Inhibition of Tat-Mediated Transactivation and HIV Replication with Tat Mutant and Repressor Domain Fusion Proteins

Home , Tat (HIV)

Gene Therapy (1998) 5, 946–954  1998 Stockton Press All rights reserved 0969-7128/98 $12.00 http://www.stockton-press.co.uk/gt Inhibition of Tat-mediated transactivation and HIV replication with Tat mutant and repressor domain fusion proteins

C Fraisier1,2, DA Abraham1, M van Oijen1, V Cunliffe3, A Irvine3, R Craig3 and EA Dzierzak1,2 1National Institute for Medical Research, Division of Eukaryotic Molecular Genetics, London, UK; 2Erasmus University Rotterdam, Department of Cell Biology and Genetics, Rotterdam, The Netherlands; and 3Therexsys Ltd, The Science Park, University of Keele, Keele, UK

Strategies to inhibit the spread of HIV infection consist of moter. This fusion mutant was also examined for its a number of speciﬁc molecular approaches. Since viral capacity to block both Tat-mediated transactivation and production is dependent upon Tat-mediated transactivation HIV replication. We show that three mutants Tat⌬53, of the HIV promoter through the Tat activating region Tat⌬58 and Tat⌬53/Eng result in a transdominant pheno- (TAR), tat antisense RNA, anti-tat ribozymes, TAR decoys type inhibiting wild-type Tat-mediated transactivation, and and dominant negative Tat mutant proteins have been sug- that the inhibiting potential is increased by the presence of gested as therapeutic inhibitors. We produced and tested the entire basic domain or the fusion of a repressor several Tat mutant proteins, including a newly generated domain. However, only the transdominant mutants Tat⌬58 form Tat⌬58, for the ability to inhibit Tat-mediated trans- and Tat⌬53/Eng signiﬁcantly inhibit HIV-1 replication after activation and HIV production. In addition, we generated a infection of transfected T cell lines. These results demon- new Tat fusion mutant between a C-terminus truncated strate the potent inhibiting activity of Tat mutants on HIV form of Tat (Tat⌬53) and the Drosophila Engrailed (Eng) replication, and suggest a synergistic effect of Tat trans- transcription repressor domain to test the hypothesis that dominant mutant fusion with the Drosophila Engrailed tran- transcriptional repression can be targeted to the HIV pro- scription repressor domain.

Keywords: HIV-1; tat transdominant mutants; transcription repressor; gene therapy

Introduction activation of transcription, and an arginine-rich basic domain (aa 49–57) which mediates Tat binding to Tat One of the many molecular strategies currently being transactivation element (TAR) RNA and also functions in examined to inhibit the spread of HIV infection consists nuclear localization (reviewed in Ref. 8). Although not of gene-based therapy utilizing genes encoding for HIV defined by specific domains, the glutamine-rich region mutant regulatory or structural proteins known as trans- between residues 58 and 72 seems to augment the action dominant or dominant negative mutant proteins. Trans- of Tat since a synthetic peptide containing residues 1–58 dominant proteins have been described for a variety of has been shown to have 5–10% the activity of the 1–86 1–3 4–6 7 HIV-1 proteins including Tat, Rev and Gag. These or 1–72 Tat protein.9 The carboxy-terminal amino acids mutant proteins are defective in their normal function of Tat (residues 72–86) do not appear essential for trans- and are able to compete with the corresponding wild- activation but they contain the conserved RGD motif that type protein to inhibit its activity. As it has been pre- mediates binding of Tat to integrins allowing exogenous viously shown, one excellent target for transdominant Tat to be taken up by cells.8 inhibition is the regulatory protein Tat (reviewed in Previously, it has been shown that mutations of HIV- Ref. 8). 1 or HIV-2 Tat protein consisting of substitutions in the Tat is a potent transactivator of HIV long terminal transactivation domain, Tat22, Tat37, Tat22/37,10 Tat41- repeat (LTR)-directed gene expression. It consists of 86 ala, Tat47ala2 and in the basic domain Tat55/58, Tat54/57 amino acids (aa) and can be taken up by cells in tissue Tat52/57,3 Tat50/57,11 or carboxy-terminus truncations 8 culture. The first 72 amino acids encoded by exon 1 of which partially remove the basic domain, Tat⌬53,1 result tat are fully active in transactivation of the HIV LTR. The in proteins defective in transactivating HIV gene Tat protein contains at least two domains that are func- expression. These mutant proteins act as transdominant tionally important in HIV transactivation and replication: proteins which inhibit wild-type Tat-mediated transactiv- an activation domain (aa 1–48) which promotes trans- ation. In addition, mutant proteins with amino acid substitutions between aa 52 and 57 (Tat 52/57)12 or between aa 50 and 57 (Tat 50/57),11 and substitution at position 10 EA Dzierzak, Department of Cell Biology and Genetics, PO Box 1738, 22 (Tat22) have been shown to inhibit HIV replication. 3000 DR Rotterdam, The Netherlands However, no inhibition of HIV replication could be Received 26 August 1997; accepted 10 February 1998 observed with the truncated mutant Tat⌬53.13 HIV inhibition using Tat mutants and repressor domain C Fraisier et al 947 To explore further the potential of Tat mutant proteins in inhibiting the spread of HIV infection for possible clinical applications, we generated several transdominant mutants of Tat: substitutions mutants, carboxy-terminus truncated mutants including a new form Tat⌬58 harboring the entire basic domain, and a Tat mutant (Tat⌬53) coupled to the repressor domain of a known transcription factor. The alanine-rich domain of the Drosophila Engrailed (Eng) transcription factor has been shown to act as a strong active repressor of transcription by competition with the TATA box-binding protein transcription factor IID (TFIID).14 Additionally, the fusion of the Droso- phila Engrailed transcription repressor domain with the Myb DNA-binding domain acts as a potent competitive inhibitor of c-Myb in transgenic animals and perturbs thymic development.15 Moreover, recent evidence suggests that a chimeric protein with a virus-specific DNA or RNA-binding domain and a strong transcriptional repressor function may interfere with the expression of viral gene products in infected cells.16–18 Indeed, Tat ¨ mutants fused to the Kruppel-associated box repressor (KRAB) showed an enhanced inhibiting activity of Tat- mediated transactivation.19 The object of the present study was to transiently and stably express the transdominant mutants in reporter cells and human T lymphoid cell lines, respectively, in order to interfere with HIV LTR-driven gene expression and HIV infection. We show here that truncated mutants Tat⌬53 and Tat⌬58 inhibit wild-type Tat-mediated transactivation and that this inhibiting activity is enhanced with the fusion mutant between Tat⌬53 and the Engrailed repressor domain (Tat⌬53/Eng). Tat⌬58 and Tat⌬53/Eng mutants also effectively inhibit HIV-1 replication in vitro, while Tat⌬53 fails to show any effect on HIV-1 infection. These results suggest the potential use Figure 1 (a) Schematic representation of HIV-1 tat exon 1 (wild-type) of transdominant mutant protein and the Engrailed and transdominant mutants; substitution mutants Tat41ala and Tat47ala; repressor domains of transcription factors for gene ther- carboxy-terminal truncated mutants Tat⌬53 and Tat⌬58; and the fusion apy against HIV-1 infection. mutant between Tat⌬53 and the Drosophila Engrailed repressor domain. (b) Schematic representation of the expression vectors pSG5 and pCD2- puro used for expression of Tat transdominant mutants. M.C.S, multiple Results cloning site.

