Coupling Both Classic and Non-Classic Progesterone Receptor Signaling
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Peripheral Nervous System……………………………………………….9
PhD School in Integrative Biomedical Research Department of Pharmacological and Biomolecular Sciences Curriculum: Neuroscience Molecular basis for the development of innovative therapies for peripheral neuropathies treatment: role and cross-regulation of the GABAergic system and neuroactive steroids SDD BIO/09 - Physiology Luca Franco Castelnovo Badge number R10402 PhD Tutor: Prof. Valerio Magnaghi PhD School Coordinator: Prof. Chiarella Sforza Academic year 2015/2016 INDEX Abstract…………………………………………………………………...page 1 Abbreviations list…………………………………………………………….....5 Introduction………………………………………………………………….....8 Peripheral nervous system……………………………………………….9 General concepts……………...……….……………………………........……..9 Sensory system and nociceptive fibers.………………..………….…………..12 Schwann cells and myelination……….……..………………...………………15 Peripheral neuropathies…….…………………………………………...26 General concepts……………………………………………………...……….26 Neuropathic pain……………………………………...……………………….27 Nerve regeneration…………………………………………………………….28 The GABAergic system………….……………………………………...32 GABA……………….…………………………………………………..……..32 GABA-A receptors…………………………………………………………….33 GABA-B receptors…………………………………………………………….42 GABAergic system in the peripheral nervous system…………………………47 Protein kinase C – type ε……………………….………………………..51 General concepts…………………………………………………….…………51 Cross-talk with allopregnanolone and GABA-A………………………………54 Neuroactive steroids…………......………………………………………57 General concepts…………………………………….…………………………57 Mechanism of action…………………………….……………………………..59 Progesterone derivatives………………………………….……………………60 -
Nicotinic Signalling and Neurosteroid Modulation in Principal Neurons of the Hippocampal Formation and Prefrontal Cortex
Nicotinic Signalling and Neurosteroid Modulation in Principal Neurons of the Hippocampal Formation and Prefrontal Cortex by Beryl Yik Ting Chung A Thesis presented to The University of Guelph In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Sciences and Neuroscience Guelph, Ontario, Canada © Beryl Yik Ting Chung, April, 2018 ABSTRACT NICOTINIC SIGNALLING AND NEUROSTEROID MODULATION IN PRINCIPAL NEURONS OF THE HIPPOCAMPAL FORMATION AND PREFRONTAL CORTEX Beryl Yik Ting Chung Advisor: University of Guelph, 2018 Dr. Craig D.C. Bailey Nicotinic signalling plays an important role in coordinating the response of neuronal networks in many brain regions. During pre- and postnatal circuit formation, neurotransmission mediated by nicotinic acetylcholine receptors (nAChRs) influences neuronal survival and regulates neuronal excitability, synaptic transmission, and synaptic plasticity. Nicotinic signalling is also necessary for the proper function of the hippocampal formation (HF) and prefrontal cortex (PFC), which are anatomically and functionally connected and facilitate higher-order cognitive functions. The decline or dysfunction in nicotinic signalling and nAChR function has been observed in various neurological disorders, and the disruption or alteration of nicotinic signalling in the HF and/or PFC can impair learning and memory. While the location and functional role of the α4β2* nAChR isoform has been well characterized in the medial portion of the PFC, this is not well-established in the HF. What is the role of α4β2* nAChRs in excitatory principal neurons of the HF during early development? Growing evidence suggests that the progesterone metabolite allopregnanolone (ALLO) plays a role in mediating the proper function of the HF and the PFC, and that it may also inhibit nAChR function. -
