DOCSLIB.ORG

Neurexin Ilia: Extensive Alternative Splicing Generates Membrane-Bound and Soluble Forms Yuri A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Neurexin Ilia: Extensive Alternative Splicing Generates Membrane-Bound and Soluble Forms Yuri A Proc. Natl. Acad. Sci. USA Vol. 90, pp. 6410-6414, July 1993 Biochemistry Neurexin IlIa: Extensive alternative splicing generates membrane-bound and soluble forms YURi A. USHKARYOV AND THOMAS C. SUDHOF* Howard Hughes Medical Institute and Department of Molecular Genetics, University of Texas Southwestern Medical School, Dallas, TX 75235 Communicated by Michael S. Brown, March 26, 1993 ABSTRACT The structure ofneurexin lIa was elucidated and 13-neurexins have identical C termini including the from overlapping cDNA clones. Neurexin lIa is highly ho- 0-linked sugar region, transmembrane region, and cytoplas- mologous to neurexins la and Ha and shares with them a mic domain (2). distinctive domain structure that resembles a cell surface Structures of the neurexins are suggestive of cell surface receptor. cDNA cloning and PCR experiments revealed alter- receptors. Indeed, the neurexins were originally found be- native splicing at four positions in the mRNA for neurexin HIa. cause of the identity of the sequence of neurexin Ia and Alternative splicing was previously observed at the same po- sequences from the high molecular weight subunit of the sitions in either neurexin Ia or neurexin Ila or both, suggesting receptor for a presynaptic neurotoxin, a-latrotoxin (7). Im- that the three neurexins are subject to extensive alternative munocytochemistry ofrat brain frozen sections revealed that splicing. This results in hundreds of different neurexins with neurexin I is highly enriched in synapses in agreement with variations in small sequences at similar positions in the pro- the localization of a-latrotoxin (2). These findings suggest teins. The most extensive alternative splicing of neurexin Ma that at least neurexins Ia and I13 are synaptic proteins that, was detected at its C-terminal site, which exhibits a minimum based on their structure and homologies, may represent a of 12 variants. Some of the alternatively spliced sequences at class of neuronal cell-interaction molecules (2). this position contain in-frame stop codons, suggesting the We now report the identification, structure, and expression synthesis of secreted proteins. None of the sequences of the of neurexin IIIa.t By extending the neurexin family of other splice sites in this or the other two neurexins include stop proteins, our results demonstrate the generality of the fea- codons. RNA blot analysis demonstrate that neurexin IlIa is tures of this protein family: their conserved alternative splic- expressed in a brain-specific pattern. Our results suggest that ing patterns, brain-specific expression, and similar domain the neurexins constitute a large family of polymorphic cell structure with distinct patterns of shared and divergent surface proteins that includes secreted variants, indicating a sequences. The expanded number of expressed neurexins possible role as signaling molecules. lends further support to a putative role of the neurexins as polymorphic identifier molecules. The surprising finding, The development and function of the nervous system are however, was that neurexin IIIa may be produced in secreted dependent on an intricate network of cell signaling and forms, suggesting a higher degree of complexity than indi- cell-cell interaction mechanisms (1). We have identified (2) a cated by the structures of neurexins I and II. family of cell surface receptors named neurexins with char- acteristics that suggest a role in such cell-cell interactions. Two genes for neurexins were identified; each gene con- EXPERIMENTAL PROCEDURES tains two independent promoters that drive transcription of cDNA Cloning and Sequencing. cDNA cloning and mapping two classes ofmRNAs. The two classes oftranscripts encode were performed as described using 32P-labeled oligonucleo- proteins with different N termini; the larger proteins are tides as probes (8). DNA sequencing was performed on referred to as a-neurexins and the shorter are l3-neurexins. single-stranded DNA from M13 subclones using the dideox- The expression of the neurexins is brain-specific and con- ynucleotide-termination method (9) with fluorescent primers centrated in neurons. Neurexins are highly polymorphic due and Taq polymerase (Promega). Reaction products were to extensive differential splicing with the potential to express analyzed on an ABI 373A automatic DNA sequencer. hundreds of different proteins. PCRs. First-strand cDNA synthesis was performed in 100 Neurexins have a distinctive domain structure. In the ,ul by standard procedures (10) using 10 ug -of poly(A)+- a-neurexins, a signal sequence is followed by three copies of enriched RNA from rat forebrain, cerebellum, or spinal cord. a long repeat that make up >75% of the total protein. Each PCR mixtures contained 2-5 ,ul of cDNA, 2.5 mM MgCl2, 10 ofthe long repeats contains a central epidermal growth factor mM Tris'HCl (pH 8.3), 50 mM KCI, 20 pmol of each primer, (EGF) domain flanked by right and left arms that are weakly all four dNTPs (each at 200 AM), and AmpliTaq DNA homologous to each other. Data bank searches (GenBank polymerase (Perkin-Elmer) at 30 units/liter. PCRs were per- Release 70 and Protein Identification Resource Release 30) formed in 32 cycles, with the first two cycles at 95°C for 5 min, demonstrated that the extracellular repeats in neurexins are 60°C for 1 min, and 72°C for 5 min, followed by 30 cycles at related to sequences found in several extracellular matrix the same temperatures but for 1 min, 1 min, and 2 min. proteins that participate in cell-cell interactions during de- Neurexin III was initially identified with two oligonucleotides velopment, including laminin A (3), agrin (4, 5), and slit (6). corresponding to sequences that are highly conserved among After the three long repeats, a-neurexins contain an 0-linked neurexins [(nucleotides in parentheses denote redundant sugar domain, a single transmembrane region, and a short positions with multiple nucleotides) GGAGATCTAGT- cytoplasmic tail. The N-terminal sequence of f-neurexins TGCGGTACTTGTACATGGC(G/A)TAGAG(G/A)AG- differs from that of the a-neurexins but is spliced into the GAT and AGCAAGCTTGGCACCGTGCCCATCGCCAT- a-neurexin sequences at the end ofthe third EGF domain. a- Abbreviation: EGF, epidermal growth factor. The publication costs of this article were defrayed in part by page charge *To whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" tThe sequences reported in this paper have been submitted to in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank (accession nos. L14851). 6410 Downloaded by guest on October 6, 2021 Biochemistry: Ushkaryov and Siidhof Proc. Natl. Acad. Sci. USA 90 (1993) 6411 CAA]. Subsequent PCRs to map the extent of alternative is followed by a long open reading frame. This identification splicing were carried out with oligonucleotides I, II, and III is supported by the fact that the putative initiator methionine in Fig. 3 (I, GCGAAGCTTGTTTCATCTGCTGAATGCT; is preceded by an in-frame stop codon (underlined in Fig. 2) II, GCGGCATGCCACATTCTTGAAAGTTGC; III, and that its sequence context conforms well to the consensus GCCTCTAGAACCCGTCTGATTCCTGGCT). Two types site of initiator methionines (12). of PCR experiments were performed: (i) PCRs were per- Six of the cDNA clones had poly(A) tails at their 3' end. formed in duplicate with one labeled primer and one unla- However, these poly(A) tails initiated at three positions in the beled primer. The products of such reactions were then nucleotide sequence (Fig. 2). None of the poly(A) tails was analyzed by denaturing PAGE and autoradiography to de- preceded by a classical polyadenylylation consensus se- termine the minimal number of fragments generated that