Differential transactivation of HIV LTR by Tat molecules activation of the HIV promoter, we tested if the mutants Several HIV-1 Tat mutants were generated by PCR themselves were defective in the transactivation of the amplification using specific oligonucleotides as described HIV promoter. Hela cells containing the human growth in Materials and methods (Figure 1a). These substitutions hormone (hGH) gene under the control of the HIV LTR and deletions were chosen because a transdominant (LTRhGH)20 were utilized as reporter cells and were tran- phenotype has been previously described for a Tat pro- siently transfected with 0.5 ␮g of wild-type (wt) or tein containing an alanine residue substituting for lysine mutant tat DNAs (Figure 2a). At 3 days after transfection, 41 and tyrosine 47, and for peptides spanning aa 37–72.2 supernatants were tested for the presence of hGH protein Pearson et al1 described a different trans-dominant inhibi- by RIA. As shown in Figure 3, maximal transactivation tory Tat mutant truncated by a premature stop codon at (100%) was found with the wild-type Tat (Tat-wt), giving aa 54. In order to make an improved transdominant the expected 10- to 20-fold increase in expression over mutant, we have generated a new truncated form Tat⌬58 the basal levels of LTR-directed expression (defined as so as to include all the activation domain and the argi- 0% transactivation). Similarly, a high level of transactiv- nine-rich TAR-binding domain. In addition to expecting ation (Ͼ90%) was also obtained with the Tat47ala these structural forms of Tat to act as transdominant mutant. However, only a low level of transactivation was inhibitors, we tested the hypothesis that the Drosophila observed in the presence of Tat41ala, Tat⌬53 and Tat⌬58, Engrailed (Eng) transcription repressor domain would giving 7, 7.5% and 7.8% transactivation, respectively. result in further HIV inhibition. Thus, a Tat⌬53/Eng Transactivation ability was completely abolished with the fusion construct was generated. Each Tat mutant was Tat⌬53/Eng mutant as only the basal levels of hGH inserted in the SV40 (pSG5) and human CD2 (pCD2- reporter gene were found (Figure 3). As controls, the puro) expression cassettes (Figure 1b) for efficient tran- expression vector containing each of the tat mutant genes scription in human cell lines. Before testing whether the in the antisense orientation did not induce transactivated Tat mutants could inhibit wild-type Tat-mediated trans- hGH expression in any of the transfection experiments HIV inhibition using Tat mutants and repressor domain C Fraisier et al 948

Figure 3 Differential transactivation by the Tat mutant molecules. Hela reporter cells were transfected with 0.5 ␮g of each tat expression plasmid vector. The level of transactivation was assessed by analysis of hGH in culture supernatant 72 h after transfection. Maximal transactivation obtained with wild-type Tat was defined as 100% transactivation. The basal level of HIVLTRhGH expression was defined as 0% transactivation. Transfection efficiency was monitored using a pCMVLacZ plasmid vector and values were normalized after spectrophotometric substrate detection. Controls were nontransfected cells and cells transfected only with pCMVLacZ, and showed no transactivation (data not shown). Data are expressed as means ± standard deviation of at least three separate experiments.

