DOCSLIB.ORG

TAZ/Wnt-Β-Catenin/C-MYC Axis Regulates Cystogenesis in Polycystic Kidney Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
TAZ/Wnt-Β-Catenin/C-MYC Axis Regulates Cystogenesis in Polycystic Kidney Disease TAZ/Wnt-β-catenin/c-MYC axis regulates cystogenesis in polycystic kidney disease Eun Ji Leea,1, Eunjeong Seob,1, Jin Won Kimb, Sun Ah Namb, Jong Young Leeb, Jaehee Juna, Sumin Oha, Minah Parka, Eek-hoon Jhoc, Kyung Hyun Yooa, Jong Hoon Parka,2, and Yong Kyun Kimb,d,2 aDepartment of Biological Science, Sookmyung Women’s University, 04310 Seoul, Republic of Korea; bCell Death Disease Research Center, College of Medicine, The Catholic University of Korea, 06591 Seoul, Korea; cDepartment of Life Science, University of Seoul, 02504 Seoul, Republic of Korea; and dDepartment of Internal Medicine, College of Medicine, The Catholic University of Korea, St. Vincent’s Hospital, 16247 Suwon, Republic of Korea Edited by Janet Rossant, The Gairdner Foundation, Toronto, ON, Canada, and approved September 28, 2020 (received for review May 11, 2020) Autosomal-dominant polycystic kidney disease (ADPKD) is the pathway, increased β-catenin activity in the kidneys (12). Fur- most common genetic renal disease, primarily caused by germline thermore, Wnt/β-catenin signaling or its target genes such as mutation of PKD1 or PKD2, leading to end-stage renal disease. The c-Myc may regulate cystogenesis in the mouse kidney (11, 13, 14). Hippo signaling pathway regulates organ growth and cell prolif- Therefore, we focused on deciphering the role of TAZ, a Hippo eration. Herein, we demonstrate the regulatory mechanism of cys- effector, in regulating cystogenesis in ADPKD. togenesis in ADPKD by transcriptional coactivator with PDZ- Herein, we elucidate a mechanism by which TAZ promotes binding motif (TAZ), a Hippo signaling effector. TAZ was highly the activation of Wnt/β-catenin signaling in the kidney of Pkd1- expressed around the renal cyst-lining epithelial cells of Pkd1- deficient mice and show that it increases c-Myc transcript levels. deficient mice. Loss of Taz in Pkd1-deficient mice reduced cyst for- Basal YAP1/TAZ expression levels were high around the cyst- mation. In wild type, TAZ interacted with PKD1, which inactivated lined cells in the kidneys of Pkd1-deficient mice and patients with β-catenin. In contrast, in PKD1-deficient cells, TAZ interacted with ADPKD and were associated with high c-MYC and β-catenin AXIN1, thus increasing β-catenin activity. Interaction of TAZ with expression levels. The loss of TAZ in Pkd1-deficient mice AXIN1 in PKD1-deficient cells resulted in nuclear accumulation of resulted in low levels of the c-MYC protein and was observed to TAZ together with β-catenin, which up-regulated c-MYC expres- delay the progression of PKD. In vitro studies revealed that sion. Our findings suggest that the PKD1–TAZ–Wnt–β-catenin– PKD1 mostly interacted with TAZ in wild-type cells, but its c-MYC signaling axis plays a critical role in cystogenesis and might absence allowed TAZ to strongly interact with AXIN1, thereby MEDICAL SCIENCES be a potential therapeutic target against ADPKD. resulting in a weak interaction between β-catenin and AXIN1. We further observed that c-MYC expression, which causes cys- polycystic kidney | TAZ | c-myc togenesis in mouse kidney, was directly regulated by TAZ and β-catenin in PKD1-deficient cells. Overall, our results show that utosomal-dominant polycystic kidney disease (ADPKD) is the TAZ–β-catenin–c-MYC axis is responsible for renal cysto- Athe most common inherited kidney disease, caused by ge- genesis in Pkd1-deficient mice. Based on these findings, we netic mutations in PKD1 or PKD2, which leads to end-stage renal disease. Polycystins, the transmembrane proteins encoded by Significance PKD1 or 2, are nonselective cation channels transporting calcium ions into the cells. Disruption of polycystic kidney disease (PKD) Autosomal-dominant polycystic kidney disease (ADPKD) is the genes impairs intracellular calcium homeostasis and results in most common genetic renal disease, primarily caused by the development of numerous fluid-filled cysts from abnormally germline mutation of PKD1 or PKD2, leading to end-stage proliferating renal tubular cells. It is also accompanied by in- renal disease. There are few cures for ADPKD, although terstitial inflammation and fibrosis around the cyst-lining cells, many researchers are trying to find a cure. The Hippo signaling ultimately reaching end-stage renal disease (ESRD) (1, 2). pathway regulates organ growth and cell proliferation. Tran- The Hippo signaling cascades are essential to control organ scriptional coactivator with PDZ-binding motif (TAZ) is a Hippo size, differentiation, and tissue regeneration. These are highly signaling effector. In this study, we demonstrated that the coordinated processes in which more than 30 core proteins are PKD1–TAZ–Wnt–β-catenin–c-MYC signaling axis plays a critical involved in responding to the mechanical stimuli from the cel- role in cystogenesis. Endo IWR1 treatment, which inhibited lular microenvironment. Activated Hippo kinase cascades, in- β-catenin activity via AXIN stabilization, reduced cyst growth in cluding sterile 20-like kinase 1/2 (MST1/2) and large tumor an ADPKD model. Our findings provide a potential therapeutic suppressor 1/2 (LATS1/2), lead to the phosphorylation of their target against ADPKD and would be important for clinical downstream effectors, YAP1/TAZ, followed either by their cy- translation. tosolic retention or degradation, thus preventing their nuclear localization (3–5). Inactivation of the Hippo pathway increases Author contributions: E.J.L., E.S., J.J., E.J., J.H.P., and Y.K.K. designed research; E.J.L., E.S., the nuclear localization of YAP1 and TAZ, which interact with J.W.K., S.A.N., J.Y.L., J.J., and M.P. performed research; E.J.L., E.S., E.J., J.H.P., and Y.K.K. contributed new reagents/analytic tools; E.J.L., E.S., J.W.K., S.A.N., J.Y.L., J.J., S.O., M.P., the TEAD family transcription factors and drive the expression E.J., K.H.Y., J.H.P., and Y.K.K. analyzed data; and E.J.L., E.S., J.H.P., and Y.K.K. wrote of target genes, such as CTGF, CYR61, and c-MYC (4, 6). the paper. Recently, the role of Hippo signaling pathway has emerged in The authors declare no competing interest. the formation of cysts in ADPKD (7, 8). A previous study has This article is a PNAS Direct Submission. c-MYC reported that YAP1 and its transcriptional target, , me- This open access article is distributed under Creative Commons Attribution-NonCommercial- diate cystic kidney pathogenesis in Pkd1-deficient mice, and a NoDerivatives License 4.0 (CC BY-NC-ND). – – RhoA YAP c-MYC axis was suggested to be involved in the 1E.J.L. and E.S. contributed equally to this work. – pathogenesis of ADPKD (9 11). 2To whom correspondence may be addressed. Email: [email protected] or However, the role of Hippo signaling pathway in cystogenesis [email protected]. in ADPKD remains unclear. TAZ may regulate the Wnt/β-cat- This article contains supporting information online at https://www.pnas.org/lookup/suppl/ enin signaling. We previously reported that intrinsic activation of doi:10.1073/pnas.2009334117/-/DCSupplemental. TAZ by genetic deletion of WW45, a component of the Hippo First published October 29, 2020. www.pnas.org/cgi/doi/10.1073/pnas.2009334117 PNAS | November 17, 2020 | vol. 117 | no. 46 | 29001–29012 Downloaded by guest on September 24, 2021 suggest that the TAZ–β-catenin–c-MYC axis is a potential ther- to those in Pkd1-deleted mice, indicating that reduced TAZ apeutic target for ADPKD. expression enhanced renal function (Fig. 3B). Next, we examined whether the increased expression of active β-catenin and c-MYC Results in the kidney of Pkd1-null mice was modulated by the reduction YAP1/TAZ and c-MYC Are Increased in the Kidney of Pkd1-Targeted in TAZ levels. As a result, TAZ mutation