Molecular Cloning and Characterization of an Antigen Associated with Early Stages of Melanoma Tumor Progression1

[CANCER RESEARCH 48, 2955-2962, June 1, 1988) Molecular Cloning and Characterization of an Antigen Associated with Early Stages of Melanoma Tumor Progression1

Hak Hotta, Alonzo H. Ross,2 Kay Huebner, Masaharu Isobe, Sebastian Wendeborn, Moses V. Chao, Robert P. Ricciardi, Yoshihide Tsujimoto, Carlo M. Croce, and Hilary Koprowski The Wistar Institute of Anatomy and Biology, Philadelphia, Pennsylvania 19104 [H. H., A. H. R., K. H., M. I., S. W., R. P. R., Y. T., C. M. C., H. KJ; Department of Microbiology, Kobe University School of Medicine, Kobe 650, Japan [H. H.]; and Department of Cell Biology and Anatomy, Cornell University Medical College, New York, New York 10021 [M. V. CJ

ABSTRACT melanomas. The antigen expression, however, is weaker or sometimes even negative in more advanced stages of melanoma The melanoma-associated antigen ME491 is expressed strongly during such as vertical growth phase primary melanoma and metastatic the early stages of tumor progression. The ME491 gene was molecularly melanoma. Because of its stage-specific expression, this antigen cloned by means of DNA-mediated gene transfer followed by screening a X genomic library with human repetitive Alu sequences as a probe. The has been considered as one of the interesting MAAs. ME491 cloned DNA, after transfection into mouse I .-cells, generated a protein antigen is also strongly expressed in adenocarcinomas of the with characteristics that were indistinguishable in Western blot analysis colon and prostate, and to a lesser degree in some other human from the ME491 antigen expressed by human melanoma cells. Repeat- tumors (8, 9). It is detected even on undifferentiated colorectal free subfragments of the cloned DNA were used for further studies. By carcinomas which lack most other gastrointestinal tumor-as Northern blot analysis, the subfragments detected a single 1.2-kilobase sociated antigens (9). mRNA in the transformants and various human melanoma cell lines. Biochemical analyses have shown that ME491 antigen is a ME491 complementary DNA clones were then obtained by probing a membrane-bound glycoprotein present both inside the cell and melanoma complementary DNA library with the genomic subfragments. at the cell surface the molecular weight of which ranges from Nucleotide sequence analysis of the cloned complementary DNA indi 30,000 to 60,000 with a single core protein of about 20,000 cated that the ME491 antigen consists of 237 amino acids (M, 25,475) (10). This heterogeneity is apparently due to A'-linked glycosyl- with four transmembrane regions and three putative JV-glycosylation sites. No significant structural homology was observed with other proteins ation since tunicamycin eliminates this heterogeneity. The thus far reported. We observed that the amounts of mRNA varied greatly NI I..-terminili amino acid sequence of ME491 antigen has been with different melanoma cell lines. Southern blot analysis revealed no determined for the first 20 amino acids and shows no homology amplification or rearrangement of the ME491 gene in the human mela with known proteins (10). Other investigators have independ noma cell lines tested, including both high and low expressors of this ently obtained MAbs which detect very similar or identical antigen. The ME491 gene has been mapped to chromosome region antigens and have characterized them in pathological and clin 12pl2â€”Â»12ql3by somatic cell hybrid analysis and more narrowly local ical studies (11-13). ized to 12ql2-Â»12ql4 by in situ hybridization. As a step toward understanding the significance of ME491 antigen for tumor progression, we have molecularly cloned the INTRODUCTION human gene and cDNA-encoding ME491 antigen. In the pres ent study, we describe the molecular cloning, expression, and Because melanoma is a pigmented, cutaneous lesion, it has chromosomal localization as well as nucleotide sequence analy been possible to observe the development of the disease and to sis of this antigen. develop a detailed model of melanocytic tumor progression (1). A large number of MAbs3 against human melanomas have been prepared to analyze the stages of progression (2â€”4).Most of MATERIALS AND METHODS these MAbs bind to both melanoma and the benign melanocytic DNA-mediated Gene Transfer to Mouse L-Cells lesion, the nevus, but not to normal tissue melanocytes. There are also a few MAbs that bind only to melanoma but not to High molecular weight DNA was isolated from human melanoma dysplastic nevi (3). Although the tissue distributions and mo cell line A87S and from human cervical carcinoma cell line HeLa, both lecular weights have been determined for many of these MAAs, of which express ME491 antigen.4 The DNA was cotransfected with the biological functions and relevance to tumor progression are purified herpes simplex virus thymidine kinase gene into Uk cells by little understood. Among the human MAAs, only two antigens, the calcium phosphate precipitate method as described (5, 14). After selection in a IS /Â¿g/ml-hypoxanthine-1 Â¿tg/mlaminopterin-5-Mg/ml M, 97,000 protein (4) and NGF receptor (5, 6), have been thymidine medium, resulting tk* colonies were screened with an im- characterized thus far by means of gene cloning. munological rosette assay (S) in which cells are incubated with MAb to ME491 antigen is a MAA which is a marker for the early ME491 antigen and then a second antibody (rabbit anti-mouse IgG) stages of tumor progression of human melanoma (7, 8). It is coupled to erythrocytes. Positive colonies were cloned and grown in not detected on normal tissue melanocytes but is strongly bulk to extract high molecular weight DNA. To reduce the amount of expressed in dysplastic nevi and radial growth phase primary extraneous human DNA, a second round of transfection was performed using DNA extracted from one of the primary transformants (MES).

