Gene Expression Profiling of Erbb Receptor and Ligand-Dependent

Gene expression proﬁling of ErbB receptor and ligand-dependent transcription

Dhara N Amin1,2,3, Archibald S Perkins2 and David F Stern*,2

1Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, CT 06510, USA; 2Department of Pathology, Yale University School of Medicine, PO Box 208023, New Haven, CT 06520-8023, USA

Overexpression of ErbB2 and ErbB4 receptors in breast lung (Yarden and Sliwkowski, 2001). ERBB2 is ampli- cancers may be accompanied by contrasting clinical fied in 15–30% of breast cancers, and its overexpression outcomes. To investigate the molecular mechanisms is associated with poor patient prognosis (Slamon et al., contributing to these differences,we undertook a com- 1987; Hynes and Stern, 1994). In contrast, ERBB4 parative study of gene expression regulated by the two overexpression is rare and its expression in breast cancer receptors. Agonistic antibodies were employed to activate may be associated with more favorable clinical out- ErbB2 and ErbB4 in isolation from the other ErbBs in comes and a differentiated tumor grade (Bacus et al., breast cancer cells. Gene expression profiling using a 1996; Srinivasan et al., 1997; Knowlden et al., 1998; 16 755-gene oligonucleotide array was performed to Vogt et al., 1998; Kew et al., 2000; Stern, 2000; Witton identify transcriptional targets of receptor activation. et al., 2003). Co-overexpression of ERBB4 with ERBB2 Our results indicate that,in the same cell line,ErbB2 and in mammary carcinoma is associated with a more ErbB4 activation influence gene transcription differen- favorable clinical outcome, than is overexpression of tially. Although there are genes that are regulated by ERBB2 alone (Suo et al., 2002). signaling from both receptors,there are also receptor- An oncogenic role for ERBB2, and a possible specific targets that are preferentially regulated by each anticarcinogenic function associated with ERBB4,is receptor. We further show that two ligands acting via the further suggested by in vitro studies. In tissue culture, same receptor homodimer may activate different subsets activation of ErbB2 is mainly associated with cellular of genes. Many of the induced genes are hitherto proliferation and transformation (DiFiore et al., 1987; unidentified targets of ErbB signaling. These include Muthuswamy et al., 2001; Penington et al., 2002). ErbB4 targets EPS15R,GATA4,and RAB2 and ErbB2- Cellular responses to ErbB4 activation vary across cell activated HRY/HES1 and PPAP2A. Targets of ErbB2 lines. While ErbB4 can support proliferation, DNA homodimer signaling may be especially important as synthesis, and transformation, in some mammary markers in breast cancer,where ErbB2 homodimerization epithelial cell lines, it induces growth arrest and mediated by overexpression and ligand-independent acti- differentiation (Chen et al., 1996; Cohen et al., 1996; vation is common. Sartor et al., 2001; Williams et al., 2003). Oncogene (2004) 23, 1428–1438. doi:10.1038/sj.onc.1207257 Furthermore, loss of ErbB2 and ErbB4 in the Published online 1 December 2003 mammary gland is associated with different developmental phenotypes, with a requirement for ErbB2 in Keywords: ErbB; HER-2; breast cancer; microarray; ductal outgrowth during puberty (Amy Jackson-Fisher/ immediate early genes DF Stern unpublished), and ErbB4 in ductal differentiation during late pregnancy and lactation (Tidcombe et al., 2003). These phenotypic differences between the two receptors during normal development and in Introduction carcinogenesis suggest differences in the signaling pathways coupled to the two receptors. The ErbB family of receptor tyrosine kinases (RTKs) Differential ErbB-driven signals can be achieved at consists of four members: ErbB1 (EGFR, HER), ErbB2 several steps. Multiple growth factors activate one or (Neu, HER2), ErbB3 (HER3), and ErbB4 (HER4). more of these receptors (Riese and Stern, 1998). Ligand- Anomalous expression and/or activation of these activated receptors form homo- as well as heterodimeric receptors is observed in cancers of the breast, ovaries, complexes with other ErbBs, thereby enabling the nervous system, prostate, bladder, colon, head neck, and activation of a non-ligand-binding receptor. A hierarchy of dimerization combination preferences exists, in which ErbB2 is the favored partner (Tzahar et al., 1996; *Correspondence: DF Stern; E-mail: [email protected] Graus-Porta et al., 1997). Each activated ErbB receptor 3Current address: Department of Surgical Research, Childrens Hospital, Boston, MA 02115 has a unique repertoire of Tyr phosphorylation sites that Received 21 August 2003; revised 26 September 2003; accepted 29 facilitate coupling to an overlapping, but a distinct set of September 2003 downstream signaling effectors (Olayioye et al., 2000; ErbB-regulated gene expression DN Amin et al 1429 Yarden and Sliwkowski, 2001). Thus, the activating ligand, the available ErbB receptors, and preferential partner choice will influence receptor combinations activated and the specific signals generated. A central question in signal transduction is how signal encoding occurs downstream of the various RTKs. For some RTKs, transcription profiling has been used to determine if differential activation of signaling pathways results in different combinations of transcriptional outputs. Surprisingly, some studies using this approach have concluded that the transcriptional response to RTK activation is qualitatively ‘generic’, and contains little receptor-specific information (Fambrough et al., 1999; Pawson and Saxton, 1999). However, pathway- specific mutations in the C. elegans EGFR result in distinct phenotypes (Lesa and Sternberg, 1997) and, in reconstructed systems, different combinations of ErbB receptors activate varying biological responses (Riese Figure 1 Activation of T47D cells with agonistic antibodies. (a) et al., 1995; Riese and Stern, 1998). Serum-starved T47D cells were stimulated with vehicle (mock), Since transcriptional outputs are an important ErbB4 Ab-1 (ErbB4Ab), ErbB2 Ab-6 (ErbB2Ab), or NRG for component of ErbB signaling, we determined if the 10 min at room temperature. Receptor-specific immunoprecipita- tions (IP) were performed and receptors were analysed by pattern of transcriptional changes depends on the immunoblotting (blot) with anti-phosphotyrosine (‘P-Tyr’). The identity of the ErbB receptor activated. The different filters were stripped and reprobed with receptor-specific antibodies biological activities of ErbB2 and ErbB4, and their to control for receptor loading (‘receptor’). (b) Anchorage- clinical importance, made a comparative study of independent growth of T47D cells incubated in vehicle (mock), NRG or ErbB4Ab for 2 weeks was measured. The fold increase in transcriptional targets of these two receptors particu- colony formation compared to mock is shown. Error bars represent larly attractive. Several studies have reported transcrip- s.e.m. from triplicate treatments. (c) Growth of T47D cells treated tion profiles associated with overexpressed and/or with ErbB2Ab and ErbB4Ab was compared with mock-treated activated ErbB2 (Oh et al., 1999; Wilson et al., cells using the MTT assay. The relative number of viable cells was 2002; Andrechek et al., 2003; Kumar-Sinha et al., determined by spectophotometry and the resultant OD (595 nm) for the three treatments is shown with error bars representing s.e.m. 2003; Mackay et al., 2003). Here, we compare the from triplicate treatments effects of acute activation of ErbB2 and ErbB4, using agonistic antibodies to forestall coactivation of other ErbBs. antibodies did not crossactivate heterologous ErbBs (data not shown). We next determined whether signaling induced by Results agonist antibody treatment of T47D cells is coupled to a biological response. Ribozyme-mediated downregula- Agonistic antibodies activate homologous receptors and tion of ErbB4 in T47D cells reduces colony growth in affect cellular growth soft agar assays (Tang et al., 1999). Consistent with this finding, ErbB4Ab treatment enhanced anchorage-inde- Most mammary epithelial cell lines express multiple pendent colony formation to the same extent as NRG ErbB receptors. Activating a single type of ErbB in (NRG 2.7-fold; ErbB4Ab 2.9-fold) (Figure 1b). In mammary epithelial cells with physiological ligands is monolayer culture, the ErbB4Ab inhibited cell growth, not possible, owing to the ability of these receptors to whereas ErbB2Ab, at the same concentration, induced heterodimerize. As an alternative, we employed agonis- proliferation (24% growth inhibition versus 8% growth tic monoclonal antibodies to promote receptor homo- induction; Figure 1c), suggesting differences in the dimers. Agonistic ErbB4 antibody (ErbB4Ab) H77.1 biological response associated with the two receptors. promotes weak differentiation of MCF7 cells (Chen et al., 1996). The ErbB2 agonistic antibody (ErbB2Ab) ErbB4 and ErbB2 homodimers regulate target genes N28 potentiates tumor growth in vivo (Stancovski et al., differentially 1991). The human mammary carcinoma cell line T47D In order to determine the pattern of receptor-activated expresses moderate levels of all the four ErbB receptors gene expression, cDNA preparations from T47D cells (Graus-Porta et al., 1995). ErbB4Ab and ErbB2Ab stimulated with ErbB4Ab or ErbB2Ab were compared treatment of T47D cells induced tyrosine phosphoryla- with those from mock-treated cells. Transcription was tion of the respective receptors (Figure 1a, upper panel, evaluated 1-h post treatment, since pilot studies and compare lanes 3 with 1 and 5 with 4). ErbB4Ab earlier growth factor-profiling work indicated this as an activated ErbB4 comparably to levels of NRG near optimal time point for detecting changes in immediate saturation for receptor phosphorylation (Figure 1a, early genes (IEGs) (Fambrough et al., 1999; Perou et al., upper panel, compare lanes 2 and 3). The agonistic 1999; Sweeney et al., 2001). The labeled cDNA was