quence. Therefore, it is doubtful that these poly(A) tracts incorporate both primers. This avoids artifacts caused by represent the poly(A) tails of the neurexin IIIa mRNA. The single-oligonucleotide priming or heteroduplex formation 3' untranslated region of the neurexin IIIa mRNA is rich in (11). (ii) PCRs were performed with unlabeled primers, adenosines, suggesting that the poly(A) tails in the cDNAs analyzed by nondenaturing PAGE, and stained by ethidium may represent oligo(dT)-priming sites that are not necessarily bromide. PCR products were then subjected to Southern blot poly(A) tracts. analysis with internal oligonucleotides or excised and cloned Alternative Splicing of Neurexin Ma. The 12 cDNA clones into M13 vectors and sequenced. All of the PCR products of that were sequenced contained four internal positions at Fig. 3 were sequenced except for products C, E, and G, which different clones exhibited sequence variations (Figs. 1 which were identified on the basis of their size in relation to and 2). These differences consisted in the presence or ab- the sequenced other products and of their hybridization with sence of a sequence stretch, suggesting that they arose by an insert-specific oligonucleotide (ACCAAGTACAGGTAG- alternative splicing. Comparison of the sequences of neurex- GTC). ins Ia, Ila, and IIIa demonstrates that, at each of these four RNA Blot Analysis. This procedure was performed (2) using positions, neurexin Ia, neurexin Ila, or both are also alter- total RNA from various rat tissues and single-stranded 32p- natively spliced (2). This result raises the possibility that the labeled DNA probes. Blots were rehybridized with a probe to three neurexins are alternatively spliced at similar positions. cyclophilin to control for RNA loading. A simple pattern of
Load more

Recommended publications
  • Slit Proteins: Molecular Guidance Cues for Cells Ranging from Neurons to Leukocytes Kit Wong, Hwan Tae Park*, Jane Y Wu* and Yi Rao†
    583 Slit proteins: molecular guidance cues for cells ranging from neurons to leukocytes Kit Wong, Hwan Tae Park*, Jane Y Wu* and Yi Rao† Recent studies of molecular guidance cues including the Slit midline glial cells was thought to be abnormal [2,3]. family of secreted proteins have provided new insights into the Projection of the commissural axons was also abnormal: mechanisms of cell migration. Initially discovered in the nervous instead of crossing the midline once before projecting system, Slit functions through its receptor, Roundabout, and an longitudinally, the commissural axons from two sides of the intracellular signal transduction pathway that includes the nerve cord are fused at the midline in slit mutants [2,3]. Abelson kinase, the Enabled protein, GTPase activating proteins Because the midline glial cells are known to be important and the Rho family of small GTPases. Interestingly, Slit also in axon guidance, the commissural axon phenotype in slit appears to use Roundabout to control leukocyte chemotaxis, mutants was initially thought to be secondary to the cell- which occurs in contexts different from neuronal migration, differentiation phenotype [3]. suggesting a fundamental conservation of mechanisms guiding the migration of distinct types of somatic cells. In early 1999, results from three groups demonstrated independently that Slit functioned as an extracellular cue Addresses to guide axon pathfinding [4–6], to promote axon branching Department of Anatomy and Neurobiology, and *Departments of [7], and to control neuronal migration [8]. The functional Pediatrics and Molecular Biology and Pharmacology, Box 8108, roles of Slit in axon guidance and neuronal migration were Washington University School of Medicine, 660 S Euclid Avenue St Louis, soon supported by other studies in Drosophila [9] and in Missouri 63110, USA *e-mail: [email protected] vertebrates [10–14].
    [Show full text]
  • Novel Roles for Slits and Netrins: Axon Guidance Cues As Anticancer Targets?
    Nature Reviews Cancer | AOP, published online 17 February 2011; doi:10.1038/nrc3005 REVIEWS Novel roles for Slits and netrins: axon guidance cues as anticancer targets? Patrick Mehlen*, Céline Delloye-Bourgeois* and Alain Chédotal‡§|| Abstract | Over the past few years, several genes, proteins and signalling pathways that are required for embryogenesis have been shown to regulate tumour development and progression by playing a major part in overriding antitumour safeguard mechanisms. These include axon guidance cues, such as Netrins and Slits. Netrin 1 and members of the Slit family are secreted extracellular matrix proteins that bind to deleted in colorectal cancer (DCC) and UNC5 receptors, and roundabout receptors (Robos), respectively. Their expression is deregulated in a large proportion of human cancers, suggesting that they could be tumour suppressor genes or oncogenes. Moreover, recent data suggest that these ligand–receptor pairs could be promising targets for personalized anticancer therapies. Floor plate Netrin 1 — named from the sanscrit netr, ‘the one who roles of netrin 1 and its receptors have been extensively A group of cells that occupy guides’ — was purified by Tessier-Lavigne and col- described, but little is known about the function of these the ventral midline of the leagues as a soluble factor secreted by floor plate cells able other netrins. Netrin 4, which shares little homology developing vertebrate nervous to elicit the growth of commissural axons1,2. This discovery with netrin 1 (netrin 4, unlike other netrins, which dis- system, extending from the spinal cord to the launched a scientific race to identify novel secreted or play homology to the short arm of laminin-γ chains, is diencephalon.
    [Show full text]
  • 5 Shh Netrin Others
    SYAPTIC PLASTICITY AND AXONAL GUIDANCE 1. The Neuron: basic Mechanisms of Action 2. Axon Guidance and Nerve Growth: Basic Principles 3. Short Range Guidance: 1. Eph-Ephrins / 2. Semaphorins 4. Long Range Cues: Semaphorins / Netrin-Slit / Nogo / Others 5. Learning and Memory - Guidance and Neuronal Adaptation in the Adult - Regulation of Pathways SLIT & NETRINS Netrins • Netrins are a small family of highly conserved guidance molecules (~70-80kDa). • One in worms (c.elegans) UNC6 • Two in Drosophila Netrin -A and -B • Two in chick, netrin-1 and -2. • In mouse and humans a third netrin identified netrin-3 (netrin-2-like). • In all species there are axons that project to the midline of the nervous system. • The midline attracts these axons and netrin plays a role in this. Netrins • Netrin-1 is produced by the floor plate • Netrin-2 is made in the ventral spinal cord except for the floor-plate • Both netrins become associated with the ECM and the receptor DCC • Model: commissural axons first encounter gradient of netrin-2, which brings them into the domain of netrin-1 Netrins Roof plate Commissural neuron 0 125 250 375 Commissural neurons extend ventrally Floor plate and then toward floor plate, if within 250µm from the floor plate Netrins • Netrins are bifunctional molecules, attracting some axons and repelling others. • C.elegans axons migrating away from the UNC-6 netrin source are misrouted in the unc-6 mutant. • The repulsive activity of netrin first shown in vertebrates for populations of motor axons that project away from the midline. • The receptors that mediate the attractive and repulsive effects of netrins are also highly conserved.
    [Show full text]
  • Changes in SLIT2 Expression Are Associated with the Migration of Human Ovarian Clear Cell Carcinoma Cells
    ONCOLOGY LETTERS 22: 551, 2021 Changes in SLIT2 expression are associated with the migration of human ovarian clear cell carcinoma cells CUEI‑JYUAN LIN1*, WAY‑REN HUANG2*, CHIA‑ZHEN WU3 and RUO‑CHIA TSENG3 1Department of Laboratory Medicine, Keelung Chang Gung Memorial Hospital, Keelung 20401; 2GLORIA Operation Center, National Tsing Hua University, Hsinchu 30013; 3Department of Molecular Biology and Human Genetics, Tzu Chi University, Hualien 97004, Taiwan, R.O.C. Received January 8, 2021; Accepted May 5, 2021 DOI: 10.3892/ol.2021.12812 Abstract. Ovarian clear cell carcinoma (OCCC) is characterized rate of ~9% in Taiwan and various other areas of the world (1,2). by a poor survival of patients, which is mainly due to metastasis EOC has several subtypes with different origins, multiple and treatment failure. Slit guidance ligand 2 (SLIT2), a secreted molecular characteristics and a range of outcomes (3). EOC protein, has been reported to modulate the migration of neural consists of five histological subtypes, namely serous, mucinous, cells and human cancer cells. However, the effect of changes in clear cell, endometrioid and transitional cell/Brenner tumor SLIT2 expression on the regulation of cell migration in OCCC subtypes (4). Ovarian clear cell carcinoma (OCCC) is a distinct remains unknown. The present study examined alterations in type of ovarian cancer, and is associated with both a poor SLIT2 expression using OCCC cell models, including low‑ and survival and resistance to platinum‑based chemotherapy (3). high‑mobility SKOV3 cells, as well as OCCC tissues. DNA OCCC is the second most common EOC subtype in Taiwan methylation analysis suggested that promoter hypermethylation and Japan (2), whereas it ranks fourth in North America (5).