Figure 2 Schemes for transfection and infection assays performed to test the activity of Tat transdominant mutants on Tat-mediated transactiv- transactivation of the HIV LTR. The most potent inhi- ation and on HIV replication. (a) Transactivation of the HIV-LTRhGH bition of Tat-mediated transactivation was obtained in gene by Tat mutants was assessed after transient transfection of Hela the presence of Tat⌬53/Eng and Tat⌬58 mutants, giving reporter cells with DNA vectors expressing tat wild-type or tat mutants. Supernatants were tested for the presence of hGH protein 3 days after 73 and 61% inhibition, respectively, at a five-molar excess transfection. (b) Inhibition of Tat wild-type-mediated transactivation by over the Tat-wt. Tat⌬53 and Tat41ala also showed Tat mutants was assessed after transient cotransfection of Hela reporter inhibiting effects on Tat-mediated transactivation, giving cells with tat-wt vector and tat mutants plasmid DNA at different molar 57 and 48% inhibition, respectively. In contrast, antisense ratios. Supernatants were tested for the presence of hGH protein 3 days Tat⌬53/Eng and Tat⌬58 mutants showed no inhibition after transfection. (c) Inhibition of HIV-1 infection was assessed after in of Tat-mediated transactivation, thus demonstrating the vitro infection of T lymphoid CEM cells stably transfected with Tat mutants. Time-course infection was determined by the presence of HIV- specificity of inhibition by sense mutants. 1 p24 core protein or HIV-1 reverse transcriptase (RT) in cell-free super- The specificity of inhibition was verified by performing natants collected every 3–4 days. the cotransfection experiments with various wt-Tat to Tat mutant ratios; 1:1, 1:2 and 1:5. Each cotransfection was performed with a total of 3 ␮g DNA. As shown in Figure performed (data not shown). These results demonstrate 4b, the percentage inhibition by each of the Tat mutants that several mutations of the tat gene abolish or substan- is decreased as less mutant DNA is cotransfected. Con- tially decrease the transactivation function of this regulat- sistent with the previous result, Tat⌬53/Eng inhibited ory molecule. transactivation better than any other Tat mutant at all ratios tested. At equimolar ratios, Tat⌬53/Eng decreased Potent inhibition of Tat-mediated transactivation by the the transactivation by wt-Tat to almost 50%. Tat⌬58, truncated Tat mutants Tat⌬53 and Tat41ala were able to inhibit transactivation To test for the inhibition of Tat-mediated transactivation at the 1:1 ratio but much less effectively (35, 26 and 25%, by the nontransactivating Tat mutants we performed respectively). Thus inhibition directly correlates with the cotransfection experiments with wild-type tat and tat quantity of mutant Tat DNA transfected, strongly sug- mutant DNAs in Hela reporter cells (Figure 2b). Cotrans- gesting specificity of inhibition by Tat mutants. fection of pSG5Tat-wt (0.5 ␮g) in combination with each of the pSG5tat mutant plasmid DNAs was carried out Expression of tat RNA in stably transfected CEM cells with a specific wild-type:mutant ratio of 1:5. As controls, The efficient but incomplete trans-negative effects of the cotransfection experiments were performed with anti- mutant Tat on HIV LTR transactivation prompted con- sense constructs of tat mutant sequences (Figure 4a). All struction of a better expression cassette for transfection nontransactivating Tat mutants inhibited the wild-type and HIV infection experiments in T cell lines. The human HIV inhibition using Tat mutants and repressor domain C Fraisier et al 949

Figure 5 Transdominant tat RNA expression in CEM transfectants. RNA was extracted from Jurkat/Tat and control CEM cells, CEM cells transfected with the pCD2 control vector, and from CEM cells stably transfected with pCD2-Tat⌬53, Tat⌬58 and Tat⌬53-Eng. Specific RNA expression was determined by RT-PCR using tat-specific primers, and primers specific to human ␤-actin mRNAs as internal control, giving PCR products of 158 and 590 bp, respectively. No corresponding Tat fragment was amplified from negative cell lines or from samples that were not subjected to the RT (data not shown). For semiquantitative RT-PCR, three serial two-fold (Tat) and four four-fold (␤-actin) dilutions of cDNA samples (Tat⌬53, Tat⌬58 and Tat⌬53/Eng) were amplified. PCR products were electrophoresed on a 3% agarose gel and stained with ethidium bro- mide. For Southern blotting, PCR products were transferred on to a nylon membrane and hybridized with 32P-labeled tat- and ␤-actin-specific probes. Relative signal intensities were quantified with a Phosphorimager.

expressing the wild-type Tat (aa 1–72) showed a high level of expression of tat RNA. No corresponding DNA Figure 4 Inhibition of Tat-mediated transactivation. Hela reporter cells product was amplified from control CEM or CEM cells were transiently transfected with pSG5Tat-wt alone (WT), cotransfected with pSG5Tat-wt and each Tat mutant DNA (41ala, ⌬53, ⌬58 and transfected with the control pCD2 vector (Figure 5) or ⌬53/Eng) plasmid in a (a) five-fold molar excess and (b) at different from samples that were not subjected to the RT (data not wt:mutant molar ratio; 1:1, 1:2 and 1:5. As controls, Tat vectors contain- shown). As internal control, the endogenous expression ing Tat⌬58 and Tat⌬53/Eng in the antisense orientation were used at the of human ␤-actin was determined by cDNA amplification 1:5 molar ratio. The level of Tat-mediated transactivation was assessed by with specific primers. All samples showed a 590-bp PCR analysis of hGH in culture supernatant 72 h after transfection. Transfec- product characteristic of ␤-actin expression (Figure 5). tion efficiency was monitored using a pCMVLacZ plasmid vector and values were normalized after spectrophotometric substrate detection. Con- Semiquantitative analysis of RNA expression using ser- trols were nontransfected cells and cells transfected only with pCMVLacZ. ial-diluted cDNA, and Phosphorimager analysis after All data presented here are from experiments in which transactivation normalisation to the ␤-actin internal control showed that levels using Tat-wt were 10- to 20-fold increased over the basal expression. Tat⌬53 and Tat⌬58 RNAs were expressed at the same Data were obtained from at least three separate experiments. level and that Tat⌬53/Eng RNA was expressed at a two- fold higher level.