The VLDL Receptor Regulates Membrane Progesterone Receptor
© 2018. Published by The Company of Biologists Ltd | Journal of Cell Science (2018) 131, jcs212522. doi:10.1242/jcs.212522 RESEARCH ARTICLE The VLDL receptor regulates membrane progesterone receptor trafficking and non-genomic signaling Nancy Nader, Maya Dib, Raphael Courjaret, Rawad Hodeify, Raya Machaca, Johannes Graumann and Khaled Machaca* ABSTRACT the plasma membrane and interact with the classical P4 receptor, is Progesterone mediates its physiological functions through activation of nonetheless effective at mediating non-genomic P4 signaling both transcription-coupled nuclear receptors and seven-pass- (Bandyopadhyay et al., 1998; Dressing et al., 2011; Peluso et al., transmembrane progesterone receptors (mPRs), which transduce 2002). These results argued for the presence of membrane P4 the rapid non-genomic actions of progesterone by coupling to various receptors that are distinct from the nuclear P4 receptors. In 2003, the signaling modules. However, the immediate mechanisms of action Thomas laboratory identified a family of membrane progesterone downstream of mPRs remain in question. Herein, we use an untargeted receptors (mPRs) from fish ovaries (Zhu et al., 2003a,b) that belong quantitative proteomics approach to identify mPR interactors to better to the progestin and adiponectin (AdipoQ) receptor family (also define progesterone non-genomic signaling. Surprisingly, we identify named PAQ receptors). However, the signal transduction cascade the very-low-density lipoprotein receptor (VLDLR) as an mPRβ downstream of mPRs that mediates the non-genomic actions of P4 (PAQR8) partner that is required for mPRβ plasma membrane remains unclear. localization. Knocking down VLDLR abolishes non-genomic The non-genomic action of mPR and the ensuing signaling progesterone signaling, which is rescued by overexpressing VLDLR. -
Progesterone Receptor Membrane Component 1 Promotes Survival of Human Breast Cancer Cells and the Growth of Xenograft Tumors
Cancer Biology & Therapy ISSN: 1538-4047 (Print) 1555-8576 (Online) Journal homepage: http://www.tandfonline.com/loi/kcbt20 Progesterone receptor membrane component 1 promotes survival of human breast cancer cells and the growth of xenograft tumors Nicole C. Clark, Anne M. Friel, Cindy A. Pru, Ling Zhang, Toshi Shioda, Bo R. Rueda, John J. Peluso & James K. Pru To cite this article: Nicole C. Clark, Anne M. Friel, Cindy A. Pru, Ling Zhang, Toshi Shioda, Bo R. Rueda, John J. Peluso & James K. Pru (2016) Progesterone receptor membrane component 1 promotes survival of human breast cancer cells and the growth of xenograft tumors, Cancer Biology & Therapy, 17:3, 262-271, DOI: 10.1080/15384047.2016.1139240 To link to this article: http://dx.doi.org/10.1080/15384047.2016.1139240 Accepted author version posted online: 19 Jan 2016. Published online: 19 Jan 2016. Submit your article to this journal Article views: 49 View related articles View Crossmark data Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=kcbt20 Download by: [University of Connecticut] Date: 26 May 2016, At: 11:28 CANCER BIOLOGY & THERAPY 2016, VOL. 17, NO. 3, 262–271 http://dx.doi.org/10.1080/15384047.2016.1139240 RESEARCH PAPER Progesterone receptor membrane component 1 promotes survival of human breast cancer cells and the growth of xenograft tumors Nicole C. Clarka,*, Anne M. Frielb,*, Cindy A. Prua, Ling Zhangb, Toshi Shiodac, Bo R. Ruedab, John J. Pelusod, and James K. Prua aDepartment of Animal Sciences, -
The Roles of Histone Deacetylase 5 and the Histone Methyltransferase Adaptor WDR5 in Myc Oncogenesis