in Pkd1-deleted mice Mice and Patients with ADPKD. We used renal collecting duct- reduced the levels of active β-catenin and c-MYC in the kidney specific Pkd1-knockout mice as previously described (15). To (Fig. 3C). Immunofluorescent analyses also revealed that the determine whether the expression of TAZ correlated with those increased signals were significantly reduced in Pkd1/Taz double- of β-catenin and c-MYC in Pkd1-null kidney, we first assessed knockout kidneys (Fig. 3 D–F). In addition, cell proliferation, protein levels of TAZ and c-MYC in the kidney of Pkd1-deleted which was hyperactivated around the cysts derived by Pkd1 de- mice and found that their levels, along with the level of active letion, was inhibited in double-knockout kidneys (Fig. 3G). β-catenin protein, were highly up-regulated (Fig. 1A). The Consistently, a strong increase in fibrosis score in Pkd1-null mRNA levels of c-Myc, a known target of β-catenin or YAP1/ kidneys, which was indicated either by Masson’s trichrome TAZ, were enhanced in the kidney of Pkd1-null mice (Fig. 1B). staining or immunohistochemical staining for collagen IV, was To ensure the collecting duct-specific deletion of Pkd1 that is restored in Pkd/Taz double-knockout ones (Fig. 3H). Collec- followed by the development of renal cysts, we costained col- tively, these results suggested that reduction in the TAZ ex- lecting duct-specific marker (DBA) with target proteins. We pression alleviated the PKD phenotype and was accompanied by have confirmed that all of the cyst-lined cells were stained with decreased expression of active β-catenin and c-MYC. DBA, and, furthermore, accumulation of TAZ and c-MYC was increased, in the Pkd1-deleted kidneys (Fig. 1 C–F). In addition, In Vitro Cystogenesis Is Stimulated by the Increase in TAZ Levels, and β-catenin was activated in both cyst-lined epithelia and periph- Wnt Inhibition Attenuates Its Effect.
Load more

Recommended publications
  • Targeted Kinase Inhibitor Profiling Using a Hybrid Quadrupole-Orbitrap Mass Spectrometer
    Targeted Kinase Inhibitor Profiling Note Application Using a Hybrid Quadrupole-Orbitrap Mass Spectrometer 1 2 3 Scott Peterman , Ryan D. Bomgarden , Rosa Viner 574 1Thermo Fisher Scientific, Cambridge, MA;2 Thermo Fisher Scientific, Rockford, IL; 3Thermo Fisher Scientific, San Jose, CA Key Words An emerging technology for identifying kinase inhibitor Q Exactive, targeted peptide quantification, msxSIM, kinome profiling by targets is based on chemical proteomic profiling of kinase MS, desthiobiotin nucleotide probes inhibitor specificity and binding affinity. This technology combines mass spectrometry (MS)-based identification Goal and quantitation with small molecule probe binding and To identify and quantify kinase inhibition by staurosporine using kinase enrichment to determine kinase active site occupancy active sites probes in combination with targeted, multiplexed SIM (msxSIM). during inhibition. One of these methods uses novel biotinylated ATP and/or ADP probes that irreversibly react with conserved lysine residues of kinase ATP binding Introduction sites.1,2 Selective enrichment of active-site peptides from Protein kinases are key enzymes involved in a wide array labeled kinase digests dramatically reduces background of complex cellular functions and pathways. Misregulation matrix and increases signal for MS analysis of low- or mutation of protein kinases underlies numerous disease abundance kinase peptides. Using this method, more than states, including tumorigenesis, making them ideal candidates 400 different protein and lipid kinases from various for drug development. However, identifying specific mammalian tissues and cell lines have been identified and kinase inhibitors is challenging due to the high degree of functionally assayed using targeted acquisition on an ion homology among subfamily members of the 500+ human trap mass spectrometer.1 The assays are available kinases.