Oncogene ErbB-regulated gene expression DN Amin et al 1430 hybridized to a 16 755-gene human oligonucleotide as being upregulated if the geometric means from three array (OHU16.7K). A gene was considered to be independent experiments showed transcript changes regulated if the geometric mean of ratios for experi- greater than 1.4-fold (a cutoff based on greater than mental versus control, for three independent repeats of 95% significance interval). Table 2 lists the top 20 genes the experiment, was greater than 1.8-fold. This cutoff upregulated by each of the three ErbB4 agonists reflects a greater than 95% significance interval for the (complete list of regulated genes available as supple- fold changes. mental data, Table S3). Although, there were genes In all, 2.7% (456/16755) of the genes on the upregulated by both NRG and HB-EGF (shown in OHU16.7K array were scored as being upregulated bold), transcription of genes such as Endoglin and Rho with ErbB4Ab activation of T47D cells. ErbB2Ab GAP9 was elevated to a greater extent with HB-EGF treatment enhanced expression of 2.06% (348/16755) than with NRG (Table 2). ErbB4Ab treatment of of the assayed genes compared to mock treatment. A SUM44 cells also resulted in overlapping, but different complete list of genes upregulated by the two treatments sets of regulated genes compared to transcripts induced is provided as supplemental data (Table S1). Activation by NRG. of the two receptors yielded different gene expression It is possible that the ligand-dependent differences in profiles. A total of 248 genes were upregulated by more gene-expression profiles observed in the SUM44 cells than 1.8-fold upon activation with both of the agonistic arise from differential homo- versus heterodimer signal- antibodies. For the purpose of comparison, genes ing linked to HB-EGF and NRG, respectively (Sartor were considered to be preferentially regulated by one et al., 2001). Alternatively, the differences in gene receptor if their transcripts changed by greater than expression could be a result of different levels of 1.8-fold with activation of one receptor and less than receptor phosphorylation induced by the two agonists 1.4-fold with activation of the other receptor. In all, 40 (Figure 2a). To address these possibilities, we analysed genes were preferentially elevated by ErbB4 homodi- human CEM/4 cells, a lymphoid line engineered to merization, and 15 genes showed a bias towards express ErbB4 in the absence of other ErbBs (Plowman upregulation by ErbB2Ab (Table 1). Analyses from et al., 1993). Both NRG and ErbB4Ab induced similar similar experiments performed using a 4600-gene cDNA levels of tyrosine phosphorylation of ErbB4 (Figure 2b). microarray also revealed differential gene regulation Hu4.6K cDNA arrays were used to analyse gene by agonistic antibodies for the two receptors (data not expression regulated by NRG and ErbB4Ab ligated to shown). ErbB4 homomers. The top 20 genes upregulated by the Altogether, 0.07% (12/16755) and 0.23% (41/16755) two treatments are reported in Table 3 (complete list of of genes showed decreases in transcript level with ErbB4 upregulated genes available as supplemental data, or ErbB2 activation, respectively (complete lists are Table S4). The top 20 genes upregulated by the two in Supplemental Data, Table S2). Once again, the ErbB4 agonists have only five genes in common (shown two agonistic antibodies downregulated individual genes in bold). Hence, two different ligands activating a single to different extents. ErbB2Ab treatment favored type of ErbB receptor can influence gene transcription decreases in transcript levels for genes including differentially. phosphatidic acid phosphatase 2A (PPAP2A) and laminin b1, whereas ErbB4Ab had greater effects Validation of microarray results on genes including AMP-activated protein kinase and H-cadherin. ErbB-induced gene regulation resulted in Microarray analyses are susceptible to artifacts arising fewer decreases than increases in transcript levels, from mechanical arraying problems, handling errors, consistent with the expression profile analyses of other annotation problems, and, in the case of cDNA arrays, RTKs (Dupont et al., 2001; Sweeney et al., 2001; clone mixtures or chimeric clones. Results from Mulligan et al., 2002). sequence verification of a subset of clones spotted on the Hu4.6K cDNA arrays are provided as supple- Ligand identity can influence gene transcription mental data (Table S5). Our error rate of 27% for misidentified clones on the Hu4.6K cDNA array was Two ErbB ligands, NRG1b and NRG2b, acting via a within the range of previously reported error rates of ErbB2 : 3 heteromer yield different gene-expression 20–38% (Ross et al., 2000; Halgren et al., 2001; Taylor profiles (Sweeney et al., 2001). We wished to determine et al., 2001). whether different ligands acting via the same receptor Changes in transcript levels for a subset of candidate could influence the expression of different genes. We genes identified from the oligonucleotide microarray addressed this question first in SUM44 breast carcinoma analyses were measured by quantitative reverse tran- cells, which express ErbB2, ErbB3, and ErbB4 (Sartor scriptase–polymerase chain reaction (QRT–PCR). Two et al., 2001). In these cells, both NRG and HB-EGF genes, RAB2 and EPS15R (identified in Table 1 in increase ErbB4 phosphorylation, but the latter induces bold), which were scored as being preferentially induced weaker receptor activation (Figure 2a, compare lanes 2 by ErbB4Ab treatment, were assayed by QRT–PCR as and 3 with 1). Gene-expression profiling of SUM44 cells was GATA4, which was induced by 1.78-fold upon treated with these two natural agonists and the ErbB4 ErbB4Ab treatment of T47D cells. The QRT–PCR agonistic antibody was performed using a 4600-gene results confirmed the preferential induction of these cDNA array (Hu4.6K cDNA array). Genes were scored genes through ErbB4 signaling (Figure 3, upper panel).

Oncogene ErbB-regulated gene expression DN Amin et al 1431 Table 1 Genes preferentially induced by ErbB4Ab or ErbB2Ab treatment of T47D cells determined using OHU16.7K arraysa Description GenBank ID Symbol ErbB4Ab ratio ErbB2Ab ratio

Genes preferentially upregulated by ErbB4Ab Hypothetical protein FLJ10057 AK000919 FLJ10057 2.39 1.4 X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound AL023653 2.32 1.27 Human DNA from chromosome 19-specific cosmid F25965, genomic sequence AC002398 2.29 1.33 Homo sapiens, clone IMAGE:3542716, mRNA, partial cds BC004918 2.24 0.91 Human DNA sequence from clone RP5-968J1 on chromosome 20 AL121760 2.22 1.39 Thyrotropin-releasing hormone NM_007117 TRH 2.14 1.32 Homo sapiens, similar to inositol 1,3,4-triphosphate 5/6 kinase BC003622 ITPK1 2.12 1.39 Homo sapiens cDNA FLJ12260 fis, clone MAMMA1001551 AK022322 RBAF600 2.1 1.14 Hypothetical SBBI03 protein AF077599 SBB103 2.08 1.23 Hypothetical protein FLJ20207 AK000214 FLJ20207 2.05 1.37 Chitinase 3-like 1 (cartilage glycoprotein-39) Y08374 2.03 1.4 Homo sapiens HSPC078 mRNA, partial cds AF161341 LOC284367 2.02 1.32 Clone FLB3816 NM_016415 2.01 1.4 Homeo box D12 NM_021193 HOXD12 2.01 1.08 G protein-coupled receptor, family C, group 5, member D NM_018654 GPRC5D 1.97 1.39 RAB2, member RAS oncogene family AL137321 RAB2 1.95 1.36 Homo sapiens mRNA; cDNA DKFZp547I094 (from clone DKFZp547I094) AL442096 DKFZp547I094 1.95 1.38 V-ros avian UR2 sarcoma virus oncogene homolog 1 M34353 ROS1 1.93 1.36 Calpain 5 U94346 CAPN5 1.92 1.16 Mitogen-activated protein kinase 4 X59727 MAPK4 1.9 1.39 Chemokine (C-C motif) receptor 1 D10925 CCR1 1.89 1.4 Human DNA sequence from clone U240C2 on chromosome X Z73497 1.89 1.31 Olfactory receptor, family 7, subfamily C, member 1 AC005255 1.88 1.38 Homo sapiens chromosome 19, cosmid R31343 AC005764 1.88 1.21 Phospholipid transfer protein L26232 PLTP 1.88 1.21 Homo sapiens mRNA; cDNA DKFZp434E0535 AL122070 1.87 1.31 Epididymis-specific, whey-acidic protein type, four-disulfide core; X63187 WFDC2 1.87 1.33 Phosphodiesterase 3B, cGMP-inhibited NM_000922 PDE3B 1.86 1.28 Taste receptor, type 2, member 7 AF227133 1.85 1.27 5,10-methylenetetrahydrofolate reductase (NADPH) AJ237672 MTHFR 1.85 1.21 Zinc-finger protein Cezanne AL122102 CEZANNE 1.85 1.34 Gamma-aminobutyric acid (GABA) A receptor, alpha NM_000806 GABRA1 1.85 1.14 Epidermal growth factor receptor substrate AL110270 EPS15R 1.84 1.2 KIAA1130 protein AB032956 KIAA1130 1.83 1.25 Indoleamine-pyrrole 2,3 dioxygenase M34455 INDO 1.83 1.21 Wiskott–Aldrich syndrome (eczema-thrombocytopenia) U12707 WAS 1.83 1.39 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 D87465 SPOCK2 1.82 1.27 CMRF35 leukocyte immunoglobulin-like receptor X66171 CMRF35 1.82 1.37 Calsyntenin-2 NM_022131 CLSTN2 1.81 1.39 Human clone 23614 mRNA sequence U79265 LOC146712 1.8 1.38

Genes preferentially upregulated by ErbB2Ab Butyrate response factor 1 (EGF-response factor 1) X79067 BRF1 1.36 2.15 Hypothetical protein PRO1728 NM_018505 PRO1728 1.35 2.08 Hypothetical protein FLJ10786 AK001648 FLJ10786 1.23 2.06 Platelet-derived growth factor alpha polypeptide X06374 PDGFA 1.38 1.97 Homo sapiens glutamate receptor, metabotropic 2 (GRM2), mRNA XM_003207 1.3 1.85 Casein, beta AF027807 CSN2 1.22 1.85 Human DNA sequence from clone RP5-1153D9 on chromosome 20 AL109806 1.4 1.84 Claudin 4 AB000712 CLDN4 1.14 1.84 Hairy (Drosophila)-homolog NM_005524 HES1 1.16 1.83 Glucose-6-phosphatase, catalytic (glycogen storage disease type I, v U01120 G6PC 1.4 1.81 Nedd4-binding protein 3 AB002339 N4BP3 1.36 1.81 Homo sapiens mRNA; cDNA DKFZp586K1721 (from clone DKFZp586K1721) AL137569 1.27 1.81 Homo sapiens (clone B3B3E13) Huntington’s disease candidate region L37198 1.27 1.81 Hypothetical protein FLJ10312 AB037735 FLJ10312 1.37 1.8 Homo sapiens mRNA; cDNA DKFZp564N2163 AL117606 1.35 1.8 aGenes were scored as being preferentially upregulated by a receptor if they were induced greater than 1.8-fold by one receptor and less than 1.4- fold by the other receptor. Genes in bold were assayed for transcript changes by QRT–PCR

HRY (identified in Table 1 in bold) and PPAP2A, QRT–PCR did not result in identical quantitative which were preferentially up- and downregulated by changes, the profile of gene regulation tracked quali- ErbB2Ab, respectively, were also confirmed by QRT– tatively between the two assays. This observation PCR as being specific to ErbB2 activation (Figure 3, is consistent with other reports comparing the two lower panel). Although the array-based profiling and techniques (Chuaqui et al., 2002).

Oncogene ErbB-regulated gene expression DN Amin et al 1432 cleavage have different requirements for PKC signaling (Pupa et al., 1993; Vecchi et al., 1996). It is plausible that differences in ErbB2 and ErbB4 internalization and cleavage may influence the potency and duration of effector pathways (Lenferink et al., 1998; Waterman et al., 1998). Interactions of the ErbBs with distinct signaling molecules can occur through differences in autophosphorylation sites and via distinct subcellular localization of the signaling receptors (Olayioye et al., 2000; Yarden and Sliwkowski, 2001; Zhou and Figure 2 Phosphorylation of ErbB4 after treatment with various Carpenter, 2002). ligands. (a) ErbB4 was immunoprecipitated from Sum44 cells that Our data further indicate that the activating ligand is had been mock stimulated or incubated with NRG or HB-EGF. able to modulate the signaling from a single ErbB The phosphotyrosine content of ErbB4 was determined by receptor type. In CEM/4 cells, activation of ErbB4 immunoblotting with anti-phosphotyrosine (‘P-Tyr’) antibody, homodimers by different ligands leads to qualitative and ErbB4 expression was determined by stripping and reprobing the blots with anti-ErbB4 antibodies. (b) CEM/4 cells, stimulated differences in the phosphorylation of the receptor and with vehicle, NRG, or ErbB4Ab were subjected to similar analysis coupling to downstream targets (Sweeney et al., 2000). Using the same cell line, we found that two ligands, NRG and ErbB4Ab, activating ErbB4 to a similar extent, can differently influence transcriptional out- Discussion comes. Activation of one receptor combination with different ligands not only couples the receptors to We have performed a comparative analysis of ErbB2- distinct biochemical pathways, but also elicits varying and ErbB4-regulated transcription targets in breast cellular outcomes, supporting the possibility that the cancer cells. Agonistic antibodies were used to specifi- differences in gene expression observed in our study may cally activate endogeneous ErbB2 and ErbB4 in T47D have functional significance (Hobbs et al., 2002). For cells. Transcriptional profiling of the ensuing responses example, multiple EGFR ligands show temporal overlap identified regulated expression of novel targets of ErbB in their expression patterns during mouse mammary activation. We found, using this global gene-expression gland development (Schroeder and Lee, 1998). Our monitoring system, that activation of two different ErbB results suggest that, instead of playing redundant roles, receptors in the same cell line can differentially influence individual agonists may be responsible for initiating gene transcription. Furthermore, we demonstrate that unique molecular programs that then dictate specific two different ligands activating the same receptor can cellular outcomes. Examples of ligand-dependent qua- have a distinct impact on transcriptional outcome. litative differences in gene regulation are also observed Earlier work by Fambrough et al. (1999) indicated outside the RTK superfamily between interferon b1 that activation of platelet-derived growth factor recep- and interferon a2a, which engage a common receptor tor (PDGFR), fibroblast growth factor receptor, or (da Silva et al., 2002). EGFR resulted in nearly identical patterns of gene Mutational analysis of the juxtamembrane region of regulation. More recently, it has been shown that insulin the extracellular domain of ErbB2 suggests that receptor and insulin-like growth factor receptor-1 transformation by the constitutively dimerized receptors regulate an overlapping but distinct group of genes occurs only when they are complexed in specific (Dupont et al., 2001, 2003; Mulligan et al., 2002). geometric configurations (Burke and Stern, 1998). Since Similar results have now been observed between TGFb binding of EGF agonists dramatically alters the receptors, ALK1 and ALK5, and two isoforms of the conformation of the EGFR (Ferguson et al., 2003), it progesterone receptor (Ota et al., 2002; Richer et al., is quite possible that there are agonist-associated 2002). Within the ErbB family, overexpression of specificities in EGFR conformation or equilibrium individual types of ErbBs also results in receptor-specific between inactive and active forms. This could influence gene expression (Alaoui-Jamali et al., 2003). The results phosphorylation site selection that would differentially presented here, that ErbB2 and ErbB4 preferentially influence substrate selection and/or subcellular localiza- regulate distinct targets, supports a model of receptor- tion and turnover (Decker, 1990). dependent signaling specificity. We also observed differential gene-expression profiles Receptor-generated specificity within the ErbB family regulated by NRG, HB-EGF, and ErbB4Ab activation may be achieved by modulating the potency and of ErbB4 in SUM44 breast cancer cells. Our CEM/4 duration of signaling, or by activating qualitatively data suggest that the differences may be accounted different signaling pathways (Marshall, 1995). NRG for by ligand-driven specificity. In this study, receptors and EGF, acting via different ErbB receptor combina- were activated with high doses of ligands that yielded tions, signal through the MAPK, p38, PKC, and PI3K similar levels of receptor phosphorylation, so we did pathways with different strengths and kinetics (Sweeney not evaluate the impact of different levels of receptor et al., 2001; Neve et al., 2002). ErbB1 endocytosis occurs activation on transcriptional output. The weaker much more rapidly than endocytosis of the other ErbB receptor activation elicited by HB-EGF in SUM44 receptors (Baulida et al., 1996). ErbB2 and ErbB4 cells compared to NRG induction may contribute to