Received 2/24/88; accepted 3/25/88. Genomic DNA Library The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in High molecular weight DNA from one of the secondary transform- accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1Supported by NIH Grants NS-21716, CA-25874, CA-10815, and RR-05540 ants (ST2-3) was partially digested with .VuÂ«3Arestrictionenzyme and and grants from the National Neurofibromatosis Foundation and the Dysautc- fractionated by 10 to 40% sucrose gradient uItracent rifugniion (IS). nomia Foundation. Fragments from 15-23 kilobases were ligated with both arms of EMBL 2To whom requests for reprints should be addressed, at The Worcester Foundation for Experimental Biology, 222 Maple Ave., Shrewsbury, MA 01S4S. 3 DNA (Promega Dioice, Madison, WI), packaged into phage particles 3The abbreviations used are: MAb, monoclonal antibody; MAA, melanoma- using a commercial packaging extract (Giga-Pack Gold; Stratagene, associated antigen; SDS, sodium dodecyl sulfate; cDNA, complementary DNA; SSC, standard saline-citrate. ' Unpublished observations. 2955

San Diego, CA), and then inoculated onto Escherichia coli NM539 to For regional localization of the ME491 gene on chromosome 12, make a genomic DNA library. This library was screened for human three mouse-human hybrids which had previously been observed to DNA sequences using human repetitive Alu sequences (16) as a probe. retain partial chromosomes 12 (22, 24) were used. The presence of a group of chromosome 12 DNA markers, including the ME491 gene, Southern and Northern Blot Analyses was determined in order to determine which parts of chromosome 12 were present or absent in the three hybrids. The chromosome 12-linked Total cellular DNA isolated from cultured cells and tissues was probes for T4, K-ros-2, homeobox gene C8, HPV 18 integration site digested with appropriate restriction enzymes, fractionated by agarose flanking region 7.16.1, and insulin-like growth factor I have been gel (0.8 or 1%) electrophoresis, and transferred to nitrocellulose filter described (22, 24-27). paper (15). To identify human DNA sequences present in the trans formed mouse cells, the transferred DNA was hybridized with nick- In Situ Hybridization. Metaphase spreads were prepared from nor mal human male lymphocyte cultures stimulated with phytohemagglu- translated "P-labeled human repetitive Alu sequences (16) in 50% tinin for 72 h. The 1.1-kilobase subcloned DNA fragment (pMel-17) formamide, 5x SSC (Ix SSC is 0.15 MNaCl plus 0.015 sodium citrate), was 'H labeled by nick-translation and hybridized to the metaphase 5x Denhardt's solution, and 100 tig of salmon sperm DNA per ml at 42"C for 20 h. To identify ME491 sequences in human and mouse- spreads as described elsewhere (26, 28, 29). human hybrid DNAs, filters were hybridized to radiolabeled pMel-17 DNA in the same hybridization mix without formamide at 65Â°C.The blots were washed with 0.2x SSC-0.1% SDS at 65Â°Cunless otherwise RESULTS stated, dried, and exposed to Kodak XAR-5 film at -70Â°C. DNA-mediated Gene Transfer to Mouse Ltk~ Cells. After Polyadenylated RNA isolated from cultured cells was denatured, transfection with high molecular weight DNA from human cell fractionated by electrophoresis through 1.5% agarose/formaldehyde lines HeLa and A875, positive colonies expressing ME491 gel, and transferred to nitrocellulose paper (15). Filters were hybridized antigen were obtained at a frequency of 1 per 10,000 tk+ with 32P-labeled probes under the same conditions used for Southern blot analysis. colonies. A stable primary transformant, MES, was derived from HeLa DNA and was used for further experiments. In the Cell Extracts and Western Blot Analysis second round of transfection using genomic DNA from the Cultured cells were swollen in hypotonie buffer, lysed by freeze- MES primary transformant, positive colonies were obtained at thawing, and centrifugea at 100,000 x g for 30 min as described practically the same frequency as that determined in the first elsewhere (10, 17). The membrane-containing pellet fraction was ex round. Southern blot analysis using human repetitive Alu se tracted with 0.5% Nonidet P-40-140 HIM NaCl-10 HIM NaF-10 HIM quences as a probe revealed that secondary transformants con Tris-5 IHMEDTA-100 Kallikrein lU/ml aprotinin-1 IHMphenylmeth- tained much smaller amounts of human DNA than did primary ylsulfonyl fluoride, pH 7.5, for 30 min at 4Â°C.The sample was then transformants and that two independent secondary transform- centrifuged at 100,000 x g for 30 min, and the supernatant was analyzed ants (ST1-1 and ST2-3) appeared to share some ^/Â«-positive by SDS-polyacrylamide gel (10%) electrophoresis. Fractionated pro fragments (6.8- and 3.2-kilobase BamHl fragments) (Fig. 1). teins were transferred electrophoretically to nitrocellulose paper and The human repetitive Alu sequences did not hybridize to Ltk~ incubated with mouse anti-ME491 MAb and then 125I-labeledgoat anti- DNA. These observations indicated that the gene encoding mouse IgG to visualize the antigen by autoradiography. ME491 antigen was very close to or even included in the 6.8- cDNA Library and/or 3.2-kilobase fragments. Molecular Cloning of Genomic DNA Sequences Encoding Polyadenylated RNA was isolated from WM1158 melanoma cells ME491 Antigen. An EMBL 3 genomic library was prepared by oligo-deoxythymidylate chromatography (18) and used to construct with DNA from one of the secondary transformants (ST2-3) a cDNA library in Xgtll as described (19) with certain modifications. and probed with human repetitive Alu sequences. Two Alu- Briefly, 25 ^g of polyadenylated RNA were used for the synthesis of the first strand using reverse transcriptase and oligodeoxythymidylate positive recombinant clones, designated XR31 and XR33, were (chain length, 12-18 residues) as primer. Second strand synthesis was obtained from 500,000 recombinant clones. Restriction enzyme performed with E. coli DNA polymerase I and E. coli RNase H as map analysis revealed that XR31 and XR33 partially overlapped described (20). The double strand cDNA was made blunt ended using and that the overlapping regions contained the ^/Â«-positive 6.8- T4 DNA polymerase and methylated with EcoRl methylase. Phospho- and 3.2-kilobase Marnili fragments detected by Southern blot rylated KcoRl linkers were ligated to the ends of the double strand analysis of the secondary transformants (Fig. 2). Another family cDNA, and excess linkers were removed by EcoRl endonuclease. The of human repetitive sequences was also mapped to the overlap cDNA was ligated into the Â£coRIsite of Xgtl 1 vector DNA, packaged ping regions. For further studies, fragments free of human in vitro, and inoculated onto K. coli Y1088 to make a cDNA library. repetitive sequences (pMel-29, pMel-17, and pMe2-13) were DNA Sequence Analysis subcloned into pBR322. To determine whether these genomic DNA fragments con Cloned cDNAs were digested with appropriate restriction endonu tained genetic information necessary for ME491 antigen clease to generate small fragments. The fragments were subcloned into expression, XR31 and XR33 DNA as well as a cloned mouse M13mp 18 and M13mp 19 vectors (Bethesda Research Laboratory, Inc., DNA (XR47) as a negative control were transfected into Ltk~ Gaithersburg, MD). Single strand DNA was prepared, and the nucleo- cells and expression of ME491 antigen was determined by the tide sequences were determined by the dideoxynucleotide chain termi nation method (21). Both strands were then sequenced. immunological rosette assay. Both XR31 and XR33 DNA could transform the cells to express the antigen (Table 1), suggesting Chromosome Mapping of the ME491 Gene that the gene necessary for ME491 antigen expression is located on the overlapping region. Digestion of XR31 DNA with Somatic Cell Hybrid Analysis. Isolation, propagation, and character Ramili or KcuRl prior to transfection completely abolished ization of parental cells and somatic cell hybrids used in this study have been described previously (22-24). DNAs extracted from the hybrids ME491 antigen expression, whereas Hindlll digestion did not and the parental cells were subjected to Southern blot analysis using a affect antigen expression (Table 1). subcloned DNA fragment (pMel-17; 1.1-kilobase BamHl-EcoRI frag To determine which subfragment(s) contains exon(s) for ment) as probe. This probe has been shown to hybridize to ME491 ME491 antigen, Northern blot analysis was done using the mRNA. subcloned fragments as a probe. pMe 1-17(1.1 -kilobase Bamlll- 2956

