidating for more direct design of ligands, by utilizing structural and chemical modifications that can enhance selectivity of bind chemical information obtained directly from the co-com ing of the compound. plex, thereby enabling one to more efficiently and quickly design lead compounds that are likely to lead to beneficial 0402 Computer models, such as homology models (i.e., drug products. In various embodiments it may be desirable based on a known, experimentally derived structure) can be to perform co-crystallography on all scaffolds that bind, or constructed using data from the co-crystal structures. When only those that bind with a particular affinity, for example, the target molecule is a protein or enzyme, preferred co only those that bind with high affinity, moderate affinity, low crystal structures for making homology models contain high affinity, very low affinity, or extremely low affinity. It may sequence identity in the binding site of the protein sequence also be advantageous to perform co-crystallography on a being modeled, and the proteins will preferentially also be selection of scaffolds that bind with any combination of within the same class and/or fold family. Knowledge of affinities. conserved residues in active sites of a protein class can be used to select homology models that accurately represent the 0397 Standard X-ray protein diffraction studies such as binding site. Homology models can also be used to map by using a Rigaku RU-200R (Rigaku, Tokyo, Japan) with an structural information from a Surrogate protein where an apo X-ray imaging plate detector or a synchrotron beam-line can or co-crystal structure exists to the target protein. be performed on co-crystals and the diffraction data mea sured on a standard X-ray detector, such as a CCD detector 0403 Virtual screening methods, such as docking, can or an X-ray imaging plate detector. also be used to predict the binding configuration and affinity 0398 Performing X-ray crystallography on about 200 of scaffolds, compounds, and/or combinatorial library mem bers to homology models. Using this data, and carrying out co-crystals should generally lead to about 50 co-crystals “virtual experiments' using computer Software can save structures, which should provide about 10 scaffolds for substantial resources and allow the person of ordinary skill validation in chemistry, which should finally result in about to make decisions about which compounds can be suitable 5 selective leads for target molecules. scaffolds or ligands, without having to actually synthesize 0399 Virtual Assays the ligand and perform co-crystallization. Decisions thus can 04.00 Commercially available software that generates be made about which compounds merit actual synthesis and three-dimensional graphical representations of the com co-crystallization. An understanding of Such chemical inter US 2006/01 00218 A1 May 11, 2006 37 actions aids in the discovery and design of drugs that interact the case of proteins and enzymes, co-crystallography data more advantageously with target proteins and/or are more shows the binding pocket of the protein with the molecular selective for one protein family member over others. Thus, scaffold bound to the binding site, and it will be apparent that applying these principles, compounds with Superior proper a modification can be made to a chemically tractable group ties can be discovered. on the scaffold. For example, a small volume of space at a 0404 Additives that promote co-crystallization can of protein binding site or pocket might be filled by modifying course be included in the target molecule formulation in the scaffold to include a small chemical group that fills the order to enhance the formation of co-crystals. In the case of volume. Filling the void volume can be expected to result in proteins or enzymes, the scaffold to be tested can be added a greater binding affinity, or the loss of undesirable binding to the protein formulation, which is preferably present at a to another member of the protein family. Similarly, the concentration of approximately 1 mg/ml. The formulation co-crystallography data may show that deletion of a chemi can also contain between 0%-10% (v/v) organic solvent, e.g. cal group on the scaffold may decrease a hindrance to DMSO, methanol, ethanol, propane diol, or 1.3 dimethyl binding and result in greater binding affinity or specificity. propane diol (MPD) or some combination of those organic 04.09. It can be desirable to take advantage of the pres solvents. Compounds are preferably solubilized in the ence of a charged chemical group located at the binding site organic solvent at a concentration of about 10 mM and or pocket of the protein. For example, a positively charged added to the protein sample at a concentration of about 100 group can be complemented with a negatively charged mM. The protein-compound complex is then concentrated to group introduced on the molecular scaffold. This can be a final concentration of protein of from about 5 to about 20 expected to increase binding affinity or binding specificity, mg/ml. The complexation and concentration steps can con thereby resulting in a more desirable ligand. In many cases, veniently be performed using a 96-well formatted concen regions of protein binding sites or pockets are known to vary tration apparatus (e.g., Amicon Inc., Piscataway, N.J.). Buff from one family member to another based on the amino acid ers and other reagents present in the formulation being differences in those regions. Chemical additions in Such crystallized can contain other components that promote regions can result in the creation or elimination of certain crystallization or are compatible with crystallization condi interactions (e.g., hydrophobic, electrostatic, or entropic) tions, such as DTT, propane diol, glycerol. that allow a compound to be more specific for one protein target over another or to bind with greater affinity, thereby 04.05 The crystallization experiment can be set-up by enabling one to synthesize a compound with greater selec placing Small aliquots of the concentrated protein-com tivity or affinity for a particular family member. Addition pound complex (1 Jul) in a 96 well format and sampling ally, certain regions can contain amino acids that are known under 96 crystallization conditions. (Other screening for to be more flexible than others. This often occurs in amino mats can also be used, e.g., plates with greater than 96 acids contained in loops connecting elements of the second wells.) Crystals can typically be obtained using standard ary structure of the protein, such as alpha helices or beta crystallization protocols that can involve the 96 well crys Strands. Additions of chemical moieties can also be directed tallization plate being placed at different temperatures. Co to these flexible regions in order to increase the likelihood of crystallization varying factors other than temperature can a specific interaction occurring between the protein target of also be considered for each protein-compound complex if interest and the compound. Virtual screening methods can desirable. For example, atmospheric pressure, the presence also be conducted in silico to assess the effect of chemical or absence of light or oxygen, a change in gravity, and many additions, Subtractions, modifications, and/or Substitutions other variables can all be tested. The person of ordinary skill on compounds with respect to members of a protein family in the art will realize other variables that can advantageously or class. be varied and considered. 0410 The addition, subtraction, or modification of a 0406 Ligand Design and Preparation chemical structure or sub-structure to a scaffold can be 0407. The design and preparation of ligands can be performed with any suitable chemical moiety. For example performed with or without structural and/or co-crystalliza the following moieties, which are provided by way of tion data by considering the chemical structures in common example and are not intended to be limiting, can be utilized: between the active scaffolds of a set. In this process struc hydrogen, alkyl, alkoxy, phenoxy, alkenyl, alkynyl, pheny ture-activity hypotheses can be formed and those chemical lalkyl, hydroxyalkyl, haloalkyl, aryl, arylalkyl, alkyloxy, structures found to be present in a substantial number of the alkylthio, alkenylthio, phenyl, phenylalkyl, phenylalkylthio. scaffolds, including those that bind with low affinity, can be hydroxyalkyl-thio, alkylthiocarbbamylthio, cyclohexyl, presumed to have some effect on the binding of the scaffold. pyridyl, piperidinyl, alkylamino, amino, nitro, mercapto, This binding can be presumed to induce a desired biochemi cyano, hydroxyl, a halogen atom, halomethyl, an oxygen cal effect when it occurs in a biological system (e.g., a atom (e.g., forming a ketone or N-oxide) or a Sulphur atom treated mammal). New or modified scaffolds or combinato (e.g., forming a thiol, thione, di-alkylsulfoxide or Sulfone) rial libraries derived from scaffolds can be tested to disprove are all examples of moieties that can be utilized. the maximum number of binding and/or structure-activity 0411 Additional examples of structures or sub-structures hypotheses. The remaining hypotheses can then be used to that may be utilized are an aryl optionally substituted with design ligands that achieve a desired binding and biochemi one, two, or three substituents independently selected from cal effect. the group consisting of alkyl, alkoxy, halogen, trihalom 0408 But in many cases it will be preferred to have ethyl, carboxylate, carboxamide, nitro, and ester moieties; co-crystallography data for consideration of how to modify an amine of formula —NXX, where X and X are the scaffold to achieve the desired binding effect (e.g., independently selected from the group consisting of hydro binding at higher affinity or with higher selectivity). Using gen, Saturated or unsaturated alkyl, and homocyclic or US 2006/01 00218 A1 May 11, 2006 heterocyclic ring moieties; halogen or trihalomethyl; a 0415 Many different types of components can be ketone of formula – COX, where X is selected from the attached. Persons with skill are familiar with the chemistries group consisting of alkyl and homocyclic or heterocyclic used for various attachments. Examples of components that ring moieties; a carboxylic acid of formula —(X),COOH can be attached include, without limitation: Solid phase or ester of formula (X), COOX-7, where Xs, X, and X, and components such as beads, plates, chips, and wells; a direct are independently selected from the group consisting of or indirect label; a linker, which may be a traceless linker; alkyl and homocyclic or heterocyclic ring moieties and among others. Such linkers can themselves be attached to where n is 0 or 1; an alcohol of formula (X), OH or an other components, e.g., to Solid phase media, labels, and/or alkoxy moiety of formula—(Xs), OX, where Xs and X are binding moieties. independently selected from the group consisting of Satu rated or unsaturated alkyl and homocyclic or heterocyclic 0416) The binding energy of a compound and the effects ring moieties, wherein said ring is optionally substituted on binding energy for attaching the molecule to another with one or more substituents independently selected from component can be calculated approximately using any of a the group consisting of alkyl, alkoxy, halogen, trihalom variety of available software or by manual calculation. An ethyl, carboxylate, nitro, and ester and where n is 0 or 1; an example is the following: amide of formula NHCOX, where X is selected from the 0417 Calculations were performed to estimate binding group consisting of alkyl, hydroxyl, and homocyclic or energies of different organic molecules to two Kinases: heterocyclic ring moieties, wherein said ring is optionally PIM-1 and CDK2. The organic molecules considered substituted with one or more substituents independently included Staurosporine, identified compounds that bind to selected from the group consisting of alkyl, alkoxy, halogen, PDE5A, and several linkers. trihalomethyl, carboxylate, nitro, and ester; SO2, NX, X2, where X and X are selected from the group consisting of 0418 Calculated binding energies between protein hydrogen, alkyl, and homocyclic or heterocyclic ring moi ligand complexes were obtained using the FlexX score (an eties; a homocyclic or heterocyclic ring moiety optionally implementation of the Bohm scoring function) within the substituted with one, two, or three substituents indepen Tripos software suite. The form for that equation is shown dently selected from the group consisting of alkyl, alkoxy, in the equation below: halogen, trihalomethyl, carboxylate, carboxamide, nitro, and ester moieties; an aldehyde of formula —CHO; a sulfone of AGlid=AG+AG+AG-AGlie+AGaret-AGot formula - SOX, where X is selected from the group wherein: AG, is a constant term that accounts for the overall consisting of Saturated or unsaturated alkyl and homocyclic loss of rotational and translational entropy of the lignand, or heterocyclic ring moieties; and a nitro of formula —NO. AG, accounts for hydrogen bonds formed between the ligand and protein, AG accounts for the ionic interactions 0412 Identification of Attachment Sites on Molecular between the ligand and protein, AG, accounts for the Scaffolds and Ligands lipophilic interaction that corresponds to the protein-ligand 0413. In addition to the identification and development of contact Surface, AG accounts for interactions between ligands for phosphodiesterases and other enzymes, determi aromatic rings in the protein and ligand, and AG, accounts nation of the orientation of a molecular scaffold or other for the entropic penalty of restricting rotatable bonds in the binding compound in a binding site allows identification of ligand upon binding. energetically allowed sites for attachment of the binding 0419. This method estimates the free energy that a lead molecule to another component. For Such sites, any free compound should have to a target protein for which there is energy change associated with the presence of the attached a crystal structure, and it accounts for the entropic penalty of component should not destablize the binding of the com flexible linkers. It can therefore be used to estimate the free pound to the phosphodiesterase to an extent that will disrupt energy penalty incurred by attaching linkers to molecules the binding. Preferably, the binding energy with the attach being screened and the binding energy that a lead compound ment should be at least 4 kcal/mol., more preferably at least should have in order to overcome the free energy penalty of 6, 8, 10, 12, 15, or 20 kcal/mol. Preferably, the presence of the linker. The method does not account for solvation and the the attachment at the particular site reduces binding energy entropic penalty is likely overestimated for cases where the by no more than 3, 4, 5, 8, 10, 12, or 15 kcal/mol. linker is bound to a solid phase through another binding 0414. In many cases, suitable attachment sites will be complex, Such as a biotin: Streptavidin complex. those that are exposed to solvent when the binding com 0420 Co-crystals were aligned by Superimposing resi pound is bound in the binding site. In some cases, attach dues of PIM-1 with corresponding residues in CDK2. The ment sites can be used that will result in Small displacements PIM-1 structure used for these calculations was a co-crystal of a portion of the enzyme without an excessive energetic of PIM-1 with a binding compound. The cost. Exposed sites can be identified in various ways. For CDK2:Staurosporine co-crystal used was from the example, exposed sites can be identified using a graphic Brookhaven database file 1aq1. Hydrogen atoms were added display or 3-dimensional model. In a grahic display, such as to the proteins and atomic charges were assigned using the a computer display, an image of a compound bound in a AMBER95 parameters within Sybyl. Modifications to the binding site can be visually inspected to reveal atoms or compounds described were made within the Sybyl modeling groups on the compound that are exposed to solvent and suite from Tripos. oriented Such that attachment at Such atom or group would not preclude binding of the enzyme and binding compound. 0421. These calcualtions indicate that the calculated Energetic costs of attachment can be calculated based on binding energy for compounds that bind strongly to a given changes or distortions that would be caused by the attach target (such as Staurosporine:CDK2) can be lower than -25 ment as well as entropic changes. kcal/mol, while the calculated binding affinity for a good US 2006/01 00218 A1 May 11, 2006 39 scaffold or an unoptimized binding compound can be in the 0431 Antibodies (Abs) finds multiple applications in a range of -15 to -20. The free energy penalty for attachment variety of areas including biotechnology, medicine and to a linker Such as the ethylene glycol or hexatriene is diagnosis, and indeed they are one of the most powerful estimated as typically being in the range of +5 to +15 tools for life Science research. Abs directed against protein kcal/mol. antigens can recognize either linear or native three-dimen sional (3D) epitopes. The obtention of Abs that recognize 3D 0422 Linkers epitopes require the use of whole native protein (or of a 0423 Linkers suitable for use in the invention can be of portion that assumes a native conformation) as immunogens. many different types. Linkers can be selected for particular Unfortunately, this not always a choice due to various applications based on factors such as linker chemistry com technical reasons: for example the native protein is just not patible for attachment to a binding compound and to another available, the protein is toxic, or its is desirable to utilize a component utilized in the particular application. Additional high density antigen presentation. In Such cases, immuniza factors can include, without limitation, linker length, linker tion with peptides is the alternative. Of course, Abs gener stability, and ability to remove the linker at an appropriate ated in this manner will recognize linear epitopes, and they time. Exemplary linkers include, but are not limited to, might or might not recognize the source native protein, but hexyl, hexatrienyl, ethylene glycol, and peptide linkers. yet they will be useful for standard laboratory applications Traceless linkers can also be used, e.g., as described in Such as western blots. The selection of peptides to use as Plunkett, M. J., and Ellman, J. A., (1995), J. Org. Chem., immunogens can be accomplished by following particular 60:6OO6. selection rules and/or use of epitope prediction software. 0424 Typical functional groups, that are utilized to link 0432 Though methods to predict antigenic peptides are binding compound(s), include, but not limited to, carboxylic not infallible, there are several rules that can be followed to acid, amine, hydroxyl, and thiol. (Examples can be found in determine what peptide fragments from a protein are likely Solid-supported combinatorial and parallel synthesis of to be antigenic. These rules are also dictated to increase the small molecular weight compound libraries; (1998) Tetra likelihood that an Ab to a particular peptide will recognize hedron organic chemistry series Vol. 17; Pergamon; p85). the native protein. 0433 1. Antigenic peptides should be located in sol 0425 Labels vent accessible regions and contain both hydrophobic 0426. As indicated above, labels can also be attached to and hydrophilic residues. a binding compound or to a linker attached to a binding compound. Such attachment may be direct (attached directly 0434 For proteins of known 3D structure, solvent to the binding compound) or indirect (attached to a compo accessibility can be determined using a variety of nent that is directly or indirectly attached to the binding programs such as DSSP, NACESS, or WHATIF, compound). Such labels allow detection of the compound among others. either directly or indirectly. Attachement of labels can be 0435. If the 3D structure is not known, use any of performed using conventional chemistries. Labels can the following web servers to predict accessibilities: include, for example, fluorescent labels, radiolabels, light PHD, JPRED, Pred Acc (c) ACCpro scattering particles, light absorbent particles, magnetic par ticles, enzymes, and specific binding agents (e.g., biotin or 0436 2. Preferably select peptides lying in long loops an antibody target moiety). connecting Secondary Structure (SS) motifs, avoiding peptides located in helical regions. This will increase 0427 Solid Phase Media the odds that the Ab recognizes the native protein. Such 0428. Additional examples of components that can be peptides can, for example, be identified from a crystal attached directly or indirectly to a binding compound structure or crystal structure-based homology model. include various Solid phase media. Similar to attachment of 0437. For protein with known 3D coordinates, SS linkers and labels, attachment to Solid phase media can be can be obtained from the sequence link of the performed using conventional chemistries. Such solid phase relevant entry at the Brookhaven data bank. The media can include, for example, Small components such as PDBsum server also offer SS analysis of pdb records. beads, nanoparticles, and fibers (e.g., in Suspension or in a gel or chromatographic matrix). Likewise, Solid phase media 0438. When no structure is available secondary can include larger objects such as plates, chips, slides, and structure predictions can be obtained from any of the tubes. In many cases, the binding compound will be attached following servers: PHD, JPRED, PSI-PRED, NNSP. in only a portion of Such an objects, e.g., in a spot or other etc local element on a generally flat Surface or in a well or 0439) 3. When possible, choose peptides that are in the portion of a well. N- and C-terminal region of the protein. Because the N and C-terminal regions of proteins are usually solvent 0429) Identification of Biological Agents accessible and unstructured, Abs against those regions 0430. The posession of structural information about a are also likely to recognize the native protein. protein also provides for the identification of useful biologi 0440 4. For cell surface glycoproteins, eliminate from cal agents, such as epitpose for development of antibodies, initial peptides those containing consesus sites for identification of mutation sites expected to affect activity, N-glycosilation. and identification of attachment sites allowing attachment of the protein to materials such as labels, linkers, peptides, and 0441 N-glycosilation sites can be detected using Solid phase media. Scanoprosite, or NetNGlyc US 2006/01 00218 A1 May 11, 2006 40

0442. In addition, several methods based on various cation 2002/0165237, Thompson et al., U.S. Patent Appli physio-chemical properties of experimental determined cation Publication 2002/0009764, Pamukcu et al., U.S. epitopes (flexibility, hydrophibility, accessibility) have been patent application Ser. No. 09/046,739, and Pamukcu et al., published for the prediction of antigenic determinants and U.S. Pat. No. 6,500,610. can be used. The antigenic index and Preditop are example. 0452. An assay for phosphodiesterase activity that can be 0443) Perhaps the simplest method for the prediction of used for PDE4B, can be performed according to the follow antigenic determinants is that of Kolaskar and Tongaonkar, ing procedure using purified PDE4B using the procedure which is based on the occurrence of amino acid residues in described in the Examples. experimentally determined epitopes. (Kolaskar and Tonga 0453 Additional alternative assays can employ binding onkar (1990) A semi-empirical method for prediction of determinations. For example, this sort of assay can be antigenic determinants on protein antigens. FEBBS Lett. formatted either in a fluorescence resonance energy transfer 276(1-2): 172-174.) The prediction algorithm works as fol (FRET) format, or using an AlphaScreen (amplified lumi lows: nescent proximity homogeneous assay) format by varying 0444 1. Calculate the average propensity for each the donor and acceptor reagents that are attached to strepta overlapping 7-mer and assign the result to the central vidin or the phosphor-specific antibody. residue (i+3) of the 7-mer. XII. Organic Synthetic Techniques 0445 2. Calculate the average for the whole protein. 0454. The versatility of computer-based modulator 0446. 3. (a) If the average for the whole protein is design and identification lies in the diversity of structures above 1.0 then all residues having average propensity screened by the computer programs. The computer pro above 1.0 are potentially antigenic. grams can search databases that contain very large numbers of molecules and can modify modulators already complexed 0447. 4. (b) If the average for the whole protein is with the enzyme with a wide variety of chemical functional below 1.0 then all residues having above the average groups. A consequence of this chemical diversity is that a for the whole protein are potentially antigenic. potential modulator of phosphodiesterase function may take a chemical form that is not predictable. A wide array of 0448) 5. Find 8-mers where all residues are selected by organic synthetic techniques exist in the art to meet the step 3 above (6-mers in the original paper) challenge of constructing these potential modulators. Many 0449 The Kolaskar and Tongaonkar method is also avail of these organic synthetic methods are described in detail in able from the GCG package, and it runs using the command standard reference sources utilized by those skilled in the art. egCg. One example of Suh a reference is March, 1994, Advanced Organic Chemistry, Reactions, Mechanisms and Structure, 0450 Crystal structures also allow identification of resi New York, McGraw Hill. Thus, the techniques useful to dues at which mutation is likely to alter the activity of the synthesize a potential modulator of phosphodiesterase func protein. Such residues include, for example, residues that tion identified by computer-based methods are readily avail interact with Susbtrate, conserved active site residues, and residues that are in a region of ordered secondary structure able to those skilled in the art of organic chemical synthesis. of involved in tertiary interactions. The mutations that are XIII. Isomers, Prodrugs, and Active Metabolites likely to affect activity will vary for different molecular 0455 The present compounds are described herein with contexts. Mutations in an active site that will affect activity generic formulas and specific compounds. In addition, the are typically Substitutions or deletions that eliminate a present compounds may exist in a number of different forms charge-charge or hydrogen bonding interaction, or introduce or derivatives, all within the scope of the present invention. a steric interference. Mutations in secondary structure These include, for example, tautomers, enantiomers, Stere regions or molecular interaction regions that are likely to oisomers, racemic mixtures, regioisomers, salts, prodrugs affect activity include, for example, substitutions that alter the hydrophobicity/hydrophilicity of a region, or that intro (e.g., carboxylic acid esters), Solvated forms, different crys duce a Sufficient strain in a region near or including the tal forms or polymorphs, and active metabolites active site so that critical residue(s) in the active site are 0456 A. Tautomers, Stereoisomers, Regioisomers, and displaced. Such substitutions and/or deletions and/or inser Solvated Forms tions are recognized, and the predicted structural and/or 0457. It is understood that certain compounds may energetic effects of mutations can be calculated using con exhibit tautomerism. In such cases, the formula drawings ventional software. within this specification expressly depict only one of the XI. Phosphodiesterase Activity Assays possible tautomeric forms. It is therefore to be understood 0451 A number of different assays for phosphodiesterase that within the invention the formulas are intended to activity can be utilized for assaying for active modulators represent any tautomeric form of the depicted compounds and/or determining specificity of a modulator for a particular and are not to be limited merely to the specific tautomeric phosphodiesterase or group or phosphodiesterases. In addi form depicted by the formula drawings. tion to the assay mentioned in the Examples below, one of 0458. Likewise, some of the present compounds may ordinary skill in the art will know of other assays that can be contain one or more chiral centers, and therefore, may exist utilized and can modify an assay for a particular application. in two or more stereoisomeric forms. Thus, Such compounds For example, numerous papers concerning PDEs described may be present as single stereoisomers (i.e., essentially free assays that can be used. For example, useful assays are of other stereoisomers), racemates, and/or mixtures of enan described in Fryburg et al., U.S. Patent Application Publi tiomers and/or diastereomers. All Such single stereoisomers, US 2006/01 00218 A1 May 11, 2006