    [Show full text]
  • Slit Antagonizes Netrin-1 Attractive Effects During the Migration of Inferior Olivary Neurons
    Developmental Biology 246, 429–440 (2002) doi:10.1006/dbio.2002.0681 View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Slit Antagonizes Netrin-1 Attractive Effects during the Migration of Inferior Olivary Neurons Fre´de´ric Causeret, Franc¸ois Danne, Fre´de´ric Ezan, Constantino Sotelo, and Evelyne Bloch-Gallego1 INSERM U106, Hoˆpital de la Salpeˆtrie`re, 75013 Paris, France Inferior olivary neurons (ION) migrate circumferentially around the caudal rhombencephalon starting from the alar plate to locate ventrally close to the floor-plate, ipsilaterally to their site of proliferation. The floor-plate constitutes a source of diffusible factors. Among them, netrin-1 is implied in the survival and attraction of migrating ION in vivo and in vitro.We have looked for a possible involvement of slit-1/2 during ION migration. We report that: (1) slit-1 and slit-2 are coexpressed in the floor-plate of the rhombencephalon throughout ION development; (2) robo-2, a slit receptor, is expressed in migrating ION, in particular when they reach the vicinity of the floor-plate; (3) using in vitro assays in collagen matrix, netrin-1 exerts an attractive effect on ION leading processes and nuclei; (4) slit has a weak repulsive effect on ION axon outgrowth and no effect on migration by itself, but (5) when combined with netrin-1, it antagonizes part of or all of the effects of netrin-1 in a dose-dependent manner, inhibiting the attraction of axons and the migration of cell nuclei. Our results indicate that slit silences the attractive effects of netrin-1 and could participate in the correct ventral positioning of ION, stopping the migration when cell bodies reach the floor-plate.
    [Show full text]
  • Connective Tissue Growth Factor Is Increased in Pseudoexfoliation Glaucoma
    Glaucoma Connective Tissue Growth Factor Is Increased in Pseudoexfoliation Glaucoma John G. Browne,1 Su Ling Ho,2 Rosemary Kane,1 Noelynn Oliver,3 Abbot. F. Clark,4,5 Colm J. O’Brien,1,2 and John K. Crean6 PURPOSE. Pseudoexfoliation (PXF) syndrome is a generalized seudoexfoliation syndrome (PXF) is an age-related disorder disorder of the extracellular matrix (ECM) involving the trabec- Pthat manifests with abnormal fibrillar extracellular material ular meshwork (TM), associated with raised intraocular pres- (ECM) accumulation in ocular tissues.1 Fibrillar material similar sure, glaucoma, and cataract. The purposes of this study were to that in the eyes of PXF patients has more recently been to quantify aqueous humor connective tissue growth factor detected in the skin and visceral organs of patients with PXF.2 (CTGF) in PXF glaucoma, to determine the effect of CTGF on In the eye, PXF is detected by pupil dilation and subsequent slit ECM production in TM cells, and to identify intracellular CTGF lamp examination. Deposits of fibrillar material are observed in signaling pathways. the anterior segment, primarily on the pupillary border and anterior lens capsule. The disease usually has an insidious METHODS. Aqueous humor samples were obtained from pa- tients undergoing routine cataract surgery or trabeculectomy. onset, unless complications occur such as cataract and glau- CTGF levels were quantified by ELISA. The effect of CTGF on coma. PXF is reported to be responsible for more than half of the cases of open-angle glaucoma in Norway, Ireland, Greece, fibrillin-1 expression in TM cells was investigated by real-time 3 PCR.
    [Show full text]
  • Structural Insights Into the Slit-Robo Complex
    Structural insights into the Slit-Robo complex Cecile Morlot*, Nicole M. Thielens†, Raimond B. G. Ravelli*, Wieger Hemrika‡, Roland A. Romijn‡, Piet Gros§, Stephen Cusack*, and Andrew A. McCarthy*¶ *European Molecular Biology Laboratory, 6 Rue Jules Horowitz, BP 181, 38042 Grenoble, France; †Laboratoire d’Enzymologie Moleculaire, Institut de Biologie Structurale J. P. Ebel, 38027 Grenoble Cedex 1, France; and ‡ABC Expression Center and §Department of Crystal and Structural Chemistry, Bijvoet Center for Biomolecular Research, Utrecht University, Padualaan 8, 3584 CH Utrecht, The Netherlands Edited by Corey S. Goodman, Renovis, South San Francisco, CA, and approved August 7, 2007 (received for review June 6, 2007) Slits are large multidomain leucine-rich repeat (LRR)-containing heterophilic interactions with Robo1. This raises the possibility proteins that provide crucial guidance cues in neuronal and vas- that Robo3 may, in fact, sequester Robo1 into an inactive cular development. More recently, Slits have been implicated in receptor complex on the developing axon to allow midline heart morphogenesis, angiogenesis, and tumor metastasis. Slits crossing (15). are ligands for the Robo (Roundabout) receptors, which belong to Slit proteins contain a unique N-terminal tandem of four the Ig superfamily of transmembrane signaling molecules. The leucine-rich repeat (LRR) domains (D1–D4) followed by seven Slit-Robo interaction is mediated by the second LRR domain of Slit to nine EGF-like domains, a laminin G domain and a C-terminal and the two N-terminal Ig domains of Robo, but the molecular cysteine-rich module (16). Proteolytic cleavage within the EGF details of this interaction and how it induces signaling remain region releases the active N-terminal fragment (17).
    [Show full text]
  • Slit Inhibition of Retinal Axon Growth and Its Role in Retinal Axon Pathfinding and Innervation Patterns in the Diencephalon
    The Journal of Neuroscience, July 1, 2000, 20(13):4983–4991 Slit Inhibition of Retinal Axon Growth and Its Role in Retinal Axon Pathfinding and Innervation Patterns in the Diencephalon Thomas Ringstedt,1 Janet E. Braisted,1 Katja Brose,2 Thomas Kidd,3 Corey Goodman,3 Marc Tessier-Lavigne,2 and Dennis D. M. O’Leary1 1Molecular Neurobiology Laboratory, The Salk Institute, La Jolla, California 92037, 2Departments of Anatomy, and Biochemistry and Biophysics, University of California, San Francisco, California 94143-0452, and 3Department of Molecular and Cell Biology, University of California, Berkeley, California 94720 We have analyzed the role of the Slit family of repellent axon retinal axons are more tightly fasciculated. This action of Slit2 guidance molecules in the patterning of the axonal projections as a growth inhibitor of retinal axons and the expression pat- of retinal ganglion cells (RGCs) within the embryonic rat dien- terns of slit1 and slit2 correlate with the fasciculation and cephalon and whether the slits can account for a repellent innervation patterns of RGC axons within the diencephalon and activity for retinal axons released by hypothalamus and epith- implicate the Slits as components of the axon repellent activity alamus. At the time RGC axons extend over the diencephalon, associated with the hypothalamus and epithalamus. Our find- slit1 and slit2 are expressed in hypothalamus and epithalamus ings suggest that in vivo the Slits control RGC axon pathfinding but not in the lateral part of dorsal thalamus, a retinal target. and targeting within the diencephalon by regulating their fas- slit3 expression is low or undetectable. The Slit receptors ciculation, preventing them or their branches from invading robo2, and to a limited extent robo1, are expressed in the RGC nontarget tissues, and steering them toward their most distal layer, as are slit1 and slit2.
    [Show full text]
  • Connective-Tissue Growth Factor Modulates WNT Signalling And
    Research article 2137 Connective-tissue growth factor modulates WNT signalling and interacts with the WNT receptor complex Sara Mercurio1,*, Branko Latinkic1,†, Nobue Itasaki2, Robb Krumlauf2,‡ and J. C. Smith1,*,§ 1Division of Developmental Biology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK 2Division of Developmental Neurobiology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK *Present address: Wellcome Trust/Cancer Research UK Institute and Department of Zoology, University of Cambridge, Tennis Court Road, Cambridge CB2 1QR, UK †Present address: School of Biosciences, Cardiff University, PO Box 911, Cardiff CF10 3US, UK ‡Present address: Stowers Institute for Medical Research, 1000 East 50th Street, Kansas City, MO 64110, USA §Author for correspondence (e-mail: [email protected]) Accepted 17 December 2003 Development 131, 2137-2147 Published by The Company of Biologists 2004 doi:10.1242/dev.01045 Summary Connective-tissue growth factor (CTGF) is a member of the Wnt pathway, in accord with its ability to bind to the Wnt CCN family of secreted proteins. CCN family members co-receptor LDL receptor-related protein 6 (LRP6). This contain four characteristic domains and exhibit multiple interaction is likely to occur through the C-terminal (CT) activities: they associate with the extracellular matrix, they domain of CTGF, which is distinct from the BMP- and can mediate cell adhesion, cell migration and chemotaxis, TGFβ-interacting domain. Our results define new activities and they can modulate the activities of peptide growth of CTGF and add to the variety of routes through which factors. Many of the effects of CTGF are thought to be cells regulate growth factor activity in development, disease mediated by binding to integrins, whereas others may be and tissue homeostasis.
    [Show full text]
  • Slit Coordinates Cardiac Morphogenesis in Drosophila ⁎ Allison Macmullin, J
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Developmental Biology 293 (2006) 154–164 www.elsevier.com/locate/ydbio Slit coordinates cardiac morphogenesis in Drosophila ⁎ Allison MacMullin, J. Roger Jacobs Department of Biology, McMaster University, LSB 429, 1280 Main St. W., Hamilton, ON, Canada L8S 4K1 Received for publication 6 December 2005; revised 26 January 2006; accepted 27 January 2006 Available online 3 March 2006 Abstract Slit is a secreted guidance cue that conveys repellent or attractive signals from target and guidepost cells. In Drosophila, responsive cells express one or more of three Robo receptors. The cardial cells of the developing heart express both Slit and Robo2. This is the first report of coincident expression of a Robo and its ligand. In slit mutants, cardial cell alignment, polarization and uniform migration are disrupted. The heart phenotype of robo2 mutants is similar, with fewer migration defects. In the guidance of neuronal growth cones in Drosophila, there is a phenotypic interaction between slit and robo heterozygotes, and also with genes required for Robo signaling. In contrast, in the heart, slit has little or no phenotypic interaction with Robo-related genes, including Robo2, Nck2, and Disabled. However, there is a strong phenotypic interaction with Integrin genes and their ligands, including Laminin and Collagen, and intracellular messengers, including Talin and ILK. This indicates that Slit participates in adhesion or adhesion signaling during heart development. © 2006 Elsevier Inc. All rights reserved. Keywords: Vasculogenesis; Guidance signaling; Adhesion Integrin; Laminin; Robo; Migration Introduction 2004; Klagsbrun and Eichmann, 2005).