The Roles of Histone Deacetylase 5 and the Histone Methyltransferase Adaptor WDR5 in Myc oncogenesis By Yuting Sun This thesis is submitted in fulfilment of the requirements for the degree of Doctor of Philosophy at the University of New South Wales Children’s Cancer Institute Australia for Medical Research School of Women’s and Children’s Health, Faculty of Medicine University of New South Wales Australia August 2014 PLEASE TYPE THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or Family name: Sun First name: Yuting Other name/s: Abbreviation for degree as given in the University calendar: PhD School : School of·Women's and Children's Health Faculty: Faculty of Medicine Title: The Roles of Histone Deacetylase 5 and the Histone Methyltransferase Adaptor WDR5 in Myc oncogenesis. Abstract 350 words maximum: (PLEASE TYPE) N-Myc Induces neuroblastoma by regulating the expression of target genes and proteins, and N-Myc protein is degraded by Fbxw7 and NEDD4 and stabilized by Aurora A. The class lla histone deacetylase HDAC5 suppresses gene transcription, and blocks myoblast and leukaemia cell differentiation. While histone H3 lysine 4 (H3K4) trimethylation at target gene promoters is a pre-requisite for Myc· induced transcriptional activation, WDRS, as a histone H3K4 methyltransferase presenter, is required for H3K4 methylation and transcriptional activation mediated by a histone H3K4 methyltransferase complex. Here, I investigated the roles of HDAC5 and WDR5 in N-Myc overexpressing neuroblastoma. I have found that N-Myc upregulates HDAC5 protein expression, and that HDAC5 represses NEDD4 gene expression, increases Aurora A gene expression and consequently upregulates N-Myc protein expression in neuroblastoma cells. -
Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes. -
PAQR6 Antibody (C-Term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP13667B
10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 PAQR6 Antibody (C-term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP13667B Specification PAQR6 Antibody (C-term) - Product Information Application WB,E Primary Accession Q6TCH4 Other Accession NP_940798.1, NP_079173.2 Reactivity Human Host Rabbit Clonality Polyclonal Isotype Rabbit Ig Calculated MW 37989 Antigen Region 283-312 PAQR6 Antibody (C-term) - Additional Information PAQR6 Antibody (C-term) (Cat. #AP13667b) Gene ID 79957 western blot analysis in Jurkat cell line lysates (35ug/lane).This demonstrates the PAQR6 Other Names antibody detected the PAQR6 protein (arrow). Progestin and adipoQ receptor family member 6, Progestin and adipoQ receptor family member VI, PAQR6 PAQR6 Antibody (C-term) - Background Target/Specificity The function of this protein remains unknown. This PAQR6 antibody is generated from rabbits immunized with a KLH conjugated PAQR6 Antibody (C-term) - References synthetic peptide between 283-312 amino acids from the C-terminal region of human PAQR6. Kamatani, Y., et al. Nat. Genet. 42(3):210-215(2010) Dilution Smith, J.L., et al. Steroids WB~~1:1000 73(11):1160-1173(2008) Tang, Y.T., et al. J. Mol. Evol. Format 61(3):372-380(2005) Purified polyclonal antibody supplied in PBS with 0.09% (W/V) sodium azide. This antibody is purified through a protein A column, followed by peptide affinity purification. Storage Maintain refrigerated at 2-8°C for up to 2 weeks. For long term storage store at -20°C in small aliquots to prevent freeze-thaw cycles. Precautions PAQR6 Antibody (C-term) is for research Page 1/3 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 use only and not for use in diagnostic or therapeutic procedures. -
Progesterone – Friend Or Foe?