racemates and mixtures thereof are intended to be within the oxidative N-delakylation, oxidative O- and S-delakylation, scope of the present invention. Unless specified to the oxidative deamination, as well as other oxidative reactions. contrary, all such steroisomeric forms are included within 0467 Reductive reactions, such as reduction of carbonyl the formulas provided herein. groups, reduction of alcoholic groups and carbon-carbon 0459. In certain embodiments, a chiral compound of the double bonds, reduction of nitrogen-containing functions present invention is in a form that contains at least 80% of groups, and other reduction reactions. a single isomer (60% enantiomeric excess (“e.e.) or dias 0468 Reactions without change in the state of oxidation, tereomeric excess (“d.e.’”)), or at least 85% (70% e.e. or Such as hydrolysis of esters and ethers, hydrolytic cleavage d.e.), 90% (80% e.e. or de...), 95% (90% e.e. or de...), 97.5% of carbon-nitrogen single bonds, hydrolytic cleavage of (95% e.e. or d.e.), or 99% (98% e.e. or d.e.). As generally non-aromatic heterocycles, hydration and dehydration at understood by those skilled in the art, an optically pure multiple bonds, new atomic linkages resulting from dehy compound having one chiral center is one that consists dration reactions, hydrolytic dehalogenation, removal of essentially of one of the two possible enantiomers (i.e., is enantiomerically pure), and an optically pure compound hydrogen halide molecule, and other such reactions. having more than one chiral center is one that is both 0469 Carrier prodrugs are drug compounds that contain diastereomerically pure and enantiomerically pure. In cer a transport moiety, e.g., that improves uptake and/or local tain embodiments, the compound is present in optically pure ized delivery to a site(s) of action. Desirably for such a form. carrier prodrug, the linkage between the drug moiety and the transport moiety is a covalent bond, the prodrug is inactive 0460 For compounds is which synthesis involves addi or less active than the drug compound, the prodrug and any tion of a single group at a double bond, particularly a release transport moiety are acceptably non-toxic. For pro carbon-carbon double bond, the addition may occur at either drugs where the transport moiety in intended to enhance of the double bond-linked atoms. For such compounds, the uptake, typically the release of the transport moiety should present invention includes both Such regioisomers. be rapid. In other cases, it is desirable to utilize a moiety that 0461 Additionally, the formulas are intended to cover provides slow release, e.g., certain polymers or other moi solvated as well as unsolvated forms of the identified eties, such as cyclodextrins. (See, e.g., Cheng et al., U.S. structures. For example, the indicated structures include Patent publ. 20040077595, application Ser. No. 10/656,838, both both hydrated and non-hydrated forms. Other examples incorporated herein by reference.) Such carrier prodrugs are of solvates include the structures in combination with iso often advantageous for orally administered drugs. Carrier propanol, ethanol, methanol, DMSO, ethyl acetate, acetic prodrugs can, for example, be used to improve one or more acid, or ethanol amine. of the following properties: increased lipophilicity, increased duration of pharmacological effects, increased 0462 B. Prodrugs and Metabolites site-specificity, decreased toxicity and adverse reactions, 0463. In addition to the present formulas and compounds and/or improvement in drug formulation (e.g., stability, described herein, the invention also includes prodrugs (gen water Solubility, Suppression of an undesirable organoleptic erally pharmaceutically acceptable prodrugs), active meta or physiochemical property). For example, lipophilicity can bolic derivatives (active metabolites), and their pharmaceu be increased by esterification of hydroxyl groups with tically acceptable salts. lipophilic carboxylic acids, or of carboxylic acid groups with alcohols, e.g., aliphatic alcohols. Wermuth, The Prac 0464) In this context, prodrugs are compounds that may tice of Medicinal Chemistry, Ch. 31-32, Ed. Wermuth, be converted under physiological conditions or by Solvolysis Academic Press, San Diego, Calif., 2001. to the specified compound or to a pharmaceutically accept 0470 Prodrugs may proceed from prodrug form to active able salt of Such a compound. A common example is an alkyl form in a single step or may have one or more intermediate ester of a carboxylic acid. forms which may themselves have activity or may be 0465. As described in The Practice of Medicinal Chem inactive. istry, Ch. 31-32 (Ed. Wermuth, Academic Press, San Diego, 0471 Metabolites, e.g., active metabolites overlap with Calif., 2001), prodrugs can be conceptually divided into two prodrugs as described above, e.g., bioprecursor prodrugs. non-exclusive categories, bioprecursor prodrugs and carrier Thus, Such metabolites are pharmacologically active com prodrugs. Generally, bioprecursor prodrugs are compounds pounds or compounds that further metabolize to pharmaco are inactive or have low activity compared to the corre logically active compounds that are derivatives resulting sponding active drug compound, that contain one or more from metabolic process in the body of a subject or patient. protective groups and are converted to an active form by Of these, active metabolites are such pharmacologically metabolism or solvolysis. Both the active drug form and any active derivative compounds. For prodrugs, the prodrug released metabolic products should have acceptably low compounds is generally inactive or of lower activity than the toxicity. Typically, the formation of active drug compound metabolic product. For active metabolites, the parent com involves a metabolic process or reaction that is one of the pound may be either an active compound or may be an follow types: inactive prodrug. 0466. Oxidative reactions, such as oxidation of alcohol, 0472. Prodrugs and active metabolites may be identified carbonyl, and acid functions, hydroxylation of aliphatic using routine techniques know in the art. See, e.g., Bertolini carbons, hydroxylation of alicyclic carbon atoms, oxidation et al., 1997, J Med Chem 40:2011-2016; Shanet al., J Pharm of aromatic carbon atoms, oxidation of carbon-carbon Sci 86:756-757: Bagshawe, 1995, Drug Dev Res 34:220 double bonds, oxidation of nitrogen-containing functional 230; Wermuth, The Practice of Medicinal Chemistry, Ch. groups, oxidation of silicon, phosphorus, arsenic, and Sulfur, 31-32. Academic Press, San Diego, Calif., 2001. US 2006/01 00218 A1 May 11, 2006 42

0473 C. Pharmaceutically Acceptable Salts examples of Suitable salts include organic salts derived from amino acids. Such as glycine and arginine, ammonia, pri 0474 Compounds can be formulated as or be in the form mary, secondary, and tertiary amines, and cyclic amines, of pharmaceutically acceptable salts. Pharmaceutically Such as piperidine, morpholine and piperazine, and inor acceptable salts are non-toxic salts in the amounts and ganic salts derived from sodium, calcium, potassium, mag concentrations at which they are administered. The prepa ration of such salts can facilitate the pharmacological use by nesium, manganese, iron, copper, Zinc, aluminum and altering the physical characteristics of a compound without lithium. preventing it from exerting its physiological effect. Useful 0480. The pharmaceutically acceptable salt of the differ alterations in physical properties include lowering the melt ent compounds may be present as a complex. Examples of ing point to facilitate transmucosal administration and complexes include 8-chlorotheophylline complex (analo increasing the Solubility to facilitate administering higher gous to, e.g., dimenhydrinate: diphenhydramine 8-chloro concentrations of the drug. theophylline (1:1) complex: Dramamine) and various cyclo 0475 Pharmaceutically acceptable salts include acid dextrin inclusion complexes. addition salts such as those containing Sulfate, chloride, 0481 Unless specified to the contrary, specification of a hydrochloride, fumarate, maleate, phosphate, Sulfamate, compound herein includes pharmaceutically acceptable salts acetate, citrate, lactate, tartrate, methanesulfonate, ethane of Such compound. Sulfonate, benzenesulfonate, p-toluenesulfonate, cyclohexy lsulfamate and quinate. Pharmaceutically acceptable salts 0482 D. Polymorphic Forms can be obtained from acids such as hydrochloric acid, maleic 0483. In the case of agents that are solids, it is understood acid, Sulfuric acid, phosphoric acid, Sulfamic acid, acetic by those skilled in the art that the compounds and salts may acid, citric acid, lactic acid, tartaric acid, malonic acid, exist in different crystal or polymorphic forms, all of which methanesulfonic acid, ethanesulfonic acid, benzenesulfonic are intended to be within the scope of the present invention acid, p-toluenesulfonic acid, cyclohexylsulfamic acid, and specified formulas. fumaric acid, and quinic acid. XIV. Administration 0476 Pharmaceutically acceptable salts also include basic addition salts such as those containing benzathine, 0484 The methods and compounds will typically be used chloroprocaine, choline, diethanolamine, ethylenediamine, in therapy for human Subjects or patients. However, they meglumine, procaine, aluminum, calcium, lithium, magne may also be used to treat similar or identical diseases in sium, potassium, sodium, ammonium, alkylamine, and Zinc, other vertebrates such as other primates, sports animals, and when acidic functional groups, such as carboxylic acid or pets Such as horses, dogs and cats. phenol are present. For example, see Remington's Pharma 0485 Suitable dosage forms, in part, depend upon the use ceutical Sciences, 19" ed., Mack Publishing Co., Easton, or the route of administration, for example, oral, transder Pa., Vol. 2, p. 1457, 1995. Such salts can be prepared using mal, transmucosal, inhalant, or by injection (parenteral). the appropriate corresponding bases. Such dosage forms should allow the compound to reach 0477 Pharmaceutically acceptable salts can be prepared target cells. Other factors are well known in the art, and by standard techniques. For example, the free-base form of include considerations such as toxicity and dosage forms a compound is dissolved in a suitable solvent, Such as an that retard the compound or composition from exerting its aqueous or aqueous-alcohol in solution containing the effects. Techniques and formulations generally may be appropriate acid and then isolated by evaporating the solu found in Remington: The Science and Practice of Pharmacy, tion. In another example, a salt is prepared by reacting the 21 edition, Lippincott, Williams and Wilkins, Philadelphia, free base and acid in an organic solvent. Pa., 2005 (hereby incorporated by reference herein). 0478 Thus, for example, if the particular compound is a 0486 Compounds can be formulated as pharmaceutically base, the desired pharmaceutically acceptable salt may be acceptable salts. Pharmaceutically acceptable salts are non prepared by any suitable method available in the art, for toxic salts in the amounts and concentrations at which they example, treatment of the free base with an inorganic acid, are administered. The preparation of Such salts can facilitate Such as hydrochloric acid, hydrobromic acid, Sulfuric acid, the pharmacological use by altering the physical character nitric acid, phosphoric acid and the like, or with an organic istics of a compound without preventing it from exerting its acid, Such as acetic acid, maleic acid, Succinic acid, man physiological effect. Useful alterations in physical properties delic acid, fumaric acid, malonic acid, pyruvic acid, oxalic include lowering the melting point to facilitate transmucosal acid, glycolic acid, salicylic acid, a pyranosidyl acid, such as administration and increasing the solubility to facilitate glucuronic acid or galacturonic acid, an alpha-hydroxy acid, administering higher concentrations of the drug. Such as citric acid or tartaric acid, an amino acid, Such as aspartic acid or glutamic acid, an aromatic acid, such as 0487 Pharmaceutically acceptable salts include acid benzoic acid or cinnamic acid, a Sulfonic acid, Such as addition salts such as those containing Sulfate, chloride, p-toluenesulfonic acid or ethanesulfonic acid, or the like. hydrochloride, fumarate, maleate, phosphate, Sulfamate, acetate, citrate, lactate, tartrate, methanesulfonate, ethane 0479. Similarly, if the particular compound is an acid, the Sulfonate, benzenesulfonate, p-toluenesulfonate, cyclohexy desired pharmaceutically acceptable salt may be prepared by lsulfamate and quinate. Pharmaceutically acceptable salts any suitable method, for example, treatment of the free acid can be obtained from acids such as hydrochloric acid, maleic with an inorganic or organic base. Such as an amine (pri acid, Sulfuric acid, phosphoric acid, Sulfamic acid, acetic mary, secondary or tertiary), an alkali metal hydroxide or acid, citric acid, lactic acid, tartaric acid, malonic acid, alkaline earth metal hydroxide, or the like. Illustrative methanesulfonic acid, ethanesulfonic acid, benzenesulfonic US 2006/01 00218 A1 May 11, 2006

acid, p-toluenesulfonic acid, cyclohexylsulfamic acid, (PEG), and/or titanium dioxide, lacquer Solutions, and Suit fumaric acid, and quinic acid. able organic solvents or solvent mixtures. Dye-stuffs or 0488 Pharmaceutically acceptable salts also include pigments may be added to the tablets or dragee coatings for basic addition salts such as those containing benzathine, identification or to characterize different combinations of chloroprocaine, choline, diethanolamine, ethylenediamine, active compound doses. meglumine, procaine, aluminum, calcium, lithium, magne 0495 Pharmaceutical preparations that can be used orally sium, potassium, sodium, ammonium, alkylamine, and Zinc, include push-fit capsules made of gelatin (“gelcaps”), as when acidic functional groups, such as carboxylic acid or well as soft, sealed capsules made of gelatin, and a plasti phenol are present. For example, see Remington's Pharma cizer, such as glycerol or Sorbitol. The push-fit capsules can ceutical Sciences, 19" ed., Mack Publishing Co., Easton, contain the active ingredients in admixture with filler Such as Pa., Vol. 2, p. 1457, 1995. Such salts can be prepared using lactose, binders such as starches, and/or lubricants such as the appropriate corresponding bases. talc or magnesium Stearate and, optionally, stabilizers. In 0489 Pharmaceutically acceptable salts can be prepared Soft capsules, the active compounds may be dissolved or by standard techniques. For example, the free-base form of Suspended in Suitable liquids, such as fatty oils, liquid a compound is dissolved in a suitable solvent, Such as an paraffin, or liquid polyethylene glycols (PEGs). In addition, aqueous or aqueous-alcohol in solution containing the stabilizers may be added. appropriate acid and then isolated by evaporating the solu 0496 Alternatively, injection (parenteral administration) tion. In another example, a salt is prepared by reacting the may be used, e.g., intramuscular, intravenous, intraperito free base and acid in an organic solvent. neal, and/or Subcutaneous. For injection, the compounds of 0490 The pharmaceutically acceptable salt of the differ the invention are formulated in Sterile liquid Solutions, ent compounds may be present as a complex. Examples of preferably in physiologically compatible buffers or solu complexes include 8-chlorotheophylline complex (analo tions, such as Saline Solution, Hank’s Solution, or Ringer's gous to, e.g., dimenhydrinate: diphenhydramine 8-chloro Solution. In addition, the compounds may be formulated in theophylline (1:1) complex: Dramamine) and various cyclo solid form and redissolved or suspended immediately prior dextrin inclusion complexes. to use. Lyophilized forms can also be produced. 0491 Carriers or excipients can be used to produce 0497 Administration can also be by transmucosal or compositions. The carriers or excipients can be chosen to transdermal means. For transmucosal or transdermal admin facilitate administration of the compound. Examples of istration, penetrants appropriate to the barrier to be perme carriers include calcium carbonate, calcium phosphate, Vari ated are used in the formulation. Such penetrants are gen ous Sugars such as lactose, glucose, or Sucrose, or types of erally known in the art, and include, for example, for starch, cellulose derivatives, gelatin, vegetable oils, poly transmucosal administration, bile salts and fusidic acid ethylene glycols and physiologically compatible solvents. derivatives. In addition, detergents may be used to facilitate Examples of physiologically compatible solvents include permeation. Transmucosal administration, for example, may sterile solutions of water for injection (WFI), saline solution, be through nasal sprays or Suppositories (rectal or vaginal). and dextrose. 0498 For inhalants, compounds of the invention may be formulated as dry powder or a suitable solution, Suspension, 0492. The compounds can be administered by different or aerosol. Powders and solutions may be formulated with routes including intravenous, intraperitoneal, Subcutaneous, suitable additives known in the art. For example, powders intramuscular, oral, transmucosal, rectal, inhalant or trans may include a Suitable powder base such as lacatose or dermal. For oral administration, for example, the com starch, and solutions may comprise propylene glycol, Sterile pounds can be formulated into conventional oral dosage water, ethanol, Sodium chloride and other additives, such as forms such as capsules, tablets, and liquid preparations such acid, alkali and buffer salts. Such solutions or Suspensions as syrups, elixirs, and concentrated drops. may be administered by inhaling via spray, pump, atomizer, 0493 Pharmaceutical preparations for oral use can be or nebulizer and the like. The compounds of the invention obtained, for example, by combining the active compounds may also be used in combination with other inhaled thera with solid excipients, optionally grinding a resulting mix pies, for example corticosteroids Such as fluticaSone prop ture, and processing the mixture of granules, after adding rionate, beclomethasone dipropionate, triamcinolone suitable auxiliaries, if desired, to obtain tablets or dragee acetonide, budesonide, and mometaSone furoate; beta ago cores. Suitable excipients are, in particular, fillers such as nists such as albuterol, Salmeterol, and formoterol; anticho Sugars, including lactose, Sucrose, mannitol, or Sorbitol; linergic agents such as ipratroprium bromide or tiotropium; cellulose preparations, for example, maize starch, wheat vasodilators such as treprostinal and iloprost; enzymes Such starch, rice starch, potato starch, gelatin, gum tragacanth, as DNAase; therapeutic proteins; immunoglobulin antibod methyl cellulose, hydroxypropylmethyl-cellulose, sodium ies; an oligonucleotide, such as single or double stranded carboxymethylcellulose (CMC), and/or polyvinylpyrroli DNA or RNA, siRNA; antibiotics such as tobramycin; done (PVP: poVidone). If desired, disintegrating agents may muscarinic receptor antagonists; leukotriene antagonists; be added, such as the cross-linked polyvinylpyrrolidone, cytokine antagonists; protease inhibitors; cromolyn Sodium; agar, or alginic acid, or a salt thereof Such as sodium nedocril sodium; and Sodium cromoglycate. alginate. 0499. It is understood that use in combination for any 0494 Dragee cores are provided with suitable coatings. route of administration includes delivery of compounds of For this purpose, concentrated Sugar Solutions may be used, the invention and one or more other therapeutics delivered which may optionally contain, for example, gum arabic, talc, by the same route of administration together in any formu poly-vinylpyrrolidone, carbopol gel, polyethylene glycol lation, including formulations where the two compounds are US 2006/01 00218 A1 May 11, 2006 44 chemically linked such that they maintain their therapeutic of general means well known to those of skill in the art. activity when administered. Combination use includes These include, e.g., analytical biochemical methods such as administration of co-formulations or formulations of chemi NMR spectrophotometry, radiography, electrophoresis, cally joined compounds, or co-administration of the com capillary electrophoresis, high performance liquid chroma pounds in separate formulations. Separate formulations may tography (HPLC), thin layer chromatography (TLC), and be co-administered by delivery via one device, for example hyperdiffusion chromatography, various immunological the same inhalant device, the same Syringe, etc., or can be methods, e.g. fluid or gel precipitin reactions, immunodif co-administered from separate devices, where co-adminis fusion, immuno-electrophoresis, radioimmunoassays tration in this case means administered within a short time (RIAS), enzyme-linked immunosorbent assays (ELISAS), of each other. Co-formulations of a compound of the inven tion and one or more additional therapies delivered by the immuno-fluorescent assays, Southern analysis, Northern same route includes preparation of the materials together analysis, dot-blot analysis, gel electrophoresis (e.g., SDS Such that they can be administered by one device, including PAGE), nucleic acid or target or signal amplification meth the separate compounds combined in one formulation, or ods, radiolabeling, Scintillation counting, and affinity chro compounds that are modified Such that they are chemically matography. joined, yet still maintain their biological activity. Such 0505. Obtaining and manipulating nucleic acids used to chemically joined compounds may have a linkage that is practice the methods of the invention can be performed by Substantially maintained in Vivo, or the linkage may break cloning from genomic samples, and, if desired, Screening down in Vivo, separating the two active components. and re-cloning inserts isolated or amplified from, e.g., 0500 The amounts of various compound to be adminis genomic clones or cDNA clones. Sources of nucleic acid tered can be determined by standard procedures taking into used in the methods of the invention include genomic or account factors such as the compound ICso, the biological cDNA libraries contained in, e.g., mammalian artificial half-life of the compound, the age, size, and weight of the chromosomes (MACs), see, e.g., U.S. Pat. Nos. 5,721,118; subject, and the disorder associated with the subject. The 6,025,155; human artificial chromosomes, see, e.g., Rosen importance of these and other factors are well known to feld (1997) Nat. Genet. 15:333-335; yeast artificial chromo those of ordinary skill in the art. Generally, a dose will be somes (YAC); bacterial artificial chromosomes (BAC); P1 between about 0.01 and 50 mg/kg, preferably 0.1 and 20 artificial chromosomes, see, e.g., Woon (1998) Genomics mg/kg of the Subject being treated. Multiple doses may be 50:306-316; P1-derived vectors (PACs), see, e.g., Kern (1997) Biotechniques 23:120-124; cosmids, recombinant used. viruses, phages or plasmids. XV. Manipulation of PDE4B 0506 The nucleic acids of the invention can be opera 0501. As the full-length coding sequence and amino acid tively linked to a promoter. A promoter can be one motif or sequence of PDE4B from various mammals including an array of nucleic acid control sequences which direct human is known, cloning, construction of recombinant transcription of a nucleic acid. A promoter can include PDE4B, production and purification of recombinant protein, necessary nucleic acid sequences near the start site of introduction of PDE4B into other organisms, and other transcription, Such as, in the case of a polymerase II type molecular biological manipulations of PDE4B are readily promoter, a TATA element. A promoter also optionally performed. includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start 0502 Techniques for the manipulation of nucleic acids, site of transcription. A “constitutive' promoter is a promoter Such as, e.g., Subcloning, labeling probes (e.g., random which is active under most environmental and developmen primer labeling using Klenow polymerase, nick translation, tal conditions. An “inducible' promoter is a promoter which amplification), sequencing, hybridization and the like are is under environmental or developmental regulation. A “tis well disclosed in the Scientific and patent literature, see, e.g., Sue specific' promoter is active in certain tissue types of an Sambrook, ed., Molecular Cloning: a Laboratory Manual organism, but not in other tissue types from the same (2nd ed.), Vols. 1-3, Cold Spring Harbor Laboratory, (1989); organism. The term “operably linked refers to a functional Current Protocols in Molecular Biology, Ausubel, ed. John linkage between a nucleic acid expression control sequence Wiley & Sons, Inc., New York (1997); Laboratory Tech (such as a promoter, or array of transcription factor binding niques in Biochemistry and Molecular Biology: Hybridiza sites) and a second nucleic acid sequence, wherein the tion With Nucleic Acid Probes, Part I. Theory and Nucleic expression control sequence directs transcription of the Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993). nucleic acid corresponding to the second sequence. 0503 Nucleic acid sequences can be amplified as neces sary for further use using amplification methods, such as 0507 The nucleic acids of the invention can also be PCR, isothermal methods, rolling circle methods, etc., are provided in expression vectors and cloning vehicles, e.g., well known to the skilled artisan. See, e.g., Saiki, "Ampli sequences encoding the polypeptides of the invention. fication of Genomic DNA’ in PCR Protocols, Innis et al., Expression vectors and cloning vehicles of the invention can Eds. Academic Press, San Diego, Calif. 1990, pp 13-20; comprise viral particles, baculovirus, phage, plasmids, Wharam et al., Nucleic Acids Res. 2001 Jun. 1:29(11):E54 phagemids, cosmids, fosmids, bacterial artificial chromo E54; Haffner et al., Biotechniques 2001 Apr.:30(4):852-6, Somes, viral DNA (e.g., vaccinia, adenovirus, foul pox virus, 858, 860 passim; Zhong et al., Biotechniques 2001 pseudorabies and derivatives of SV40), P1-based artificial Apr.:30(4):852-6, 858, 860 passim. chromosomes, yeast plasmids, yeast artificial chromosomes, and any other vectors specific for specific hosts of interest 0504 Nucleic acids, vectors, capsids, polypeptides, and (such as bacillus, Aspergillus and yeast). Vectors of the the like can be analyzed and quantified by any of a number invention can include chromosomal, non-chromosomal and US 2006/01 00218 A1 May 11, 2006 synthetic DNA sequences. Large numbers of Suitable vec invention can be fused to a heterologous peptide or polypep tors are known to those of skill in the art, and are commer tide, such as N-terminal identification peptides which impart cially available. desired characteristics, such as increased stability or simpli fied purification. Peptides and polypeptides of the invention 0508 The nucleic acids of the invention can be cloned, if can also be synthesized and expressed as fusion proteins desired, into any of a variety of vectors using routine with one or more additional domains linked thereto for, e.g., molecular biological methods; methods for cloning in vitro producing a more immunogenic peptide, to more readily amplified nucleic acids are disclosed, e.g., U.S. Pat. No. isolate a recombinantly synthesized peptide, to identify and 5,426,039. To facilitate cloning of amplified sequences, isolate antibodies and antibody-expressing B cells, and the restriction enzyme sites can be “built into a PCR primer like. Detection and purification facilitating domains include, pair. Vectors may be introduced into a genome or into the e.g., metal chelating peptides such as polyhistidine tracts cytoplasm or a nucleus of a cell and expressed by a variety and histidine-tryptophan modules that allow purification on of conventional techniques, well described in the scientific immobilized metals, protein A domains that allow purifica and patent literature. See, e.g., Roberts (1987) Nature tion on immobilized immunoglobulin, and the domain uti 328:731; Schneider (1995) Protein Expr: Purif. 6435:10: lized in the FLAGS extension/affinity purification system Sambrook, Tijssen or Ausubel. The vectors can be isolated (Immunex Corp, Seattle Wash.). The inclusion of a cleavable from natural sources, obtained from such sources as ATCC linker sequences such as Factor Xa or enterokinase (Invit or GenBank libraries, or prepared by synthetic or recombi rogen, San Diego Calif.) between a purification domain and nant methods. For example, the nucleic acids of the inven the motif-comprising peptide or polypeptide to facilitate tion can be expressed in expression cassettes, vectors or purification. For example, an expression vector can include viruses which are stably or transiently expressed in cells an epitope-encoding nucleic acid sequence linked to six (e.g., episomal expression systems). Selection markers can histidine residues followed by a thioredoxin and an enter be incorporated into expression cassettes and vectors to okinase cleavage site (see e.g., Williams (1995) Biochem confer a selectable phenotype on transformed cells and istry 34:1787-1797; Dobeli (1998) Protein Expr: Purif sequences. For example, selection markers can code for 12:404-414). The histidine residues facilitate detection and episomal maintenance and replication Such that integration purification while the enterokinase cleavage site provides a into the host genome is not required. means for purifying the epitope from the remainder of the 0509. The nucleic acids can be administered in vivo for fusion protein. In one aspect, a nucleic acid encoding a in situ expression of the peptides or polypeptides of the polypeptide of the invention is assembled in appropriate invention. The nucleic acids can be administered as “naked phase with a leader sequence capable of directing secretion DNA” (see, e.g., U.S. Pat. No. 5,580,859) or in the form of of the translated polypeptide or fragment thereof. Technol an expression vector, e.g., a recombinant virus. The nucleic ogy pertaining to vectors encoding fusion proteins and acids can be administered by any route, including peri- or application of fusion proteins are well disclosed in the intra-tumorally, as described below. Vectors administered in scientific and patent literature, see e.g., Kroll (1993) DNA Vivo can be derived from viral genomes, including recom Cell. Biol. 12:441-53. binantly modified enveloped or non-enveloped DNA and RNA viruses, preferably selected from baculoviridiae, par 0511. The nucleic acids and polypeptides of the invention voviridiae, picornoviridiae, herpesveridiae, poxyiridae, can be bound to a Solid Support, e.g., for use in Screening and adenoviridiae, or picornnaviridiae. Chimeric vectors may diagnostic methods. Solid Supports can include, e.g., mem also be employed which exploit advantageous merits of each branes (e.g., nitrocellulose or nylon), a microtiter dish (e.g., of the parent vector properties (See e.g., Feng (1997) Nature PVC, polypropylene, or polystyrene), a test tube (glass or Biotechnology 15:866-870). Such viral genomes may be plastic), a dip Stick (e.g., glass, PVC, polypropylene, poly modified by recombinant DNA techniques to include the styrene, latex and the like), a microfuge tube, or a glass, nucleic acids of the invention; and may be further engi silica, plastic, metallic or polymer bead or other Substrate neered to be replication deficient, conditionally replicating Such as paper. One solid Support uses a metal (e.g., cobalt or or replication competent. In alternative aspects, vectors are nickel)-comprising column which binds with specificity to a derived from the adenoviral (e.g., replication incompetent histidine tag engineered onto a peptide. vectors derived from the human adenovirus genome, see, 0512) Adhesion of molecules to a solid support can be e.g., U.S. Pat. Nos. 6,096,718; 6,110,458; 6,113.913; 5,631, direct (i.e., the molecule contacts the Solid Support) or 236); adeno-associated viral and retroviral genomes. Retro indirect (a “linker' is bound to the support and the molecule viral vectors can include those based upon murine leukemia of interest binds to this linker). Molecules can be immobi virus (Mul V), gibbon ape leukemia virus (Gal. V), Simian lized either covalently (e.g., utilizing single reactive thiol Immuno deficiency virus (SIV), human immuno deficiency groups of cysteine residues (see, e.g., Colliuod (1993) virus (HIV), and combinations thereof; see, e.g., U.S. Pat. Bioconjugate Chem. 4:528-536) or non-covalently but spe Nos. 6,117,681; 6,107,478; 5,658,775; 5,449,614; Buch cifically (e.g., via immobilized antibodies (see, e.g., Schu scher (1992).J. Virol. 66:2731-2739; Johann (1992).J. Virol. hmann (1991) Adv. Mater. 3:388-391; Lu (1995) Anal. 66:1635-1640). Adeno-associated virus (AAV)-based vec Chem. 67:83-87; the biotin/strepavidin system (see, e.g., tors can be used to transduce cells with target nucleic acids, Iwane (1997) Biophys. Biochem. Res. Comm. 230:76-80); e.g., in the in vitro production of nucleic acids and peptides, metal chelating, e.g., Langmuir-Blodgett films (see, e.g., Ng and in in vivo and ex vivo gene therapy procedures; see, e.g., (1995) Langmuir 11:4048-55); metal-chelating self-as U.S. Pat. Nos. 6,110,456; 5,474,935: Okada (1996) Gene sembled monolayers (see, e.g., Sigal (1996) Anal. Chem. Ther. 3:957-964. 68:490-497) for binding of polyhistidine fusions. 0510) The present invention also relates to fusion pro 0513 Indirect binding can be achieved using a variety of teins, and nucleic acids encoding them. A polypeptide of the linkers which are commercially available. The reactive ends US 2006/01 00218 A1 May 11, 2006 46 can be any of a variety of functionalities including, but not example, in U.S. Pat. Nos. 6,277.628; 6.277,489; 6,261,776: limited to: amino reacting ends such as N-hydroxysuccin 6,258,606; 6,054,270; 6,048,695; 6,045,996; 6,022,963: imide (NHS) active esters, imidoesters, aldehydes, epoxides, 6,013,440; 5,965,452; 5,959,098; 5,856,174; 5,830,645; Sulfonyl halides, isocyanate, isothiocyanate, and nitroaryl 5,770,456; 5,632,957; 5,556,752; 5,143,854; 5,807,522; halides; and thiol reacting ends such as pyridyl disulfides, 5,800,992; 5,744,305; 5,700,637; 5,556,752; 5.434,049; see maleimides, thiophthalimides, and active halogens. The het also, e.g., WO 99/51773; WO99/09217; WO 97/46313; WO erobifunctional crosslinking reagents have two different 96/17958; see also, e.g., Johnston (1998) Curr. Biol. 8:R'7'- reactive ends, e.g., an amino-reactive end and a thiol R''': Schummer (1997) Biotechniques 23:1087-1092: Kern reactive end, while homobifunctional reagents have two (1997) Biotechniques 23:120-124; Solinas-Toldo (1997) similar reactive ends, e.g., bismaleimidohexane (BMH) Genes, Chromosomes & Cancer 20:399-407; Bowtell which permits the cross-linking of Sulfhydryl-containing (1999) Nature Genetics Supp. 21:25-32. See also published compounds. The spacer can be of varying length and be U.S. patent applications Nos. 20010018642: 20010019827: aliphatic or aromatic. Examples of commercially available 20010016322: 20010014449; 20010014448; 20010012537; homobifunctional cross-linking reagents include, but are not 2001 OOO8765. limited to, the imidoesters such as dimethyl adipimidate dihydrochloride (DMA); dimethyl pimelimidate dihydro 0517 Host Cells and Transformed Cells chloride (DMP); and dimethyl suberimidate dihydrochloride 0518. The invention also provides a transformed cell (DMS). Heterobifunctional reagents include commercially comprising a nucleic acid sequence of the invention, e.g., a available active halogen-NHS active esters coupling agents sequence encoding a polypeptide of the invention, or a Such as N-Succinimidyl bromoacetate and N-Succinimidyl vector of the invention. The host cell may be any of the host (4-iodoacetyl)aminobenzoate (SIAB) and the sulfosuccin cells familiar to those skilled in the art, including prokary imidyl derivatives such as SulfoSuccinimidyl(4-iodoacety otic cells, eukaryotic cells, such as bacterial cells, fungal l)aminobenzoate (sulfo-SIAB) (Pierce). Another group of cells, yeast cells, mammalian cells, insect cells, or plant coupling agents is the heterobifunctional and thiol cleavable cells. Exemplary bacterial cells include E. coli, Streptomy agents such as N-Succinimidyl 3-(2-pyridyidithio)propi ces, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and onate (SPDP) (Pierce Chemicals, Rockford, Ill.). Staphylococcus. Exemplary insect cells include Drosophila 0514 Antibodies can also be used for binding polypep S2 and Spodoptera Sf9. Exemplary animal cells include tides and peptides of the invention to a solid support. This CHO, COS or Bowes melanoma or any mouse or human cell can be done directly by binding peptide-specific antibodies line. The selection of an appropriate host is within the to the column or it can be done by creating fusion protein abilities of those skilled in the art. chimeras comprising motif-containing peptides linked to, 0519 Vectors may be introduced into the host cells using e.g., a known epitope (e.g., a tag (e.g., FLAG, myc) or an any of a variety of techniques, including transformation, appropriate immunoglobulin constant domain sequence (an transfection, transduction, viral infection, gene guns, or “immunoadhesin, see, e.g., Capon (1989) Nature 377:525 Ti-mediated gene transfer. Particular methods include cal 531 (1989). cium phosphate transfection, DEAE-Dextran mediated 0515 Nucleic acids or polypeptides of the invention can transfection, lipofection, or electroporation. be immobilized to or applied to an array. Arrays can be used 0520 Engineered host cells can be cultured in conven to screen for or monitor libraries of compositions (e.g., Small tional nutrient media modified as appropriate for activating molecules, antibodies, nucleic acids, etc.) for their ability to promoters, selecting transformants or amplifying the genes bind to or modulate the activity of a nucleic acid or a of the invention. Following transformation of a suitable host polypeptide of the invention. For example, in one aspect of strain and growth of the host strain to an appropriate cell the invention, a monitored parameter is transcript expression density, the selected promoter may be induced by appropri of a gene comprising a nucleic acid of the invention. One or ate means (e.g., temperature shift or chemical induction) and more, or, all the transcripts of a cell can be measured by the cells may be cultured for an additional period to allow hybridization of a sample comprising transcripts of the cell, them to produce the desired polypeptide or fragment thereof. or, nucleic acids representative of or complementary to transcripts of a cell, by hybridization to immobilized nucleic 0521. Cells can be harvested by centrifugation, disrupted acids on an array, or “biochip. By using an “array' of by physical or chemical means, and the resulting crude nucleic acids on a microchip, some or all of the transcripts extract is retained for further purification. Microbial cells of a cell can be simultaneously quantified. Alternatively, employed for expression of proteins can be disrupted by any arrays comprising genomic nucleic acid can also be used to convenient method, including freeze-thaw cycling, Sonica determine the genotype of a newly engineered strain made tion, mechanical disruption, or use of cell lysing agents. by the methods of the invention. Polypeptide arrays' can Such methods are well known to those skilled in the art. The also be used to simultaneously quantify a plurality of expressed polypeptide or fragment can be recovered and proteins. purified from recombinant cell cultures by methods includ ing ammonium sulfate or ethanol precipitation, acid extrac 0516) The terms “array” or “microarray” or “biochip” or tion, anion or cation exchange chromatography, phospho "chip’ as used herein is a plurality of target elements, each cellulose chromatography, hydrophobic interaction target element comprising a defined amount of one or more chromatography, affinity chromatography, hydroxylapatite polypeptides (including antibodies) or nucleic acids immo chromatography and lectin chromatography. Protein refold bilized onto a defined area of a substrate surface. In prac ing steps can be used, as necessary, in completing configu ticing the methods of the invention, any known array and/or ration of the polypeptide. If desired, high performance liquid method of making and using arrays can be incorporated in chromatography (HPLC) can be employed for final purifi whole or in part, or variations thereof, as disclosed, for cation steps. US 2006/01 00218 A1 May 11, 2006 47

0522 Various mammalian cell culture systems can also pp. 16.30-16.37. An exemplary method is as follows. be employed to express recombinant protein. Examples of Briefly, COS-1 cells are plated at a density of 5x10 cells/ mammalian expression systems include the COS-7 lines of dish and then grown for 24 hours in FBS-supplemented monkey kidney fibroblasts and other cell lines capable of DMEM/F 12 medium. Medium is then removed and cells are expressing proteins from a compatible vector, such as the washed in PBS and then in medium. A transfection solution C127, 3T3, CHO, HeLa and BHK cell lines. containing DEAE dextran (0.4 mg/ml), 100 uM chloroquine, 0523 The constructs in host cells can be used in a 10% NuSerum, DNA (0.4 mg/ml) in DMEM/F12 medium is conventional manner to produce the gene product encoded then applied on the cells 10 ml volume. After incubation for by the recombinant sequence. Depending upon the host 3 hours at 37° C., cells are washed in PBS and medium as employed in a recombinant production procedure, the polypeptides produced by host cells containing the vector just described and then shocked for 1 minute with 10% may be glycosylated or may be non-glycosylated. Polypep DMSO in DMEM/F12 medium. Cells are allowed to grow tides of the invention may or may not also include an initial for 2-3 days in 10% FBS-supplemented medium, and at the methionine amino acid residue. end of incubation dishes are placed on ice, washed with ice cold PBS and then removed by scraping. Cells are then 0524 Cell-free translation systems can also be employed harvested by centrifugation at 1000 rpm for 10 minutes and to produce a polypeptide of the invention. Cell-free trans the cellular pellet is frozen in liquid nitrogen, for Subsequent lation systems can use mRNAs transcribed from a DNA construct comprising a promoter operably linked to a nucleic use in protein expression. Northern blot analysis of a thawed acid encoding the polypeptide or fragment thereof. In some aliquot of frozen cells may be used to confirm expression of aspects, the DNA construct may be linearized prior to receptor-encoding cDNA in cells under storage. conducting an in vitro transcription reaction. The transcribed mRNA is then incubated with an appropriate cell-free trans 0529. In a like manner, stably transfected cell lines can lation extract, Such as a rabbit reticulocyte extract, to pro also prepared, for example, using two different cell types as duce the desired polypeptide or fragment thereof. host: CHO K1 and CHO Pro5. To construct these cell lines, cDNA coding for the relevant protein may be incorporated 0525) The expression vectors can contain one or more into the mammalian expression vector pRC/CMV (Invitro selectable marker genes to provide a phenotypic trait for gen), which enables stable expression. Insertion at this site selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, places the cDNA under the expression control of the or Such as tetracycline or amplicillin resistance in E. coli. cytomegalovirus promoter and upstream of the polyadeny lation site and terminator of the bovine growth hormone 0526 For transient expression in mammalian cells, gene, and into a vector background comprising the neomy cDNA encoding a polypeptide of interest may be incorpo cin resistance gene (driven by the SV40 early promoter) as rated into a mammalian expression vector, e.g. pcDNA1, selectable marker. which is available commercially from Invitrogen Corpora tion (San Diego, Calif., U.S.A.: catalogue number V490 0530. An exemplary protocol to introduce plasmids con 20). This is a multifunctional 4.2 kb plasmid vector designed structed as described above is as follows. The host CHO for cDNA expression in eukaryotic systems, and cDNA cells are first seeded at a density of 5x10 in 10% FBS analysis in prokaryotes, incorporated on the vector are the supplemented MEM medium. After growth for 24 hours, CMV promoter and enhancer, splice segment and polyade nylation signal, an SV40 and Polyoma virus origin of fresh medium is added to the plates and three hours later, the replication, and M13 origin to rescue single strand DNA for cells are transfected using the calcium phosphate-DNA sequencing and mutagenesis, Sp6 and T7 RNA promoters co-precipitation procedure (Sambrook et al. Supra). Briefly, for the production of sense and anti-sense RNA transcripts 3 ug of DNA is mixed and incubated with buffered calcium and a Col E1-like high copy plasmid origin. A polylinker is Solution for 10 minutes at room temperature. An equal located appropriately downstream of the CMV promoter volume of buffered phosphate solution is added and the (and 3' of the T7 promoter). Suspension is incubated for 15 minutes at room temperature. Next, the incubated suspension is applied to the cells for 4 0527 The cDNA insert may be first released from the hours, removed and cells were shocked with medium con above phagemid incorporated at appropriate restriction sites taining 15% glycerol. Three minutes later, cells are washed in the pcDNAI polylinker. Sequencing across the junctions with medium and incubated for 24 hours at normal growth may be performed to confirm proper insert orientation in conditions. Cells resistant to neomycin are selected in 10% pcDNAI. The resulting plasmid may then be introduced for FBS-supplemented alpha-MEM medium containing G418 transient expression into a selected mammalian cell host, for (1 mg/ml). Individual colonies of G418-resistant cells are example, the monkey-derived, fibroblast like cells of the isolated about 2-3 weeks later, clonally selected and then COS-1 lineage (available from the American Type Culture propagated for assay purposes. Collection, Rockville, Md. as ATCC CRL 1650). 0528 For transient expression of the protein-encoding EXAMPLES DNA, for example, COS-1 cells may be transfected with approximately 8 ug DNA per 10 COS cells, by DEAE 0531. A number of examples involved in the present mediated DNA transfection and treated with chloroquine invention are described below. In most cases, alternative according to the procedures described by Sambrook et al. techniques could also be used. The examples are intended to Molecular Cloning: A Laboratory Manual, 1989, Cold be illustrative and are not limiting or restrictive to the scope Spring Harbor Laboratory Press, Cold Spring Harbor N.Y. of the invention. US 2006/01 00218 A1 May 11, 2006 48

Example 1 0537) Step 3 Synthesis of Formula V Synthesis of compounds of Formula Ia 0538 Compound of Formula V can be prepared from compound IV by reacting with boronic acids under Suzuki 0532) reaction conditions (Smith M. B.; March, J. March's Advanced Organic Chemistry. Reactions, Mechanisms, and Structure, 5" ed., John Wiley & Sons: New York, 2001 p Scheme - 1 868). Alternately, compound IV can also be reacted with tin, y2"\ y2"\ Zinc, or copper reagents, under Stille, Negishi or cuprate X X coupling reaction conditions, respectively (Smith M. B.: Step 1 Step 2 March, J. March's Advanced Organic Chemistry. Reactions, Null sent- 1\ld Seni Mechanisms, and Structure, 5" ed., John Wiley & Sons: t-NH. t-N New York, 2001 p. 931), to provide compound V. The V product can be isolated by conventional work up procedure, Prot e.g. extraction of the product with an organic solvent and II III purifying by column chromatography. y2"Q 0539 Step 4 Synthesis of Formula VI X Br f Step 3 0540 Compound of formula VI can be prepared by -- st reacting compound V with fluorides (for silyl protecting t-N groups—tetrabutyl ammonium fluoride or ammonium fluo V ride) (Greene, T. W.; Wuts, P.G.M. Protective Groups in Prot Organic Synthesis, 3" ed., John Wiley & Sons: New York, IV 1999. p 620), base (for aryl sulfone protecting groups— a's aqueous potassium hydroxide) (Greene, T. W.; Wuts, P.G.M. A l Step 4 Protective Groups in Organic Synthesis, 3rd ed., John Wiley & Sons: New York, 1999. p 615), or an acid (for carbam y ates trifluoroacetic acid) (Greene, T. W.; Wuts, P.G.M. t-N Protective Groups in Organic Synthesis, 3" ed., John Wiley V Prot & Sons: New York, 1999, p 272) and isolating the product following standard workup procedures, e.g. extraction of the V product with organic Solvent and purifying by column 2WS y2"Q chromatography. X X 0541) Step–5 Synthesis of Formula la

ts NH -N 0542 Compounds of Formula Ia can be prepared by V reacting compound VI with nucleophilic reagents, e.g. acid k chlorides, Sulfonyl chlorides, isocyanates, isothiocyanates, VI Formula Ia alkyl halides, benzyl halides, etc., under basic conditions (General reference: Smith M. B.; March, J. March's Advanced Organic Chemistry. Reactions, Mechanisms, and 0533 Step–1 Synthesis of Formula III Structure, 5" ed., John Wiley & Sons: New York, 2001). The product can be isolated by following standard workup 0534 Compound of Formula III can be prepared from procedures, e.g. extraction of the product with organic commercially available compound II by reacting with a Solvent and purifying by column chromatography. reagent containing a leaving group, e.g. chloro, tosyl, etc., in presence of a base, e.g. triethyl amine, pyridine, aqueous Example 2 hydroxides, etc., in a polar solvent, e.g. dimethylformamide (DMF), or water (Greene, T. W.; Wuts, P.G.M. Protective Alternate Synthesis of Compounds of Formula Ia Groups in Organic Synthesis, 3" ed.: John Wiley & Sons: New York, 1999). The product can be isolated by conven 0543) tional work up procedure, e.g. extraction of the product with an organic solvent and evaporation. Scheme - 2 0535) Step 2 Synthesis of Formula IV -"S a's 0536 Compound of Formula IV can be prepared from N f Step 1 Br N f Step 2 compound III by reacting with bromine in carbon tetrachlo ride or N-bromosuccinimide in THF. The product can be isolated by conventional work up procedure, e.g. extraction of the product with an organic solvent and purifying by column chromatography. US 2006/01 00218 A1 May 11, 2006 49

acetic acid) and isolating the product following standard -continued workup procedures, e.g. extraction of the product with 2^ organic solvent and purifying by column chromatography. X Br N W Step 3 0551 Step–5 Synthesis of Formula la y 0552 Compound of Formula Ia can be prepared by !- reacting compound VI with nucleophilic reagents, e.g. acid V chlorides, Sulfonyl chlorides, isocyanates, isothiocyanates, Prot etc., under basic conditions. The product can be isolated by IV following standard workup procedures, e.g. extraction of the eW product with organic Solvent and purifying by column chromatography. A N. Stepep 4 -- st Example 3 t-N V Alternate Synthesis of Compounds of Formula Ia Prot V 0553) eWN y2eW N. X X A Step 5 A ? Scheme - 3 y- y 2W t-NH. t-N X Y. Br -- ? alStep 1 VI Formula Ia t-N V Prot 0544 Step–1 Synthesis of Formula VII IV y2'\ 0545 Compound of Formula VII can be prepared from X commercially available compound II by reacting with bro (RO)2B l Step 2 mine in carbon tetrachloride at low temperature, for example -20°C., or N-bromosuccinimide in THF. The product can be y t-N isolated by conventional work up procedure, e.g. extraction V of the product with an organic solvent and purifying by Prot column chromatography. VIII 0546) Step 2 Synthesis of Formula IV y2S X 0547 Compound of Formula IV can be prepared from A Step 3 compound VII by reacting with a reagent containing a leaving group, e.g. chloro, tosyl, etc., in presence of a base, -- e. e.g. triethyl amine, pyridine, aqueous hydroxides, etc., in a t-N V polar solvent, e.g. dimethylformamide (DMF), or water. The Prot product can be isolated by conventional work up procedure, e.g. extraction of the product with an organic solvent and V evaporation. Step 3 Synthesis of Formula V 2WS y2\ X X 0548 Compound of Formula V can be prepared from A N f Step 4 A N W compound IV by reacting with boronic acids under Suzuki reaction conditions. Alternately, compound IV can also be ts NH t-N reacted with tin, Zinc, or copper reagents, under Stille, V Negishi or cuprate coupling reaction conditions respectively, k to provide compound V. The product can be isolated by VI Formula Ia conventional work up procedure, e.g. extraction of the product with an organic Solvent and purifying by column chromatography. 0554 Step–1 Synthesis of Formula VIII 0549 Step 4 Synthesis of Formula VI 0555 Compound of Formula VIII can be prepared from 0550 Compound of Formula VI can be prepared by compound IV by reacting with the tributyl ester of boronic reacting compound V with fluorides (for silyl protecting acid as described by Gilman et al. in J. Am. Chem. Soc., groups—tetrabutyl ammonium fluoride, or ammonium fluo 1957, 79, 3077. The product can be isolated by conventional ride), base (for aryl Sulfone protecting groups—aqueous work up procedure, e.g. extraction of the product with an potassium hydroxide), or an acid (for carbamates-trifluoro organic solvent and purifying by column chromatography. US 2006/01 00218 A1 May 11, 2006 50

0556) Step 2 Synthesis of Formula V procedures, e.g. extraction of the product with organic 0557 Compound of Formula V can be prepared by Solvent and purifying by column chromatography. reacting compound VIII with compounds of Formula A-Br 0565) Step 2 Synthesis of Formula la or A-I under Suzuki reaction conditions and isolating the product following standard workup procedures, e.g. extrac 0566 Compound of Formula Ia can be prepared from tion of the product with organic solvent and purifying by compound IX by reacting with boronic acids under Suzuki column chromatography. reaction conditions (aqueous base and Pd(0) catalyst or anhydrous conditions with KF in dioxane with Pd(0) cata 0558 Step 3 Synthesis of Formula VI lyst). Alternately, compound IX can also be reacted with a 0559) Compound of Formula VI can be prepared by tin reagent, Zinc reagent or copper reagent, under Stille, reacting compound V with fluorides (for silyl protecting Negishi or cuprate coupling reaction conditions respectively, groups—tetrabutyl ammonium fluoride, or ammonium fluo to provide compound Ia. The product can be isolated by ride), base (for aryl Sulfone protecting groups—aqueous conventional work up procedure, e.g. extraction of the potassium hydroxide), or an acid (for carbamates—trifluo product with an organic solvent and purifying by column roacetic acid) and isolating the product following standard chromatography. workup procedures, e.g. extraction of the product with organic solvent and purifying by column chromatography Example 5 0560 Step 4 Synthesis of Formula Ia Alternate Synthesis of Compounds of Formula Ia 0561 Compound of Formula Ia can be prepared by reacting compound VI with nucleophilic reagents, e.g. acid 0567) chlorides, Sulfonyl chlorides, isocyanates, isothiocyanates, etc., under basic conditions. The product can be isolated by following standard workup procedures, e.g. extraction of the Scheme - 5 product with organic Solvent and purifying by column chromatography. eW. Br w \, Stepep 1 Example 4 N y/ re tNN Alternate synthesis of compounds of Formula Ia V k 0562 DX

Scheme - 4 veW veW

B r y=w X Stepep 1 B r -- Stepep 2 (R)OB N X Step 2 A X y N yW N y/ re- N /y re NN t-N Isk tNN V k \ k X Formula Ia VII IX

y=w X 0568 Step–1 Synthesis of Formula X N y/ 'NN 0569 Compound of Formula X can be prepared from V compound IX by reacting with tributyl ester of boronic acid k as described by Gilman et. al. in J. Am. Chem. Soc., 1957, 79, 3077. The product can be isolated by conventional work Formula Ia up procedure, e.g. extraction of the product with an organic Solvent and purifying by column chromatography. 0570 Step 2 Synthesis of Formula la 0563) Step–1 Synthesis of Formula IX 0571 Compound of Formula Ia can be prepared by 0564 Compound of Formula IX can be prepared by reacting compound X with compounds of Formula A-Br or reacting compound VII with nucleophilic reagents, e.g. acid A-I under Suzuki reaction conditions and isolating the chlorides, Sulfonyl chlorides, isocyanates, isothiocyanates, product following standard workup procedures, e.g. extrac alkyl halides, benzyl halides, etc., under basic conditions. tion of the product with organic solvent and purifying by The product can be isolated by following standard workup column chromatography. US 2006/01 00218 A1 May 11, 2006 51

Example 6 -continued Alternate synthesis of compounds of Formula Ia Br 0572) / \ W sN Step 3 Scheme - 6.

eW. eW Br w \, Step 1 w \, Step 2 ,O so / orep - / orep - Y-4 Y-4 4 NN tNN / H H O VII VI

y=w O X / N y/ 'NN / 7 \ Step 4 V k sN Formula Ia

O 0573 Step–1 Synthesis of Formula VI O-lis 0574 Compound of Formula VI can be prepared from 5 compound VII by reacting with boronic acids under Suzuki / reaction conditions (aqueous base and Pd(0) catalyst or O anhydrous conditions with KF in dioxane with Pd(0) cata lyst). Alternately, compound VII can also be reacted with a O tin reagent, Zinc reagent or copper reagent, under Stille, Negishi or cuprate coupling reaction conditions respectively, to provide compound VI. The product can be isolated by conventional work up procedure, e.g. extraction of the product with an organic Solvent and purifying by column chromatography. N 0575 Step 2 Synthesis of Formula Ia 0576 Compound of Formula Ia can be prepared by reacting compound VI with nucleophilic reagents, e.g. acid 0578 Step 1–Preparation of 3-bromo-1H-pyrrolo2,3- chlorides, Sulfonyl chlorides, isocyanates, isothiocyanates, bipyridine 3 alkyl halides, benzyl halides, etc., under basic conditions. The product can be isolated by following standard workup 0579 7-Azaindole (2, 3.57 g., 30.2 mmol) was dissolved procedures, e.g. extraction of the product with organic in tetrahydrofuran (240 mL) under an atmosphere of nitro Solvent and purifying by column chromatography. gen. At -40°C., N-bromosuccinimide (5.38 g. 30.2 mmol) in tetrahydrofuran was added under an atmosphere of nitro Example 7 gen. The reaction mixture was stirred for a few hours as it was gradually warmed to room temperature and the reaction Synthesis of intermediate was followed by TLC. The reaction was quenched with 3-(3,4-dimethoxy-phenyl)-1H-pyrrolo sodium thiosulfate pentahydrate (7.50 g. 30.2 mmol) in 2,3-bipyridine 1 water (1M). Two layers were separated, and the aqueous layer was extracted with ethyl acetate. The combined 0577) organic layers were washed with water, brine, dried with anhydrous sodium sulfate, and evaporated to dryness. The crude material was purified by column chromatography (25-40% ethyl acetate in hexanes) to yield the desired product as a white solid, 3, (4.20 g, 21.3 mmol). MS(ESI) M+H=198.5. 0580 Step 2 Preparation of 1-benzenesulfonyl-3- N N bromo-1H-pyrrolo2,3-bipyridine 4 0581 3-Bromo-1H-pyrrolo2,3-bipyridine (3, 280 mg. 1.4 mmol) was dissolved in acetone (15 mL) and potassium US 2006/01 00218 A1 May 11, 2006 52 carbonate (220 mg, 1.6 mmol) was added, followed by benzenesulfonyl chloride (0.2 mL, 1.6 mmol). The reaction -continued mixture was heated to reflux overnight, filtered and concen trated under reduced pressure. The resulting solid was purified by flash chromatography (5%-20% ethyl acetate :hexanes) to provide the desired product, 4. (300 mg. 47%). MS(ESI) M+H=455.0. 0582 Step 3 Preparation of 1-benzenesulfonyl-3-(3,4- dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine 5 0583. 1-Benzenesulfonyl-3-bromo-1H-pyrrolo2,3-bpy ridine (4, 1.00 g, 2.96 mmol) was dissolved in tetrahydro furan (16 mL) and 3,4-dimethoxyphenylboronic acid (1.35 g, 7.41 mmol), tetrakis(triphenylphosphine)palladium(0) (200 mg, 0.1 mmol), and 1 M potassium carbonate (8 mL) were added. The reaction mixture was heated in a CEM Discover microwave at 120° C. for 10 minutes. The reaction mixture was concentrated under reduced pressure and par titioned between ethyl acetate and water. The organic por tions were dried with anhydrous magnesium Sulfate, filtered, 0587 Step—1 Preparation of 3-Bromo-pyrrolo2,3-bipy and the filtrate was adsorbed onto silica. The mixture was ridine-1-carboxylic acid tert-butyl ester 6 purified by flash chromatography (30% ethyl acetate:hex anes) to provide the desired product, 5., (909 mg, 78%). 0588 Into a round bottom flask was added 3-bromo-7- MS(ESI) M+H=394.9. azaindole (3, 2.6 g. 13.0 mmol) and N,N-dimethylforma 0584) Step 4 Preparation of 3-(3,4-dimethoxy-phenyl)- mide (50 mL) and sodium hydride (60% dispersion in 1H-pyrrolo2,3-bipyridine 1 mineral oil) (550 mg, 14.0 mmol) under an atmosphere of 0585 1-Benzenesulfonyl-3-(3,4-dimethoxy-phenyl)-1H nitrogen. The reaction mixture was stirred at room tempera pyrrolo2,3-bipyridine (5, 290 mg, 0.74 mmol) was dis ture for 30 minutes, followed by addition of di-tert-butyl Solved in ethanol (4 mL) and potassium hydroxide pellets dicarbonate (4.0 g, 18.0 mmol). The reaction mixture was (330 mg, 5.9 mmol) were added. The reaction was heated in stirred at room temperature overnight and was poured into a CEM Discover microwave instrument at 120° C. for 10 water and extracted into ethyl acetate. The organic layer was minutes. The reaction mixture was concentrated to dryness and the residue was partitioned between ethyl acetate and washed with brine and dried over anhydrous sodium sulfate. saturated Sodium bicarbonate. The organic portions were The crude material was purified by column chromatography dried with anhydrous magnesium Sulfate, filtered and the (30% ethyl acetate in hexane) to yield the desired product, filtrate concentrated to provide the desired product, 1, which 6, as a solid (3.0 g, 10.1 mmol). was used without further purification (191 mg). MS(ESI) 0589 Step 2 Preparation of 3-(3,4-dimethoxy-phenyl)- M+H=255.1. 1H-pyrrolo2,3-bipyridine 1 Example 8 0590) Into a round bottom flask was added 3-Bromo Alternative Synthesis of the key intermediate 3-(3. pyrrolo2,3-bipyridine-1-carboxylic acid tert-butyl ester (6. 4-dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine 1 2.8 g., 9.4 mmol) and tetrahydrofuran (100 mL). Tetraki 0586 s(triphenylphosphine)palladium(0) (500 mg, 0.50 mmol), 3,4-dimethoxyphenylboronic acid (2.1 g, 11 mmol) and 1 M KCO solution (50 mL) The reaction mixture was stirred at 65° C. overnight. The reaction mixture was poured into water and extracted into ethyl acetate. The organic layer was washed with brine and dried over anhydrous magnesium sulfate. The crude material was purified by column chroma tography (gradient system of hexanes and ethyl acetate) to yield the titled compound, 1. (500 mg, 2 mmol. 20%) and 3-(3,4-dimethoxy-phenyl)-pyrrolo2,4-bipyridine-1-car boxylic acid tert-butyl ester (2.1 g, 5.9 mmol. 63%). The later compound can be easily converted to the desired compound, 1 by treatment with acid reagents such as TFA or HC1. US 2006/01 00218 A1 May 11, 2006

Example 9 Example 10 Synthesis of 8-3-(3,4-dimethoxy-phenyl)-pyrrolo2, Synthesis of 3-(3,4-dimethoxy-phenyl)-1-phenyl 3-bipyridine-1-sulfonyl-quinoline 7 methanesulfonyl-1H-pyrrolo2,3-bipyridine 8 0591) 0594)

N

0595 3-(3,4-Dimethoxy-phenyl)-1-phenylmethanesulfo nyl-1H-pyrrolo2,3-bipyridine 8 was prepared using the same protocol as described in Example 9. Substituting 8-quinoline-sulfonyl chloride with phenyl-methanesulfonyl chloride. MS(ESI) M+H=409.0. Example 11 Synthesis of 1-(3-chloro-phenylmethanesulfonyl)-3- (3,4-dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine 9 0596) / 0592 Preparation of 8-3-(3,4-dimethoxy-phenyl)-pyr rolo2,3-bipyridine-1-sulfonyl-quinoline 7 0593 3-(3,4-Dimethoxy-phenyl)-1H-pyrrolo-2,3-bipy ridine, 1. (50 mg 0.20 mmol) was dissolved in methylene y 7 chloride (4 mL). Aqueous potassium hydroxide (50% wit/vol. 300 uL) and tetrabutylammonium hydrogen sulfate (2 mg 0.007 mmol) were added. The reaction mixture was stirred for 10 minutes at room temperature. Into the reaction was added 8-quinoline-sulfonyl chloride (48 mg, 0.21 SO mmol) and the reaction mixture was stirred for 2 hours at room temperature. The reaction mixture was concentrated and the residue was washed with brine and ethyl acetate. The organic portion was dried with anhydrous sodium Sulfate and filtered. The filtrate was concentrated and purified by preparative TLC (75% ethyl acetate:hexanes). The product was eluted from the silica with ethyl acetate and filtration. The filtrate was concentrated to provide 7 (14 mg, 16%). 0597 1-(3-Chloro-phenylmethanesulfonyl)-3-(3,4- MS(ESI) M+H=445.9. dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine 9 was pre US 2006/01 00218 A1 May 11, 2006 54 pared using the same protocol as described in Example 9. same protocol as described in Example 9. Substituting substituting 8-quinoline-sulfonyl chloride with (3-chlo 8-quinoline sulfonyl chloride with 2-naphthalene-sulfonyl rophenyl)-methanesulfonyl chloride. MS(ESI) M+H"= chloride. The crude material was purified by preparative 443.3. TLC (50% ethyl acetate:hexanes). The compound was eluted from silica with ethyl acetate and concentrated to Example 12 provide an oil. The oil was washed with a minimum of methanol and a white precipitate was collected by filtration Synthesis of 1-(Biphenyl-4-sulfonyl)-3-(3,4- to provide 11. MS(ESI) M+H""=445.0. dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine 10 Example 14 0598 10 Synthesis of 3-(3,4-Dimethoxy-phenyl)-1-(4-me / thyl-naphthalene-1-sulfonyl)-1H-pyrrolo2,3-bipyri O dine 12 0602) 12

) (/ ) N N

SRO O 0599) 1-(Biphenyl-4-sulfonyl)-3-(3,4-dimethoxy-phe nyl)-1H-pyrrolo2,3-bipyridine 10 was prepared using the same protocol as described in Example 9. Substituting 1. 8-quinoline sulfonyl chloride with biphenyl-4-sulfonyl chlo ride. The crude material was purified by preparative TLC 0603 3-(3,4-Dimethoxy-phenyl)-1-(4-methyl-naphtha (50% ethyl acetate:hexanes). The compound was eluted lene-1-sulfonyl)-1H-pyrrolo2,3-bipyridine 12 was pre from silica with ethyl acetate and concentrated to provide an pared using the same protocol as described in Example 9. oil. The oil was washed with a minimum of methanol and a substituting 8-quinoline sulfonyl chloride with 4-methyl white precipitate was collected by filtration to provide 10. naphthalene-1-sulfonyl chloride. The crude oil was washed MS(ESI) M+H=471.0. with ethyl acetate, which provided a solid that was washed with acetonitrile: water and methanol:methylene chloride to Example 13 provide 12. MS(ESI) M+H=458.9. Example 15 Synthesis of 3-(3,4-Dimethoxy-phenyl)-1-(naphtha lene-2-sulfonyl)-1H-pyrrolo2,3-bipyridine 11 Synthesis of 8-3-(3,4-Dimethoxy-phenyl)-pyrrolo 2,3-bipyridine-1-sulfonyl-3-methyl-quinoline 13 0600 11 / 0604) 13 O / O

0601 3-(3,4-Dimethoxy-phenyl)-1-(naphthalene-2-sul fonyl)-1H-pyrrolo2,3-bipyridine 11 was prepared using the US 2006/01 00218 A1 May 11, 2006

0605 8-3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyri 0609 3-(3,4-Dimethoxy-phenyl)-1-(4-phenoxy-benze dine-1-sulfonyl-3-methyl-quinoline 13 was prepared using nesulfonyl)-1H-pyrrolo2,3-bipyridine 15 was prepared the same protocol as described in Example 9, Substituting using the same protocol as described in Example 9, Substi 8-quinoline sulfonyl chloride with 3-methyl-quinoline-8- tuting 8-quinoline Sulfonyl chloride with 4-phenoxy-benze sulfonyl chloride. The crude oil was washed with ethyl acetate, which provided a solid that was washed with nesulfonyl chloride. The crude mixture was crystallized acetonitrile, methanol and methylene chloride to provide 13. from acetonitrile to provide 15. MS(ESI) M+H=487.1. MS(ESI) M+H=460.0. Example 18 Example 16 Synthesis of 3-(3,4-Dimethoxy-phenyl)-1-(naphtha Synthesis of 5-3-(3,4-Dimethoxy-phenyl)-pyrrolo 2,3-bipyridine-1-sulfonyl)-isoquinoline 14 lene-1-sulfonyl)-1H-pyrrolo2,3-bipyridine 16 14 0606) / 0610) O 16

0607 5-3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyri dine-1-sulfonyl-isoquinoline 14 was prepared using the same protocol as described in Example 9. Substituting 8-quinoline sulfonyl chloride with isoquinoline-5-sulfonyl chloride. The crude mixture was purified by preparative TLC in two subsequent runs of 75% ethyl acetate:hexanes 0611 3-(3,4-Dimethoxy-phenyl)-1-(naphthalene-1-sul and 50% ethyl acetate:hexanes to provide 14. MS(ESI) fonyl)-1H-pyrrolo2,3-bipyridine 16 was prepared using the M+H=446.0. same protocol as described in Example 9. Substituting 8-quinoline sulfonyl chloride with 1-naphthalenesulfonyl Example 17 chloride. MS(ESI) M+H=445.5. Synthesis of 3-(3,4-Dimethoxy-phenyl)-1-(4-phe noxy-benzenesulfonyl)-1H-pyrrolo2,3-bipyridine Example 19 15 15 Synthesis of 1-(4-chloro-phenylmethanesulfonyl)-3- 0608) / (3,4-dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine O 17 0612) ) (7 ) N N o

O Crs US 2006/01 00218 A1 May 11, 2006 56

0616) 3-(3,4-Dimethoxy-phenyl)-1-(3-nitro-phenyl -continued methanesulfonyl)-1H-pyrrolo2,3-bipyridine 18 was pre / pared using the same protocol as described in Example 19, Substituting (4-chloro-phenyl)-methanesulfonyl chloride with (3-nitropheny)-methanesulfonyl chloride. The crude / material was purified by preperative TLC (50% ethyl 7 \ acetate:hexanes). MS(ESI) M+H""=454.0.

N Example 21 N in\So Synthesis of 1-benzenesulfonyl-3-(3,4-dimethoxy phenyl)-1H-indole 19

0617)

C 17 0613 Preparation of 1-(4-chloro-phenylmethanesulfo nyl)-3-(3,4-dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine 17 Scheme-ll 0614 3-(3,4-Dimethoxy-phenyl)-1H-pyrrolo-2,3-bipy- / ridine 1 (40 mg 0.16 mmol) was dissolved in tetrahydrofu- O ran (3.5 mL). Sodium hydride (60% dispersion in mineral oil, 10 mg 0.24 mmol) was added. The reaction was stirred for 15 minutes. Into the reaction mixture was added O (4-chloro-phenyl)-methanesulfonyl chloride (40 mg, 0.18 Br / mmol). The mixture was stirred overnight, concentrated, and partitioned between brine and ethyl acetate. The organic W portions was dried with anhydrous sodium sulfate, filtered, W and concentrated. The product was purified by reverse phase HPLC with 40-100% acetonitrile: 0.1% aqueous formic acid. The appropriate fractions were lyophilized to provide ot 17 as the formate salt (7.5 mg, 11%). MS(ESI) M+H"= 2 So 443.0. O Example 20 2O 19 Synthesis of 3-(3,4-dimethoxy-phenyl)-1-(3-nitro phenylmethanesulfonyl)-1H-pyrrolo2,3-bipyridine 18 0615 18 / 0618 1-Benzenesulfonyl-3-bromoindole 20 (350 mg, 1.0 mmol) was dissolved in tetrahydrofuran (6 mL). Into the solution was added 3,4-dimethoxyphenylboronic acid (379 y” mg, 2.1 mmol), tetrakis(triphenylphosphine)palladium(0) Z (60 mg 0.05 mmol) and 1 M potassium carbonate (3 mL). / \ The reaction mixture was heated in a CEM Discover micro sN wave instrument at 120° C. for 10 minutes. The reaction mixture was concentrated under reduced pressure and par vo tioned between ethyl acetate and saturated sodium bica O bonate. The organic portion was dried over anhydrous magnesium sulfate, and filtered. The filtrate was adsorbed onto silica gel and purified by flash chromatography (5%- ON 50% ethyl acetate:hexanes) to provide the desired product, 19, (359 mg, 88%). US 2006/01 00218 A1 May 11, 2006 57

Example 22 Sodium bicarbonate. The organic portion was dried with anhydrous magnesium sulfate, filtered and the filtrate con Synthesis of 8-3-(3,4-dimethoxy-phenyl)-indole-1- centrated to provide the desired product 22, which was used Sulfonyl-quinoline 21 without further purification (208 mg. 92 0622 Step 2 Preparation of 8-3-(3,4-dimethoxy-phe 0619 nyl)-indole-1-sulfonyl-quinoline 21 0623 3-(3,4-Dimethoxy-phenyl)-indole 22 (70 mg, 0.28 mmol) was dissolved in methylene chloride (5.0 mL). Tetra / N-butylammonium bromide (3 mg, 0.01 mmol) and aqueous O potassium hydroxide (50% wit/vol. 500 uL) were added. The reaction mixture was stirred for 5 minutes. 8-quinoline sulfonyl chloride (89.5 mg, 0.39 mmol) was added and the O reaction mixture was stirred for 2 hours. The product was extracted with 2 N lithium hydroxide and methylene chlo ride. The organic portion was dried over anhydrous magne / He sium sulfate and filtered. The filtrate was concentrated and O Step 1 purified by flash chromatography (ethyl acetate:hexanes 0%-50%). The appropriate fractions were combined and concentrated to provide 21, (76.1 mg, 90%). MS(ESI) M+H=445.0. Example 23 19 / Synthesis of 8-3-(3,4-dimethoxy-phenyl)-pyrrolo2, O 3-bipyridine-1-sulfonyl-3-methyl-quinoline 24 0624