Table 1 Frequency of positive colonies after transfection with the recombinant DNA clones Mouse Ltk~ cells (1 x IO6)were transfected with 2 ^g of recombinant DNA clone, 100 ng of pTK, and 15 jig of Ltk~ DNA in the calcium phosphate kb precipitate. After 2 weeks in the hypoxanthine-aminopterin-thymidine selection medium, plates were screened by the immunological rosette assay. %of 23 â€” positive Recombinant DNA clones colonies XR31 50(1000)Â° 9.4 â€” XR31, Â«Â«milltreated 0(500) XR31,Â£coRI treated 0(200) 6.6 â€” XR31, ffmdlll treated 45(1000) XR33 70(1000) XR47 (mouse DNA) 0(2000) 4.4 â€” " Numbers in parentheses, approximate number of colonies tested.

pMe1-17 pMe1-29 pMe2-13

CO co m co co er co Â«e OC 2.3 â€” Z 2.0 â€”

28S â€” I Â» 18S â€”

*â€¢ 1 6 Fig. 1. Detection of human DNA sequences in primary and secondary trans formants using Alu repetitive sequences as a probe. Total cellular DNA was digested with Â«umili and separated on a 1% agarose gel (20 *ig/lane). After transfer to a nitrocellulose filter, the DNA was probed with 300 base pair Alu human repetitive sequence. (Washing conditions were 0.5x SSC-0.1% SDS at 65*C.) (Lane 1) N2C, a primary transformant which was generated by transfection of Ltk~ cells with total human DNA; (Lane 2) mouse I ik ; (Lane 3) a primary 123 4 5 transformant MES the DNA of which was used to generate secondary transform- Fig. 3. Detection of ME491 mRNA in L-XR33 and A875 human melanoma ants; (Lane 4) a secondary transformant ST2-3; (Lane 5) an independently obtained secondary transformant ST1-1-2; (Lane 6) Sill, a partially cloned cells. Polyadenylated RNA was separated on a 1.5% agarose/formaldehyde gel (3 Mg/lane). After transfer to a nitrocellulose filter, the RNA was probed with pMel- culture with 30% antigen-positive cells; the ST1-1-2 clone was derived from this 17 (Lanes 1, 2, and J), pMel-29 (Lane 4) or pMe2-13 (Lane 5). (Lane 1) Mouse culture. Ltk~; (Lane 2) A875; (Lanes 3, 4, and S) LXR33.