    [Show full text]
  • Overlap of Vitamin a and Vitamin D Target Genes with CAKUT- Related Processes [Version 1; Peer Review: 1 Approved with Reservations]
    F1000Research 2021, 10:395 Last updated: 21 JUL 2021 BRIEF REPORT Overlap of vitamin A and vitamin D target genes with CAKUT- related processes [version 1; peer review: 1 approved with reservations] Ozan Ozisik1, Friederike Ehrhart 2,3, Chris T Evelo 2, Alberto Mantovani4, Anaı̈s Baudot 1,5 1Aix Marseille University, Inserm, MMG, Marseille, 13385, France 2Department of Bioinformatics - BiGCaT, Maastricht University, Maastricht, 6200 MD, The Netherlands 3Department of Bioinformatics, NUTRIM/MHeNs, Maastricht University, Maastricht, 6200 MD, The Netherlands 4Istituto Superiore di Sanità, Rome, 00161, Italy 5Barcelona Supercomputing Center (BSC), Barcelona, 08034, Spain v1 First published: 18 May 2021, 10:395 Open Peer Review https://doi.org/10.12688/f1000research.51018.1 Latest published: 18 May 2021, 10:395 https://doi.org/10.12688/f1000research.51018.1 Reviewer Status Invited Reviewers Abstract Congenital Anomalies of the Kidney and Urinary Tract (CAKUT) are a 1 group of abnormalities affecting the kidneys and their outflow tracts, which include the ureters, the bladder, and the urethra. CAKUT version 1 patients display a large clinical variability as well as a complex 18 May 2021 report aetiology, as only 5% to 20% of the cases have a monogenic origin. It is thereby suspected that interactions of both genetic and 1. Elena Menegola, Università degli Studi di environmental factors contribute to the disease. Vitamins are among the environmental factors that are considered for CAKUT aetiology. In Milano, Milan, Italy this study, we collected vitamin A and vitamin D target genes and Any reports and responses or comments on the computed their overlap with CAKUT-related gene sets.
    [Show full text]
  • Dysfunctional Mechanotransduction Through the YAP/TAZ/Hippo Pathway As a Feature of Chronic Disease
    cells Review Dysfunctional Mechanotransduction through the YAP/TAZ/Hippo Pathway as a Feature of Chronic Disease 1, 2, 2,3, 4 Mathias Cobbaut y, Simge Karagil y, Lucrezia Bruno y, Maria Del Carmen Diaz de la Loza , Francesca E Mackenzie 3, Michael Stolinski 2 and Ahmed Elbediwy 2,* 1 Protein Phosphorylation Lab, Francis Crick Institute, London NW1 1AT, UK; [email protected] 2 Department of Biomolecular Sciences, Kingston University, Kingston-upon-Thames KT1 2EE, UK; [email protected] (S.K.); [email protected] (L.B.); [email protected] (M.S.) 3 Department of Chemical and Pharmaceutical Sciences, Kingston University, Kingston-upon-Thames KT1 2EE, UK; [email protected] 4 Epithelial Biology Lab, Francis Crick Institute, London NW1 1AT, UK; [email protected] * Correspondence: [email protected] These authors contribute equally to this work. y Received: 30 November 2019; Accepted: 4 January 2020; Published: 8 January 2020 Abstract: In order to ascertain their external environment, cells and tissues have the capability to sense and process a variety of stresses, including stretching and compression forces. These mechanical forces, as experienced by cells and tissues, are then converted into biochemical signals within the cell, leading to a number of cellular mechanisms being activated, including proliferation, differentiation and migration. If the conversion of mechanical cues into biochemical signals is perturbed in any way, then this can be potentially implicated in chronic disease development and processes such as neurological disorders, cancer and obesity. This review will focus on how the interplay between mechanotransduction, cellular structure, metabolism and signalling cascades led by the Hippo-YAP/TAZ axis can lead to a number of chronic diseases and suggest how we can target various pathways in order to design therapeutic targets for these debilitating diseases and conditions.
    [Show full text]
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Clinicopathological and Molecular Genetic Analysis of Low-Grade Glioma in Adults
    A CLINICOPATHOLOGICAL AND MOLECULAR GENETIC ANALYSIS OF LOW-GRADE GLIOMA IN ADULTS Presented by ANUSHREE SINGH MSc A thesis submitted in partial fulfilment of the requirements of the University of Wolverhampton for the degree of Doctor of Philosophy Brain Tumour Research Centre Research Institute in Healthcare Sciences Faculty of Science and Engineering University of Wolverhampton November 2014 i DECLARATION This work or any part thereof has not previously been presented in any form to the University or to any other body whether for the purposes of assessment, publication or for any other purpose (unless otherwise indicated). Save for any express acknowledgments, references and/or bibliographies cited in the work, I confirm that the intellectual content of the work is the result of my own efforts and of no other person. The right of Anushree Singh to be identified as author of this work is asserted in accordance with ss.77 and 78 of the Copyright, Designs and Patents Act 1988. At this date copyright is owned by the author. Signature: Anushree Date: 30th November 2014 ii ABSTRACT The aim of the study was to identify molecular markers that can determine progression of low grade glioma. This was done using various approaches such as IDH1 and IDH2 mutation analysis, MGMT methylation analysis, copy number analysis using array comparative genomic hybridisation and identification of differentially expressed miRNAs using miRNA microarray analysis. IDH1 mutation was present at a frequency of 71% in low grade glioma and was identified as an independent marker for improved OS in a multivariate analysis, which confirms the previous findings in low grade glioma studies.