Oncogene ErbB-regulated gene expression DN Amin et al 1433 Table 2 Top 20 genes upregulated upon NRG, HB-EGF, and ErbB4Ab treatment of Sum44 cells determined using Hu4.6K cDNA arraysa Name GenBank ID Symbol NRG ratio HB-EGF ratio ErbB4Ab ratio

Genes upregulated by NRG FBJ murine osteosarcoma viral oncogene B T62179 FOSB 14.83 1.67 0.89 Activating transcription factor 3 H21041 ATF3 11.96 1.65 1.01 Early growth response 1 EGR1 6.9 2.77 1.01 isovaleryl Coenzyme A dehydrogenase AA464149 IVD 6 1.54 1.16 Homo sapiens Cri-du-chat region mRNA H14816 5.35 1.1 0.92 Serum response factor AA487973 3.86 1.61 1.13 v-jun avian sarcoma virus 17 oncogene homolog W96134 JUN 3.78 1.26 1.06 Connective tissue growth factor AA598794 CTGF 3.61 0.96 0.89 SRY (sex-determining region Y)-box 2 AA451892 SOX2 3.41 1.2 1.13 Cullin 1 AA486790 CUL1 3.24 0.98 0.94 Kallmann syndrome 1 sequence H17882 3.15 1.26 0.94 Ectonucleoside triphosphate diphosphohydrolase 1 H13577 ENTPD1 3.07 1.28 1.13 Low-density lipoprotein receptor AA504461 LDLR 3.04 1.33 1.08 ras homolog gene family, member B AA495846 2.91 1.09 1.02 actinin, alpha 3 AA196000 ACTN3 2.82 1.16 0.96 sialyltransferase 1 AA598652 SIAT1 2.81 1.12 1.13 Myeloid cell leukemia sequence 1 (BCL2-related) AA488674 MCL1 2.76 0.94 0.78 Acetyl-coenzyme A acetyltransferase 2 R25823 ACAT2 2.69 0.99 0.97 Dual-speciﬁcity phosphatase 5 W65461 DUSP5 2.68 1.3 1.02 jun B proto-oncogene T99236 2.46 0.98 0.92

Genes upregulated by HB-EGF Early growth response 1 EGR1 6.9 2.77 1.01 Polymerase (RNA) II (DNA directed) polypeptide C (33 kDa) AA430656 POLR2C 2.06 2.43 1.45 Pre-alpha (globulin) inhibitor,H3 polypeptide T68035 ITIH3 1.94 2.04 1.63 Homo sapiens cDNA FLJ20144 ﬁs H71812 1.69 2 1.19 Intersectin (SH3 domain protein 1A) AA496795 ITSN1 1.63 1.82 2.11 Histone deacetylase 3 AA064973 1.96 1.75 1.64 FBJ murine osteosarcoma viral oncogene B T62179 FOSB 14.83 1.67 0.89 Activating transcription factor 3 H21041 ATF3 11.96 1.65 1.01 CUG triplet repeat,RNA-binding protein 1 R15111 CUGBP1 1.89 1.64 1.13 Serum response factor AA487973 3.86 1.61 1.13 HP1-BP74 T84669 HP1-BP74 1.88 1.61 1.24 Protein phosphatase 4,regulatory subunit 1 T62804 PPP4R1 2.16 1.58 1.42 Isovaleryl coenzyme A dehydrogenase AA464149 IVD 6 1.54 1.16 FK506-binding protein 1B (12.6 kDa) R08266 FKBP1B 1.5 1.53 1.48 Homo sapiens clone IMAGE:110582 T90074 0.94 1.5 1.49 KIAA1691 protein N78076 KIAA1691 1.4 1.49 1.41 IQ motif containing GTPase activating protein 2 W32272 IQGAP2 1.36 1.48 1.12 Rho GTPase activating protein 9 R06851 ARHGAP9 1.31 1.47 1.6 Endoglin (Osler–Rendu–Weber syndrome 1) AA446108 ENG 0.82 1.44 1.6 Homo sapiens clone 24828 mRNA sequence H51336 LOC57795 1.11 1.43 1.15

Genes upregulated by ErbB4Ab ESTs R09284 1.32 1.38 1.62 Endoglin (Osler–Rendu–Weber syndrome 1) AA446108 ENG 0.82 1.44 1.6 Rho GTPase activating protein 9 R06851 ARHGAP9 1.31 1.47 1.6 DNA segment on chromosome X (unique) 9879 AA480035 DXS9879E 1.29 1.35 1.6 Hypothetical protein MGC15416 H91631 MGC15416 1.22 1.19 1.58 GTF2I repeat domain containing 1 AA019591 GTF2IRD1 1.36 1.3 1.55 LOC147184 T70541 LOC147184 1.27 1.22 1.54 Proteasome subunit, beta type, 10 T53775 PSMB10 1.3 1.31 1.53 ESTs, weakly similar to line-1 protein ORF2 H51825 1.36 1.22 1.53 ESTs, moderately similar to E54024 protein kinase R01619 1.14 1.26 1.51 Transient receptor potential cation channel, V2 T71382 TRPV2 0.91 1.19 1.49 Hypothetical protein MGC16037 W74293 MGC16037 1.15 1.31 1.49 Homo sapiens clone IMAGE:110582 T90074 0.94 1.5 1.49 FK506-binding protein 1B (12.6 kDa) R08266 FKBP1B 1.5 1.53 1.48 CD3G antigen, gamma polypeptide T66800 1.27 1.41 1.48 ATPase, H+ transporting, lysosomal AA480826 ATP6V0B 1.1 1.23 1.46 UDP-galactose transporter related R41839 UGTREL1 1.33 1.29 1.46 Human clone 23627 mRNA, complete cds W95346 HSU79266 1.08 1.31 1.45 Hepsin (transmembrane protease, serine 1) H62162 HPN 1.1 1.2 1.45 Interferon, alpha-inducible protein AA448478 G1P3 1.01 1.05 1.44 aGenes were scored as being upregulated if their geometric mean ratio was greater than 1.4-fold. Genes shown in bold were upregulated in common with NRG treatment