    [Show full text]
  • Roles of Slit-Robo Signaling in Pathogenesis of Multiple Human Diseases: HIV-1 Infection, Vascular Endothelial Inflammation and Breast Cancer
    Roles of Slit-Robo Signaling in Pathogenesis of Multiple Human Diseases: HIV-1 Infection, Vascular Endothelial Inflammation and Breast Cancer DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Helong Zhao Biomedical Sciences Graduate Program The Ohio State University 2015 Dissertation Committee: Ramesh K. Ganju, PhD, Advisor Li Wu, PhD, Committee Chair W. James Waldman, PhD Sujit Basu, MD, PhD Copyright by Helong Zhao 2015 Abstract The signal molecule, Slit, is a family of secreted glycoprotein, which contains 3 isoforms, Slit1-3. The cellular surface receptor for Slit is Robo (Roundabout), which contains 4 isoforms, Robo1-4. It is now clear that, Slit and Robo are expressed and functional in a variety of tissues besides the neuronal system, including but not limited to leukocytes, endothelial cells and epithelial cells. And Slit-Robo signaling also plays important roles in regulating cell functions that are not directly related to cell migration, such as cell attachment, survival and proliferation. Thus, Slit-Robo signaling is proposed to regulate the post-development pathogenesis of multiple human diseases. HIV-1 infection: Slit2 is a ~ 200 kDa isoform of Slit, and it has been shown to regulate immune functions. However, not much is known about its role in HIV-1 (Human Immunodeficiency Virus type 1) pathogenesis. In our study, we show that the N-terminal fragment of Slit2 (Slit2-N) (~120 kDa) inhibits replication of HIV-1 virus in T-cell lines and peripheral blood T cells. Furthermore, we demonstrate inhibition of HIV-1 infection in resting CD4+ T cells.
    [Show full text]
  • The Cytoplasmic Domains of Slit and Netrin Receptors Specify Attraction Versus Repulsion
    Cell, Vol. 97, 917±926, June 25, 1999, Copyright 1999 by Cell Press Chimeric Axon Guidance Receptors: The Cytoplasmic Domains of Slit and Netrin Receptors Specify Attraction versus Repulsion Greg J. Bashaw and Corey S. Goodman* In the present study, we asked where attraction versus Howard Hughes Medical Institute repulsion is encoded. Netrin and Slit receptors in Dro- Department of Molecular and Cell Biology sophila melanogaster provide an ideal opportunity to University of California answer this question. In Drosophila, both Netrins (NetA Berkeley, California 94720 and NetB) (Harris et al., 1996; Mitchell et al., 1996) and Slit (Rothberg et al., 1990; Kidd et al., 1999) are ex- pressed by the same midline cells. At the Drosophila Summary midline, Netrins function largely as attractants. This at- tractive function is mediated by Frazzled (Fra) (Kolodziej Frazzled (Fra) is the DCC-like Netrin receptor in Dro- et al., 1996), a member of the Deleted in Colorectal sophila that mediates attraction; Roundabout (Robo) Cancer (DCC)/UNC-40 family of Netrin receptors (Chan is a Slit receptor that mediates repulsion. Both ligands et al., 1996; Keino-Masu et al., 1996). Slit, on the other are expressed at the midline; both receptors have re- hand, functions as a midline repellent. This repulsive lated structures and are often expressed by the same function is mediated largely by Roundabout (Robo) (Kidd neurons. To determine if attraction versus repulsion et al., 1998a, 1999; Brose et al., 1999). Fra and Robo is a modular function encoded in the cytoplasmic do- are related proteins; both are members of the immuno- main of these receptors, we created chimeras carrying globulin (Ig) superfamily.
    [Show full text]