Identity of the Antigen Expression in L-XR33 and Human Melanoma Cells. The antigen expressed in the L-XR33 trans

EE HE HEB formant was biochemically characterized and compared with III that expressed in human melanoma cells. Western blot analysis of the membrane fractions from L-XR33 and A875 melanoma pMe1-29 I 1 cells showed practically the same pattern, i.e., a broad band pMe1-17 I 1

pMe2-13 I 1 with a molecular weight ranging from 30,000 to 60,000 (Fig. 4). This broad band has been observed in all melanoma cells Fig. 2. Restriction maps of ME491 genomic clones. XR3I and XR33 were cloned from a X genomic library prepared with secondary transformant ST2-3 thus far tested and may be the result of extensive and hetero DNA using Alu human repetitive sequences as a probe, n, mouse cellular se geneous glycosylation (8, 10). The cytosol fraction of L-XR33 quences which were identified by Southern blotting using Ltk~ DNA as a probe; cells contained almost no ME491 antigen (Fig. 4), in agreement â€¢.Aluhuman sequences; A, human repetitive sequences other than the Alu family. lÃ¬,H,and E, restriction sites for /fumili,EcoRl, andHindlll, respectively. pMel- with previous reports with melanoma cells (7). 29, pMel-17, and pMe2-13 are fragments subcloned into pBR322. kb, kilobase. Nucleotide Sequences and Deduced Amino Acid Sequences of ME491 Antigen. A Xgtll cDNA library prepared with mRNA from melanoma cell line WM 1158 was probed with the repeat- EcoRl fragment) strongly hybridized to a 1.2-kilobase poly- free genomic subfragments (pMel-17 or pMel-29), and several adenylated RNA from both a XR33 transformant (L-XR33) and overlapping clones were obtained. Fig. 5 shows the nucleotide human melanoma cell line A875 (Fig. 3). Note that the tran sequences and deduced amino acid sequences. The predicted script was much more abundant in L-XR33 than in A875 cells. amino acid sequence following the first ATG codon coincides pMel-29 (l.S-kilobase BamHl-EcoRl fragment), but not perfectly with the NH2-terminal amino acid sequence (Nos. 1 pMe2-13, was also shown to hybridize to the 1.2-kilobase to 20) of purified ME491 antigen except for No. 8 (Cys) which polyadenylated RNA from the L-XR33 transformant. was not previously assigned (10). The ME491 antigen consists 2957

<0 of 237 amino acids (M, 25,475) with three putative sites for N- linked glycosylation. Computer searches (NBRF Protein Data 0) o C Bank) revealed no significant homology with known proteins.

CTG TCT CTT ATC ATG TTG GTG GAG GTG GCC GCA GCC ATT GCT GGC TAT GTG TTT AGA GAT 327 differs greatly with different cell lines. WM98, WM35, LeuSerLeuIleMetLeuValGluValAlaAlaAla IleAlaGlyTyrValPheArgAsp 108 WM1158, and WM983-A cell lines are high expressors for AAG GTG ATG TCA GAG TTT AAT AAC AAC TTC CGG CAG CAG ATG GAG AAT TAC CCG AAA AAC 387 Lys Val Met Ser Glu Phe Asn Asn Asn Phe Arg Gin Gin Met Glu Asn Tyr Pro Lys Asn 128 ME491 antigen as judged by the immunological rosette assay, whereas A875 and HS294 are low expressors (data not shown). AAC CAC ACT GCT TCG ATC CTG GAC AGG ATG CAG GCA GAT TTT AAG TGC TGT GGG GCT GCT 447 AsnH1sThrAlaSerIleLeuAspArgMetGinAlaAspPheLysCysCysGlyAlaAla 148 Polyadenylated RNAs from some of the cell lines were analyzed AAC TAC ACÃ• GAT TGG GAG AAA ATC CCT TCC ATG TCG AAG AAC CGA GTC CCC GAC TCC TGC 507 by Northern blot analysis using the cloned DNA subfragment Asn Tyr Thr Asp Trp Glu Lys Ile Pro Ser Met Ser Lys Asn Arg Val Pro Asp Ser Cys 168 as a probe (Fig. 7). Consistent with results in the immunological TGCATTAATGTTACTGTGGGCTGTGGGATTAATTTCAACGAGAAGGCGATCCATAAGGAG 567 CysHe AsnValThrValGlyCysGlyIleAsnPheAsnGluLysAla IleH)sLysGlu 188 GGCTGTGTGGAGAAGATTGGGGGCTGGCTGAGGAAAAATGTGCTGGTGGTAGCTGCAGCA 627 GlyCysValGluLysIleGlyGlyTrpLeuArgLysAsnValLeuValValAlaAlaAla 208

GCC CTT GGA ATT GCT TTT GTC GAG GTT TTG GGA ATT GTC TTT GCC TGC TGC CTC GTG AAG 687 AlaLeuGlyIleAlaPheValGluValLeuGlyIleValPheAlaCysCysLeuValLys 228

AGT ATC AGA AGT GGC TAC GAG GTG ATG TAG GGGTCTGGTCTCCTCAGCCTCCTCATCTGGGGGAGTGGA 747 SerIleArgSerGlyTyrGluValMetEND 237

ATAGTATCCTCCAGGTTTTTCAATTAAACGGATTATTTTTTCA 790 \ r \ Fig. S. Complete nucleotide sequence of ME491 antigen and its predicted 50 100 150 200 primary amino acid sequence. MI .-terminal amino acid sequence of purified Amino acid position ME491 antigen (32) is underlined. Putative recognition sites for asparagine- Fig. 6. Hydrophobicity plot of predicted amino acid sequences of ME491 linked JV-glycosylation are double-underlined. A polyadenylation signal (AT antigen. Hydrophobicity indices were determined as described by Kyte and Doo- TA AA) (23) is dot-underlined. *, nucleotide position of +1. Right ordinate, little (31). / to /(, putative transmembrane regions; arwws, positions of aspara- nucleotide positions and amino acid coordinates of mature ME491 antigen. gines for putative A'-glycosylation sites. 2958

O CO co CO in eo cL^ 0^ co 00 CO ta O> o> co 05 00 O> S O) a> m in CO CM r^ 00 CO oo X Â§ 5 kb 285 â€” 23 â€” 9.4 â€”

18S â€” 4.4 â€”

2.3 â€” 2.0 â€”

12345 6 Fig. 7. Northern blot analysis of various human melanoma cell lines. Poly- adenylated RNA extracted from cultured cells was separated on a 1% agarose/ 1 2345678 formarmele gel (3 Â«ig/lane).After transfer to a nitrocellulose filter, the RNA was Fig. 8. Southern blot analysis of various melanoma cell lines. Total cellular probed with a 1.1-kilobase fragment of pMel-17. (Lane 1) WM98; (Lane 2) DNA (10 jig/lane) was digested with /tornili and separated electrophoretically HS294; (Lane 3) WM9, passage 19; (Lane 4) WM9, passage 130; (Lane 5) on a 1% agarose gel. After transfer to a nitrocellulose filter, DNA was probed WM35; (Lane 6) A875. with the 1.1-kilobase fragment of pMel-17. (Lane 1) WM98; (Lane 2) HS294; (Lane 3) WM9; (Lane 4) WM35; (Lane 5) A875; (Lane 6) WM1158; (Lane 7) WM983-A; (Lane 8) WI38 human fibroblasts. kb, kilobase. rosette assay, ME491 mRNA was much more abundant in WM98 and WM35 than in HS294 or A875 cells. The presence antigen, a panel of 18 DNAs derived from mouse-human hy of equal amounts of polyadenylated RNAs was verified by brids retaining defined overlapping subsets of human chromo probing with a housekeeping gene (phosphoglycerate kinase somes was tested for the presence of ME491 sequences by gene) (data not shown). To determine whether any significant analysis of hybrid DNA-containing Southern blots after hybrid difference in DNA levels might be responsible for altering gene ization with the pMel-17 subclone. Screening of hybrid DNAs expression, high molecular weight DNAs extracted from the by this method showed that ME491 sequences were present in above cell lines were subjected to Southern blot analysis using mouse-human hybrids retaining chromosome 12 and absent in the 1.1-kilobase fragment of pMel-17 (Fig. 8). No significant difference was observed between high expressors and low ex- hybrids which had lost chromosome 12. Fig. 10 summarizes these results. pressors in terms of intensity and size of DNA fragments In mapping genes to chromosome 12 in earlier experiments, corresponding to the ME491 gene. These results indicate that we had observed that some of the hybrid cells retained some there is no amplification or apparent rearrangement of the chromosome 12-linked genes but not others. Thus, we used ME491 gene. The additional weaker band(s) observed in every human DNA tested may indicate the presence of a ME491- hybrid cells M44cl2S5, M44cl2S9, and GL-3a to determine the order of some of the chromosome 12-linked genes, including related gene. Further studies including molecular cloning of the related gene will clarify this matter. The different pattern of the ME491. As shown in Table 2, all three hybrids retain ME491 weaker band for WM9 DNA appears to be due to restriction sequences, localizing the ME491 gene between 12pl2, where fragment length polymorphism, because DNA from peripheral K-ras-2 maps (27), and the SW756 papillomavirus integration site 7.16.1 at 12ql2-ql3 (24).5 blood lymphocytes of the same patient showed a pattern iden tical with that of WM9 melanoma DNA (data not shown). The assignment of the ME491 locus to human chromosome Cross-Species Sequence Homology of the ME491 Gene. Mon 12 was confirmed and refined by in situ hybridization of 3H- key DNA was obtained from the COS cell line (34) and mouse labeled pMel-17 plasmid DNA to metaphase chromosomes DNA from Ltk" and NIH/3T3 cells (35, 36). Rat and squirrel from peripheral blood lymphocytes of a normal male. After DNA were obtained from tissue spleen cells, and chicken DNA autoradiography, metaphase spreads were analyzed for grain was obtained from chick embryo. Southern blot analysis of localization. About 23% of all grains were located on the long these DNA samples using the 1.1-kilobase fragment of pMe 1- arm of chromosome 12. Over 82% of the 12q grains were 17 was performed to detect any cross-species sequence homol- between 12ql2 and 12ql4 with most grains at 12ql3. Fig. 11 ogy. Significant hybridization was observed to DNA from mon shows a histogram depicting the silver grain distribution among key, rat, mouse, and squirrel, but only negligible hybridization the human chromosomes. The long arm of chromosome 12 was detected with chick embryo under low stringency conditions (2x SSC-0.1% SDS at 65'C) (Fig. 9). Under high stringency represents approximately 3.3% of the haploid genome, and our observations that more than 19% of the pMel-17 probe hybrid conditions (0.2x SSC-0.1% SDS at 65Â°C),significant hybridi ization was localized to this region are highly significant (P < zation was observed only in human, monkey, and squirrel DNA 0.001). Thus cytological hybridization localizes the ME491 (data not shown). gene to the region between 12ql2 and 12ql4. Chromosomal Localization of ME491 Gene. To determine which human chromosome bears the gene for the ME491 5N. Popescu and J. DiPaolo, personal communication. 2959

CO Human Chromotomes C\J CM Hybrid 1 2345678 910111213141516171819202122 O) (O C C â€¢?Sf O) 0) O o 3 >â€¢ CO ^ o (0 E c c E E -3 O Q> * 1 3 Â£ S -5. E O) co I g " r 3 D a Â» = CT CT co o rr z CO co o < kb Â» 23- 9.4 â€” 6.6 â€”

4.4 â€” Fig. 10. Presence of ME491 sequences, in a panel of mouse-human hybrids. A summary figure showing human chromosomes (top abscissa) or chromosome regions present in a panel of mouse-human hybrids (left ordinate). Right ordinate column, positive or negative hybridization with the pMel-17 cloned probe rep resenting the ME491 gene. â€¢,hybrid named on the left contains the chromosome indicated at the top of the column; Eil.retention of the long arm of the chromosome â€¢indicated; D. retention of the short arm of the respective chromosome; stippling of larger or smaller fractions of the boxes, retention of more than or less than 2.3 â€” one arm of a chromosome; U, absence of the chromosome indicated. The column for chromosome 12 is boldly outlined and stippled to highlight the correlation of 2.0 â€” pattern of segregation of the pMel-17 probe with the pattern of retention of chromosome 12.

Table 2 Segregation of chromosome 12-linked probes in hybrids retaining partial chromosome 12 Hybrids B2 and 3c-9, which retain a complete chromosome 12, and C'll, which has lost chromosome 12, are described in Fig. 10. Each of the hybrids in 1 23456789 Table 2 was tested for the presence of each of the chromosome 12-linked genes Fig. 9. Detection of DNA sequences homologous to the ME49I gene in as described in the legend to Fig. 10. different species. Total cellular DNA (20 Â«ig/lane)was examined as described in Chromosome 12-linked DNA probes the legend for Fig. 8 except that washing was under less stringent conditions (2 x SSC-0.1% SDS at 65'C instead of 0.2x SSC-0.1% SDS at 65'C). (Lane 1) WI38 human fibroblasts; (Lane 2) COS monkey fibroblasts; (Lane 3) rat spleen cells; (Lane 4) Ltk" mouse fibroblasts; (Lane 5) NIH/3T3 mouse fibroblasts; C812pl2â€”T4 Hox factorI12q22â€” (Lane 6) squirrel spleen cells, A-2; (Lane 7) squirrel spleen cells, K-28; (Lane 8) K-r

2013105III cluster Hox-3 (22), and the SW756 HPV 18 integration site (24). Furthermore, Southern blot analysis revealed a possible M E491-related gene which hybridizes weakly to the cloned gene. Characterization of this ME491-related gene and com

*VlliP i iWil l'i 1il 11iifmjÃ lfih ' 'rqlÃf\JI'i â€¢i-i parison between the two genes should provide more information on this particular MAA. p1 q P q q345 p q p Z\ 20 ACKNOWLEDGMENTS Â« 15 K We are grateful to D. M. Jackson for technical assistance, Dr. A. O IO Sehgal for help in preparing primary transfectant MES, and Dr. A. b. Linnenbach for helpful discussions. Thanks are also due to Dr. M. O Colombo for providing rat and squirrel DNA and Dr. D. Ewert for ijhntt Â¿Â»JJLU. Â«f- uÃ providing chicken DNA. We also thank the Editorial Services Depart i P q P q P q P q p q ment of The Wistar Institute for preparing the manuscript. 3 6 7 IO II 12

2015IOS-â€¢â€¢.|P REFERENCES

1. Clark, W. H., Elder, D. E., Guerry, D., IV, Epstein, M. N., Green, M. H., and van Horn. M. The development and subsequent cellular evolution of the primary human cutaneous malignant melanomas. Hum. Pathol., Â¡5:1147- 1165, 1984. ti> 2. Herlyn, M., Thurin, J., Calaban, G., Bennicelli, J. L., Herlyn, D., Elder, D. q b q b q q qi q P q pq pq P q pq E., Bondi, E., Guerry, D., Nowell, P., Clark, W. H., and Koprowski, H. Characteristics of cultured human melanocytes isolated from different stages 13 1 14 1 15P 16ÃœJP17 1"finii"18 119 120 211Pq22 X 1Y of tumor progression. Cancer Res-, 45: 5670-5676, 1985. 3. Herlyn, M., Clark, W. H., Rodeck, U., Mancianti, M-A., Jambrosic, J., and Koprowski, H. Biology of disease: biology of tumor progression in human CHROMOSOMES melanocytes. Lab. Invest., 56:461-474, 1987. Fig. 11. Localization of ME491 gene in the human genome by in situ hybrid 4. Rose, T. M., Plowman, G. D., Teplow, D. B., Dreyer, W. J., Hellstrom, K. ization analysis. The diagram shows the grain distribution in 108 metaphases. E., and Brown, J. P. Primary structure of the human melanoma-associated Abscissa, chromosomes in their relative size proportion; ordinate, number of silver antigen p97 (melanotransferrin) deduced from the mRNA sequence. Proc. grains. The distribution of 198 grains on 108 spreads was scored; 38 were found Nati. Acad. Sci. USA, 83: 1261-1265, 1986. over 12ql2â€”12ql4. 5. Chao, M. V., Bothwell, M. A., Ross, A. H., Koprowski, H., Lanathan. A. A., Buck, C. R., and Sehgal, A. Gene transfer and molecular cloning of the human NGF receptor. Science (Wash. DC), 232: 518-521, 1986. acting factors which fully activate the polyoma virus enhancer 6. Johnson, D., Lanahan, A., Buck, C. R., Sehgal, A., Morgan, C., Mercer, E., Bothwell, M., and Chao, M. Expression and structure of the human NGF sequence and that NIH/3T3 cells lack these factors (40). Thus, receptor. Cell, 47: 545-554, 1986. a /ra/Â«-acting factor(s) might be responsible for ME491 gene 7. Atkinson, B., Ernst, C. S., Christ, B. F. D., Herlyn, M., Blaszczyk, M., Ross, activation. A. H., Herlyn, D., Steplewski, Z., and Koprowski, H. Identification of melanoma-associated antigens using fixed tissue screening of antibodies. The observation that the ME491 sequence is conserved Cancer Res., 44: 2577-2581, 1984. among different species suggests that this antigen has an im 8. Atkinson, B., Ernst, C. S., Christ, B. F. D., Ross. A. H., Clark, W. H., portant biological function. Nucleotide sequence analysis has Herlyn, M., Herlyn, D., Maul, G., Steplewski, Z., and Koprowski, H. Monoclonal antibody to a highly glycosylated protein reacts in fixed tissue suggested that ME491 antigen is a membrane-bound protein with melanoma and other tumors. Hybridoma, 4: 243-255, 1985. with four transmembrane regions. No structural homology was 9. Ernst, C. S., Shen, J.-W., Litwin, S., Herlyn, M., Koprowski, H., and Sears, H. F. Multiparameter evaluation of the expression in situ of normal and found with known proteins, suggesting that this is a novel tumor-associated antigens in human colorÃ©ela!carcinoma. J. Nati. Cancer protein. Although we do not yet know the biological function Inst., 77:387-395, 1986. of ME491 antigen, it is significant that this antigen is strongly 10. Ross, A. H., Dietzschold, B., Jackson, D. M., Barley, J. J., Jr., Christ, B. F. D., Atkinson, B., and Koprowski, H. Isolation and amino terminal sequenc expressed in the early stages of tumor progression of melanoma. ing of a novel melanoma-associated antigen. Arch. Biochem. Biophys., 242: We were unable to test the oncogenic function of this gene in 540-548, 1985. NIH/3T3 cells because of the lack of expression. On the other 11. Sikora, L. K. J., Pinto, A., Demetric, D. J., Dixon, W. T., Urbanski, S. J., hand, the ME491 gene may serve as a rapid growth-inhibitory Temple, W., and Jerry, L. M. Characterization of a novel neuroglandular antigen (NGA) expressed on abnormal human melanocytes. Int. J. Cancer, gene. This idea comes from the observations that decrease or 39:138-145, 1987. disappearance of ME491 expression in melanoma in vivo co 12. Vennegoor, C., Calafat, J., Hageman, P., van Buttenen, F., Janssen, H., Kolk, A., and RÃ¼mke,P. Biochemical characterization and cellular localiza incides with tumor progression towards more malignant stages tion of a formalin-resistant melanoma-associated antigen reacting with (7, 8) and that dysplastic nevi and radial growth phase mela monoclonal antibody NKI/C-3. Int. J. Cancer, 35: 287-295, 1985. 13. Vennegoor, C., and RÃ¼mke,P. Circulating melanoma-associated antigen noma, both of which strongly express this antigen in vivo, hardly detected by monoclonal antibody NKI-C-3. Cancer luminimi. Immunother., grow in vitro in contrast to other stages of melanocytic cells 25:93-100, 1986. (3). It will be important to know if this antigen plays a role in 14. Wigler, M., Pellicer, A., Silverstein, S., and Axel, R. Biochemical transfer of single-copy eucaryotic genes using total cellular DNA as donor. Cell, 14: either progression or suppression of melanoma. We are cur 725-731, 1978. rently preparing an expression system for this antigen under 15. Maniatis, T., Fritsch, E. F., and Sambrook, J. Molecular Cloning: A Labo the control of a strong viral promoter and enhancer, which will ratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982. enable us to study any stimulatory or inhibitory effects of 16. Jelinek, M. R., Toomey, T. P., Leinwand, L., Duncun, C. H., Biro, P. A., ME491 antigen on the functions of other oncogenes in an NIH/ Chondary, P. V., Weisman, S. M., Rubin, C. M., Houck, C. M., Deininger, P. L., and Schmid, C. W. Ubiquitous, interspersed repeated sequences in 3T3 transformation assay. mammalian genomes. Proc. Nati. Acad. Sci. USA, 77: 1398-1402, 1980. It will also be of interest to determine any relationship 17. Ross, A. H., Pleasure, D., Sonnenfeld, K., Atkinson, B., Kreider, B., Jackson, between the ME491 gene, which maps to 12ql2â€”Â»12ql3,and D. M., Tabb, I., Scarpini, E., Lisak, R. P., and Koprowski, H. Expression of melanoma-associated antigens by normal and neurofibroma Schwann cells. other genes located in the same region of chromosome 12 such Cancer Res., 46: 5887-5892, 1986. as glioma-associated gene gli (41), int \ (42), horneo box gene 18. Aviv, H., and Leder. P. Purification of biologically active globin messenger 2961