Oncogene ErbB-regulated gene expression DN Amin et al 1434 Table 3 Top 20 genes upregulated with NRG and ErbB4Ab treatment of CEM4 cells, determined using Hu4.6K cDNA arraysa Description GenBank ID Symbol NRG ratio ErbB4Ab ratio

Genes upregulated by NRG Early growth response 1* EGR1 3.18 0.94 BTG family, member 3 N74741 BTG3 2.02 1.07 Homo sapiens cDNA FLJ37691 ﬁs, clone BRHIP2014387, highly N94245 1.65 0.92 similar to Human GT334 Junction plakoglobin R06417 JUP 1.51 1.09 Serine (or cysteine) proteinase inhibitor, clade B 6 AA410517 SERPINB6 1.51 1.39 Serum response factor AA487973 1.51 1.15 DNA segment on chromosome X (unique) 9879 AA480035 DXS9879E 1.47 1.57 Proteasome subunit, beta type, 10 T53775 PSMB10 1.45 1.58 Adenine phosphoribosyltransferase AA598510 APRT 1.44 1.52 Amyloid beta (A4) precursor protein-binding, family A3 W19429 APBA3 1.44 1.22 Homo sapiens, similar to hypothetical protein FLJ21394, clone R60807 1.44 1.24 MGC:23917 IMAGE:4770900 Protein kinase, AMP-activated, gamma 1 noncatalytic AA070381 PRKAG1 1.43 1.07 SRY (sex-determining region Y)-box 2 AA451892 SOX2 1.43 1.1 Ribosomal protein S14 H73727 RPS14 1.43 1.23 Cyclin-dependent kinase inhibitor 2D (p19) R77517 CDKN2D 1.42 1.4 jun D proto-oncogene AA418670 JUND 1.42 1.27 CD69 antigen (p60, early T-cell-activation antigen) AA279883 CD69 1.41 0.97 EST R08690 1.41 1 Hypothetical protein MGC16037 W74293 MGC16037 1.41 1.45 Sec61 gamma W96107 SEC61G 1.4 1.36

Genes upregulated by ErbB4Ab GTF2I repeat domain containing 1 AA019591 GTF2IRD1 0.97 1.93 CUG triplet repeat, RNA-binding protein 1 R15111 CUGBP1 1.12 1.61 Coxsackie virus and adenovirus receptor N31467 CXADR 1.05 1.6 Proteasome subunit,beta type,10 T53775 PSMB10 1.45 1.58 DNA segment on chromosome X (unique) 9879 AA480035 DXS9879E 1.47 1.57 Protein predicted by clone 23627 W95346 HSU79266 1.19 1.54 Metallothionein 1L N80129 MT1L 1.23 1.54 Adenine phosphoribosyltransferase AA598510 APRT 1.44 1.52 Tumor necrosis factor receptor superfamily, member 5 H98636 TNFRSF5 1.36 1.51 Ubiquinol-cytochrome c reductase (6.4 kDa) subunit R46837 UQCR 1.24 1.5 POP7 (processing of precursor, S. cerevisiae) homolog H71217 RPP20 1.32 1.5 ClpP caseinolytic protease, ATP-dependent, proteolytic W58658 CLPP 1.31 1.5 Peanut-like 1 (Drosophila) W24429 PNUTL1 1.34 1.5 Protein predicted by clone 23627 W95346 HSU79266 1.22 1.49 Yip1p-interacting factor H79466 YIF1P 1.36 1.49 UDP-galactose transporter related R41839 UGTREL1 1.2 1.46 Peroxiredoxin 5 N91311 PRDX5 1.29 1.46 Metallothionein 1H H77766 MT1H 1.14 1.45 Hypothetical protein MGC16037 W74293 MGC16037 1.41 1.45 Crystallin, alpha B AA504943 CRYAB 1.21 1.44

aGenes were scored as being upregulated if their geometric mean ratio was greater than 1.4-fold. Genes shown in bold were upregulated in common with NRG

differences in gene expression regulated by the two targets of homo- versus heterodimeric activation are ligands. especially intriguing in the case of ErbB2. In mammary HB-EGF activates homodimers of ErbB4 in SUM44 carcinoma, ERBB2 can be activated by multiple cells, whereas NRG can promote heteromers containing mechanisms, including overexpression, which will in- ErbB2, ErbB3, and ErbB4 (Sartor et al., 2001). Hence, duce ligand-independent homodimerization, and auto- differences arising from homomeric versus heteromeric crine activation through heterodimerization with other signaling may also contribute to distinct patterns of gene ErbBs (Stern, 2000). The results presented here suggest regulation (Olayioye et al., 1998). In fact, heterodimers that these different modes of activation may be of ErbBs overexpressed in NIH3T3 cells result in associated with differential regulation of signaling overlapping but distinct expression profiles from sin- pathways, which could influence the clinical outcomes. gle-receptor homodimers (Alaoui-Jamali et al., 2003). The differential response of T47D cells to agonist Our study mainly identified targets of ErbB4 and ErbB2 ErbB2 and ErbB4 antibodies parallels similar work homodimer activation. Although, ErbB signaling in vivo with growth factors (Figure 1, Sartor et al., 2001; generally includes formation of heterodimers (Gass- Penington et al., 2002; Williams et al., 2003). In these mann et al., 1995; Lee et al., 1995), ErbB4 homodimer experiments, receptor activation was at similar levels to signaling may be important during hindbrain develop- that observed with near saturating levels of NRG. ment (Tidcombe et al., 2003). Differences in signaling However, we cannot rule out the possibility that the

Oncogene ErbB-regulated gene expression DN Amin et al 1435 functional and transcriptional differences observed in et al., 2001; Hirata et al., 2002). Transcript levels for our experiments could be due to a stronger phosphor- the phosphatase PTPN6/SHP-1 are increased upon ylation of ErbB2 compared to that of ErbB4. However, ErbB2Ab treatment. SHP-1 levels are high in breast our data are in agreement with other studies reporting tumors and its expression is correlated with expression an antiproliferative response associated with ErbB4 of GRB2, a key mediator of ErbB2 signaling (Yip et al., activation in comparison to ErbB2 activation. 2000). A number of ErbB2 targets identified in this study are Since ErbB2 and ErbB4 regulate key morphogenetic abnormally expressed in tumors, making them good events in the developing mammary gland, we were also candidates for diagnostic and prognostic markers. An interested in identifying ErbB target genes with known increase in transcription of RNA encoding Claudin 4, a functions or regulated expression in mammary tissue tight-junction protein, is associated with ErbB2 homo- (Stern, 2003). ErbB2Ab induction of b-casein is dimerization. Increased Claudin 4 levels are observed in consistent with reduced levels of this milk protein in ovarian tumors compared to ovarian cystadenomas NRGa knockout mammary glands (Li et al., 2002), and (Rangel et al., 2003). Hairy drosophila homologue lactational differentiation defects in mice expressing (HRY/HES1) is a basic helix loop helix transcription dominant-negative ErbB2 (Jones and Stern, 1999). The factor that is a target of Notch signaling (Sasai et al., ErbB4 target CSF1R (encoded by c-fms) is expressed 1992; Ohtsuka et al., 1999). Notch1 expression is preferentially in mammary glands of pregnant and observed in breast tumors, but is minimal in normal lactating mice, coinciding with ErbB4 expression and breast tissue (Weijzen et al., 2002). Both EGF and NRG function (Sapi et al., 1998; Schroeder and Lee, 1998; induce HRY expression in breast tumor cells (Sweeney Jones et al., 1999). Mice homozygous for an inactivating mutation of CSF-1, the ligand for the CSF1R, display defects during lactation (Pollard and Hennighausen, 1994). Cezanne is a zinc-finger-binding protein that suppresses NF-kappa B transcription (Evans et al., 2001). In the developing mammary gland, NF-kappa B activation antagonizes Stat5-mediated b-casein induction (Geymayer and Doppler, 2000). Thus, an ErbB4- mediated increase in Cezanne transcript levels might potentiate Stat5 signaling in the mammary gland, which is regulated in part through ErbB4 (Jones et al., 1999). ErbB4 preferentially induced Rab2, a small G-protein, which promotes vesicle formation from pre-Golgi intermediates (Tisdale, 1999). It will be of interest to determine if ErbB4 induction of Rab2 influences milk secretion in the mammary gland, as has been proposed for NRG-induced milk secretion via Figure 3 Evaluation of microarray results by QRT–PCR. RNA transcriptional regulation of Rab3A (Vadlamudi et al., from T47D cells, mock-treated (‘mock’), or incubated with 2000). ErbB4Ab (4Ab), or ErbB2Ab (2Ab) was subjected to QRT–PCR This study is the first description of IEG targets of analyses. The genes analysed were determined by microarray analysis to be preferentially regulated by ErbB4 (upper panel) or endogenously expressed ErbB2 and ErbB4 activated ErbB2 (lower panel). For each gene, the black bars represent singly. We have identified candidate receptor targets relative transcript levels with mock set equal to 1.0, as measured by that may mediate ErbB-dependent morphogenesis of the QRT–PCR analysis. The error bars show s.e.m. from three mammary tissue. In addition, transcriptional regulation independent experiments. The white bars represent the geometric mean values of each transcript after treatment with the two by ErbB2 may be important in mammary carcinogen- agonistic antibodies as measured on the microarray, with mock set esis. Since signaling differences between these ErbBs and equal to 1.0 other receptor kinases may have important diagnostic