Frontiers in Neuroendocrinology 59 (2020) 100856 Contents lists available at ScienceDirect Frontiers in Neuroendocrinology journal homepage: www.elsevier.com/locate/yfrne Progesterone – Friend or foe? T ⁎ Inger Sundström-Poromaaa, , Erika Comascob, Rachael Sumnerc, Eileen Ludersd,e a Department of Women’s and Children’s Health, Uppsala University, Sweden b Department of Neuroscience, Science for Life Laboratory, Uppsala University, Uppsala, Sweden c School of Pharmacy, University of Auckland, New Zealand d School of Psychology, University of Auckland, New Zealand e Laboratory of Neuro Imaging, School of Medicine, University of Southern California, Los Angeles, USA ARTICLE INFO ABSTRACT Keywords: Estradiol is the “prototypic” sex hormone of women. Yet, women have another sex hormone, which is often Allopregnanolone disregarded: Progesterone. The goal of this article is to provide a comprehensive review on progesterone, and its Emotion metabolite allopregnanolone, emphasizing three key areas: biological properties, main functions, and effects on Hormonal contraceptives mood in women. Recent years of intensive research on progesterone and allopregnanolone have paved the way Postpartum depression for new treatment of postpartum depression. However, treatment for premenstrual syndrome and premenstrual Premenstrual dysphoric disorder dysphoric disorder as well as contraception that women can use without risking mental health problems are still Progesterone needed. As far as progesterone is concerned, we might be dealing with a two-edged sword: while its metabolite allopregnanolone has been proven useful for treatment of PPD, it may trigger negative symptoms in women with PMS and PMDD. Overall, our current knowledge on the beneficial and harmful effects of progesterone is limited and further research is imperative. Introduction 1. -
PAQR6 (NM 001272108) Human Tagged ORF Clone – RG236776
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG236776 PAQR6 (NM_001272108) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: PAQR6 (NM_001272108) Human Tagged ORF Clone Tag: TurboGFP Symbol: PAQR6 Synonyms: PRdelta Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG236776 representing NM_001272108. Sequence: Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTCAGTCTCAAGCTGCCCCAACTTCTTCAAGTCCACCAGGTCCCCCGGGTGTTCTGGGAAGATGGC ATCATGTCTGGCTACCGCCGCCCCACCAGCTCGGCTTTGGACTGTGTCCTCAGCTCCTTCCAGATGACC AACGAGACGGTCAACATCTGGACTCACTTCCTGCCCACCTGTTTCCTGGAGCTGGAAAGCCCTGGGCTC AGTAAGGTCCTCCGCACAGGAGCCTTCGCCTATCCATTCCTGTTCGACAACCTCCCACTCTTTTATCGG CTCGGGCTGTGCTGGGGCAGGGGCCACGGCTGTGGGCAGGAGGCCCTGAGCACCAGCCATGGCTACCAT CTCTTCTGCGCGCTGCTCACTGGCTTCCTCTTCGCCTCCCACCTGCCTGAAAGGCTGGCACCAGGACGC TTTGATTACATCGGCCACAGCCACCAGTTATTCCACATCTGTGCAGTGCTGGGCACCCACTTCCAGCTG GAGGCAGTGCTGGCTGATATGGGATCACGCAGAGCCTGGCTGGCCACACAGGAACCTGCCCTGGGCCTG GCAGGCACAGTGGCCACACTGGTCTTGGCTGCAGCTGGGAACCTACTCATTATTGCTGCTTTCACAGCC ACCCTGCTTCGGGCCCCCAGTACATGCCCTCTGCTGCAGGGTGGCCCACTGGAGGGGGGTACCCAGGCC AAACAACAG ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAAAC This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View -
Expression of Progesterone Receptor Membrane Component 1 (PGRMC1
Hindawi Publishing Corporation BioMed Research International Volume 2016, Article ID 8065830, 12 pages http://dx.doi.org/10.1155/2016/8065830 Research Article Expression of Progesterone Receptor Membrane Component 1 (PGRMC1), Progestin and AdipoQ Receptor 7 (PAQPR7), and Plasminogen Activator Inhibitor 1 RNA-Binding Protein (PAIRBP1) in Glioma Spheroids In Vitro Juraj Hlavaty,1 Reinhard Ertl,2 Ingrid Miller,3 and Cordula Gabriel1 1 Institute of Anatomy, Histology and Embryology, University of Veterinary Medicine, 1210 Vienna, Austria 2VetCORE, Facility for Research, University of Veterinary Medicine, 1210 Vienna, Austria 3Institute of Medical Biochemistry, University of Veterinary Medicine, 1210 Vienna, Austria Correspondence should be addressed to Cordula Gabriel; [email protected] Received 27 January 2016; Revised 14 April 2016; Accepted 27 April 2016 Academic Editor: Emeline Tabouret Copyright © 2016 Juraj Hlavaty et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Objective. Some effects of progesterone on glioma