CD2 gene control elements are known to direct T cell- Inhibition of HIV-1 replication in CEM cells expressing specific expression to high levels due to the presence of Tat⌬58 and Tat⌬53/Eng the locus control region (LCR). LCRs have been described To determine if the CEM cell lines expressing transdomi- as elements capable of yielding position-independent and nant Tat mutants inhibited HIV-1 replication, each trans- copy number-dependent expression of heterologous fectant pool (Tat⌬53, Tat⌬58 and Tat⌬53/Eng) was transgenes.21 Thus, Tat mutant DNAs were inserted into infected with HIV-1 and its replication compared with the pCD2-puro expression plasmid (Figure 1b) contain- that of the parental untransfected control CEM cells as ing the CD2 promoter, 3Ј untranslated region (UTR) and well as the control CEM cells transfected with the pCD2 locus control region (LCR).22 CEM cells were stably trans- expression cassette. Triplicate cultures of the CEM popu- fected with each pCD2-tat mutant construct and tested lations were infected with HIV-1IIIB/LAI and were main- for the expression of tat mutant RNA by RT-PCR. RNA tained in the absence of drug selection during the course was digested with RNase-free DNase to eradicate poten- of infection. Every 3–4 days, cell-free supernatants were tially contaminating DNA and reverse transcription was tested for the presence of RT activity or p24 core protein performed with randomized oligonucleotides. The result- (Figure 6). ant cDNA was amplified in the presence of tat-specific After challenge with HIV-1 at a low mutiplicity of primers. As shown in Figure 5, the presence of a 158- infection (MOI 0.0001, 50 TCID50/ml), substantial inhi- bp PCR product detected after hybridization with a tat- bition of HIV-1 replication in Tat⌬58 transfectants was specific probe and common to the three Tat mutants, con- observed throughout the 23 day culture period (Figure firmed the expression of tat mutant RNA in CEM cells 6a). Only 2 ng/ml of p24 was detected at day 23, whereas transfected with pCD2-Tat⌬53, pCD2-Tat⌬58 and pCD2- p24 levels rapidly increased after day 6 for the control Tat⌬53/Eng. As a positive control, Jurkat/Tat cells pCD2-transfected cells. The p24 levels of the control cells HIV inhibition using Tat mutants and repressor domain C Fraisier et al 950

Figure 6 Inhibition of HIV-1 replication in CEM cells expressing Tat transdominant mutants. CEM cells were stably transfected with the pCD2-tat

plasmid DNA and challenged in vitro with HIV-1IIIB/LAI at different MOI. (a) MOI 0.0001; (b) MOI 0.0002; (c) MOI 0.001 and (d) MOI 0.002. Cell- free supernatants were tested every 3–4 days for the presence of HIV-1 p24 (a) or reverse transcriptase (RT) activity (b, c and d). HIV replication in cells expressing Tat mutants was compared with that in control pCD2-transfected cells (a, b and c) or with that in parental CEM cells (d). These infection experiments have been repeated at least twice with similar results.