Table 4 Primers used for QRT–PCR Gene symbol Primer sequence

EPS15R 50 GCAGCGTCAGCAGCCTCAAC 30 50 CCACTCACGTAGCCATCCAG 30

GAPDH 50ACCACAGTCCATGCCATCAC 30 50 TCCACCACCCTGTTGCTGTA 30

GATA4 50 CCGCCCTGCATCCCTAATAC 30 50 CACCTGGGGGAGAAGTTGCC 30

HRY 50 GCCAGTTTGCTTTCCTCATT 30 50 GTTGGGGAGTTTAGGAGGAG 30

PAPP2A 50 CTCTTTCATTCTTTTCTACC 30 50 TAAGCCAGGGGGAATCAGAA 30

Rab2 50 TAATAATGAGGCAAATGGCA 30 50GAGAGGGGGTGAAAGAATAA 30

Oncogene ErbB-regulated gene expression DN Amin et al 1436 and therapeutic implications, and since receptor-direc- MTT assay ted drugs are under development or in clinical use, it will In total, 2 Â 103 cells/well were seeded in 96-well plates and be important to evaluate the activity of individual allowed to adhere overnight. Cells were either mock-treated or receptors in tumor biopsy specimens. One strategy relies treated with 10 mg/ml of the agonistic antibodies in media on receptor-specific phospho-antibodies. As an alter- containing 0.1% serum for 3 days. Each treatment was native approach, some of the gene targets identified here performed in triplicate. Cell growth was determined using may become useful as signature receptor-specific mar- the Cell Proliferation Kit 1 (Roche, Indianapolis, IN, USA), kers for signaling during normal development and according to the manufacturer’s instructions. Results were oncogenesis. quantified by spectrophotometry using a BioRad 3550-UV microplate reader at a wavelength 595 nm.

Materials and methods Oligonucleotide and cDNA arrays A total of 4608 gene human cDNA arrays (Hu4.6K) and Cell culture 16 755-gene oligonucleotide human arrays (OHU16.7K) T47D and CEM/4 cells were maintained in RPMI 1640 media printed on glass slides were obtained from the Keck DNA supplemented with 10% heat-inactivated fetal bovine serum Microarray Resource, Yale University. The cDNA arrays (FBS) and 2 mML-glutamine. T47D medium was supplemen- consisted of sequence-verified clones obtained from Research ted with bovine insulin at 5 mg/ml and the CEM/4 medium Genetics (Huntsville, AL, USA). Approximately 39% of the with 200 mg/ml Geneticin. MCF7 cells were maintained in genes are ESTs. These arrays were spotted in tandem minimum essential medium-a supplemented 10% FBS, 2 mM duplicates for each clone. The OHU16.7K arrays consist of L-glutamine, 0.1 mM nonessential amino acids, and 1 mM 70mer oligonucleotides representing 16 659 genes from the sodium pyruvate. The cells were cultured at 371Cin5% Operon Oligo Set Version 1.1 and 96 genes from Compugen CO2. SUM44 cells were generously provided by Dr S Ethier spotted singly. Both cDNA and oligonucleotide array gene sets (University of Michigan, Ann Arbor, MI, USA), and were are described at http://info.med.yale.edu/wmkeck/dna_ar- maintained in serum-free Ham’s F-12 supplemented with 0.1% rays.htm. Prior to use, DNA on the Hu4.6K cDNA slides bovine serum albumin, 5 mg/ml gentamycin, 5 mM ethanola- was denatured at 761C for 2 min. Slides were prehybridized at mine, 10 mM HEPES, 5 mg/ml transferrin, 10 mM T3, 50 mM 421C in 35% formamide, 4 Â SSPE, 2.5 Â Denhardt’s reagent selenium, 5 mg/ml insulin, and 1 mg/ml hydrocortisone. SUM44 and 0.2 mg/ml single-stranded salmon sperm DNA containing cells were maintained at 371C in 10% CO2. Cells were solution for 2 h. The prehybridization solution was drained grown to confluency in 100 mm plates or at 1 Â 106 cells/ml from the slides and the probe was applied to the array. (CEM/4), and switched to serum-free media for 24 h prior to stimulation. Probe preparation and hybridization for microarray experiments Serum-starved cells prepared as above were incubated with Immunoprecipitation and immunoblotting vehicle, A ErbB4 Ab-1, ErbB2 Ab-6, or NRG-b for 1 h at Stimulations were performed with vehicle (Dulbecco’s phos- 371C. Total cellular RNA was isolated using the RNEasy phate-buffered saline with Ca2 þ and Mg2 þ , containing 0.1%. miniprep kit (Qiagen, Valencia, CA, USA), with an on-column bovine serum albumin, ErbB4 Ab-1 H77.1 (Chen et al., 1996) DNAse treatment step, according to the manufacturer’s (NeoMarkers, Fremont, CA, USA; 10 mg/ml), ErbB2 Ab-6 instructions. A measure of 40–50 mg of total RNA was reverse N28 (Stancovski et al., 1991) (NeoMarkers; 10 mg/ml), NRG- transcribed using Superscript II reagents (Invitrogen, Carls- b1 (R&D Systems, Minneapolis, MN, USA; 50 ng/ml), or HB- bad, CA, USA) containing either Cy3-dUTP or Cy5-dUTP EGF (R&D Systems, Minneapolis, MN, USA; 100 ng/ml) for (1 mM) for 2 h at 421C. After labeling, the RNA was 10 min at room temperature. ErbB receptor phosphorylation hydrolysed using EDTA (55.6 mM) and NaOH (181.8 mM). was detected as described previously (Jones et al., 1999). The probe was neutralized with Tris-HCl pH 7.4 (312.5 mM). Briefly, receptors were immunoprecipitated from cell lysates and The unincorporated label was removed using Centricon YM- processed for immunoblotting. ErbB2 and ErbB4 were im- 30 spin columns. For the cDNA arrays, the probe was added munoprecipitated and immunoblotted with SC-284 and SC-283 to 35% formamide, 0.5% SDS, 2.5 Â Denhardt’s reagent and antibodies, respectively (Santa Cruz Biotechnology, Santa Cruz, 4 Â SSPE, 0.1 mg/ml poly dA, 2 mg/ml yeast tRNA, and 10 mg/ml CA, USA). Tyrosine phosphorylation was detected by immu- human Cot1 DNA. The probe was denatured by incubation at noblotting with mAb 4G10 (Upstate, Lake Placid, NY, USA). 981C for 2 min and then allowed to prehybridize at 421C for 1 h prior to hybridization to the array. The slides were 1 Soft agar assays hybridized at 42 C for 20 h in humidified hybridization chambers (Gene Machines, San Carlos, CA, USA). For the An underlay of 0.7% agar in DMEM, 5 mg/ml insulin, and OHU16.7K arrays, the probe was added to 0.8 Â SSPE, 10% FBS was prepared in 35 mm plates. In all, 10 000 T47D 2.56 Â SSC, 0.2% SDS, and 0.66 mg/ml poly dA, and cells were plated in an overlay of 0.35% agar in DMEM hybridized to slides at 631C for 20 h. After hybridization, supplemented with 5 mg/ml insulin and 10% FBS. Vehicle only, slides were washed in 1 Â SSC containing 0.1% SDS, followed ErbB4 Ab-1 at 10 mg/ml, or NRG-b1 at 50 ng/ml were added by 0.2 Â SSC and 0.05 Â SSC. The slides were dried by to the overlay. The colonies were allowed to form over 2 weeks centrifuging and scanned. at 371C, 5% CO2. Colonies were stained overnight at 371C with p-iodonitrotetrazolium violet (Sigma, St Louis, MO, Scanning, data acquisition, and analysis USA) at 1 g/l in 20 mM HEPES (pH 7.4). The plates were scanned and the images imported into TotalLab software, Slides were scanned using GenePix 4000A (Axon Instruments, which then determined colony numbers on the image (Non- Union City, CA, USA) at 532 nm (Cy3) and 635 nm (Cy5) linear Dynamics, Madison, WI, USA). Each treatment was wavelengths. The scanned images were imported into GenePix performed in triplicate. Pro 3.0 software for data acquisition. The data were exported