RNA by chromatography on oligothymidylic acid-cellulose. Proc. Nati. Acad. 30. Mueckler, M., Caruso, C., Baldwin, S. A., Panico, M., Blench, I., Morris, H. Sci. USA, 69:1408-1412, 1972. R., Allard, W. J., Lienhard, G. E., and Lodish, H. F. Sequence and structure 19. Huynh, T. V., Young, R. A., and Davis, R. W. Constructing and screening of a human glucose transporter. Science (Wash. DC), 229:941-945, 1985. cDNA libraries in Agt 10 and Xgt 11. In: D. H. Glover (ed.), DNA Cloning, 31. Kyte, J., and Doolittle, R. F. A simple method for displaying the hydropathic a Practical Approach, pp. 49-78. Oxford, England: IRL Press, 1985. character of a protein. J. Mol. Biol., 157: 105-132, 1982. 20. Gubler, 1'.. and Hoffman, B. J. A simple and very efficient method for 32. Kozak, M. Possible role of flanking nucleotides in recognition of the AUG generating cDNA libraries. Gene, 25: 263-269, 1983. initiator codon by eukaryotic ribosomes. NucÃ.Acids Res., 9: 5233-5252, 21. Sanger, F., Nicklen, S., and Coulson, A. R. DNA sequencing with chain- 1981. termination inhibitors. Proc. Nati. Acad. Sci. USA, 74: 5463-5467, 1977. 33. Young, D., Waitches, G., Birchmeier, C., Fasano, O., and Wigler, M. 22. Cannizzaro, L. A., Huebner, K., Griffen, C. A., Simeone, A., Boncinelli, E., Isolation and characterization of a new cellular oncogene encoding a protein and Croce, C. M. Human horneo box-containing genes located at chromo with multiple potential transmembrane domains. Cell, 45: 711-719, 1986. some regions 2q31-Â»2q37 and 12ql2â€”>12ql3. Am. J. Hum. Genet., 41: 1- 34. Gluzman, Y. SV40-transformed simian cells support the replication of early 15, 1987. SV40 mutants. Cell, 23: 175-182. 1981. 23. Dalla Pavera, R., Bregni, M., Erickson, J., Patterson, D., Gallo, R. C., and 35. Jainchill, J. L., Aaronson, S. A., and Todaro, G. J. Murine sarcoma and Croce, C. M. Human c-myc one gene is located on the region of chromosome leukemia viruses: assay using clonal lines of contact-inhibited mouse cells. J. 8 that is translocated in Burkitt lymphoma cells. Proc. Nati. Acad. Sci. USA, Virol., 4: 549-553, 1969. 79:7824-7827, 1982. 36. Kit, S., Dubbs, D., Piekarski, L., and Hsu, T. Deletion of thymidine kinase 24. Durst, M., Croce, C. M., Gissman, L., Schwarz, E., and Huebner, K. activity from L cells resistant to bromodeoxyuridine. Exp. Cell Res., 31: Papillomavirus sequences integrate near cellular oncogenes in some cervical 297-312, 1963. carcinomas. Proc. Nati. Acad. Sci. USA, 84:1070-1074, 1987. 37. Bishop, J. M. The molecular genetics of cancer. Science (Wash. DC), 235: 25. Brissenden, J. E., Ullrich, A., and Francke, U. Human chromosomal mapping 305-311, 1987. of genes for insulin-like growth factors I and II and epidermal growth factor. 38. Croce, C. M. Role of chromosome translocations in human neoplasia. Cell, Nature (Lond.), 310: 781-784, 1984. 49: 155-156, 1987. 26. Isobe, M., Huebner, K., Maddon, P. J., Liftman, D. R., Axel, R., and Croce, 39. Taya, Y., Terada, M., and Sugimura, T. Role of oncogene amplificai imi in C. M. The gene encoding the T-cell surface protein T4 is located on human tumor progression. Adv. Viral Oncol., 7: 141-153, 1987. chromosome 12. Proc. Nati. Acad. Sci. USA, 83:4399-4402, 1986. 40. Wasylyk, C., Imler, J. L., Perez-Mutul, J., and Wasylyk, B. The c-Ha-roj 27. McBride, O. W., Swan, D. C, Tronick, S. R., Gol, R., Klimanis, D., Moore, oncogene and a tumor promoter activate the polyoma virus enhancer. Cell, D. E., and Aaronson, S. A. Regional chromosomal localization of N-ros, K- 48: 525-534, 1987. ras-l, K-nu-2 and myh oncogenes in human cells. NucÃ.Acids Res., II: 41. Kinzler, K. W., Bigner, S. H., Bigner, D. D., Trent, J. M., Law, M. L., 8221-8235, 1983. O'Brien, S. J., Wong, A. J., and Vogelstein, B. Identification of an amplified, 28. Cannizzaro, L. A., and Emanuel, B. S. An improved method for G-banding highly expressed gene in a human glioma. Science (Wash. DC), 236: 70-73, chromosomes after in situ hybridization. Cytogenet. Cell Genet., 38: 308- 1987. 309, 1984. 42. van't Veer, L. J., van Kessel, A. G., van Heerikhuizen, H., van Ooyen, A., 29. Harper, M. E., and Saunders, G. F. Localization of single copy DNA and NÃ¼sse,R.Molecular cloning and chromosomal assignment of the human sequences of G-banded human chromosomes by in situ hybridization. Chro- homolog of i'nf-1, a mouse gene implicated in mammary tumorigenesis. Mol. mosoma (Beri.), 83:431-439, 1981. Cell Biol., 4: 2532-2534, 1984.

2962

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 1988 American Association for Cancer Research. Molecular Cloning and Characterization of an Antigen Associated with Early Stages of Melanoma Tumor Progression

Hak Hotta, Alonzo H. Ross, Kay Huebner, et al.

Cancer Res 1988;48:2955-2962.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/48/11/2955

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/48/11/2955. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.