/-( ) Step 2 Scheme-13 / O O N H 22 O / / "Ns2, W / \ S-1N, -1 - sN 21 So 23 N o N So Nu N 0625 Preparation of 8-3-(3,4-dimethoxy-phenyl)-pyr Nul rolo2,3-bipyridine-1-sulfonyl-3-methyl-quinoline 24 21 0626) 3-(3,4-Dimethoxy-phenyl)-1H-pyrrolo-2,3-bipy ridine, 1, (40 mg 0.1 mmol) was dissolved in methylene 0620 Step 1—Preparation of 3-(3,4-dimethoxy-phenyl)- chloride (4 mL). Aqueous potassium hydroxide (50% indole 22 wit/vol. 300 uL) and tetrabutylammonium hydrogen sulfate (20 mg, 0.007 mmol) were added. The reaction mixture was 0621 1-Benzenesulfonyl-3-(3,4-dimethoxy-phenyl)-in stirred for 10 minutes at room temperature. Into the reaction dole (350 mg. 0.89 mmol) 19 was dissolved in ethanol (3 was added 6-methyl-quinoline-8-sulfonyl chloride (68 mg, mL) and potassium hydroxide pellets (385 mg. 6.9 mmol) 0.28 mmol), prepared as described (Lubenets, V.I.; Stad were added. The reaction mixture was heated in a CEM nitskaya, N. E.; Novikov, V. P.; Russ. J. Org. Chem. 36: Discover microwave instrument at 120° C. for 10 minutes. 2000: 851-853) and the reaction mixture was stirred for 2 The reaction mixture was concentrated to dryness and the hours at room temperature. The reaction mixture was con residue was partitioned between ethyl acetate and Saturated centrated and the residue was washed with brine and ethyl US 2006/01 00218 A1 May 11, 2006 acetate. The organic portion was dried with anhydrous sodium sulfate and filtered. The filtrate was concentrated and -continued the resulting solid was washed with acetonitrile to provide / 24 (43 mg, 60%). MS(ESI) M+H=460.1. O Example 24 Synthesis of 8-3-(3,4-dimethoxy-phenyl)-indole-1- sulfonyl-3-methyl-quinoline 25 0627) 25 / O

C 26

0630 Preparation of 3-(3,4-dimethoxy-phenyl)-pyrrolo 2,3-bipyridine-1-carboxylic acid (4-chloro-phenyl)-amide 26 0631 3-(3,4-Dimethoxy-phenyl)-1H-pyrrolo-2,3-bipy ridine 1 (40 mg, 0.16 mmol) was dissolved in benzene and 4-chlorophenyl isocyanate (36 mg, 0.24 mol) dissolved in tetrahydrofuran (4 mL) was added. 4-Dimethylaminopyri dine (20 mg, polymer bound) was added. The reaction was 0628 8-3-(3,4-Dimethoxy-phenyl)-indole-1-sulfonyl heated in a CEM Discover microwave at 200° C. for 10 minutes. The mixture was filtered and concentrated. The 3-methyl-quinoline 25 was prepared using the same protocol resulting Solid was washed with a minimum of methanol, as described in Example 22, Substituting 8-quinoline-Sulfo filtered, and then washed with dichloromethane to provide nyl chloride with 6-methyl-quinoline-8-sulfonyl chloride. 26, (26 mg, 40%). MS(ESI) M+H""=408.4. After the crude material was concentrated, acetonitrile was added to the oil and let stand. The resulting precipitate was Example 26 filtered and further washed with acetonitrile and dried in Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3- vacuo to provide the desired product 25. MS(ESI) bipyridine-1-carboxylic acid (3-chloro-4-methoxy M+H=459.1. phenyl)-amide 27 0632) 27 Example 25 / O Synthesis of 3-(3,4-dimethoxy-phenyl)-pyrrolo2,3- bipyridine-1-carboxylic acid (4-chloro-phenyl)- amide 26 0629) 7 / O

C N -O US 2006/01 00218 A1 May 11, 2006 59

0633 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine 0637 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine 1-carboxylic acid (3-chloro-4-methoxy-phenyl)-amide 27 1-carboxylic acid (3,5-dimethoxy-phenyl)-amide 29 was was prepared using the same protocol as described in prepared using the same protocol as described in Example Example 25, Substituting 4-chlorophenyl isocyanate with 25, substituting 4-chlorophenyl isocyanate with 3.5- 3-chloro-4-methoxyphenyl isocyanate. MS(ESI) M+H= dimethoxyphenyl isocyanate and microwave heating for 20 438.4. minutes at 200° C. MS(ESI) M+H""=434.2. Example 27 Example 29 Synthesis of 3-3-(3,4-Dimethoxy-phenyl)-pyrrolo Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3- 2,3-bipyridine-1-carbonyl-amino-benzoic acid bipyridine-1-carboxylic acid phenylamide 28 ethyl ester 30 30 0634) 28 (0638) / / O O

0635 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine 1-carboxylic acid phenylamide 28 was prepared using the same protocol as described in Example 25, Substituting 0639 3-3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyri 4-chlorophenyl isocyanate with phenylisocyanate. After an dine-1-carbonyl-amino-benzoic acid ethyl ester 30 was initial heating at 120° C. for 15 minutes, additional phenyl prepared using the same protocol as described in Example isocyanate was added (500 LL) and the reaction was heated 25, Substituting 4-chlorophenyl isocyanate with 3-isocy again in the microwave for 30 minutes at 180° C. The anato-benzoic acid ethyl ester and microwave heating for 20 concentrated Solid was washed with a minimum of aceto minutes at 200° C. After washing with a minimum of nitrile and purified by reverse phase HPLC (0.1% formic methanol and methylene chloride, the reaction mixture was diluted with methanol:methylene chloride (95:5) and let acid: acetonitrile) to provide the desired product 28. stand. The resulting precipitate was isolated by filtration and MS(ESI) M+H=374.3. dried in vacuo to provide 30. MS(ESI) M+H""=446.5. Example 28 Example 30 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3- Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3- bipyridine-1-carboxylic acid (3,5-dimethoxy-phe bipyridine-1-carboxylic acid (4-fluoro-3-nitro-phe nyl)-amide 29 nyl)-amide 31 31 0636) 29 (0640) / / O O

7 7 ) ( ) N N

HN O

HN O

NO No1 No1 F US 2006/01 00218 A1 May 11, 2006 60

0641 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine Example 32 1-carboxylic acid (4-fluoro-3-nitro-phenyl)-amide 31 was Synthesis of 4-3-(3,4-Dimethoxy-phenyl)-pyrrolo prepared using the same protocol as described in Example 2,3-bipyridine-1-carbonyl-amino-benzoic acid 25, substituting 4-chlorophenyl isocyanate with 1-fluoro-4- ethyl ester 33 isocyanato-2-nitro-benzene and reacting at room tempera 0644) / 33 ture for two hours. The resulting precipitate was washed O with methanol and dichloromethane and dried in vacuo to provide 31. MS(ESI) IM+H=437.5.

Example 31

Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3- bipyridine-1-carboxylic acid (3-methoxy-phenyl)- amide 32

0642)

32 0.645 4-3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyri dine-1-carbonyl-amino-benzoic acid ethyl ester 33 was prepared using the same protocol as described in Example 25, Substituting 4-chlorophenyl isocyanate with 4-isocy anato-benzoic acid ethyl ester. Example 33 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3- bipyridine-1-carboxylic acid (3-acetyl-phenyl)- amide 34 0646) 34

0643 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine 1-carboxylic acid (3-methoxy-phenyl)-amide 32 was pre pared using the same protocol as described in Example 25, Substituting 4-chlorophenyl isocyanate with 3-methoxy phenyl isocyanate. After filtration and concentration, the reaction mixture was redissolved in acetonitrile and a mini mum of water and let stand. The resulting precipitate was collected by filtration and dried in vacuo to provide 32. MS(ESI) M+H=404.4. US 2006/01 00218 A1 May 11, 2006

0647 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine 0651 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine 1-carboxylic acid (3-acetyl-phenyl)-amide 34 was prepared 1-carboxylic acidbenzo1.3dioxol-5-ylamide 36 was pre using the same protocol as described in Example 25, Sub pared using the same protocol as described in Example 25, stituting 4-chlorophenyl isocyanate with 3-acetyl-phenyl Substituting 4-chlorophenyl isocyanate with 5-isocyanato isocyanate. MS(ESI) M+H""=416.3. benzo1.3dioxole. After the initial microwave heating, the reaction was heated again in the microwave for 10 minutes Example 34 at 210° C. The crude material was recrystallized from methanol:methylene chloride to provide 36. MS(ESI) Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3- M+H=418.5. bipyridine-1-carboxylic acid (3-fluoro-phenyl)-amide Example 36 35 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3- (0648) / 35 bipyridine-1-carboxylic acid (3,4-dichloro-phenyl)- O amide 37 37

(0652) O/

7

C

C 0649) 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine 1-carboxylic acid (3-fluoro-phenyl)-amide 35 was prepared 0653 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine using the same protocol as described in Example 25, Sub 1-carboxylic acid (3,4-dichloro-phenyl)-amide 37 was pre stituting 4-chlorophenyl isocyanate with 3-fluoro-isocy pared using the same protocol as described in Example 25, anato-benzene. MS(ESI) M+H=392.0. Substituting 4-chlorophenyl isocyanate with 1,2-dichloro-4- isocyanato-benze. MS(ESI) M+H""=443.5. Example 35 Example 37 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3- Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3- bipyridine-1-carboxylic acidbenzo1.3dioxol-5- bipyridine-1-carboxylic acid (3-nitro-phenyl)-amide ylamide 36 38 (0650) / 36 0654) 38 O / O

7 ) (7 ) N N ins N HN O

C, NO US 2006/01 00218 A1 May 11, 2006 62

0655 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine 0659 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine 1-carboxylic acid (3-nitro-phenyl)-amide 38 was prepared 1-carboxylic acid (4-acetyl-phenyl)-amide 40 was prepared using the same protocol as described in Example 25, Sub using the same protocol as described in Example 25, Sub stituting 4-chlorophenyl isocyanate with 1-isocyanato-3- stituting 4-chlorophenyl isocyanate with 4-acetylphenyl iso nitro-benzene. After the initial microwave heating, the reac tion was heated again in a CEM Discover microwave for 6 cyanate. After the initial microwave heating, the reaction minutes at 200° C. with an additional equivalent of 1-iso was heated again in the microwave for 20 minutes at 220 cyanato-3-nitro-benzene. MS(ESI) M+H""=419.2. C. MS(ESI) M+H=416.2. Example 38 Example 40 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3- bipyridine-1-carboxylic acid (4-methoxy-phenyl)- Synthesis of 3-(3,4-dimethoxy-phenyl)-pyrrolo2,3- amide 39 39 bipyridine-1-carbothioic acid phenylamide 41

(0656) O/ 0660)

7

N

HN lsO

0657 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine 1-carboxylic acid (4-methoxy-phenyl)-amide 39 was pre pared using the same protocol as described in Example 25, Substituting 4-chlorophenyl isocyanate with 4-methoxyphe nyl isocyanate. After the initial microwave heating, the reaction was heated again in the microwave for 5 minutes at 190° C. MS(ESI) M+H=404.2. Example 39 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3- bipyridine-1-carboxylic acid (4-acetyl-phenyl)- amide 40 40

(0658) O/ 41

0661 Preparation of 3-(3,4-dimethoxy-phenyl)-pyrrolo 2,3-bipyridine-1-carbothioic acid phenylamide 41 7 0662 3-(3,4-Dimethoxy-phenyl)-1H-pyrrolo-2,3-bipy ridine 1 (50 mg, 0.20 mmol) was dissolved in N,N-dimeth N ylformamide (4 mL). Sodium hydride (10 mg, 0.24 mmol. 60% dispersion in mineral oil) was added. The reaction mixture was stirred for 15 minutes at room temperature. HN O 1-Isothiocyanatobenzene (35 uL, 0.29 mmol) was added and the reaction mixture was stirred for 40 minutes at room temperature. The product was concentrated and the residue was partitioned between brine and ethyl acetate. The organic portion was dried over anhydrous sodium sulfate, filtered, and concentrated to provide a solid. The solid was washed with a minimum of methanol and dried in vacuo to provide C 41, (38 mg, 49%). MS(ESI) M+H=390.2. US 2006/01 00218 A1 May 11, 2006

Example 41 -continued 3-(3,4-dimethoxy-phenyl)-pyrrolo2,3-bipyridine-1- carbothioic acid (3-methoxy-phenyl)-amide 42 0663) Nsk 42 N 'ss, 2N le

43

0.666 Step—1 Preparation of 8-(3-bromo-pyrrolo2,3-b pyridine-1-sulfonyl)-quinoline 44 0667 Into a round bottom flask was added 3-bromo-7- azaindole (3, 1.18 g, 5.99 mmol) and tetra-N-butylammo nium bromide (193 mg 0.600 mmol), and 5.0 M sodium hydroxide (15.4 mL). 8-Quinoline-sulfonyl chloride (1.64g, 7.19 mmol) in dichloromethane (5.9 mL) was added drop wise at room temperature. After a few hours, all starting 0664) 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridine materials were gone. After 30 mL of dichlormethane was added, two layers were separated. The aqueous layer was 1-carbothioic acid (3-methoxy-phenyl)-amide 42 was pre washed with dichloromethane. The combined organic layers pared using the same protocol as described in Example 40, were washed with 1 M sodium bicarbonate, water, and brine Substituting 1-isothiocyanatobenzene with 1-chloro-4- and dried over anhydrous sodium sulfate. The crude material isothiocyanatobenzene. was concentrated under reduced pressure and was purified by column chromatography (55-80% ethyl acetate in hex Example 42 ane) to yield the desired product as a light yellow colored solid (44, 1.72 g, 4.43 mmol). MS(ESI) M+H=389.4. Synthesis of 8-3-(2-methoxy-pyrimidin-5-yl)-pyr 0668 Step 2 Preparation of 8-3-(2-methoxy-pyrimi rolo2,3-bipyridine-1-sulfonyl-quinoline 43 din-5-yl)-pyrrolo2,3-bipyridine-1-sulfonyl-quinoline 43 0669. In a microwave reaction tube, 8-(3-bromo-pyrrolo 0665) 2,3-bipyridine-1-sulfonyl)-quinoline (44, 68 mg, 0.18 mmol), 2-methoxy-pyrimidine-4-boronic acid (67.4 mg. Scheme-16 0.438 mmol), and tetrakis(triphenylphosphine)palladium(0) Br Br (10 mg, 0.0088 mmol) were mixed in 1.0 M of potassium carbonate (0.52 mL) and tetrahydrofuran (0.84 mL). The N N resulting mixture was heated at 120° C. in a CEM Discover CS2 Step 1 2 N Step 2 microwave unit for 10 minutes. Ethyl acetate and water were added and two layers were separated. The aqueous layer was N N N \ 220 3 2S extracted with ethyl acetate and the combined organic layers were washed with brine and dried over sodium sulfate. The product was concentrated under reduced pressure and the resultant crude material was purified by column chromatog raphy (80-90% ethyl acetate in hexane) to yield the desired product as a white solid (43, 0.005 g, 0.01 mmol). MS(ESI) M+H=417.8. US 2006/01 00218 A1 May 11, 2006 64

Example 43 -continued Synthesis of 3-(2-Methoxy-pyrimidin-5-yl)-1-phe nylmethanesulfonyl-1H-pyrrolo2,3-bipyridine 45 0670)

Step 2 45 ->

r 2 N 0671 3-(2-Methoxy-pyrimidin-5-yl)-1-phenylmethane- N sulfonyl-1H-pyrrolo2,3-bipyridine 45 was prepared using s the same protocol as described in Example 42, Substituting \ 2-N O 8-quinoline-sulfonyl chloride with phenyl methanesulfonyl N Yé chloride. MS(ESI) M+H=381.2. % Example 44 Synthesis of 8-3-(2-Methylsulfanyl-pyrimidin-4- yl)-pyrrolo2,3-bipyridine-1-sulfonyl-quinoline 46 0672)

0673 Step–1 Preparation of 8-3-(4,4,5,5-tetramethyl Scheme-17 1.3.2dioxaborolan-2-yl)-pyrrolo2,3-bipyridine-1-sulfo Br nyl-quinoline 47

N 0674) Into a round bottom flask, 8-(3-bromo-pyrrolo2, Step 1 3-bipyridine-1-sulfonyl)-quinoline (44, 335 mg. 0.863 4. mmol), diboron pinacol ester (263 mg, 1.04 mmol), and bis(triphenylphosphine)palladium(II) chloride (18 mg, 0.026 mmol) were added. Under an atmosphere of nitrogen, N,N-dimethylformamide (4.0 mL) was added. The mixture was thoroughly degassed by alternately connecting the flask to vacuum and nitrogen source. The resulting mixture was heated to 100° C. overnight. After the reaction mixture was cooled to room temperature, it was poured into water and extracted with ethyl acetate twice. The combined organic layers were washed with water and brine and dried over anhydrous Sodium Sulfate. The product was concentracted under reduced pressure and the crude material was purified US 2006/01 00218 A1 May 11, 2006

by column chromatography (55% ethyl acetate in hexane) to 2.50 mmole) was added in small portions to the reaction yield the desired product as a white solid (47, 70 mg, 0.16 mixture. After stirring for 30 minutes, 2-ethoxy-1-naphthoyl mmol). MS(ESI) M+H=435.8. chloride (646 mg, 2.76 mmole) was added and the reaction 0675) Step 2 Preparation of 8-3-(2-Methylsulfanyl-py was stirred for 4 hours. The reaction mixture was poured into rimidin-4-yl)-pyrrolo2,3-bipyridine-1-sulfonyl-quinoline 200 mL of ice water and was extracted with ethyl acetate. 46 The organic layer was washed with saturated bicarbonate 0676 In a microwave reaction tube, 8-3-(4.4.5.5-tetram Solution followed by Saturated potassium hydrogen Sulfate ethyl-1,3,2dioxaborolan-2-yl)-pyrrolo2,3-bipyridine-1- and then brine. The resulting solution was dried over anhy sulfonyl-quinoline (47, 70 mg, 0.16 mmol), 4-iodo-2-me drous magnesium sulfate, filtered and concentrated under thylsulfanyl-pyrimidine (101 mg, 0.402 mmol), and reduced pressure. The residue was purified by silica gel tetrakis(triphenylphosphine)palladium(0) (9.3 mg, 0.008 chromatography (30% ethyl acetate:hexanes) to yield 800 mmol) were mixed in 1.0 M potassium carbonate in water mg (70%) of the titled compound as a white solid MS(ESI) (0.48 mL) and tetrahydrofuran (0.77 mL). The resulting M+H=453.06. mixture was heated at 120° C. in a CEM Discover micro wave unit for 10 minutes. Ethyl acetate and water were Example 46 added, and the two layers were separated. The aqueous layer was extracted with ethyl acetate. The combined organic Synthesis of 3-(3,4-Dimethoxy-phenyl)-1-(3-nitro layers were washed with brine and dried over sodium benzyl)-1H-pyrrolo2,3-bipyridine 53 sulfate. Concentration under reduced pressure afforded the 0679) crude material, which was purified by column chromatog raphy (50% ethyl acetate in hexane) to yield the desired product in light yellow solid (46, 10 mg, 0.023 mmol). MS(ESI) M+H=434.0. Scheme-19 Example 45 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2. Y, / Y. 3-bpyridin-1-yl)-(2-ethoxy-naphthalen-1-yl)-metha O O none 52 0677) 21 \ 1 N s N s N NO

53

0680 3-(3,4-Dimethoxy-phenyl)-1H-pyrrolo2,3-bipyri dine 1 (35 mg, 0.14 mmole) was dissolved in 15 mL of DMF and sodium hydride (60% dispersion in mineral oil, 10 mg. 0.25 mmol) was added in small portion to the reaction mixture. After stirring for 30 minutes, m-nitro-benzyl chlo ride (30 mg, 0.14 mmole) was added to the reaction mixture and was stirred for 2 hours. The reaction mixture was poured into 50 mL of ice water and was extracted with ethyl acetate. 52 The organic layer was washed with Saturated Sodium bicar bonate followed by saturated potassium bisulfate and then brine. The resulting solution was dried over anhydrous magnesium Sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel chromatog 0678 3-(3,4-Dimethoxy-phenyl)-1H-pyrrolo2,3-bipyri raphy (30% ethyl acetate in hexanes) to yield 42 mg (71%) dine 1 (638 mg, 2.51 mmole) was dissolved in DMF (30 mL) of the titled compound as a white solid. MS(ESI)M+H= and sodium hydride (60% dispersion in mineral oil, 100 mg. 390.1. US 2006/01 00218 A1 May 11, 2006 66

Example 47 Example 48 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2. Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2, 3-bipyridin-1-yl)-(2-ethoxy-4-nitro-phenyl)-metha 3-bpyridin-1-yl)phenylmethanone-amide 55 none 54 0683) 0681) 55

Scheme-20

/ NO O

s N

0684 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin 1-yl)phenylmethanone-amide 55 was prepared using the same protocol as described for Example 45, Substituting 2-ethoxy-1-naphthalene carbonyl chloride with benzoyl chloride. MS(ESI) M+H=359.2. Example 49 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2, 3-bpyridin-1-yl)-(3-pyridylyl)-methanone-amide 56 0685)

56 O 54 \

N 0682 3-(3,4-Dimethoxy-phenyl)-1H-pyrrolo2,3-bipyri dine 1 (250 mg. 0.98 mmole) was dissolved in 50 mL of 21 )N CHCl. N,N-diethylisopropylamine (205 ul, 1.2 mmol), 2-ethoxy-4-nitro-benzoic acid (228 mg, 1.1 mmol) and S/ bromotris(pyrolodino)phoshonium hexafluorophosphate (550 mg, 1.1 mmol) were added to the stirring reaction \ 2 mixture. The mixture was stirred at ambient temperature for N 4 h and washed consecutively with Saturated Sodium bicar bonate and saturated potassium bisulfate solution. The resulting solution was dried over anhydrous magnesium 0686 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin Sulfate, filtered and concentrated under reduced pressure. 1-yl)-(3-pyridylyl)-methanone-amide 56 was prepared using The residue was purified by silica gel chromatography (30% the same protocol as described for Example 45, substituting ethyl acetate in hexanes) to yield 340 mg (77%) of the titled 2-ethoxy-1-naphthalene carbonyl chloride with pyridine-3- compound as a yellow solid. MS(ESI) M+H=448.2. carbonyl chloride. MS(ESI) M+H""=360.0. US 2006/01 00218 A1 May 11, 2006 67

Example 50 Example 52 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2. Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2, 3-bipyridin-1-yl)-(4-trifluoromethypyridin-3-yl)- 3-bpyridin-1-yl)-(2-chloropyridin-3-yl)-methanone methanone-amide 57 amide 59 0687) 0691)

59 57 O

O N rN\, 4N s O \ Z N C

0692 3-(3,4-Dimethoxy-phenyl)-pyrrolo32,3-bipyri 0688 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin din-1-yl)-(2-chloropyridin-3-yl)-methanone—amide 59 was 1-yl)-(4-trifluoromethypyridin-3-yl)-methanone-amide 57 prepared using the same protocol as described for Example was prepared using the same protocol as described for 45, substituting 2-ethoxy-1-naphthalene carbonyl chloride Example 45 substituting 2-ethoxy-1-naphthalene carbonyl with 2-chloropyridine-3-carbonyl chloride. MS(ESI) chloride with 4-trifluoromethylpyridine-3-carbonyl chlo M+H"-393.9. ride. MS(ESI) M+H=428.0. Example 53 Example 51 Synthesis of 1-3-(3,4-Dimethoxy-phenyl)-pyrrolo Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2. 2,3-bipyridin-1-yl)-2-(4-methoxy-phenyl)-etha 3-bpyridin-1-yl-(1-naphthyl)-methanone-amide 58 none-amide 60 0693) 0689)

60

58 N rN\, 4.

y 0690 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin 1-yl-(1-naphthyl)-methanone amide 58 was prepared using the same protocol as described for Example 45, substituting 0694 1-3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyri 2-ethoxy-1-naphthalene carbonyl chloride with naphthyl din-1-yl)-2-(4-methoxy-phenyl)-ethanone-amide 60 was ene-1-carbonyl chloride. MS(ESI) M+H"=409.1. prepared using the same protocol as described for Example US 2006/01 00218 A1 May 11, 2006

45, substituting 2-ethoxy-1-naphthalene carbonyl chloride was prepared using the same protocol as described for with (4-methoxy-phenyl)-acetyl chloride. MS(ESI) Example 47, substituting 2-ethoxy-4-nitrobenzoic acid with M+H=403.0. 5-acetoxy-naphthalene-2-carboxylic acid. MS(ESI) M+H=467.5. Example 54 Example 56 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2. 3-bpyridin-1-yl)-(2-ethoxy-phenyl)-methanone Synthesis of Benzobthiophen-3-yl-3-(3,4- amide 61 dimethoxy-phenyl)-pyrrolo2,3-bipyridin-1-yl)- methanone 63 0695) 0699)

e 61 O 63 ? rN\, 4. N

O

0700 Benzobthiophen-3-yl-3-(3,4-dimethoxy-phe 0696 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin nyl)-pyrrolo2,3-bipyridin-1-yl)-methanone 63 was pre 1-yl)-(2-ethoxy-phenyl)-methanone-amide 61 was prepared pared using the same protocol as described for Example 45. using the same protocol as described for Example 45 Sub substituting 2-ethoxy-1-naphthalene carbonyl chloride with stituting 2-ethoxy-1-naphthalene carbonyl chloride with benzobthiophene-3-carbonyl chloride. 2-ethoxybenzoyl chloride. MS(ESI) M+H"=403.5. Example 57 Example 55 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2, Synthesis of Acetic acid 6-3-(3,4-dimethoxy-phe 3-bpyridin-1-yl)-(4-fluoro-naphthalen-1-yl)-metha nyl)-pyrrolo2,3-bipyridine-1-carbonyl-naphthalen none 64 1-yl ester-amide 62 0701 0697)

64 62

0698 Acetic acid 6-3-(3,4-dimethoxy-phenyl)-pyrrolo 0702 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin 2,3-bipyridine-1-carbonyl-naphthalen-1-yl ester-amide 62 1-yl)-(4-fluoro-naphthalen-1-yl)-methanone 64 was pre US 2006/01 00218 A1 May 11, 2006 69 pared using the same protocol as described for Example 47. 0706 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin substituting 2-ethoxy-4-nitrobenzoic acid with 4-fluro 1-yl)-isoquinolin-8-yl-methanone 66 was prepared using the naphthalene-1-carboxylic acid. MS(ESI) M+H""=427.5. same protocol as described for Example 47, Substituting 2-ethoxy-4-nitrobenzoic acid with quinolin-8-carboxylic Example 58 acid. MS(ESI) M+H=410.5. Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2. Example 60 3-bipyridin-1-yl)-(5-methoxynaphthalen-1-yl)- methanone 65 Synthesis of 1-3-(3,4-Dimethoxy-phenyl)-pyrrolo 2,3-bipyridin-1-yl-ethanone 67 0703) 0707)

65 67 O ? rN\, 4. )- O

0708 1-3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyri din-1-yl-ethanone 67 was prepared using the same protocol as described for Example 45, substituting 2-ethoxy-1-naph 0704 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin thalene carbonyl chloride with acetyl chloride. MS(ESI) 1-yl)-(5-methoxynaphthalen-1-yl)-methanone 65 was pre M+H=279.2. pared using the same protocol as described for Example 47. substituting 2-ethoxy-4-nitrobenzoic acid with 5-methoxy Example 61 naphthalene-2-carboxylic acid. Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2, Example 59 3-bpyridin-1-yl)-(2-methoxyphenyl)-methanone 68 Synthesis of 3-(3,4-Dimethoxy-phenyl)-pyrrolo2. 0709) 3-bpyridin-1-yl)-isoquinolin-8-yl-methanone 66 0705) 68

66

0710 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin 1-yl)-(2-methoxyphenyl)-methanone 68 was prepared using the same protocol as described for Example 45, substituting

US 2006/01 00218 A1 May 11, 2006 tuting 8-quinoline-sulfonyl chloride with 3-oxazol-5-yl-ben 0722 1-(2-Benzenesulfonylmethyl-benzyl)-3-(3,4- Zenesulfonyl chloride. MS(ESI) M+H=462.0. dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine 74 was pre pared using the same protocol as described in Example 46, Example 66 substituting m-nitro-benzyl chloride with 1-benzenesulfo nylmethyl-2-chloromethyl-benzene. MS(ESI) M+H""= Synthesis of 3-(3,4-Dimethoxy-phenyl)-1-4-(5- 499.1. methyl-1,3,4oxadiazol-2-yl)-benzenesulfonyl)-1H pyrrolo2,3-bipyridine 73 Example 68 0719) Synthesis of 1-Benzyl-3-(3,4-dimethoxy-phenyl)- 1H-pyrrolo2,3-bipyridine 75

--- 73 O 0723)

ON 75 rN\, 2 N N \% % sy \ -N

0720 3-(3,4-Dimethoxy-phenyl)-1-4-(5-methyl-1,3,4) oxadiazol-2-yl)-benzenesulfonyl)-1H-pyrrolo2,3-bipyri dine 73 was prepared using the same protocol as described in Example 9, substituting 8-quinoline-sulfonyl chloride with 3-oxazol-5-yl-benzenesulfonyl chloride. MS(ESI) 0724 1-Benzyl-3-(3,4-dimethoxy-phenyl)-1H-pyrrolo2, M+H=477.0. 3-bipyridine 75 was prepared using the same protocol as described in Example 46, substituting m-nitro-benzyl chlo Example 67 ride with benzyl chloride. MS(ESI) M+H""=345.1. Synthesis of 1-(2-Benzenesulfonylmethyl-benzyl)-3- Example 69 (3,4-dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine 74 Synthesis of 3-(3,4-Dimethoxy-phenyl)-1-(2-me thyl-naphthalen-1-ylmethyl)-1H-pyrrolo2,3-bipyri 0721) dine 76

74 0725)

76 O \ N ) N N rN\, 4. N \lO US 2006/01 00218 A1 May 11, 2006 72

0726) 3-(3,4-Dimethoxy-phenyl)-1-(2-methyl-naphtha protocol as described in Example 46, Substituting m-nitro len-1-ylmethyl)-1H-pyrrolo2,3-bipyridine 76 was prepared benzyl chloride with 2-phenylbenzyl chloride. using the same protocol as described in Example 46, Sub stituting m-nitro-benzyl chloride with 1-chloromethyl-2- Example 72 methyl-naphthalene. Synthesis of 3-(3,4-Dimethoxy-phenyl)-1-(3-trifluo Example 70 romethyl-benzyl)-1H-pyrrolo2,3-bipyridine 79 Synthesis of 4-3-(3,4-Dimethoxy-phenyl)-pyrrolo 0731) 2,3-bipyridin-1-ylmethyl-benzonitrile 77 0727 79

77

SN 0732 3-(3,4-Dimethoxy-phenyl)-1-(3-trifluoromethyl 0728 4-3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyri benzyl)-1H-pyrrolo2,3-bipyridine 79 was prepared using din-1-ylmethyl-benzonitrile 77 was prepared using the the same protocol as described in Example 46, Substituting same protocol as described in Example 46, Substituting m-nitro-benzyl chloride with m-trifluoromethylbenzyl chlo m-nitro-benzyl chloride with 4-chloromethylbenzonitrile. ride. MS(ESI) M+H=413.0. MS(ESI) IM+H"-370.2. Example 73 Example 71 Synthesis of compounds of Formula Ib Synthesis of 1-Biphenyl-2-ylmethyl-3-(3,4- dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine 78 0733) 0729) Scheme-21

78 C A O eW.\, eW.\, l N / Step 1 l N / Step 2 \ | y | y t- N t- N H H XI XII N A eW N) N l | N y/ t- N C. V k O Formula Ib 0734) Step–1 Synthesis of Formula XII 0730 1-Biphenyl-2-ylmethyl-3-(3,4-dimethoxy-phenyl)- 0735 Compound XI can be prepared from 7-azaindole 1H-pyrrolo2,3-bipyridine 78 was prepared using the same following published procedure (Schneller, S.W.; Luo, Jiann US 2006/01 00218 A1 May 11, 2006

Kuan. J. Org. Chem. 1980, 45, 4045-4.048), and compound 0739 Step—1 Preparation of 4-(3,4-Dimethoxy-phenyl)- of Formula XII can prepared from compound XI by reacting 1H-pyrrolo2,3-bipyridine 50 with boronic acids under Suzuki reaction conditions (aque 0740. In a microwave reaction tube, 4-chloro-7-azaindole ous base and Pd(0) catalyst or anhydrous conditions with KF (49, 1.362 g, 8.926 mmol), prepared from 7-azaindole in dioxane with Pd(0) catalyst). Alternately, compound XI following published procedure (Schneller, S.W.; Luo, Jiann can also be reacted with a tin reagent, Zinc reagent or copper Kuan. J. Org. Chem. 1980, 45, 4045-4.048), 3,4-dimethox reagent, under Stille, Negishi or cuprate coupling reaction yphenylboronic acid (4.06 g. 22.3 mmol), and tetrakis(triph conditions respectively, to provide compound XII. The enylphosphine)palladium(0) (52 mg 0.45 mmol) were product can isolated by conventional work up procedure, mixed in 1.0 M potassium carbonate in water (27 mL) and e.g. extraction of the product with an organic solvent and tetrahydrofuran (43 mL). The resulting mixture was heated purifying by column chromatography. at 150° C. in a CEM Discover microwave unit for 20 minutes. Ethyl acetate and water were added, and the two 0736) Step 2 Synthesis of Formula Ib layers were separated. The aqueous layer was extracted with ethyl acetate. The combined organic layers were washed 0737 Compound of Formula Ib can be prepared by with brine and dried over anhydrous sodium sulfate. Con reacting compound XII with nucleophilic reagents, e.g. acid centration under reduced pressure afforded the crude mate chlorides, Sulfonyl chlorides, isocyanates, isothiocyanates, rial, which was purified by column chromatography (40 alkyl halides, benzyl halides, etc., under basic conditions. 70% ethyl acetate in hexane) to yield the desired product in The product can be isolated by following standard workup light yellow solid (50, 974 mg., 3.83 mmol). MS(ESI) procedures, e.g. extraction of the product with organic M+H=255.2. Solvent and purifying by column chromatography. 0741 Step 2 Preparation of 4-(3,4-Dimethoxy-phe nyl)-pyrrolo2,3-bipyridin-1-yl)-(2-ethoxy-naphthalen-1- Example 74 yl)-methanone 48 Synthesis of 4-(3,4-Dimethoxy-phenyl)-pyrrolo2. 0742 Sodium hydride (60% dispersion in mineral oil, 3-bpyridin-1-yl)-(2-ethoxy-naphthalen-1-yl)-metha 39.9 mg, 0.997 mmol) was washed with hexane and put none 48 under an atmosphere of nitrogen, and 1 mL of tetrahydro furan was added. 4-(3,4-dimethoxy-phenyl)-1H-pyrrolo2, 0738) 3-bipyridine (50, 195 mg, 0.767 mmol) in tetrahydrofuran (6.2 mL) was added, and the resulting mixture was stirred for 10 minutes at room temperature. 2-ethoxy naphthoyl chloride (202 mg, 0.844 mmol) in tetrahydrofuran was added. After two hours, the reaction was quenched with water, and the two layers were separated. The aqueous layer was extracted with ethyl acetate. The combined organic layers were washed with brine and dried over anhydrous Sodium Sulfate. Concentration under reduced pressure afforded the crude material, which was purified by column C chromatography (35-60% ethyl acetate in hexane) to yield the desired product in light yellow solid (48, 262 mg 0.579 ry mmol). MS(ESI) M+H=453.2. 2 Example 75 NY N Synthesis of 4-(3,4-Dimethoxy-phenyl)-pyrrolo2, 49 3-bipyridin-1-yl)-(2-ethoxy-phenyl)-methanone 51 0743)

51

0744 4-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin 1-yl)-(2-ethoxy-phenyl)-methanone 51 was prepared using the same protocol as described in Example 74. Substituting US 2006/01 00218 A1 May 11, 2006 74

2-ethoxy naphthoyol chloride with 2-ethoxy-benzoyl chlo Example 77 ride. MS(ESI) M+H=403.3. Synthesis of 5-(3,4-Dimethoxy-phenyl)-pyrrolo2, Example 76 3-bpyridin-1-yl)-(2-ethoxy-naphthalen-1-yl)-metha none 80 Synthesis of Compounds of Formula Ic 0750) 0745) Scheme-24 Br

Scheme-23 Cy Step 1 NY2 N Br A 81 -Q eer No X X

I N y/ Step 1 T N yW Step 2 -O t- N t- N H H XIII XIV N N Step 2 N.2 N 82

No 10 Formula Ic rN\, 4N O 0746 Step–1 Synthesis of Formula XIV 9N-1 0747 Compound XIII can be prepared from 7-azaindole following published procedure (Marie-Claude, Viaud, Het erocycles, 1999, 50, 1065-1080), and compound of Formula 80 XIV can be prepared from compound XIII by reacting with boronic acids under Suzuki reaction conditions (aqueous base and Pd(0) catalyst or anhydrous conditions with KF in dioxane with Pd(0) catalyst). Alternately, compound XIII can also be reacted with a tin reagent, Zinc reagent or copper 0751 Step—1 Preparation of 5-(3,4-Dimethoxy-phenyl)- reagent, under Stille, Negishi or cuprate coupling reaction 1H-pyrrolo2,3-bipyridine 82 conditions respectively, to provide compound XIV. The 0752. In a microwave safe tube, 5-bromo-7-azaindole product can be isolated by conventional work up procedure, (81. 392 mg, 1.99 mmol), prepared from 7-azaindole fol e.g. extraction of the product with an organic solvent and lowing the published procedure (Marie-Claude, Viaud, Het purifying by column chromatography. erocycles, 1999, 50, 1065-1080), 3,4-dimethoxyphenyl 0748 Step 2 Synthesis of Formula Ic boronic acid (905 mg, 4.97 mmol), and tetrakis(triph enylphosphine)palladium(0) (11 mg, 0.099 mol) were mixed 0749 Compound of Formula Ic can be prepared by in 1.0 M of potassium carbonate (6.0 mL) and tetrahydro reacting compound XIV with nucleophilic reagents, e.g. furan (9.5 mL, 0.12 mol). The resulting mixture was heated acid chlorides, Sulfonyl chlorides, isocyanates, isothiocyan at 120° C. in a CEM Discover microwave unit for 10 ates, alkyl halides, benzyl halides, etc., under basic condi minutes. Ethyl acetate and water were added, and the two tions. The product can be isolated by following standard layers were separated. The aqueous layer was extracted with workup procedures, e.g. extraction of the product with ethyl acetate. The combined organic layers were washed organic solvent and purifying by column chromatography. with brine and dried over anhydrous sodium sulfate. Con US 2006/01 00218 A1 May 11, 2006

centration under reduced pressure afforded the crude mate the same protocol as described in Example 77, substituting rial, which was purified by column chromatography (40 2-ethoxy naphthoyol chloride with 2-ethoxy-benzoyl chlo 70% ethyl acetate:hexanes) to yield the desired product as a light yellow solid (82, 207 mg, 41%). MS(ESI) M+H= ride. MS(ESI) M+H=403.2. 255.2. 0753 Step 2 Preparation of 5-(3,4-Dimethoxy-phe Example 79 nyl)-pyrrolo2,3-bipyridin-1-yl)-(2-ethoxy-naphthalen-1- Synthesis of (2-Ethoxy-naphthalen-1-yl)-3-(4- yl)-methanone 80 methanesulfonyl-phenyl)-pyrrolo2,3-bipyridin-1- 0754 Sodium hydride (60% dispersion in mineral oil, yl)-methanone 84 10.1 mg, 0.252 mmol) was washed with hexane and put 0757 under an atmosphere of nitrogen, and 1 mL of tetrahydro furan was added. 5-(3,4-Dimethoxy-phenyl)-1H-pyrrolo2, 3-bipyridine (82, 49.3 mg, 0.194 mmol) in tetrahydrofuran (1.6 mL) was added, and the resulting mixture was stirred for 30 minutes at room temperature. 2-Ethoxy naphthoyol O 84 chloride (51.1 mg, 0.213 mmol) in THF was added. After Y two hours, the reaction was quenched with water, and the N two layers were seperated. The aqueous layer was extracted with ethyl acetate. The combined organic layers were washed with brine and dried over anhydrous sodium sulfate. Concentration under reduced pressure afforde the crude, which was purified by column chromatography (40-55% ethyl acetate in hexane) to yield the desired product as a rN\, liquid (80, 61 mg, 70%). MS(ESI) M+H""=453.2. 1- O Example 78 C. Synthesis of 5-(3,4-Dimethoxy-phenyl)-pyrrolo2. 3-bipyridin-1-yl)-(2-ethoxy-phenyl)-methanone 83 0755) )

Scheme-25 83 Br

N N H 3

Br W 7 \ HoStep 2 s N N O O O O 0756 5-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin 85 1-yl)-(2-ethoxy-phenyl)-methanone 83 was prepared using US 2006/01 00218 A1 May 11, 2006 76

Example 80 -continued Synthesis of (2-Ethoxy-naphthalen-1-yl)-3-(3- O methanesulfonyl-phenyl)-pyrrolo2,3-bipyridin-1- yl)-methanone 86 YsN N 0762)

86 rN\,4N O

0758 Step 1 Preparation of (3-Bromo-pyrrolo2,3-b pyridin-1-yl)-(2-ethoxy-naphthalen-1-yl)-methanone 85 0763 (2-Ethoxy-naphthalen-1-yl)-3-(3-methanesulfo 0759) 3-Bromo-7-azaindole (500 mg, 2.0 mmol) 3 was nyl-phenyl)-pyrrolo2,3-bipyridin-1-yl)-methanone 86 was dissolved in N,N-dimethylformamide (50 mL) and sodium prepared using the same protocol as described in Example hydride (210 mg, 5.3 mmol. 60% dispersion in mineral oil) 79, substituting 4-Methanesulfonyl-phenylboronic acid with and 2-Ethoxy-naphthalene-1-carbonyl chloride (710 mg, 3.0 3-Methanesulfonyl-phenylboronic acid. mmol) were added. The reaction mixture was stirred at Example 81 ambient temperature for 30 min, cast into ice water (100 Synthesis of 3-1-(2-Ethoxy-naphthalene-1-carbo mL) and extracted into ethyl acetate. The organic portion nyl)-1H-pyrrolo2,3-bipyridin-3-yl)-benzoic acid benzyl ester 87 was dried with anhydrous magnesium Sulfate, filtered and 0764) the filtrate concentrated. Purification via column chroma tography (10% Ethyl acetate in hexanes) provided the desired product 85 (800 mg, 80%). 87 0760 Step 2 Preparation of (2-Ethoxy-naphthalen-1- yl)-3-(4-methanesulfonyl-phenyl)-pyrrolo2,3-bipyridin-1- yl)-methanone 84 0761 (3-Bromo-pyrrolo2,3-bipyridin-1-yl)-(2-ethoxy naphthalen-1-yl)-methanone 85 (35 mg, 0.0088 mmol), 4-Methanesulfonyl-phenylboronic acid (35 mg, 0.18 mmol) and tetrakis(triphenylphosphine)palladium(0) (5 mg) were stirred in tetrahydrofuran (16 mL) and potassium carbonate solution (8.0 mL, 1 M aqueous). The reaction mixture was stirred over night at 60° C. The reaction mixture was concentrated under reduced pressure and partitioned between ethyl acetate and brine. The organic portion was 0765 3-1-(2-Ethoxy-naphthalene-1-carbonyl)-1H-pyr dried over anhydrous magnesium sulfate and filtered. The rolo2,3-bipyridin-3-yl)-benzoic acid benzyl ester 87 was filtrate was concentrated and purified by flash chromatog prepared using the same protocol as described in Example raphy (ethyl acetate:hexanes 20%-100%). The desired prod 79, substituting 4-Methanesulfonyl-phenylboronic acid with uct, 84 was obtained as a pale yellow powder (10 mg, 20%). 3-carbobenzyloxy-phenylboronic acid. US 2006/01 00218 A1 May 11, 2006 77

Example 82 Example 84 Synthesis of 3-(3-Cyclopentyloxy-4-methoxy-phe Synthesis of 3-Benzo1.3dioxol-5-yl-1H-pyrrolo2, nyl)-1H-pyrrolo2,3-bipyridine 88 3-bpyridine 90 0766) 0770

88 90

N N

0771) 3-Benzo1.3dioxol-5-yl-1H-pyrrolo2,3-bpyri 0767 3-(3-Cyclopentyloxy-4-methoxy-phenyl)-1H-pyr dine 90 was prepared using the same protocol as described rolo2,3-bipyridine 88 was prepared using the same protocol in Example 7. Substituting 3,4-dimethoxyphenylboronic as described in Example 7. Substituting 3,4-dimethoxyphe acid with 3.4-methylenedioxybenzene boronic acid. nylboronic acid with 3-cyclopentyloxy,4-methoxy-phenyl Example 85 boronic acid. MS(ESI) M+H=309.20. Synthesis of 1-(Benzobthiophene-3-sulfonyl)-3-(3. Example 83 4-dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine 91 Synthesis of 3-(3-Benzyloxy-4-methoxy-phenyl)- 0772) 1H-pyrrolo2,3-bipyridine 89 O768)

91 / O 89 O /

()sN N s N i? Y, S

0769 3-(3-Benzyloxy-4-methoxy-phenyl)-1H-pyrrolo2. 0773) 1-(Benzobthiophene-3-sulfonyl)-3-(3,4- 3-bipyridine 89 was prepared using the same protocol as dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine 91 was pre described in Example 7, substituting 3,4-dimethoxyphenyl pared using the same protocol as described in Example 9. boronic acid with 3-benzyloxy,4-methoxy-phenylboronic substituting 8-quinoline-sulfonyl chloride with Benzob acid. thiophene-3-sulfonyl chloride. MS(ESI) M+H""=450.97. US 2006/01 00218 A1 May 11, 2006

Example 86 Example 88 Synthesis of 8-3-(3,4-Dimethoxy-phenyl)-5-meth Synthesis of 8-3-(3,4-Dimethoxy-phenyl)-5-meth oxy-indole-1-sulfonyl-quinoline 92 oxy-indole-1-sulfonyl-3-methyl-quinoline 94 0778) 0774)

94 92

s N SN \ SEO \ Z y /Y \,

0779) 8-3-(3,4-Dimethoxy-phenyl)-5-methoxy-indole 1-sulfonyl-3-methyl-quinoline 94 was prepared using the 0775 8-3-(3,4-Dimethoxy-phenyl)-5-methoxy-indole same protocol as described in Examples 21 and 22, Substi 1-sulfonyl-quinoline 92 was prepared using the same pro tuting 8-quinoline-Sulfonyl chloride with 3-methyl-quino tocol as described in Examples 21 and 22, substituting line-8-sulfonyl chloride. MS(ESI) M+H""=489.10. 1-benzenesulfonyl-3-bromoindole with 1-Benzenesulfonyl Example 89 3-bromo-5-methoxyindole. MS(ESI) M+H""=475.10. Synthesis of 8-5-Chloro-3-(3-cyclopentyloxy-4- methoxy-phenyl)-indole-1-sulfonyl-3-methyl Example 87 quinoline 95 Synthesis of 8-3-(3,4-Dimethoxy-phenyl)-5-chloro 0780) indole-1-sulfonyl-quinoline 93 95 0776) / 93

\ Z so 0781 8-5-Chloro-3-(3-cyclopentyloxy-4-methoxy-phe nyl)-indole-1-sulfonyl-3-methyl-quinoline 95 was prepared using the same protocolas described in Examples 21 and 22. substituting 8-quinoline-sulfonyl chloride, 1-Benzenesulfo 0777 8-3-(3,4-Dimethoxy-phenyl)-5-chloro-indole-1- nyl-3-bromoindole and 3,4-dimethoxyphenyl boronic acid Sulfonyl-quinoline 93 was prepared using the same protocol with 3-methyl-quinoline-8-sulfonyl chloride, 1-Benzene as described in Examples 21 and 22, substituting 1-Benze sulfonyl-3-bromo-5-chloro-indole and 3-cyclopentyloxy-4- nesulfonyl-3-bromoindole with 1-Benzenesulfonyl-3- methoxy-phenylboronic acid respectively. MS(ESI) bromo-5-chloroindole. MS(ESI) M+H"=479.10. M+H=547.10. US 2006/01 00218 A1 May 11, 2006 79

Example 90 0785 8-5-Methoxy-3-(3-cyclopentyloxy-4-methoxy phenyl)-indole-1-sulfonyl-3-methyl-quinoline 97 was pre Synthesis of 8-5-Chloro-3-(3,4-Dimethoxy-phe nyl)-indole-1-sulfonyl-3-methyl-quinoline 96 pared using the same protocol as described in Examples 21 and 22, Substituting 8-quinoline-Sulfonyl chloride, 1-Benze 0782) nesulfonyl-3-bromoindole and 3,4-dimethoxyphenyl boronic acid with 3-methyl-quinoline-8-sulfonyl chloride, 1-benzenesulfonyl-3-bromo-5-methoxy-indole and 3-cyclo 96 pentyloxy-4-methoxy-phenylboronic acid respectively. MS(ESI) M+H=543.20.