Oncogene ErbB-regulated gene expression DN Amin et al 1437 to Microsoft Excel. Prior to further analysis, spots that were 15 min at 951C and then 35–40 cycles at 941C for 1 min, 461C removed from analysis (i) if they were flagged as ‘not found’, for 1 min, and 721C for 1 min. Analysis was performed using or (ii) if Cy3 or Cy5 mean spot intensities were less than mean the I-Cycler optical interface version 2.3 (BioRad). Melt curve background intensity plus 3 standard deviations (s.d.) for the analysis was performed to ensure that single products had been OHU16.7K array, or 2 s.d. for the Hu4.6K cDNA array. amplified. Reactions lacking reverse transcriptase were per- Ratios of Cy5 : Cy3 (experimental: control) were obtained, formed to control for genomic DNA amplification. Relative based on the normalized background subtracted median standard curves for each of the genes were obtained by values. Lowess curve fit was performed to normalize the data performing two-fold dilutions of a cDNA pool. The relative for the two dyes (BRB-array software, NIH, Bethesda, MD, concentrations were obtained for each gene under each USA) (Tseng et al., 2001). Each experiment was repeated using treatment. The relative concentrations were normalized to three independent sources of RNA to control for interexperi- the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mental variability. Geometric means were obtained for ratios levels. Fold changes were obtained relative to mock treatment across three independent repeats. for ErbB4Ab, ErbB2Ab, and NRG-stimulated RNA. Each experiment was repeated using three independent sources of Quantitative real-time reverse transcriptase–polymerase chain RNA and, within each experimental repeat, amplifications reaction (QRT-PCR) were performed in triplicate. The average fold change ratio and the standard error of the mean (s.e.m.) were determined. A measure of 5 mg of total RNA was reverse-transcribed using Superscript II (Invitrogen). Dilution (1 : 100) of the cDNA obtained was subjected to quantitative real-time amplification on the I-Cycler (BioRad, Hercules, CA, USA), using the Acknowledgements Quantitect Sybr Green PCR kit (Qiagen). Primer sequences are This work was supported by US Public Health Service Grant reported in Table 4. Amplification cycles consisted of an initial R01CA80065 from the National Cancer Institute.

References

Alaoui-Jamali MA, Song DJ, Benlimame N, Yen L, Deng X, Geymayer S and Doppler W. (2000). FASEB J., 14, 1159–1170. Hernandez-Perez M and Wang T. (2003). Cancer Res., 63, Graus-Porta D, Beerli R, Daly J and Hynes N. (1997). EMBO 3764–3774. J., 16, 1647–1655. Andrechek ER, Laing MA, Girgis-Gabardo AA, Siegel PM, Graus-Porta D, Beerli RR and Hynes NE. (1995). Mol. Cell. Cardiff RD and Muller WJ. (2003). Cancer Res., 63, Biol., 15, 1182–1191. 4920–4926. Halgren RG, Fielden MR, Fong CJ and Zacharewski TR. Bacus SS, Chin D, Zelnick CR and Stern DF. (1996). Am. J. (2001). Nucleic Acids Res., 29, 582–588. Pathol., 148, 549–558. Hirata H, Yoshiura S, Ohtsuka T, Bessho Y, Harada T, Baulida J, Kraus M, Alimandi M, Di Fiore P and Carpenter Yoshikawa K and Kageyama R. (2002). Science, 298, G. (1996). J. Biol. Chem., 271, 5251–5257. 840–843. Burke CL and Stern DF. (1998). Mol. Cell. Biol., 18, Hobbs SS, Cofﬁng SL, Le AT, Cameron EM, Williams EE, 5371–5379. Andrew M, Blommel EN, Hammer RP, Chang H and Riese Chen X, Levkowitz G, Tzahar E, Karunagaran D, Lavi S, II DJ. (2002). Oncogene, 21, 8442–8452. Ben-Baruch N, Leitner O, Ratzkin BJ, Bacus SS and Yarden Hynes NE and Stern DF. (1994). Biochem. Biophys. Acta Rev. Y. (1996). J. Biol. Chem., 271, 7620–7629. Cancer, 1198, 165–184. Chuaqui RF, Bonner RF, Best CJ, Gillespie JW, Flaig MJ, Jones FE and Stern DF. (1999). Oncogene, 18, 3481–3490. Hewitt SM, Phillips JL, Krizman DB, Tangrea MA, Ahram Jones FE, Welte T, Fu XY and Stern DF. (1999). J. Cell Biol., M, Linehan WM, Knezevic V and Emmert-Buck MR. 147, 77–88. (2002). Nat. Genet., 32, 509–514. Kew TY, Bell JA, Pinder SE, Denley H, Srinivasan R, Gullick Cohen B, Green J, Foy L and Fell H. (1996). J. Biol. Chem., WJ, Nicholson RI, Blamey RW and Ellis IO. (2000). Br. J. 271, 4813–4818. Cancer, 82, 1163–1170. da Silva AJ, Brickelmaier M, Majeau GR, Lukashin AV, Knowlden J, Gee J, Seery L, Farrow L, Gullick W, Ellis I, Peyman J, Whitty A and Hochman PS. (2002). J. Interferon Blamey R, Robertson J and Nicholson R. (1998). Oncogene, Cytokine Res., 22, 173–188. 17, 1949–1957. Decker SJ. (1990). Biochem. Biophys. Res. Commun., 166, 615–621. Kumar-Sinha C, Ignatoski KW, Lippman ME, Ethier SP and DiFiore PP, Pierce JH, Kraus MH, Segatto O, King CR and Chinnaiyan AM. (2003). Cancer Res., 63, 132–139. Aaronson SA. (1987). Science, 237, 178–182. Lee K-F, Simon H, Chen H, Bates B, Hung M-C and Hauser Dupont J, Dunn SE, Barrett JC and LeRoith D. (2003). Recent C. (1995). Nature, 378, 394–398. Prog. Horm. Res., 58, 325–342. Lenferink AE, Pinkas-Kramarski R, van de Poll ML, van Dupont J, Khan J, Qu BH, Metzler P, Helman L and LeRoith Vugt MJ, Klapper LN, Tzahar E, Waterman H, Sela M, van D. (2001). Endocrinology, 142, 4969–4975. Zoelen EJ and Yarden Y. (1998). EMBO J., 17, 3385–3397. Evans PC, Taylor ER, Coadwell J, Heyninck K, Beyaert R Lesa GM and Sternberg PW. (1997). Mol. Biol. Cell, 8, and Kilshaw PJ. (2001). Biochem. J., 357, 617–623. 779–793. Fambrough D, McClure K, Kazlauskas A and Lander ES. Li L, Cleary S, Mandarano MA, Long W, Birchmeier C and (1999). Cell, 97, 727–741. Jones FE. (2002). Oncogene, 21, 4900–4907. Ferguson KM, Berger MB, Mendrola JM, Cho HS, Leahy DJ Mackay A, Jones C, Dexter T, Silva RL, Bulmer K, and Lemmon MA. (2003). Mol. Cell, 11, 507–517. Jones A, Simpson P, Harris RA, Jat PS, Neville AM, Gassmann M, Casagranda F, Orioli D, Simon H, Lai C, Reis LF, Lakhani SR and O’Hare MJ. (2003). Oncogene, 22, Klein R and Lemke G. (1995). Nature, 378, 390–394. 2680–2688.

Oncogene ErbB-regulated gene expression DN Amin et al 1438 Marshall CJ. (1995). Cell, 80, 179–185. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A and Mulligan C, Rochford J, Denyer G, Stephens R, Yeo G, McGuire WL. (1987). Science, 235, 177–182. Freeman T, Siddle K and O’Rahilly S. (2002). J. Biol. Srinivasan R, Poulsom R, Hurst H and Gullick W. (1997). Chem., 277, 42480–42487. J. Pathol., 185, 236–245. Muthuswamy SK, Li D, Lelievre S, Bissell MJ and Brugge JS. Stancovski I, Hurwitz E, Leitner O, Ullrich A, Yarden Y and (2001). Nat. Cell Biol., 3, 785–792. Sela M. (1991). Proc. Natl. Acad. Sci. USA, 88, 8691–8695. Neve RM, Holbro T and Hynes NE. (2002). Oncogene, 21, Stern D. (2000). Breast Cancer Res., 2, 176–183. 4567–4576. Stern DF. (2003). Exp. Cell Res., 284, 89–98. Oh JJ, Grosshans DR, Wong SG and Slamon DJ. (1999). Suo Z, Risberg B, Kalsson MG, Willman K, Tierens A, Nucleic Acids Res., 27, 4008–4017. Skovlund E and Nesland JM. (2002). J. Pathol., 196, 17–25. Ohtsuka T, Ishibashi M, Gradwohl G, Nakanishi S, Guillemot Sweeney C, Fambrough D, Huard C, Diamonti AJ, Lander F and Kageyama R. (1999). EMBO J, 18, 2196–2207. ES, Cantley LC and Carraway III KL. (2001). J. Biol. Olayioye MA, Graus-Porta D, Beerli RR, Rohrer J, Gay B Chem., 276, 22685–22698. and Hynes NE. (1998). Mol. Cell. Biol., 18, 5042–5051. Sweeney C, Lai C, Riese II DJ, Diamonti AJ, Cantley LC and Olayioye MA, Neve RM, Lane HA and Hynes NE. (2000). Carraway III KL. (2000). J. Biol. Chem., 275, 19803–19807. EMBO J., 19, 3159–3167. Tang CK, Concepcion XZ, Milan M, Gong X, Montgomery E Ota T, Fujii M, Sugizaki T, Ishii M, Miyazawa K, Aburatani and Lippman ME. (1999). Cancer Res., 59, 5315–5322. H and Miyazono K. (2002). J. Cell. Physiol., 193, 299–318. Taylor E, Cogdell D, Coombes K, Hu L, Ramdas L, Tabor A, Pawson T and Saxton TM. (1999). Cell, 97, 675–678. Hamilton S and Zhang W. (2001). Biotechniques, 31, 62–65. Penington DJ, Bryant I and Riese II DJ. (2002). Cell Growth Tidcombe H, Jackson-Fisher A, Mathers K, Stern DF, Differ., 13, 247–256. Gassman M and Golding JP. (2003). Proc. Natl. Acad. Sci. Perou CM, Jeffrey SS, van de Rijn M, Rees CA, Eisen MB, USA, 100, 8281–8286. Ross DT, Pergamenschikov A, Williams CF, Zhu SX, Tisdale EJ. (1999). Mol. Biol. Cell, 10, 1837–1849. Lee JC, Lashkari D, Shalon D, Brown PO and Botstein D. Tseng GC, Oh MK, Rohlin L, Liao JC and Wong WH. (2001). (1999). Proc. Natl. Acad. Sci. USA, 96, 9212–9217. Nucleic Acids Res., 29, 2549–2557. Plowman G, Green J, Culouscou J-M, Carlton G, Rothwell V Tzahar E, Waterman H, Chen X, Levkowitz G, Karunagaran and Buckley S. (1993). Nature, 366, 473–475. D, Lavi S, Ratzkin BJ and Yarden Y. (1996). Mol. Cell. Pollard JW and Hennighausen L. (1994). Proc. Natl. Acad. Biol., 16, 5276–5287. Sci. USA, 91, 9312–9316. Vadlamudi RK, Wang RA, Talukder AH, Adam L, Johnson Pupa SM, Menard S, Morelli D, Pozzi B, De Palo G and R and Kumar R. (2000). Mol. Cell. Biol., 20, 9092–9101. Colnaghi MI. (1993). Oncogene, 8, 2917–2923. Vecchi M, Baulida J and Carpenter G. (1996). J. Biol. Chem., Rangel LB, Agarwal R, D’Souza T, Pizer ES, Alo PL, 271, 18989–18995. Lancaster WD, Gregoire L, Schwartz DR, Cho KR and Vogt U, Bielawski K, Schlotter C, Bosse U, Falkiewicz B and Morin PJ. (2003). Clin. Cancer Res., 9, 2567–2575. Podhajska A. (1998). Gene, 223, 375–380. Richer JK, Jacobsen BM, Manning NG, Abel MG, Wolf DM Waterman H, Sabanai I, Geiger B and Yarden Y. (1998). and Horwitz KB. (2002). J. Biol. Chem., 277, 5209–5218. J. Biol. Chem., 273, 13819–13827. Riese DI, van Raaij T, Plowman G, Andrews G and Stern D. Weijzen S, Rizzo P, Braid M, Vaishnav R, Jonkheer SM, (1995). Mol. Cell. Biol., 15, 5770–5776. Zlobin A, Osborne BA, Gottipati S, Aster JC, Hahn WC, Riese II DJ and Stern DF. (1998). BioEssays, 20, 41–48. Rudolf M, Siziopikou K, Kast WM and Miele L. (2002). Ross DT, Scherf U, Eisen MB, Perou CM, Rees C, Nat. Med., 8, 979–986. Spellman P, Iyer V, Jeffrey SS, Van de Rijn M, Waltham Williams EE, Trout LJ, Gallo RM, Pitﬁeld SE, Bryant I, M, Pergamenschikov A, Lee JC, Lashkari D, Shalon D, Penington DJ and Riese II DJ. (2003). Cancer Lett., 192, Myers TG, Weinstein JN, Botstein D and Brown PO. (2000). 67–74. Nat. Genet., 24, 227–235. Wilson KS, Roberts H, Leek R, Harris AL and Geradts J. Sapi E, Flick MB, Rodov S, Carter D and Kacinski BM. (2002). Am. J. Pathol., 161, 1171–1185. (1998). J. Soc. Gynecol. Investig., 5, 94–101. Witton CJ, Reeves JR, Going JJ, Cooke TG and Bartlett JM. Sartor CI, Zhou H, Kozlowska E, Guttridge K, Kawata E, (2003). J. Pathol., 200, 290–297. Caskey L, Harrelson J, Hynes N, Ethier S, Calvo B and Yarden Y and Sliwkowski MX. (2001). Nat. Rev. Mol. Cell Earp III HS. (2001). Mol. Cell. Biol., 21, 4265–4275. Biol., 2, 127–137. Sasai Y, Kageyama R, Tagawa Y, Shigemoto R and Yip SS, Crew AJ, Gee JM, Hui R, Blamey RW, Robertson JF, Nakanishi S. (1992). Genes Dev., 6, 2620–2634. Nicholson RI, Sutherland RL and Daly RJ. (2000). Int. J. Schroeder JA and Lee DC. (1998). Cell Growth Differ., 9, Cancer, 88, 363–368. 451–464. Zhou W and Carpenter G. (2002). Inﬂamm. Res., 51, 91–101.

Oncogene