reached a concentration of 5–10 ␮g/ml beginning at day control infected cells. At the higher MOI of 0.001, only a 16. Thus, the Tat⌬58 mutant is able to inhibit HIV repli- two-fold reduction in RT activity (280 c.p.m./100 ␮l for cation, as measured by p24 levels, by a factor of 10 000– Tat⌬53/Eng compared with 560 c.p.m./100 ␮l for control 25 000. In addition, while Tat⌬53 transfectants showed no pCD2-transfected cells) was detected at day 6. In contrast, inhibiting effects (and appeared to be potentiating Tat⌬53 showed no inhibiting activity at any day at an infection), Tat⌬53/Eng transfectants inhibited infection MOI of 0.001, but instead, increased HIV-1 replication during the first 16 days of culture. Approximately a 40- substantially. Thus, when HIV infection of Tat⌬53/Eng fold reduction of p24 production was observed at day transfectants is compared directly with Tat⌬53 cells as 16 when Tat⌬53/Eng transfectants were compared with the control, a 13- and two-fold reduction of HIV repli- Tat⌬53 cells. cation is observed at day 9 and day 12, respectively, sug- To test the efficiency of inhibition by the Tat mutants gesting that the Engrailed repressor domain is effective in further, CEM transfectants were challenged with higher inhibiting HIV replication even at high viral doses. Taken ⌬ doses of HIV-1IIIB/LAI; MOI 0.0002 (Figure 6b), MOI 0.001 together, these results demonstrate that both Tat 53/Eng (Figure 6c) and MOI 0.002 (Figure 6d). Tat⌬58 showed and Tat⌬58 inhibit HIV-1 replication in a viral dose- the greatest inhibiting effects, as measured by RT activity dependent manner. at all infective doses used. At an MOI of 0.0002, a 10- to 20-fold reduction in RT activity was obtained in super- Discussion natant of Tat⌬58 cells up to day 13. A five- to 10-fold inhibition of HIV replication was also found up to day The use of transdominants of the HIV-1 regulatory pro- 13 at an MOI of 0.001 and up to day 7 at an MOI of 0.002, tein Tat has been proposed as a possible therapeutic after which levels of RT approached the levels found in approach method for inhibition of HIV replication. In this control pCD2-transfected cells and control parental CEM study, we examined the ability of several Tat transdomi- populations, respectively. nant mutants with either amino acid substitutions in the Tat⌬53/Eng also showed inhibiting effects. At an MOI activation domain or with C-terminus truncations to of 0.0002, Tat⌬53/Eng-transfected cells could inhibit RT inhibit Tat-mediated transactivation or inhibition of HIV activity by a factor of four up to day 10 as compared with replication in human T cell lines. To increase the potential HIV inhibition using Tat mutants and repressor domain C Fraisier et al 951 transdominant inhibitory effects further and to test the RNAs, not all the transfected CEM cell populations used hypothesis that transcriptional repression can be targeted for HIV infection experiments express high levels of the to the HIV promoter, we also generated and examined mutant tat gene. Since the cells are uncloned drug-resist- the inhibiting effects of a fusion mutant between a trunc- ant populations, some of the transfected cells (those with ated Tat and the Drosophila Engrailed transcription lower levels of tat transdominant mutant transcription) repressor domain. may not be protected when challenged with increasing Out of the Tat mutants generated, only Tat with a doses of virus. As suggested by others,11,13 because Tat lysine to alanine substitution at position 41 (Tat41ala), Tat acts on the HIV-1 LTR in a positive feedback loop to C-terminus deletions (Tat⌬53 and Tat⌬58), and the increase its own expression, the amount of wild-type Tat Tat⌬53-Drosophila Engrailed repressor domain fusion protein synthesized during the course of infection may (Tat⌬53/Eng), did not transactivate HIV LTR-driven be sufficient to overcome the effects of the transdominant gene expression. Instead, these mutants showed a strong Tat mutant protein and thus avoid the complete inhi- transdominant phenotype, inhibiting wild-type Tat- bition of replication. Indeed, it has been recently reported mediated transactivation. Inhibition was specific and that high levels of transdominant RevM10 protein are dose-dependent. While two separate groups have required to inhibit HIV-1 replication.23 Future experi- described the transdominant phenotype of Tat41ala and ments will focus on the use of transfectant clones which Tat⌬53,1,2 we show by direct comparison that the newly may express higher levels of Tat transdominant mutant. generated C-terminus deletion mutant Tat⌬58 harboring Considering the possible mechanisms of inhibition, it the entire TAR-binding region, and the fusion mutant has been suggested previously that Tat⌬53 sequesters Tat⌬53/Eng act as the most effective dominant negative cellular factors in the cytoplasm which are necessary for proteins, followed by Tat⌬53 and Tat41ala. At a 1:1 wild- efficient viral transcription.3 Alternatively, inactive com- type to mutant ratio, Tat41ala and Tat⌬53 were able to plexes are formed between wild-type and Tat⌬53. In inhibit transactivation equally by 25%, while at a 1:5 addition to these mechanisms, our data suggest that ratio, Tat⌬53 inhibits slightly better (55%) than Tat41ala Tat⌬58 may act by competition with the wild-type pro- (45%). In contrast, Tat⌬58 yielded a 35% (1:1 ratio) and tein for binding to the TAR RNA sequence. While some 60% (1:5 ratio) decrease in transactivation compared with or all of these mechanisms may be operating, the fusion wild-type Tat. Overall, the fusion mutant Tat⌬53/Eng is of the Engrailed repressor domain to Tat⌬53 suggests the most potent inhibitor; inhibiting 70% of the wild-type action within the transcriptional complex itself. The Dro- Tat-mediated transactivation, Tat⌬53/Eng is 10% better sophila Engrailed protein has been described to compete than Tat⌬58 and 