    [Show full text]
  • Spatiotemporal DNA Methylome Dynamics of the Developing Mouse Fetus
    Article Spatiotemporal DNA methylome dynamics of the developing mouse fetus https://doi.org/10.1038/s41586-020-2119-x Yupeng He1,2, Manoj Hariharan1, David U. Gorkin3, Diane E. Dickel4, Chongyuan Luo1, Rosa G. Castanon1, Joseph R. Nery1, Ah Young Lee3, Yuan Zhao2,3, Hui Huang3,5, Received: 9 August 2017 Brian A. Williams6, Diane Trout6, Henry Amrhein6, Rongxin Fang2,3, Huaming Chen1, Bin Li3, Accepted: 11 June 2019 Axel Visel4,7,8, Len A. Pennacchio4,7,9, Bing Ren3,10 & Joseph R. Ecker1,11 ✉ Published online: 29 July 2020 Open access Cytosine DNA methylation is essential for mammalian development but Check for updates understanding of its spatiotemporal distribution in the developing embryo remains limited1,2. Here, as part of the mouse Encyclopedia of DNA Elements (ENCODE) project, we profled 168 methylomes from 12 mouse tissues or organs at 9 developmental stages from embryogenesis to adulthood. We identifed 1,808,810 genomic regions that showed variations in CG methylation by comparing the methylomes of diferent tissues or organs from diferent developmental stages. These DNA elements predominantly lose CG methylation during fetal development, whereas the trend is reversed after birth. During late stages of fetal development, non- CG methylation accumulated within the bodies of key developmental transcription factor genes, coinciding with their transcriptional repression. Integration of genome- wide DNA methylation, histone modifcation and chromatin accessibility data enabled us to predict 461,141 putative developmental tissue-specifc enhancers, the human orthologues of which were enriched for disease-associated genetic variants. These spatiotemporal epigenome maps provide a resource for studies of gene regulation during tissue or organ progression, and a starting point for investigating regulatory elements that are involved in human developmental disorders.
    [Show full text]
  • CRISPR Activation Screening of Circulating Tumor Cells Identifies Enhancers of Blood-Based Metastasis
    CRISPR Activation Screening of Circulating Tumor Cells Identifies Enhancers of Blood-Based Metastasis The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Ebright, Richard Yon. 2020. CRISPR Activation Screening of Circulating Tumor Cells Identifies Enhancers of Blood-Based Metastasis. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link https://nrs.harvard.edu/URN-3:HUL.INSTREPOS:37365157 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA CRISPR activation screening of circulating tumor cells identifies enhancers of blood-based metastasis A dissertation presented by Richard Yon Ebright to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts September 2019 © 2019 Richard Yon Ebright All rights reserved. Dissertation Advisors: Daniel A. Haber & Shyamala Maheswaran Richard Yon Ebright CRISPR activation screening of circulating tumor cells identifies enhancers of blood-based metastasis Abstract Over ninety percent of cancer mortality is attributable to metastasis, most commonly due to the blood-borne dissemination of cancer cells from a primary tumor to secondary tissues. However, the vast majority of these cancer cells in the circulation, known as circulating tumor cells (CTCs), never go on to form clinically relevant metastases, instead dying or senescing in the circulation or at distant sites.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Per2 Antibody
    Product Datasheet Per2 Antibody Catalog No: #SAB436 Orders: [email protected] Description Support: [email protected] Product Name Per2 Antibody Host Species Rabbit Clonality Polyclonal Purification Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibodies were purified by affinity-chromatography using epitope-specific peptide. Applications Custom antibody Species Reactivity Ms Immunogen Type Peptide-KLH Target Name Per2 Other Names Period circadian protein homolog 2 Accession No. uniprot:O54943 Calculated MW 136kDa Formulation Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 85% glycerol. Storage Store at -20°C for long term preservation (recommended). Store at 4°C for short term use. Application Details Western blotting: 1:500~1:1000 Background Transcriptional repressor which forms a core component of the circadian clock. The circadian clock, an internal time-keeping system, regulates various physiological processes through the generation of approximately 24 hour circadian rhythms in gene expression, which are translated into rhythms in metabolism and behavior. It is derived from the Latin roots 'circa' (about) and 'diem' (day) and acts as an important regulator of a wide array of physiological functions including metabolism, sleep, body temperature, blood pressure, endocrine, immune, cardiovascular, and renal function. Consists of two major components: the central clock, residing in the suprachiasmatic nucleus (SCN) of the brain, and the peripheral clocks that are present in nearly every tissue and organ system. Both the central and peripheral clocks can be reset by environmental cues, also known as Zeitgebers (German for 'timegivers').
    [Show full text]
  • The Hippo Pathway Component Wwc2 Is a Key Regulator of Embryonic Development and Angiogenesis in Mice Anke Hermann1,Guangmingwu2, Pavel I
    Hermann et al. Cell Death and Disease (2021) 12:117 https://doi.org/10.1038/s41419-021-03409-0 Cell Death & Disease ARTICLE Open Access The Hippo pathway component Wwc2 is a key regulator of embryonic development and angiogenesis in mice Anke Hermann1,GuangmingWu2, Pavel I. Nedvetsky1,ViktoriaC.Brücher3, Charlotte Egbring3, Jakob Bonse1, Verena Höffken1, Dirk Oliver Wennmann1, Matthias Marks4,MichaelP.Krahn 1,HansSchöler5,PeterHeiduschka3, Hermann Pavenstädt1 and Joachim Kremerskothen1 Abstract The WW-and-C2-domain-containing (WWC) protein family is involved in the regulation of cell differentiation, cell proliferation, and organ growth control. As upstream components of the Hippo signaling pathway, WWC proteins activate the Large tumor suppressor (LATS) kinase that in turn phosphorylates Yes-associated protein (YAP) and its paralog Transcriptional coactivator-with-PDZ-binding motif (TAZ) preventing their nuclear import and transcriptional activity. Inhibition of WWC expression leads to downregulation of the Hippo pathway, increased expression of YAP/ TAZ target genes and enhanced organ growth. In mice, a ubiquitous Wwc1 knockout (KO) induces a mild neurological phenotype with no impact on embryogenesis or organ growth. In contrast, we could show here that ubiquitous deletion of Wwc2 in mice leads to early embryonic lethality. Wwc2 KO embryos display growth retardation, a disturbed placenta development, impaired vascularization, and finally embryonic death. A whole-transcriptome analysis of embryos lacking Wwc2 revealed a massive deregulation of gene expression with impact on cell fate determination, 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; cell metabolism, and angiogenesis. Consequently, a perinatal, endothelial-specific Wwc2 KO in mice led to disturbed vessel formation and vascular hypersprouting in the retina.
    [Show full text]
  • NF-Ya Activates Multiple Hematopoietic Stem Cell (HSC) Regulatory Genes and Promotes HSC Self-Renewal
    NF-Ya activates multiple hematopoietic stem cell (HSC) regulatory genes and promotes HSC self-renewal Jiang Zhu, Yi Zhang, Gerard J. Joe, Richard Pompetti, and Stephen G. Emerson* Departments of Medicine and Pediatrics, and Abramson Cancer Center, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 Communicated by Zhu Chen, Shanghai Second Medical University, Shanghai, People’s Republic of China, April 25, 2005 (received for review December 15, 2004) Hematopoietic stem cell (HSC) self-renewal and differentiation are chased from The Jackson Laboratory and maintained in the animal influenced through multiple pathways, including homeobox tran- facilities of the University of Pennsylvania with sterile water or with scription factors, signaling through ␤-catenin and Notch-1, telom- the water supplemented with neomycin sulfate and polymyxin B erase, and p27. How these multiple pathways interact and are (Sigma) within 3–4 weeks after BMT. orchestrated is currently unknown. We now report that NF-Ya, the regulatory and DNA-binding subunit of the trimeric transcription NF-Ya cDNA, MigR1 Retroviral Vector, and Preparation of Retrovi- factor NF-Y, plays a central, integrating role in several of these HSC ruses. cDNA for NF-Ya was amplified from human normal bone pathways. NF-Ya is preferentially expressed in HSC-enriched bone marrow (BM) cell RNA by using Pfu DNA polymerase (Strat- marrow subpopulations, and NF-Ya mRNA rapidly declines with agene) (7). MigR1 retroviral vector was obtained from Warren HSC differentiation. Overexpression of NF-Ya in primitive hema- Pear (Department of Pathology and Laboratory Medicine, Uni- topoietic cells activates the transcription of multiple HOX4 paral- versity of Pennsylvania).
    [Show full text]