Example 92 3-(3-Cyclopentyloxy-4-methoxy-phenyl)-pyrrolo2, 3-bpyridine-1-carboxylic acid (3-nitro-4-fluoro phenyl)-amide 98 sN \ SRO 0786) /Y \,

0783 8-5-Chloro-3-(3,4-Dimethoxy-phenyl)-indole-1- 98 Sulfonyl-3-methyl-quinoline 96 was prepared using the same protocol as described in Examples 21 and 22, Substi tuting 8-quinoline-sulfonyl chloride and 1-Benzenesulfonyl 3-bromoindole with 3-methyl-quinoline-8-sulfonyl chloride and 1-benzenesulfonyl-3-bromo-5-methoxy-indole respec tively. MS(ESI) M+H=493.00. Example 91 Synthesis of 8-5-Methoxy-3-(3-cyclopentyloxy-4- methoxy-phenyl)-indole-1-sulfonyl-3-methyl quinoline 97 0784) NO

97

0787 3-(3-Cyclopentyloxy-4-methoxy-phenyl)-pyrrolo 2,3-bipyridine-1-carboxylic acid (3-nitro-4-fluoro-phenyl)- sN amide 98 was prepared using the same protocol as described \ SRO in Example 25, substituting 3-(3,4-dimethoxy-phenyl)-1H Z \, pyrrolo2,3-bipyridine 1 and 4-chlorophenyl isocyanate with 3-(3-Cyclopentyloxy-4-methoxy-phenyl)-1H-pyrrolo 2,3-bipyridine 88 and 4-fluoro-3-nitrophenyl isocyanate respectively. MS(ESI) M+H=491.10. US 2006/01 00218 A1 May 11, 2006

Example 93 Example 95 1-Benzenesulfonyl-3-(3-cyclopentyloxy-4-methoxy 1-Benzenesulfonyl-3-(3-cyclopentyloxy-4-methoxy phenyl)-1H-indole 99 phenyl)-1H-pyrrolo2,3-bipyridine 101 0788) 0792)

99 / 101 / O

O C / \- N

OFSFO OESEO

0789 1-Benzenesulfonyl-3-(3-cyclopentyloxy-4-meth 0793 1-Benzenesulfonyl-3-(3-cyclopentyloxy-4-meth oxy-phenyl)-1H-indole 99 was prepared using the same oxy-phenyl)-1H-pyrrolo2,3-bipyridine 101 was prepared protocol as described in Example 21, Substituting 3,4- using the same protocol as described in Example 7. Substi dimethoxyphenyl boronic acid with 3-cyclopentyloxy-4- tuting 3,4-dimethoxyphenyl boronic acid with 3-cyclopen methoxy-phenylboronic acid. MS(ESI) M+H=448.31. tyloxy-4-methoxy-phenylboronic acid. MS(ESI) M+H= 449.13 Example 94 Example 96 8-3-(3-Cyclopentyloxy-4-methoxy-phenyl)-indole 1-sulfonyl-quinoline 100 8-3-(3-Cyclopentyloxy-4-methoxy-phenyl)-pyrrolo 0790) 2,3-bipyridine-1-sulfonyl-quinoline 102 0794)

100 o 102 O - E O E O

0791) 8-3-(3-Cyclopentyloxy-4-methoxy-phenyl)-in dole-1-sulfonyl-quinoline 100 was prepared using the same 0795 8-3-(3-Cyclopentyloxy-4-methoxy-phenyl)-pyr protocol as described in Examples 21 and 22, Substituting rolo2,3-bipyridine-1-sulfonyl-quinoline 102 was prepared 3,4-dimethoxyphenyl boronic acid and benxene sulfonyl using the same protocol as described in Example 42, Sub chloride with 3-cyclopentyloxy-4-methoxy-phenyl boronic stituting 2-methoxy-pyrimidine-4-boronic acid with 3-cy acid and 8-quinoline sulfonyl chloride respectively. clopentyloxy-4-methoxy-phenyl boronic acid. MS(ESI) MS(ESI) M+H=499.09. M+H=500.20. US 2006/01 00218 A1 May 11, 2006

Example 97 Example 99 1-Benzenesulfonyl-3-(3-benzyloxy-4-methoxy-phe 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin-1- nyl)-1H-pyrrolo2,3-bipyridine 103 yl)-5-(3-iodo-phenyl)-isoxazol-3-yl)-methanone 0796) 105 0800 103 / 105

O-O sN

OESEO

0797 1-Benzenesulfonyl-3-(3-benzyloxy-4-methoxy 0801 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin phenyl)-1H-pyrrolo2,3-bipyridine 103 was prepared using 1-yl)-5-(3-iodo-phenyl)-isoxazol-3-yl)-methanone 105 was the same protocol as described in Example 42, Substituting prepared using the same protocol as described in Example 2-methoxy-pyrimidine-4-boronic acid and quinoline-8-sul 45, substituting 2-ethoxy-1-naphthoyl chloride with 3-(3- fonyl chloride with 3-cyclopentyloxy-4-methoxy-phenyl Iodo-phenyl)-isoxazole-5-carbonyl chloride. boronic acid and benzene sulfonyl chloride respectively. Example 100 Example 98 4-3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyri 3-(3,4-Dimethoxy-phenyl)-1-(3-phenyl-isoxazol-5- dine-1-carbonyl-benzonitrile 106 ylmethyl)-1H-pyrrolo2,3-bipyridine 104 0802) 0798)

106 104

CN

0799 3-(3,4-Dimethoxy-phenyl)-1-(3-phenyl-isoxazol 0803 4-3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyri 5-ylmethyl)-1H-pyrrolo2,3-bipyridine 104 was prepared dine-1-carbonyl-benzonitrile 106 was prepared using the using the same protocol as described in Example 46, Sub same protocol as described in Example 45. Substituting stituting m-nitro-benzyl chloride with 5-Chloromethyl-3- 2-ethoxy-1-naphthoyl chloride with 4-cyano-benzoyl chlo phenyl-isoxazole. MS(ESI) M+H=412.23. ride. MS(ESI) M+H=384.20. US 2006/01 00218 A1 May 11, 2006

Example 101 Example 103 (6-Chloro-pyridin-3-yl)-3-(3,4-dimethoxy-phenyl)- 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin-1- pyrrolo2,3-bipyridin-1-yl)-methanone 107 yl)-(4-dimethylamino-naphthalen-1-yl)-methanone 0804) 109 0808) / 107 109 Y, 7

O N % C C. 0805 (6-Chloro-pyridin-3-yl)-3-(3,4-dimethoxy-phe nyl)-pyrrolo2,3-bipyridin-1-yl)-methanone 107 was pre Orr pared using the same protocol as described in Example 45. substituting 2-ethoxy-1-naphthoyl chloride with 2-chloro nicotinoyl chloride. MS(ESI) M+H""=394.10. 0809 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin 1-yl)-(4-dimethylamino-naphthalen-1-yl)-methanone 109 Example 102 was prepared using the same protocol as described in 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin-1- Example 45, substituting 2-ethoxy-1-naphthoyl chloride yl)-((1R,2R)-2-phenyl-trans-cyclopropyl)-metha with 4-Dimethylamino-naphthalene-1-carbonyl chloride. none 108 MS(ESI) M+H=452.20. 0806) Example 104 Acetic acid 2-3-(3,4-dimethoxy-phenyl)-pyrrolo2. 108 3-bipyridine-1-carbonyl-phenyl ester 110 0810)

110

0807 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin 1-yl)-((1R,2R)-2-phenyl-trans-cyclopropyl)-methanone 108 was prepared using the same protocol as described in Example 45, substituting 2-ethoxy-1-naphthoyl chloride with trans-2-phenylcyclopropane-carbonyl chloride. 0811 Acetic acid 2-3-(3,4-dimethoxy-phenyl)-pyrrolo MS(ESI) IM+H"-399.17. 2,3-bipyridine-1-carbonyl-phenyl ester 110 was prepared US 2006/01 00218 A1 May 11, 2006 using the same protocol as described in Example 45, Sub in Example 47, Substituting 2-ethoxy-4-nitro-benzoic acid stituting 2-ethoxy-1-naphthoyl chloride with Acetic acid with 2-(2.2.2-Trifluoro-ethoxy)-naphthalene-1-carboxylic 2-chlorocarbonyl-phenyl ester. MS(ESI) M+H"=417.20. acid. MS(ESI) M+H=507.10. Example 105 Example 107 (2,4-Diethoxy-phenyl)-3-(3,4-dimethoxy-phenyl)- 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin-1- pyrrolo2,3-bipyridin-1-yl)-methanone 111 yl)-(2-propoxy-phenyl)-methanone 113 08.12) 0816)

111 113 / \ O 7 sN ( ) N N N

O 1No O Ou 1n 0813 (2,4-Diethoxy-phenyl)-3-(3,4-dimethoxy-phe nyl)-pyrrolo2,3-bipyridin-1-yl)-methanone 111 was pre 0817 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin pared using the same protocol as described in Example 45. 1-yl)-(2-propoxy-phenyl)-methanone 113 was prepared substituting 2-ethoxy-1-naphthoyl chloride with 2,4- using the same protocol as described in Example 47, Sub dimethoxy-benzoyl chloride. MS(ESI) M+H=447.20. stituting 2-ethoxy-4-nitro-benzoic acid with 2-propoxy naphthalene-1-carboxylic acid. MS(ESI) M+H=417.20. Example 106 Example 108 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin-1- yl)-2-(2.2.2-trifluoro-ethoxy)-naphthalen-1-yl)- 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin-1- methanone 112 yl)-(4-methyl-naphthalen-1-yl)-methanone 114 0814) 0818

112 114

u2O 0815. 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin 1-yl)-2-(2.2.2-trifluoro-ethoxy)-naphthalen-1-yl)-metha 0819 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin none 112 was prepared using the same protocol as described 1-yl)-(4-methyl-naphthalen-1-yl)-methanone 114 was pre US 2006/01 00218 A1 May 11, 2006 pared using the same protocol as described in Example 47. Example 111 Substituting 2-ethoxy-4-nitro-benzoic acid with 4-methyl 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin-1- naphthalene-1-carboxylic acid. MS(ESI) M+H""=423.20. yl)-(3-phenyl-quinolin-4-yl)-methanone 117 Example 109 0824) 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin-1- yl)-quinolin-4-yl-methanone 115 117 0820) 115 / Y, /

O Z \

0821 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin 0825 (3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin 1-yl)-quinolin-4-yl-methanone 115 was prepared using the 1-yl)-(3-phenyl-quinolin-4-yl)-methanone 117 was prepared same protocol as described in Example 47, Substituting using the same protocol as described in Example 47, Sub 2-ethoxy-4-nitro-benzoic acid with quinoline-4-carboxylic stituting 2-ethoxy-4-nitro-benzoic acid with 3-phenyl acid. MS(ESI) M+H=410.20. quinoline-4-carboxylic acid. MS(ESI) M+H=486.20. Example 110 Example 112 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin-1- 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin-1- yl)-(2-phenoxy-phenyl)-methanone 118 yl)-(2-methyl-quinolin-4-yl)-methanone 116 0826) 0822) 116 / 118 Y, 7

0823 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin 1-yl)-(2-methyl-quinolin-4-yl)-methanone 116 was prepared using the same protocol as described in Example 47, Sub stituting 2-ethoxy-4-nitro-benzoic acid with 2-methyl 0827 3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-bipyridin quinoline-4-carboxylic acid. MS(ESI) IM+H=424.20. 1-yl)-(2-phenoxy-phenyl)-methanone 118 was prepared US 2006/01 00218 A1 May 11, 2006 using the same protocol as described in Example 47, Sub prepared using the same protocol as described in Example stituting 2-ethoxy-4-nitro-benzoic acid with 2-phenoxy 79, substituting 4-Methanesulfonyl-phenylboronic acid with benxoic acid. MS(ESI) M+H=451.16. 3-methoxycarbonyl phenyl boronic acid. MS(ESI) Example 113 M+H=451.14. 3-(3-Cyclopentyloxy-4-methoxy-phenyl)-pyrrolo2. Example 115 3-bpyridin-1-yl)-(2-ethoxy-naphthalen-1-yl)-metha 3-1-(2-Ethoxy-naphthalene-1-carbonyl)-1H-pyrrolo none 119 2,3-bipyridin-3-yl)-benzamide 121 0828) 0832

119 121 HN

W 7 \ sN N

s N N u u 0833 3-1-(2-Ethoxy-naphthalene-1-carbonyl)-1H-pyr rolo2,3-bipyridin-3-yl)-benzamide 121 was prepared using 0829 3-(3-Cyclopentyloxy-4-methoxy-phenyl)-pyrrolo the same protocol as described in Example 79, substituting 2,3-bipyridin-1-yl)-(2-ethoxy-naphthalen-1-yl)-methanone 4-Methanesulfonyl-phenylboronic acid with 3-amido phe 119 was prepared using the same protocol as described in nyl boronic acid. MS(ESI) M+H""=436.14. Example 79, substituting 4-Methanesulfonyl-phenylboronic Example 116 acid with 3-cyclopentoxy-4-methoxy phenyl boronic acid. MS(ESI) IM+H"-507.30. N-3-1-(2-Ethoxy-naphthalene-1-carbonyl)-1H pyrrolo2,3-bipyridin-3-yl-phenyl-methane Example 114 sulfonamide 122 3-1-(2-Ethoxy-naphthalene-1-carbonyl)-1H-pyrrolo 0834) 2,3-bipyridin-3-yl)-benzoic acid methyl ester 120

0830) 122

120

l 0835 N-3-1-(2-Ethoxy-naphthalene-1-carbonyl)-1H C pyrrolo2,3-bipyridin-3-yl-phenyl-methanesulfonamide 122 was prepared using the same protocol as described in Example 79, substituting 4-Methanesulfonyl-phenylboronic 0831 3-1-(2-Ethoxy-naphthalene-1-carbonyl)-1H-pyr acid with 3-N-methanesulfonamide phenyl boronic acid. rolo2,3-bipyridin-3-yl)-benzoic acid methyl ester 120 was MS(ESI) M+H=486.10. US 2006/01 00218 A1 May 11, 2006 86

Example 117 0839) 3-(3-Cyclopentyloxy-4-methoxy-phenyl)-pyrrolo 2,3-bipyridin-1-yl)-2-(2.2.2-trifluoro-ethoxy)-naphthalen (2-Ethoxy-naphthalen-1-yl)-3-(4-hydroxy-3-meth oxy-phenyl)-pyrrolo2,3-bipyridin-1-yl)-methanone 1-yl)-methanone 124 was prepared using the same protocol 123 as described in Example 47, Substituting 2-ethoxy-4-nitro 0836) benzoic acid and 3-(3,4-Dimethoxy-phenyl)-1H-pyrrolo2, 3-bipyridine with 2-(2.2.2-Trifluoro-ethoxy)-naphthalene 1-carboxylic acid and 3-(3-cyclopentoxy-4-methoxy HO 123 phenyl)-1H-pyrrolo2,3-bpyridine. MS(ESI) M+H""= \ 561.10. O

Y \ Example 119 / \- N N 1-Benzenesulfonyl-3-3-methoxy-4-(3-phenyl-isox azol-5-ylmethoxy)-phenyl)-1H-pyrrolo2,3-bipyri --O dine 125 -O 0840

0837 (2-Ethoxy-naphthalen-1-yl)-3-(4-hydroxy-3- methoxy-phenyl)-pyrrolo2,3-bipyridin-1-yl)-methanone 125 123 was prepared using the same protocol as described in Example 79, substituting 4-Methanesulfonyl-phenylboronic a N No acid with 2-Methoxy-4-(4,4,5,5-tetramethyl-1,3,2diox aborolan-2-yl)-phenol. MS(ESI) M+H=439.17.

Example 118 O 3-(3-Cyclopentyloxy-4-methoxy-phenyl)-pyrrolo2. 3-bipyridin-1-yl)-2-(2.2.2-trifluoro-ethoxy)-naph O thalen-1-yl)-methanone 124 / 0838) Y \ / \- N 124 OFSFO

0841 1-Benzenesulfonyl-3-3-methoxy-4-(3-phenyl isoxazol-5-ylmethoxy)-phenyl)-1H-pyrrolo2,3-bipyridine 125 was prepared using the same protocol as described in Example 7, substituting 2,3-dimethoxy-phenylboronic acid with 5-2-Methoxy-4-(4.4.5.5-tetramethyl-1,3,2diox 25 aborolan-2-yl)-phenoxymethyl-3-phenyl-isoxazole. MS(ESI) M+H=538.06. US 2006/01 00218 A1 May 11, 2006

Example 120 mixture was diliuted with an addional 25 mL of methylene chloride. The organic layer was washed with 1 M sodium 1-Benzenesulfonyl-3-3-methoxy-4-(3-phenyl-isox azol-5-ylmethoxy)-phenyl)-1H-pyrrolo2,3-bipyri bicarbonate (aq.) (30 mlx2) and then with brine. The sepa dine 126 rated organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The resi 0842) due was purified by silica gel chromatography (30% ethyl acetate in hexanes) to yield the titled compound as a white solid. MS(ESI) M+H=446.20. Example 121 Scheme-26 4-(3,4-Dimethoxy-phenyl)-1-phenylmethanesulfo / nyl-1H-pyrrolo2,3-bipyridine 127 0845 / SOCI N 127 Y \ 21 / / Y \ ( \- N N o==o

0846 4-(3,4-Dimethoxy-phenyl)-1-phenylmethanesulfo nyl-1H-pyrrolo2,3-bipyridine 127 was prepared using the same protocol as described in Example 120, Substituting 8-quinoline-sulfonyl chloride with benzylsulfonyl chloride. MS(ESI) M+H=409.20.

126 Example 122 4-(3,4-Dimethoxy-phenyl)-1H-indole 128 0847) 0843 Preparation of 8-4-(3,4-Dimethoxy-phenyl)-pyr rolo2,3-bipyridine-1-sulfonyl-quinoline 126 Scheme-27 0844 Into a Round bottom flask was added 4-(3,4- No Dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridine (0.222 g, 0.000873 mol), 50 and Tetra-N-butylammonium bromide (0.0282g, 0.0000874 mol), and 5.000 M of Sodium hydrox ide in Water (2.25 mL). 8-quinoline-sulfonyl chloride (0.238 g, 0.00105 mol) dissolved in Methylene chloride (0.616 mL, N 0.00960 mol) was added dropwise at 0 Celsius. The reaction H was stirred at ambient temperature for 3 hand the reaction US 2006/01 00218 A1 May 11, 2006

Example 124 -continued 8-5-(3,4-Dimethoxy-phenyl)-indole-1-sulfonyl quinoline 130 0852)

130

N 128

0848 Synthesis of 4-(3,4-Dimethoxy-phenyl)-1H-indole 128 0849. In a microwave safe tube, 4-Bromoindole (1.383 g, 0.007054 mol), 3,4-dimethoxyphenylboronic acid (3.21 g, 0.0176 mol), and Tetrakis(triphenylphosphine)palladium(0) (0.41 g, 0.00035 mol) were mixed in 1.00 M of Potassium carbonate in Water (21 mL) and Tetrahydrofuran (34 mL, 0.42 mol). The resulting mixture was heated at 100° Celsius 0853 8-5-(3,4-Dimethoxy-phenyl)-indole-1-sulfonyl in the microwave for 10 minutes. The reaction mixture was quinoline 130 was prepared using the same protocol as described in Example 9, substituting 3-(3,4-Dimethoxy partitioned between water and ethyl acetate. The aqueous phenyl)-1H-pyrrolo-2,3-bipyridine with 5-(3,4- layer was extracted with ethyl acetate and the organic layers Dimethoxy-phenyl)-1H-indole. MS(ESI) M+H=445.20 were combined, washed with brine and dried over sodium Sulfate. The reaction mixture was concentrated under Example 125 reduced pressure and the residue was purified by Silica gel chromatography (30% ethyl acetate in hexanes) to the yield 8-4-(3,4-Dimethoxy-phenyl)-indole-1-sulfonyl 1.02 g of the titled compound as a light green solid. MS(ESI) quinoline 131 M+H=254.20. 0854) Example 123 131 5-(3,4-Dimethoxy-phenyl)-1H-indole 129 / 0850 /O 129

N o=l N N n 2 0851 5-(3,4-Dimethoxy-phenyl)-1H-indole 129 was pre pared using the same protocol as described in Example 122, 0855 8-4-(3,4-Dimethoxy-phenyl)-indole-1-sulfonyl substituting 4-bromoindole with 5-bromoindole. MS(ESI) quinoline 131 was prepared using the same protocol as M+H=254.20 described in Example 9, substituting 3-(3,4-Dimethoxy US 2006/01 00218 A1 May 11, 2006 89 phenyl)-1H-pyrrolo-2,3-bipyridine with 4-(3,4- Dimethoxy-phenyl)-1H-indole. MS(ESI) M+H=445.10 Scheme-28

Example 126 O 1-Benzenesulfonyl-5-(3,4-dimethoxy-phenyl)-1H pyrrolo2,3-bipyridine 132 0856) / 132 7 \ Step 1

s

82

/ Step 2

0857 1-Benzenesulfonyl-5-(3,4-dimethoxy-phenyl)-1H- O pyrrolo2,3-bipyridine 132 was prepared using the same protocol as described in Example 9, substituting 3-(3,4- Dimethoxy-phenyl)-1H-pyrrolo-2,3-bipyridine and quio line-8-sulfonyl chloride with 5-(3,4-Dimethoxy-phenyl)- 1H-pyrrolo-2,3-bipyridine and benzene sulfonyl chloride 7 respectively. MS(ESI) M+H""=395.20 W \ Step 3 Example 127 N N

4-1-Benzenesulfonyl-5-(3,4-dimethoxy-phenyl)- OESEO 1H-pyrrolo2,3-bipyridin-3-ylethynyl)-benzoic acid ethyl ester 135 0858) 135

134

135 US 2006/01 00218 A1 May 11, 2006 90

0859 Step 1—Preparation of 5-(3,4-Dimethoxy-phenyl)- Example 128 3-iodo-1H-pyrrolo2,3-bipyridine 133 1-Benzenesulfonyl-5-(3,4-dimethoxy-phenyl)-3- 0860 5-(3,4-Dimethoxy-phenyl)-1H-pyrrolo2,3-bipyri phenylethynyl-1H-pyrrolo2,3-bipyridine 136 dine, 82, (0.270 g., 0.00106 mol) was dissolved in Tetrahy drofuran (8.5 mL, 0.10 mol) under an atmosphere of Nitro 0865) gen. The solution was stirred at -40° C. and Iodine (0.269 g, 0.00106 mol) dissolved in 2.5 mL of Tetrahydrofuran was 136 added. The chilled reaction mixture was stirred for 2 hand was then quenched with the addition of Sodium thiosulfate, pentahydrate (0.13 g, 0.00053 mol) in water (1M). The reaction mixture was partitioned between water (20 mL and ethyl acetate (30 mL). The two layers were seperated, and the aquous layer was extracted with ethyl acetate. The organic layers were washed with water and brine, dried with Sodium Sulfate, then concentrated under reduced pressure. The dark colored crude residue was carried onto the next reaction without further purification. 0861 Step 2 Preparation of 1-Benzenesulfonyl-5-(3,4- dimethoxy-phenyl)-3-iodo-1H-pyrrolo2,3-bipyridine 134 0862 Into a Round bottom flask was added 5-(3,4- Dimethoxy-phenyl)-3-iodo-1H-pyrrolo2,3-bipyridine, 133, (0.403 g, 0.00106 mol) and Tetra-N-butylammonium bro 0866 1-Benzenesulfonyl-5-(3,4-dimethoxy-phenyl)-3- mide (0.0342 g, 0.0001.06 mol), in 5.000 M of Sodium phenylethynyl-1H-pyrrolo2,3-bipyridine 136 was prepared hydroxide in Water (2.73 mL). Benzenesulfonyl chloride using the same protocol as described in Example 127. (0.225 g, 0.00127 mol) in Methylene chloride (0.747 mL, substituting 4-Ethynyl-benzoic acid ethyl ester with Ethy 0.0116 mol) was added dropwise. After 2 h, 30 mL of nyl-benzene. MS(ESI) M+H"=495.20 Methylene chloride and 30 mL of water were added. The organic layer was separated and washed with 1M sodium Example 129 bicarbonate (aq.) (30 mlx2) followed by water (30 ml) and 3-1-Benzenesulfonyl-5-(3,4-dimethoxy-phenyl)- brine (30 mL). The organic layer was collected and dried 1H-pyrrolo2,3-bipyridin-3-ylethynyl)-benzoic acid over anhydrous sodium Sulfate, then concentrated under methyl ester 137 reduced pressure. The residue was purified by chromatog raphy (Silica gel, ethyl acetate/hexanes) to give 295 mg of 0867) the desired product as a white solid. MS(ESI) M+H"= 521.04 137 0863 Step 3 Preparation of 4-1-Benzenesulfonyl-5-(3. 4-dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridin-3-ylethy nyl-benzoic acid ethyl ester 135 0864 1-Benzenesulfonyl-5-(3,4-dimethoxy-phenyl)-3- iodo-1H-pyrrolo2,3-bipyridine (0.0800 g, 0.000151 mol), 4-Ethynyl-benzoic acid ethyl ester (0.0321 g, 0.000181 mol), Bis(triphenylphosphine)palladium(II) chloride (0.004.8 g., 0.0000069 mol), and Copper(I) iodide (0.00024 g, 0.0000013 mol) were dissolved in Triethylamine (0.8 mL, 0.005 mol) under an atmosphere of Nitrogen. The resulting mixture was heated to 60° C. and stirred under an atmo sphere of Nitrogen for 2 hours. The reaction mixture was was concentrated under reduced pressure and water (30 mL) was added to the residue. This slurry was extracted with ether. (20 mL 2x). The combined organic layers were washed with brine, dried over sodium sulfate and concen trated under reduced pressure. The crude was purified by chromatography (Silica gel, ethyl acetate/hexanes to give 85 0868 3-1-Benzenesulfonyl-5-(3,4-dimethoxy-phenyl)- mg of the titled product as a pale orange solid. MS(ESI) 1H-pyrrolo2,3-bipyridin-3-ylethynyl)-benzoic acid methyl M+H"-567.10 ester 137 was prepared using the same protocol as described US 2006/01 00218 A1 May 11, 2006 91 in Example 127, substituting 4-Ethynyl-benzoic acid ethyl Example 132 ester with 3-Ethynyl-benzoic acid methy ester. MS(ESI) M+H"-553.10 3-5-(3,4-Dimethoxy-phenyl)-1H-pyrrolo2,3-b Example 130 pyridin-3-ylethynyl)-benzoic acid 140 5-(3,4-Dimethoxy-phenyl)-3-phenylethynyl-1H 0873) pyrrolo2,3-bipyridine 138 0869)

138

0870 5-(3,4-Dimethoxy-phenyl)-3-phenylethynyl-1H pyrrolo2,3-bipyridine 138 was prepared using the same protocol as described in Example 7, substituting 1-Benze nesulfonyl-3-(3,4-dimethoxy-phenyl)-1H-pyrrolo2,3-bpy ridine with 1-Benzenesulfonyl-5-(3,4-dimethoxy-phenyl)-3- phenylethynyl-1H-pyrrolo2,3-bipyridine. MS(ESI) M+H"-355.20 Example 131 3-5-(3,4-Dimethoxy-phenyl)-1H-pyrrolo2,3-b pyridin-3-ylethynyl-benzoic acid methyl ester 139 0871)

139 0874) Preparation of 3-5-(3,4-Dimethoxy-phenyl)-1H pyrrolo2,3-bipyridin-3-ylethynyl)-benzoic acid 140 0875) Into a microwave safe tube, 3-5-(3,4-Dimethoxy phenyl)-1H-pyrrolo2,3-bipyridin-3-ylethynyl-benzoic acid methyl ester (0.049 g, 0.00012 mol) was dissolved in 5.00 M of Sodium hydroxide in Water (1.78 mL) and Methanol (7.1 mL, 0.18 mol). The reaction was warmed at 60 watts to 100° C. for 10 minutes. The resulting clear yellow solution was concentrated under reduced pressure. 0872 3-5-(3,4-Dimethoxy-phenyl)-1H-pyrrolo2,3-b The resulting aqueous slurry was acidified to pH 5 with 1 M pyridin-3-ylethynyl)-benzoic acid methyl ester 139 was pre HCl (aq) and was extracted into ethyl acetate. The organic pared using the same protocol as described in Example 7. layer was washed with brine, dried over anhydrous sodium substituting 1-Benzenesulfonyl-3-(3,4-dimethoxy-phenyl)- sulfate, then concentrated under reduced pressure. The 1H-pyrrolo2,3-bipyridine with 3-1-Benzenesulfonyl-5-(3, resulting residue was recrystalized from ethyl acetate and 4-dimethoxy-phenyl)-1H-pyrrolo2,3-bipyridin-3-ylethy methanol to yield the titled compound as a white solid. nyl-benzoic acid methyl ester. MS(ESI) M+H""=413.20 MS(ESI) IM+H"-399.20 US 2006/01 00218 A1 May 11, 2006 92

Example 133 Example 134 3-Benzo1.3dioxol-5-yl-2-methyl-1H-pyrrolo2,3-b 5-(1-Benzenesulfonyl-1H-pyrrolo2,3-bipyridin-3- pyridine 142 yl)-2-methoxy-phenol 0879) 142 0876) /No O / Scheme-30

sN N ()- H 0880 3-Benzo1.3dioxol-5-yl-2-methyl-1H-pyrrolo2, 3-bipyridine 142 was prepared using the same protocol as described in Example 8, substituting 3-Bromo-1H-pyrrolo ) () 2,3-bipyridine and 3,4-dimethoxy-phenylboronic acid with 3-Bromo-2-methyl-1H-pyrrolo2,3-bipyridine and 5-(4.4.5, 5-Tetramethyl-1,3,2dioxaborolan-2-yl)-benzo1.3dioxole respectively. Example 135 3-(3,4-Dimethoxy-phenyl)-2-methyl-1H-pyrrolo2,3- bipyridine 143

0881 143 | 9 O

/ 7 } ( ) N N H 0882 3-(3,4-Dimethoxy-phenyl)-2-methyl-1H-pyrrolo ol 2,3-bipyridine 143 was prepared using the same protocol as described in Example 8, substituting 3-Bromo-1H-pyrrolo 2,3-bipyridine with 3-Bromo-2-methyl-1H-pyrrolo2,3-b pyridine.

141 Example 136 (4-Amino-2-ethoxy-phenyl)-3-(3,4-dimethoxy-phe nyl)-pyrrolo2,3-bipyridin-1-yl)-methanone 144

0883) 144 / 0877 Preparation of 5-(1-Benzenesulfonyl-1H-pyrrolo O 2,3-bipyridin-3-yl)-2-methoxy-phenol 141 0878 Into a Parr pressure reactor 1-Benzenesulfonyl-3- (3-benzyloxy-4-methoxy-phenyl)-1H-pyrrolo2,3-bipyri dine (92 mg, 0.00020 mol) was placed with Palladium (50 mg, 0.00005 mol) 10%, tetrahydrofuran (15 mL, 0.18 mol) and Methanol (1 mL, 0.02 mol) and HCl solution (3 mL, 0.04 mol). The reaction was shaken under an atmosphere of hydrogen at 50 psi for 4 hours. The mixture reaction was filtered through CeliteTM and concentrated under reduced pressure. The residue was purified by preparative TLC (ethyl acetate/hexanes 1:1) to give 31 mg of the titled product. MS(ESI) M+H=381.11. US 2006/01 00218 A1 May 11, 2006

0884 3-(3,4-dimethoxy-phenyl)-pyrrolo2,3-bipyri chloride (38 mg, 0.00034 mol) was added to reaction dine-1-yl)-(2-ethoxy-4-nitro-phenyl)-methanone, 54, (100 mixture, which was then stirred at room temperature over mg, 0.22 mmol) was dissolved in EtOAc (30 mL). A night. Top of FormColumn chromatoghraphy purification catalytic amount of 10% Pd/C (7 mg) was added and the (silica gel) gave the titled compoundBottom of Form. flask capped with rubber septa. The flask was evacuated and MS(ESI) M+H=496.08 back filled with hydrogen twice. Finally, the reaction was stirred overnight under a hydrogen gas atmosphere (bal Example 138 loon). The reaction mixture was filtered over Celite(R), rinsed generously with EtOAc (2x75 mL) and concentrated under Cloning of PDE4B Phosphodiesterase Domain reduced pressure to give the titled compound. (56 mg, 60%) MS(ESI) M+H=418.24 0887 PDE4B cDNA sequence was amplified from a Human Brain, hippocampus QUICK-Clone cDNA library Example 137 (Clontech, #7169-1) by PCR using the following primers: N-4-3-(3,4-Dimethoxy-phenyl)-pyrrolo2,3-b pyridine-1-carbonyl-3-ethoxy-phenyl)-methane PDE4B-S: sulfonamide 145 5'-CCGAATT CATATG AGCATCTCACGCTTTGGAGTC-3' 34 mer PDE4B-A 0885) 5'-TGTGCT. CTCGAG TA GCTGTGTCCCTCTCCCTCC-3' 34 mer

145 0888. An internal Ndel site was then engineered out by site directed mutagenesis using the following primers:

PDE4B-NDE1 O 5'-GATATGTCTAAACACATGAGCCTGCTGGC-3' 29 mer PDE4B-NDE2 5'-GCCAGCAGGCTCATGTGTTTAGACATATC-3' 29 mer

| \- N 0889. The resulting PCR fragment was digested with N Ndel and SalI and subcloned into the pET15S vector. 0890. In this expression plasmid, residues 152-528 of O O PDE4B (NCBI sequence JC1519, SEQ ID NO:1) are in \1 frame with an N-terminal His-tag followed by a thrombin 1No N1 \ cleavage site. H O 0891. The sequence of plT15S, with multi-cloning site is shown below:

T7 promoter AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCC

RBS TCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACC

NdeI ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGGATCCGG M. G. S S H H H H H H S S G L W P R G S H M ------

Stu Sall AATTCAAAGGCCTACGTCGACTAGAGCCTGCAGTCTCGACCATCATCATCATCATCATTAATAAAAGGGCG

Spel. BamHI AATTCCAGCACACTGGCGGCCGTTACTAGTGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGG IVEX-3 Primer

Bpul102 I T7 terminator CTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG 3'-PET Primer

0886 Into a round bottom flask was (4-amino-2-ethox 0892 pET15S vector is derived from pET15b vector yphenyl)3-(3,4-dimethoxyphenyl)-pyrrolo2,3-bipyridin (Novagen) for bacterial expression to produce the proteins 1-yl)methonone (56 mg 0.00013 mol) in tetrahydrofuran with N-terminal His6. This vector was modified by replace (15 mL). Sodium hydride (4.8 mg, 0.00020 mol, 60% ment of Ndel-BamHI fragment to others to create a SalI site dispersion in mineral oil) was added and Methanesulfonyl and stop codon (TAG). Vector size is 5814 bp. Insertion can US 2006/01 00218 A1 May 11, 2006 94 be performed using Ndel-SalI site. The amino acid and determined are provided in Table 1 (coordinates for a nucleic acid sequences for the PDE4B phosphodiesterase co-crystal structure is provided in Table 2). domain utilized are provided in Table 3. Example 142 Example 139 PDE Binding Assays Purification of PDE4B 0897 Binding assays can be performed in a variety of 0893 PDE4B is purified from E. coli cells BL21 (DE3) ways, including a variety of ways known in the art. For Codon Plus (RIL) (Novagen) grown in Terrific broth that example, as indicated above, binding assays can be per has been supplemented with 0.2 mM Zinc Acetate and 1 mM formed using fluorescence resonance energy transfer MgCl2 and induced for 16-20h with 1 mM IPTG at 22°C. (FRET) format, or using an AlphaScreen The centrifuged bacterial pellet (typically 200-250 g from 16 0898 Alternatively, any method which can measure L) is suspended in lysis buffer (0.1 M potassium phosphate binding of a ligand to the cAMP-binding site can be used. buffer, pH 8.0, 10% glycerol, 1 mM PMSF). 100 ug/ml of For example, a fluorescent ligand can be used. When bound lysozyme is added to the lysate and the cells are lysed in a to PDE4B, the emitted fluorescence is polarized. Once Cell Disruptor (MicroFluidics). The cell extract is clarified displaced by inhibitor binding, the polarization decreases. at 5000 rpm in a Sorvall SA6000 rotor for 1 h, and the supernatant is recentrifuged for another hour at 17000 rpm 0899) Determination of ICs for compounds by competi in a Sorvall SA 600 rotor. 5 mM imidazole (pH 8.0) is added tive binding assays. (Note that K, is the dissociation con to the clarified supernatant and 2 ml of cobalt beads (50% stant for inhibitor binding; K is the dissociation constant slurry) is added to each 35 ml of extract. The beads are for substrate binding.) For this system, the IC50, inhibitor mixed at 4 C for 3-4 h on a Nutator and the beads are binding constant and Substrate binding constant can be recovered by centrifugation at 4000 rpm for 3 min. The interrelated according to the following formula: pelleted beads are washed several times with lysis buffer and 0900 When using radiolabeled substrate, the beads are packed on a BioRad disposable column. The bound protein is eluted with 3-4 column volumes of 0.1M imidazole followed by 0.25M imidazole, both prepared in Cso lysis buffer. The protein eluted from the cobalt beads is Ki = 1 III, K. concentrated on Centriprep-10 membranes (Amicon) and separated on a Pharmacia Superdex 200 column (26/60) in low salt buffer (25 mM Tris-HCl, pH 8.0, 150 mM NaCl, 14 and the ICs-K, when there is a small amount of labeled mM beta-mercaptoethanol). At this stage the PDE proteins substrate. are treated with thrombin for 16-20 hours at room tempera ture. The PDE proteins are further purified by anion Example 143 exchange chromatography on a Pharmacia Source Q column (10/10) in 20 mM Tris-HCl pH 8 and 14 mM beta-mercap PDE Activity Assay toethanol using a NaCl gradient in an AKTA-FPLC (Phar 0901. As an exemplary phosphodiesterase assay, the macia). effect of potential modulators phosphodiesterase activity of PDE4B, PDE5A, and other PDEs was measured in the Example 140 following assay format: Crystallization of PDE4B Phosphodiesterase Reagents Domain 0902 Assay Buffer 0894) Crystals of PDE4B were grown in 30% PEG 400, 0.2M MgCl, 0.1M Tris pH 8.5, 1 mM binding ligand, 15.9 0903) 50 mM Tris, 7.5 mg/ml protein at 4° C., using an Intelliplate (Robbins 0904) 8.3 mM MgCl, Scientific, Hampton) by mixing one microliter of protein with one microliter of precipitant. Data was collected to 1.4 0905) 1.7 mM EGTA A. 0906) 0.01% BSA 0895 Additionally, PDE4B crystals were grown in 20% 0907 Store (a 4 degrees PEG 3000, 0.2M Ca(OAc), 0.1M Tris pH 7.0, 1 mM binding ligand, 15.9 mg/ml protein at 4° C., using an 0908) RNA binding YSi SPA beads Intelliplate (Robbins Scientific, Hampton) by mixing one 0909 Beads are 100 mg/ml in water. Dilute to 5 mg/ml microliter of protein with one microliter of precipitant. Data in 18 mM Zn using 1 MZnAcetate/ZnSO solution (3:1) and was collected to 1.7 A. water. Store (a 4 degrees. Example 141

Structure Determination of PDE4B Low control compounds Concentration of 20XDMSO Stock PDE1B: 8-methoxymethyl IBMX 20 mM 0896) The structure of PDE4B was solved using molecu PDE2A: EHNA 10 mM lar replacement, using the previously deposited coordinates PDE3B: Mirinone 2 mM for PDE4B. The atomic coordinates for the PDE4B Structure US 2006/01 00218 A1 May 11, 2006

0932 Analyze data as % inhibition of enzyme activity. -continued Average of high controls=0% inhibition. Average of low controls=100% inhibition. Low control compounds Concentration of 20XDMSO Stock PDE4D: Rolipram 10 mM Example 144 PDE5A: Zaprinast 10 mM PDE7B: IBMX 40 nM Expression and purification of PPARs for use in PDE10A: Dipyridamole 4 mM biochemical and cell assays 0933 Genetic Engineering 0910 Enzyme concentrations (2x final concentration. 0934 Plasmids encoding the human phosphodiesterases Diluted in assay buffer) (PDEs) 4B and 4D were engineered using common poly 0911 PDE 1 B 50 ng/ml merase chain reaction (PCR) methods. Both the full-length PDEs and truncated versions harboring just the PDE cata 0912 PDE2A 50 ng/ml lytic domains were engineered for heterologous expression. 0913) PDE3B 10 ng/ml The relevant DNA sequences and encoded protein sequences used are shown for each (see below). The human PDE4B 0914 PDE4D 5 ng/ml and PDE4D genes have several splice variants; the splice 0915 PDE5A 20 ng/ml variants chosen for full-length expression are PDE4B2 (NCBI accession gi292387) and PDE4D5 (NCBI accession 0916 PDE7B 25 ng/ml gi 2735856). Complementary DNA cloned from various 0917 PDE10A 5 ng/ml) human tissues were purchased from Invitrogen, and these were used as substrates in the PCR reactions. Specific 0918 Radioligands custom synthetic oligonucleotide primers (Invitrogen, see 0919) H cAMP (Amersham TRK559). Dilute 2000x in below) were designed to initiate the PCR product, and also assay buffer. to provide the appropriate restriction enzyme cleavage sites 0920 H coMP (Amersham TRK392). For PDE5A for ligation with the plasmids. assay only. Dilute 2000x in assay buffer. 0935 The plasmid used for ligation with the catalytic domain-encoding PDE4B and PDE4D inserts was derived 0921) Protocol from pET15 (Novagen) for expression using E. coli. The 0922 Make assay plates from 2 mM, 96 well master plasmid used for ligation of the full-length PDE4B and plates by transferring 1 ul of PDE4D inserts was pFastEachT (Invitrogen). In all of these cases the PDE was engineered to include a Histidine tag for 0923 compound to 384 well plate using BiomekFX. purification using metal affinity chromatography. Final concentration of compounds will be ~100 uM. Duplicate assay plates are prepared from each master 0936 Protein Expression and Purification of PDE4 Cata plate so that compounds are assayed in duplicate. lytic domains in E. coli: 0924. To column 23 of the assay plate add 1 ul of 20x 0937 For protein expression, plasmids containing genes DMSO stock of appropriate control compound. These of interest were transformed into E. coli strains BL21 (DE3) will be the low controls. RIL and transformants selected for on LB agar plates containing appropriate antibiotics. Single colonies were 0925 Columns 1 and 2 of Chembridge library assay grown for 4 hrs at 37° C. in 200 ml LB media. For PDE4B plates and columns 21 and 22 of the Maybridge library and PDE4D all protein expression was performed by large assay plates have 1 ul DMSO. These are the high scale fermentation using a 30L bioreactor. 400 ml of starter controls. culture was added to 30L TB culture and allowed to grow at 37° C. until an OD600 nm of 2-5 was obtained. The culture 0926. Using BiomekFX, pipet 10 ul of radioligand into was cooled to 20° C. and 0.5 mM IPTG, 1 mM MgCl2 and each assay well, then, using the same tips, pipet 10 ul 0.2 mM ZnOAc added, the culture was allowed to grow for of enzyme into each well. a further 18 hrs. 0927 Seal assay plate with transparent cover. Centri 0938 For protein purificatio all operations were carried fuge briefly (1000 RPM, them mix on plate shaker for out at 4°C. Frozen E. coli cell pellets were resuspended in 10 S. lysis buffer and lysed using standard mechanical methods. Soluble proteins were purified via poly-Histidine tags using 0928) Incubate (a 30° for 30 min. immobilized metal affinity purification (IMAC). For each of 0929. Using BiomekFX, add 10 ul of bead mixture to the PDEs purification was achieved using a 3 step purifi each assay well. Mix beads thoroughly in reservoir cation process utilizing, IMAC, size exclusion chromatog immediately prior to each assay plate addition. raphy and ion exchange chromatography. For both PDE4B and PDE4D, the poly-Histidine tag was removed using 0930 Re-seal plate with fresh transparent cover. Mix Thrombin (Calbiochem) before the final purification step. on plate shaker for 10 s, then centrifuge for 1 min. (a11000 RPM. 0939 For proteins provided for assay purposes, the above described expression conditions were carried out except 0931 Place plates in counting racks. Let stand for 230 purification was only 2-steps and the poly-histidine tag was min, then count on Wallac TriLux using program 8. not removed. Enzymes were stored in 50% glycerol.