15% better than Tat⌬53 without the with the TATA-box binding protein transcription factor Engrailed domain. IID (TFIID) for binding to the TATA box,14 leading to a As a more rigorous investigation of the inhibitory transcription repression mechanism. Physical interactions properties of the transdominants, the Tat⌬53 and Tat⌬58, have also been demonstrated between Tat and the TATA- and Tat⌬53/Eng mutants were tested for the ability to binding protein (TBP) which is part of TFIID.24 The com- inhibit viral replication in vitro. Inhibition of HIV-1IIIB/LAI bination of these two mechanisms may then contribute replication was observed in CEM cells expressing Tat⌬58 to the enhanced inhibitory effect observed with the fusion in a viral dose-dependent manner. Tat⌬53/Eng also mutant Tat⌬53/Eng; the Tat mutant sequestering cellular showed an inhibiting effect at low viral doses when com- factors, particularly TFIID, and Engrailed blocking the pared with the CD2 vector control transfectants, but access of TFIID to the TATA box. Previously, an improve- failed to show any protection against HIV-1 when the ment of a Tat transdominant phenotype has been amount of input virus was increased, and rather than described for Tat22/37 and Tat37 mutants fused to the ¨ inhibiting HIV replication, Tat⌬53 potentiated viral pro- Kruppel-associated box repressor (KRAB).19 Taken duction by at least two-fold. Thus when Tat⌬53 is used together, these data support the hypothesis that chimeric as the control, Tat⌬53/Eng inhibits HIV replication in a proteins containing a virus-specific DNA or RNA-bind- dose-dependent manner. ing domain and a strong repressor domain may interfere In contrast to the results of the transactivation assays, with the expression of viral gene products in infected the inhibition of HIV replication was most efficient with cells.16–18 Therefore, the use of the Engrailed domain to the Tat⌬58 mutant. Tat⌬58 was able to inhibit HIV repli- enhance the inhibitory effect of transdominant Tat cation completely up to at least day 23 after infection at mutants may represent a novel strategy for inhibiting a low MOI. The lack of strong inhibition by Tat⌬53/Eng HIV-1 infection. is unexpected since a two-fold higher level of tat RNA is Successful inhibition of HIV infection has been found in the Tat⌬53/Eng than in the Tat⌬58 populations. reported in CD4+ cells from non-infected individuals It is possible that the intracellular localization of Tat transduced with vectors expressing Rev transdominant mutants varies in transiently transfected reporter cells as mutant RevM10,6,23 anti-tat ribozymes, tat antisense mol- compared with stable transfectants used for in vitro HIV ecules and TAR RNA decoys.25 Suppression of HIV repli- infection. Moreover, other viral or cellular proteins cation and prolonged survival was also observed in CD4+ present in human T cells and not in Hela reporter cells cells from HIV-positive subjects, ex vivo transduced with may affect Tat mutant localization and thus activity. anti-HIV genes expressing an anti-U5 ribozyme or the These differences in reporter assays versus inhibition of RevM10 transdominant mutant.26,27 Hence, to analyse HIV replication illustrate the necessity of testing mutants further the efficacy of the Tat mutants described, experi- in infection scenarios. ments should be carried out to determine whether Tat⌬58 From our results, it appears that at least a five-fold and Tat⌬53/Eng are protective against different labora- molar excess of the transdominant Tat mutant protein is tory and primary isolates of HIV-1, and whether they can necessary to markedly inhibit wild-type Tat-mediated inhibit HIV-1 infection in primary cells. Since macro- transactivation. As judged by detection of tat-specific phages serve as reservoirs for HIV-1 during the asympto- HIV inhibition using Tat mutants and repressor domain C Fraisier et al 952 matic phase of infection, Tat mutants need to be tested taining a BssHII site. The Engrailed (Eng) repressor against macrophage-tropic HIV-1 strains, which have domain was amplified using the 5Ј primer been shown to be the predominant type in primary iso- TTTGGCGCGCCCTGGAGGATCGCTGC containing a lates from HIV-infected patients. In fact, all the cells affec- BssHII site and the 3Ј primer (5Ј → 3Ј) CCGGAA ted by HIV-1 infection, including CD4+ T lymphocytes, TTCCTAGTTCAGGTCCTCCTC containing an EcoRI site macrophages, dendritic cells and central nervous system and a stop codon. The BssHII site allowed the direct in- (CNS) microglial cells, are derived from hematopoietic frame fusion between the two protein sequences. The stem cells. Therefore, gene transfer into pluripotent hem- Tat⌬53 and Engrailed fragments were inserted into the atopoietic stem cells would be a preferred strategy for EcoRI site of pSG5 and pCD2-puro vectors. achieving sustained immune reconstitution.28 Recent studies have shown that the bone marrow from HIV-1- Transient transfection experiments infected donors yielded CD34+ progenitor cells of suf- Transient transfections were performed with the Lipofec- ficient quality and quantity to be used as targets for gene tamine reagent (Gibco BRL, Life Technologies), according therapy.29 Thus, for combination stem cell therapy, the to the manufacturer’s instructions, using a Hela HIV- further development of the Tat⌬58 and Tat⌬53/Eng LTRhGH reporter cell line containing the human growth mutants may yield potent inhibitors against HIV-1 repli- hormone (hGH) gene under the control of the HIV LTR.20 cation for use in clinical applications. The level of Tat-mediated transactivation was assessed ` by RIA (Tandem HGH; Hybritech, Liege, Belgium) of the hGH protein in culture supernatant 72 h after transfec- Materials and methods tion. Transfection efficiency was monitored using a pCMVLacZ plasmid vector and values were normalised Cells and virus after spectrophotometric substrate detection.20 CEM and Jurkat cells were grown in RPMI 1640 (GIBCO BRL, Life Technologies, Paisley, UK) containing 5% heat- Electroporation of CEM cells inactivated fetal calf serum (FCS), and supplemented in CEM cells were washed twice with cold RPMI 1640 and ° 7 antibiotics and glutamine, at 37 C5%CO2. Hela reporter resuspended at 10 cell/ml in cold RPMI 1640. For each cells were grown in Dulbecco’s modified Eagle’s medium sample, cells were mixed with 20–30 ␮gofKpnI-lin- (DMEM; Gibco BRL)-10% FCS supplemented in anti- earized plasmid DNA and placed into disposable elec- ° biotics and glutamine, at 37 C5%CO2. troporation cuvettes (0.4 cm gap width, Bio-Rad, Rich- HIV-1IIIB/LAI strain was kindly provided by the MRC mond, CA, USA) for 10 min on ice. Electroporations were AIDS Reagent Project. Virus stocks were prepared by then performed with the Bio-Rad Gene Pulser at 500 ␮F infecting CEM cells. The virus titer of cell-free super- and 300 V for 20 ms. After electroporation the cells were natant from infected CEM cells was determined to be 106 maintained in the cuvettes for 10 min on ice and then tissue culture 50% infective dose (TCID50) per ml. transferred into 15 ml of RPMI 1640–15% FCS. Two days later, debris and dead cells were removed by density Generation of Tat mutants gradient (Lymphoprep, Nycomed Pharma AS, Oslo, Exon 1 of tat (wild-type Tat) was amplified by PCR from Norway) and viable cells were resuspended in RPMI pCMVTat (provided by Dr Edward Blair, Wellcome Lab- 1640–15% FCS containing 0.5 ␮g/ml puromycin (Sigma, oratories, Beckenham, UK), using the 5Ј primer GCT St Louis, MO, USA). CTAGAATTCATGGAGCCAGTAGATCC containing XbaI and EcoRI sites and the 3Ј primer (5Ј → 3Ј) CGGGAT RNA analysis CCAGATCTTTACTGCTTTGATTAGA containing BglII RNA samples were extracted with LiCl/Urea or RNA and BamHI sites and a stop codon. The wt-Tat fragment isolation reagent (Ultraspec, Biotecx Laboratories, Hous- was cloned into the EcoRI–BglII sites of the expression ton, TX, USA). To remove potentially contaminating vector pSG5 (Stratagene, La Jolla, CA, USA). Tat41ala and DNA, all the RNA samples were digested with DNase. Tat47ala fragments were generated by PCR and overlap- Fifty micrograms of RNA were mixed with 4 units of ping oligonucleotides introducing a substitution at pos- RNase-free DNase I (RQ1; Promega, Madison, WI, USA), ␮ itions 41 and 47, respectively, and cloned into the EcoRI 50 mm Tris pH 7.5, 10 mm MgCl2 in 200 l reaction, incu- site of pSG5 vector. Tat⌬53 was obtained using the 5Ј bated at 37°C for 30 min. DNase-treated RNA was primer for wt-Tat and the 3Ј primers (5Ј → 3Ј) CGGGATC reverse transcribed. Two micrograms of RNA were incu- CAGATCTTTATCTCCGCTTCTTCCTGC containing BglII bated with 1 ␮l of oligo(dT) in 20 ␮l reaction, incubated and BamHI sites, or CGGAATTCTTATCTCCGCTTC at 100°C for 2 min and stored on ice. Ten microliters of TTCCTGC containing an EcoRI site. Both 3Ј primers have the reaction were reverse transcribed in the presence of been designed to introduce a stop codon at position 54. reverse transcriptase (RT) buffer (Enzyme Biotechnolog- Tat⌬53 was cloned into EcoRI–BglII sites of pSG5 vector, ies, Cambridge, UK), 1 mm dNTPs, 0.5 ␮l (28 900 U/ml) and the EcoRI site of the human CD2 expression vector RNA guard (Pharmacia), 1 ␮l (21 U/␮l) RT (Enzyme (pCD2 vector) (a gift from Dr D Kioussis, NIMR, London, Biotechnologies) in 20 ␮l reaction, incubated at 37°C for UK). Tat⌬58 was amplified using the 5Ј primer above and 90 min and stored at −20°C before PCR. Control reactions the 3Ј primer (5Ј → 3Ј) CGGGATCCAGATCTGAAT lacking RT were performed to confirm that contaminat- TCTTAAGCTCTTCGTCGCTGTCT containing BamHI, ing DNA was eliminated by DNase treatment. BglII and EcoRI sites. Tat⌬58 was cloned into the EcoRI For semiquantitative RT-PCR, three two-fold (Tat) and site of pSG5 and pCD2-puro vectors. The fusion mutant four four-fold (␤-actin) diluted cDNA samples were Tat⌬53/Eng was generated as follows: the Tat⌬53 frag- amplified. A 50 ␮l reaction mixture containing 1 ␮l Ј Ј ␮ ment was obtained using the 5 primer above and the 3 cDNA, 10 l PCR buffer (Tris-HCl 300 mm,NH4SO4 75 Ј → Ј ␮ primer (5 3 ) TTTCGCGCGCCGCTTCTTCCTGC con- mm, MgCl2 17.5 mm, pH 9.5) for Tat primers or 5 l HIV inhibition using Tat mutants and repressor domain C Fraisier et al 953 virus long terminal repeat. Proc Natl Acad Sci USA 1990; 87: Table 1 Sequences of oligonucleotide primers used for RT-PCR 5079–5083. ¨ 2 Green M, Ishimo M, Loewenstein PM. Mutational analysis of Tat primers HIV-1 Tat minimal domain peptides: identification of trans- Tat-S1 (+)5Ј atg gag cca gta gat cct ag 3Ј − Ј Ј dominant mutants that suppress HIV LTR-driven gene Tat-AS53( )5ctc cgc ttc ttc ctg cca t 3 expression. Cell 1989; 58: 215–223. Human ␤-actin 3 Modesti N et al. Trans-dominant Tat mutants with alterations primers in the basic domain inhibit HIV-1 gene expression. New Biol ␤-ACTIN 1 (+)5Ј atg gat gat gat atc gcc gc 3Ј 1991; 3: 759–768. ␤-ACTIN 2 (−)5Ј gcg ctc ggt gag gat ctt 3Ј 4 Malim MH et al. Stable expression of transdominant Rev protein in human T-cells inhibits human immunodeficiency virus replication. J Exp Med 1992; 176: 1197–1201. 5 Ragheb JA et al. Analysis of trans-dominant mutants of the HIV SuperTaq buffer (Enzyme Biotechnologies) for type 1 Rev protein for their ability to inhibit Rev function, HIV ␤-actin primers, 200 mm dNTPs, 0.1 unit SuperTaq type 1 replication, and their use as anti-HIV gene therapeutics. AIDS Res Hum Retrovir 1995; 11: 1343–1353. (Enzyme Biotechnologies) polymerase and 200 ng each 6 Vandendriessche T et al. Inhibition of clinical human immuno- appropriate primer (Table 1) was used for amplification + ° ° ° deficiency virus (HIV) type 1 isolates in primary CD4 T lym- as follows: 94 C 3 min one cycle; 94 C30s,58C30s, phocytes by retroviral vectors expressing anti-HIV genes. J Virol 72°C 45 s, 40 cycles; and 72°C 10 min one cycle. RT-PCR 1995; 69: 4045–4052. products were electrophoresed on 3% agarose gels and 7 Trono D, Feinberg M, Baltimore D. HIV-1 gag mutants can analyzed by Southern blot hybridization using a nylon dominantly interfere with the replication of the wild-type virus. membrane (Hybond-N+, Amersham International PLC, Cell 1989; 59: 113–120. Amersham, UK). Tat and ␤-actin DNA probes were 32P- 8 Caputo A et al. The tat gene and protein of the human immuno- labeled by random priming method using Klenow deficiency virus type 1. Microbiol 1995; 18: 87–100. enzyme (Boehringer Mannheim, Mannheim, Germany) 9 Frankel AD, Biancalana S, Hudson D. Activity of synthetic pep- ␣ 32 tides from the Tat protein of human immunodeficiency virus and - P-dATP (Amersham). Relative levels of Tat type 1. Proc Natl Acad Sci USA 1989; 86: 7397–7401. RNAs were quantified by Phosphorimager (Molecular ␤ 10 Caputo A et al. Inhibition of HIV-1 replication and reactivation Dynamics) analysis and normalized to the -actin from latency by tat transdominant negative mutants in the cyst- internal control. The dilutions of cDNA were determined eine rich region. Gene Therapy 1996; 3: 235–245. so that quantification values after hybridization fell 11 Ulich C et al. Inhibition of human immunodeficiency virus type within a linear range. 1 replication is enhanced by combination of transdominant Tat and Rev proteins. J Virol 1996; 70: 4871–4876. HIV-1 challenge 12 Aguilar-Cordova E et al. Inhibition of HIV-1 by a double trans- Control and stably transfected CEM cells were grown dominant fusion gene. Gene Therapy 1995; 2: 181–196. without puromycin at least 3 days before infection. The 13 Bahner I et al. Comparison of trans-dominant inhibitory mutant cells were challenged at 5 × 105 cell/ml with HIV-1 human immunodeficiency virus type 1 genes expressed by IIIB/LAI retroviral vectors in human T lymphocytes. J Virol 1993; 67: viral doses from 50 to 1000 TCID50/ml (MOI from 0.0001 ° 3199–3207. to 0.002) for 24 h at 37 C. Cells were washed, resus- 14 Ohkuma Y et al. Engrailed, a homeodomain protein, can repress pended in fresh medium and incubated in triplicate in in vitro transcription by competition with the TATA box-binding 12-well plates (1 ml per well). Cell-free supernatants were protein transcription factor IID. Proc Natl Acad Sci USA 1990; 87: collected every 3–4 days and tested for the presence of RT 2289–2293. activity or the presence of HIV-1 p24 core protein using a 15 Badiani P et al. Dominant interfering alleles define a role for c- commercial ELISA (Dupont, Boston, MA, USA). At the Myb in T cell development. Genes Dev 1994; 8: 770–782. time of sample collection, cells were counted and 16 Baltimore D. Intracellular immunization. Nature 1988; 335: replated in fresh medium at 5 × 105 cell/ml. 395–396. 17 Choo Y, Sanchez-Garcia I, Klug A. In vivo repression by a site- specific DNA-binding protein designed against an oncogenic Acknowledgements sequence. Nature 1994; 372: 642–645. 18 Pomerantz JL, Sharp PA, Pabo CO. Structure-based design of We thank Rod Daniels and Cherelyn Vella (NIMR, Lon- transcription factor. Science 1995; 267: 93–96. don, UK) for advice and assistance in HIV infection 19 Pengue G et al. Transcriptional silencing of human immuno- experiments, and the MRC AIDS reagent project for pro- deficiency virus type 1 long terminal repeat-driven gene ¨ viding the HIV-1IIIB/LAI strain. We also thank Edward expression by the Kruppel-associated box repressor domain tar- Blair (Wellcome Laboratories, Beckenham, UK) for geted to the transactivating response element. J Virol 1995; 69: pCMVTat, Dimitris Kioussis (NIMR, London, UK) for the 6577–6580. CD2 vectors, Kathy Weston (ICR, London, UK) for 20 Brady HJM et al. Specific ablation of HIV-Tat expressing cells Engrailed sequences, Alan Holmes for assistance in tissue by conditionally toxic retroviruses. Proc Natl Acad Sci USA 1994; culture work, Daniel Pennington, Hugh Brady, Dubravka 91: 365–369. 21 Greaves DR et al. Human CD2 3Ј-flanking sequences confer high Drabek and other members of the laboratory for helpful level, T cell-specific, position-independent gene expression in discussions and advice. CF and MO were supported by transgenic mice. Cell 1989; 56: 979–986. a grant from Therexsys, DA by MRC AIDS Directed Pro- 22 Brady HJM et al. Altered cytokine expression in T lymphocytes gramme grant E30/518 and ED by MRC, UK. from human immunodeficiency virus Tat transgenic mice. J Virol 1995; 69: 7622–7629. References 23 Plavec I et al. High transdominant RevM10 protein levels are required to inhibit HIV-1 replication in cell lines and primary 1 Pearson L et al. A transdominant Tat mutant that inhibits Tat- T cells: implications for gene therapy of AIDS. Gene Therapy induced gene expression from the human immunodeficiency 1997; 4: 128–139. HIV inhibition using Tat mutants and repressor domain C Fraisier et al 954 24 Kashanshi F et al. Direct interaction of human TFIID with the 27 Woffendin C et al. Expression of a protective gene prolongs sur- HIV-1 trans-activator tat. Nature 1994; 367: 295–299. vival of T cells in human immunodeficiency virus-infected 25 Sun LQ et al. Resistance to human immunodeficiency virus type patients. Proc Natl Acad Sci USA 1996; 93: 2889–2894. 1 infection conferred by transduction of human peripheral blood 28 Yu M, Poeschla E, Wong-Staal F. Progress towards gene therapy lymphocytes with ribozyme, antisense, or polymeric trans-acti- for HIV infection. Gene Therapy 1994; 1: 13–26. vation response element constructs. Proc Natl Acad Sci USA 1995; 29 Kearns K et al. Suitability of bone marrow from HIV-1-infected 92: 7272–7276. donors for retrovirus-mediated gene transfer. Hum Gene Ther + 26 Leavitt MC et al. Ex vivo transduction and expansion of CD4 1997; 8: 301–311. lymphocytes from HIV+ donors: prelude to a ribozyme gene therapy trial. Gene Therapy 1996; 3: 599–606.