cells can be explained through the slow, genomic mediated response via nuclear receptors; the other effects suggest potential role of a fast, nongenomic action mediated by membrane-associated progesterone receptors. Methods. The effects of progesterone treatment on the expression levels of progesterone receptor membrane component 1 (PGRMC1), plasminogen activator inhibitor 1 RNA-binding protein (PAIRBP1), and progestin and adipoQ receptor 7 (PAQR7) on both mRNA and protein levels were investigated in spheroids derived from human glioma cell lines U-87 MG and LN-229. Results. The only significant alteration at the transcript level was the decrease in PGRMC1 mRNA observed in LN-229 spheroids treated with 30 ng/mL of progesterone. -
PRODUCT SPECIFICATION Anti-PAQR9 Product
Anti-PAQR9 Product Datasheet Polyclonal Antibody PRODUCT SPECIFICATION Product Name Anti-PAQR9 Product Number HPA052798 Gene Description progestin and adipoQ receptor family member IX Clonality Polyclonal Isotype IgG Host Rabbit Antigen Sequence Recombinant Protein Epitope Signature Tag (PrEST) antigen sequence: IMLESWLFDLRGENPTLFVHF Purification Method Affinity purified using the PrEST antigen as affinity ligand Verified Species Human Reactivity Recommended IHC (Immunohistochemistry) Applications - Antibody dilution: 1:20 - 1:50 - Retrieval method: HIER pH6 Characterization Data Available at atlasantibodies.com/products/HPA052798 Buffer 40% glycerol and PBS (pH 7.2). 0.02% sodium azide is added as preservative. Concentration Lot dependent Storage Store at +4°C for short term storage. Long time storage is recommended at -20°C. Notes Gently mix before use. Optimal concentrations and conditions for each application should be determined by the user. For protocols, additional product information, such as images and references, see atlasantibodies.com. Product of Sweden. For research use only. Not intended for pharmaceutical development, diagnostic, therapeutic or any in vivo use. No products from Atlas Antibodies may be resold, modified for resale or used to manufacture commercial products without prior written approval from Atlas Antibodies AB. Warranty: The products supplied by Atlas Antibodies are warranted to meet stated product specifications and to conform to label descriptions when used and stored properly. Unless otherwise stated, this warranty is limited to one year from date of sales for products used, handled and stored according to Atlas Antibodies AB's instructions. Atlas Antibodies AB's sole liability is limited to replacement of the product or refund of the purchase price. -
Neuroprotection in Perimenopause New Insights for Hormone Therapy
ISSN: 2573-9565 Review Article Journal of Clinical Review & Case Reports Neuroprotection in Perimenopause New Insights for Hormone Therapy Manuela Cristina Russu MD, Ph.D *Corresponding author Manuela Cristina Russu: “Dr I Cantacuzino” Clinic of Obstetrics and Gynecology; “Carol Davila” University of Medicine and Pharmacy, Bucharest, 5-7 Ion Movilă Professor of Obstetrics and Gynecology Street, District 2, zip code 020745. Romania Submitted: 18 Mar 2020; Accepted: 25 Mar 2020; Published: 03 Apr 2020 Abbreviations a demented status to progress from early stages of endocrine aging FMP: Final Menstrual Period process [1]. HPOA: Hypothalamic-Pituitary-Ovarian Axis MT: Menopausal Transition Update on the importance of Hormone Therapy in perimenopause VMS: Vasomotor Symptoms The menopausal transition (MT) or perimenopause– 4 to 6 years MHT: Menopausal Hormone Therapy duration [2]. with reproductive and dynamic critical changes in ERT: Estrogen Replacement Therapy hypothalamic-pituitary-ovarian axis (HPOA), and entire women’s PCC: Posterior Cingulate Cortex body, biology and psychology, starts with menstrual irregularities MCI: Mild Cognitive Impairment from the stage -3b/-3a in the late reproductive ages, with ethnic AD: Alzheimer ’s disease differences in symptoms, hormones and their receptors and actions PD: Parkinson’s Disease [3, 4]. Aβ: Beta Amyloid CVD: Cerebrovascular Disease CAA: Cerebral Amyloid Angiopathy HS: Hippocampal Sclerosis 17ß-E2: 17ß-Estradiol CEE: Conjugated Equine Estrogens ERs: Estrogen Receptors Pg: Progesterone PRs: