DOCSLIB.ORG

Suffix Trees

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Suffix Trees CSE 549: Suffix Tries & Suffix Trees All slides in this lecture not marked with “*” of Ben Langmead. KMP is great, but |T| = m |P| = n (note: m,n are opposite from previous lecture) Without pre- Given pre- Without pre- Given pre- processing processing processing processing (KMP) (KMP) (ST) (ST) Find an O(m+n) O(m) O(m+n) O(n) occurrence of P Find all occurrences of O(m+n) O(m) O(m + n + k) O(n+k) P Find an occurrence of O(l(m+n)) O(l(m)) O( m + ln) O(ln) P1,…,Pl If the text is constant over many patterns, pre-processing the text rather than the pattern is better (and allows other efficient queries). * Tries A trie (pronounced “try”) is a rootedtree representing tree representing a collection a collection of strings of with strings with one node per common prefx Smallest tree such that: Each edge is labeled with a character c ∈ Σ A node has at most one outgoing edge labeled c, for c ∈ Σ Each key is “spelled out” along some path starting at the root Natural way to represent either a set or a map where keys are strings This structure is also known as a Σ-tree Tries: example Represent this map with a trie: i Key Value instant 1 n s t internal 2 internet 3 t e a r The smallest tree such that: n n Each edge is labeled with a character c ∈ Σ t a e A node has at most one outgoing edge 1 labeled c, for c ∈ Σ l t Each key is “spelled out” along some path 2 3 starting at the root Tries: example i Checking for presence of a key P, where n = | P |, is ???O(n ) time n t s If total length of all keys is N, trie has O ???(N ) nodes t e a r What about | Σ | ? n n Depends how we represent outgoing t a e edges. If we don’t assume | Σ | is a 1 small constant, it shows up in one or l t both bounds. 2 3 Tries: another example We can index T with a trie. The trie maps substrings to ofsets where they occur c 4 g 8 t ac 4 a ag 8 14 at 14 c c cc 12 t 12, 2 cc 2 root: g ct 6 6 gt 18 t t gt 0 18, 0 ta 10 a tt 16 10 t 16 Indexing with sufxes SomeUntil indices now, (e.g. our indexes the inverted have beenindex) based are based on extracting on extracting substrings substrings from T from T A very diferent approach is to extract sufxes from T. This will lead us to some interesting and practical index data structures: 6 $ $ B A N A N A 5 A$ A $ B A N A N 3 ANA$ A N A $ B A N 1 ANANA$ A N A N A $ B 0 BANANA$ B A N A N A $ 4 NA$ N A $ B A N A 2 NANA$ N A N A $ B A Sufx Trie Sufx Tree Sufx Array FM Index Trie Definitions A Σ-tree (trie) is a rooted tree where each edge is labeled with a single character c ϵ Σ, such that no node has two outgoing edges labeled with the same character. • for a node v in T, depth(v) or node-depth(v) is the distance from v to the root. • node-depth(r) = 0 • string(v) = concatenation of all characters on the path r ⤳ v • string-depth(v) = |string(v)| (note: string-depth(v) ≥ node-depth(v)) • for a string x, if ∃ node v with string(v) = x, we say node(x) = v • T displays string x if ∃ node v and string y such that xy = string(v) • words(T) = { x | T displays x} • A suffix trie of string s is a Σ-tree such that words(T) = {s’ | s’ is a substring of s} • An internal/leaf edge leads to an internal/leaf node Defs. from: http://profs.sci.univr.it/~liptak/ALBioinfo/files/sequence_analysis.pdf * Sufx trie Build a trie containing all sufxes of a text T T: GTTATAGCTGATCGCGGCGTAGCGG$ GTTATAGCTGATCGCGGCGTAGCGG$ TTATAGCTGATCGCGGCGTAGCGG$ TATAGCTGATCGCGGCGTAGCGG$ ATAGCTGATCGCGGCGTAGCGG$ TAGCTGATCGCGGCGTAGCGG$ AGCTGATCGCGGCGTAGCGG$ GCTGATCGCGGCGTAGCGG$ CTGATCGCGGCGTAGCGG$ TGATCGCGGCGTAGCGG$ GATCGCGGCGTAGCGG$ ATCGCGGCGTAGCGG$m(m+1)/2 TCGCGGCGTAGCGG$ CGCGGCGTAGCGG$chars GCGGCGTAGCGG$ CGGCGTAGCGG$ GGCGTAGCGG$ GCGTAGCGG$ CGTAGCGG$ GTAGCGG$ TAGCGG$ AGCGG$ GCGG$ CGG$ GG$ G$ $ Sufx trie First add special terminal character $ to the end of T $ is a character that does not appear elsewhere in T, and we defne it to be less than other characters (for DNA: $ < A < C < G < T) $ enforces a rule we’re all used to using: e.g. “as” comes before “ash” in the dictionary. $ also guarantees no sufx is a prefx of any other sufx. T: GTTATAGCTGATCGCGGCGTAGCGG$ GTTATAGCTGATCGCGGCGTAGCGG$ TTATAGCTGATCGCGGCGTAGCGG$ TATAGCTGATCGCGGCGTAGCGG$ ATAGCTGATCGCGGCGTAGCGG$ TAGCTGATCGCGGCGTAGCGG$ AGCTGATCGCGGCGTAGCGG$ GCTGATCGCGGCGTAGCGG$ CTGATCGCGGCGTAGCGG$ TGATCGCGGCGTAGCGG$ GATCGCGGCGTAGCGG$ ATCGCGGCGTAGCGG$ TCGCGGCGTAGCGG$ CGCGGCGTAGCGG$ GCGGCGTAGCGG$ CGGCGTAGCGG$ GGCGTAGCGG$ GCGTAGCGG$ CGTAGCGG$ GTAGCGG$ TAGCGG$ AGCGG$ GCGG$ CGG$ GG$ G$ $ Sufx trie a b $ Shortest T: abaaba T$: abaaba$ (non-empty) sufx a b $ a Each path from root to leaf represents a sufx; each sufx is represented by some b a a $ path from root to leaf a a $ b Would this still be the case if we hadn’t added $? $ b a a $ $ Longest sufx Sufx trie a b T: abaaba Each path from root to leaf represents a a b a sufx; each sufx is represented by some path from root to leaf b a a Would this still be the case if we hadn’t added $? No a a b b a a Sufx trie a b $ We can think of nodes as having labels, where the label spells out characters on the a b $ a path from the root to the node b a a $ a a $ b baa $ b a a $ $ Sufx trie a b $ How do we check whether a string S is a substring of T? a b $ a Note: Each of T’s substrings is spelled out along a path from the root. I.e., every b a a $ substring is a prefx of some sufx of T. a a $ b S = baa Yes, it’s a substring Start at the root and follow the edges labeled with the characters of S $ b a If we “fall of” the trie -- i.e. there is no outgoing edge for next character of S, then a $ S is not a substring of T If we exhaust S without falling of, S is a substring of T $ Sufx trie a b $ How do we check whether a string S is a substring of T? a b $ a Note: Each of T’s substrings is spelled out along a path from the root. I.e., every b a a $ substring is a prefx of some sufx of T. a a $ b S = baa Yes, it’s a substring Start at the root and follow the edges labeled with the characters of S $ b a If we “fall of” the trie -- i.e. there is no outgoing edge for next character of S, then a $ S is not a substring of T If we exhaust S without falling of, S is a substring of T $ Sufx trie a b $ How do we check whether a string S is a substring of T? a b $ a Note: Each of T’s substrings is spelled out along a path from the root. I.e., every b a a $ substring is a prefx of some sufx of T. a a $ b Start at the root and follow the edges labeled with the characters of S $ b a If we “fall of” the trie -- i.e. there is no outgoing edge for next character of S, then a $ S is not a substring of T S = abaaba Yes, it’s a substring If we exhaust S without falling of, S is a substring of T $ Sufx trie a b $ How do we check whether a string S is a substring of T? a b $ a Note: Each of T’s substrings is spelled out along a path from the root. I.e., every b a a $ substring is a prefx of some sufx of T. a a $ b Start at the root and follow the edges labeled with the characters of S x $ b a S = baabb If we “fall of” the trie -- i.e. there is no No, not a substring outgoing edge for next character of S, then a $ S is not a substring of T If we exhaust S without falling of, S is a substring of T $ Sufx trie a b $ How do we check whether a string S is a sufx of T? a b $ a Same procedure as for substring, but additionally check whether the fnal node in b a a $ the walk has an outgoing edge labeled $ a a $ b S = baa Not a sufx $ b a a $ $ Sufx trie a b $ How do we check whether a string S is a sufx of T? a b $ a Same procedure as for substring, but additionally check whether the fnal node in b a a $ the walk has an outgoing edge labeled $ a a $ b S = baa Not a sufx $ b a a $ $ Sufx trie a b $ How do we check whether a string S is a sufx of T? a b $ a Same procedure as for substring, but b a a $ additionally check whether the fnal node in S = aba the walk has an outgoing edge labeled $ Is a sufx a a $ b $ b a a $ $ Sufx trie a b $ How do we count the number of times a string S occurs as a substring of T? a b $ a Follow path corresponding to S.
Load more

Recommended publications
  • Compressed Suffix Trees with Full Functionality
    Compressed Suffix Trees with Full Functionality Kunihiko Sadakane Department of Computer Science and Communication Engineering, Kyushu University Hakozaki 6-10-1, Higashi-ku, Fukuoka 812-8581, Japan [email protected] Abstract We introduce new data structures for compressed suffix trees whose size are linear in the text size. The size is measured in bits; thus they occupy only O(n log |A|) bits for a text of length n on an alphabet A. This is a remarkable improvement on current suffix trees which require O(n log n) bits. Though some components of suffix trees have been compressed, there is no linear-size data structure for suffix trees with full functionality such as computing suffix links, string-depths and lowest common ancestors. The data structure proposed in this paper is the first one that has linear size and supports all operations efficiently. Any algorithm running on a suffix tree can also be executed on our compressed suffix trees with a slight slowdown of a factor of polylog(n). 1 Introduction Suffix trees are basic data structures for string algorithms [13]. A pattern can be found in time proportional to the pattern length from a text by constructing the suffix tree of the text in advance. The suffix tree can also be used for more complicated problems, for example finding the longest repeated substring in linear time. Many efficient string algorithms are based on the use of suffix trees because this does not increase the asymptotic time complexity. A suffix tree of a string can be constructed in linear time in the string length [28, 21, 27, 5].
    [Show full text]
  • Suffix Trees
    JASS 2008 Trees - the ubiquitous structure in computer science and mathematics Suffix Trees Caroline L¨obhard St. Petersburg, 9.3. - 19.3. 2008 1 Contents 1 Introduction to Suffix Trees 3 1.1 Basics . 3 1.2 Getting a first feeling for the nice structure of suffix trees . 4 1.3 A historical overview of algorithms . 5 2 Ukkonen’s on-line space-economic linear-time algorithm 6 2.1 High-level description . 6 2.2 Using suffix links . 7 2.3 Edge-label compression and the skip/count trick . 8 2.4 Two more observations . 9 3 Generalised Suffix Trees 9 4 Applications of Suffix Trees 10 References 12 2 1 Introduction to Suffix Trees A suffix tree is a tree-like data-structure for strings, which affords fast algorithms to find all occurrences of substrings. A given String S is preprocessed in O(|S|) time. Afterwards, for any other string P , one can decide in O(|P |) time, whether P can be found in S and denounce all its exact positions in S. This linear worst case time bound depending only on the length of the (shorter) string |P | is special and important for suffix trees since an amount of applications of string processing has to deal with large strings S. 1.1 Basics In this paper, we will denote the fixed alphabet with Σ, single characters with lower-case letters x, y, ..., strings over Σ with upper-case or Greek letters P, S, ..., α, σ, τ, ..., Trees with script letters T , ... and inner nodes of trees (that is, all nodes despite of root and leaves) with lower-case letters u, v, ...
    [Show full text]
  • Search Trees
    Lecture III Page 1 “Trees are the earth’s endless effort to speak to the listening heaven.” – Rabindranath Tagore, Fireflies, 1928 Alice was walking beside the White Knight in Looking Glass Land. ”You are sad.” the Knight said in an anxious tone: ”let me sing you a song to comfort you.” ”Is it very long?” Alice asked, for she had heard a good deal of poetry that day. ”It’s long.” said the Knight, ”but it’s very, very beautiful. Everybody that hears me sing it - either it brings tears to their eyes, or else -” ”Or else what?” said Alice, for the Knight had made a sudden pause. ”Or else it doesn’t, you know. The name of the song is called ’Haddocks’ Eyes.’” ”Oh, that’s the name of the song, is it?” Alice said, trying to feel interested. ”No, you don’t understand,” the Knight said, looking a little vexed. ”That’s what the name is called. The name really is ’The Aged, Aged Man.’” ”Then I ought to have said ’That’s what the song is called’?” Alice corrected herself. ”No you oughtn’t: that’s another thing. The song is called ’Ways and Means’ but that’s only what it’s called, you know!” ”Well, what is the song then?” said Alice, who was by this time completely bewildered. ”I was coming to that,” the Knight said. ”The song really is ’A-sitting On a Gate’: and the tune’s my own invention.” So saying, he stopped his horse and let the reins fall on its neck: then slowly beating time with one hand, and with a faint smile lighting up his gentle, foolish face, he began..
    [Show full text]
  • Lecture 1: Introduction
    Lecture 1: Introduction Agenda: • Welcome to CS 238 — Algorithmic Techniques in Computational Biology • Official course information • Course description • Announcements • Basic concepts in molecular biology 1 Lecture 1: Introduction Official course information • Grading weights: – 50% assignments (3-4) – 50% participation, presentation, and course report. • Text and reference books: – T. Jiang, Y. Xu and M. Zhang (co-eds), Current Topics in Computational Biology, MIT Press, 2002. (co-published by Tsinghua University Press in China) – D. Gusfield, Algorithms for Strings, Trees, and Sequences: Computer Science and Computational Biology, Cambridge Press, 1997. – D. Krane and M. Raymer, Fundamental Concepts of Bioin- formatics, Benjamin Cummings, 2003. – P. Pevzner, Computational Molecular Biology: An Algo- rithmic Approach, 2000, the MIT Press. – M. Waterman, Introduction to Computational Biology: Maps, Sequences and Genomes, Chapman and Hall, 1995. – These notes (typeset by Guohui Lin and Tao Jiang). • Instructor: Tao Jiang – Surge Building 330, x82991, [email protected] – Office hours: Tuesday & Thursday 3-4pm 2 Lecture 1: Introduction Course overview • Topics covered: – Biological background introduction – My research topics – Sequence homology search and comparison – Sequence structural comparison – string matching algorithms and suffix tree – Genome rearrangement – Protein structure and function prediction – Phylogenetic reconstruction * DNA sequencing, sequence assembly * Physical/restriction mapping * Prediction of regulatiory elements • Announcements:
    [Show full text]
  • Suffix Trees for Fast Sensor Data Forwarding
    Suffix Trees for Fast Sensor Data Forwarding Jui-Chieh Wub Hsueh-I Lubc Polly Huangac Department of Electrical Engineeringa Department of Computer Science and Information Engineeringb Graduate Institute of Networking and Multimediac National Taiwan University [email protected], [email protected], [email protected] Abstract— In data-centric wireless sensor networks, data are alleviates the effort of node addressing and address reconfig- no longer sent by the sink node’s address. Instead, the sink uration in large-scale mobile sensor networks. node sends an explicit interest for a particular type of data. The source and the intermediate nodes then forward the data Forwarding in data-centric sensor networks is particularly according to the routing states set by the corresponding interest. challenging. It involves matching of the data content, i.e., This data-centric style of communication is promising in that it string-based attributes and values, instead of numeric ad- alleviates the effort of node addressing and address reconfigura- dresses. This content-based forwarding problem is well studied tion. However, when the number of interests from different sinks in the domain of publish-subscribe systems. It is estimated increases, the size of the interest table grows. It could take 10s to 100s milliseconds to match an incoming data to a particular in [3] that the time it takes to match an incoming data to a interest, which is orders of mangnitude higher than the typical particular interest ranges from 10s to 100s milliseconds. This transmission and propagation delay in a wireless sensor network. processing delay is several orders of magnitudes higher than The interest table lookup process is the bottleneck of packet the propagation and transmission delay.
    [Show full text]
  • Tries and String Matching
    Tries and String Matching Where We've Been ● Fundamental Data Structures ● Red/black trees, B-trees, RMQ, etc. ● Isometries ● Red/black trees ≡ 2-3-4 trees, binomial heaps ≡ binary numbers, etc. ● Amortized Analysis ● Aggregate, banker's, and potential methods. Where We're Going ● String Data Structures ● Data structures for storing and manipulating text. ● Randomized Data Structures ● Using randomness as a building block. ● Integer Data Structures ● Breaking the Ω(n log n) sorting barrier. ● Dynamic Connectivity ● Maintaining connectivity in an changing world. String Data Structures Text Processing ● String processing shows up everywhere: ● Computational biology: Manipulating DNA sequences. ● NLP: Storing and organizing huge text databases. ● Computer security: Building antivirus databases. ● Many problems have polynomial-time solutions. ● Goal: Design theoretically and practically efficient algorithms that outperform brute-force approaches. Outline for Today ● Tries ● A fundamental building block in string processing algorithms. ● Aho-Corasick String Matching ● A fast and elegant algorithm for searching large texts for known substrings. Tries Ordered Dictionaries ● Suppose we want to store a set of elements supporting the following operations: ● Insertion of new elements. ● Deletion of old elements. ● Membership queries. ● Successor queries. ● Predecessor queries. ● Min/max queries. ● Can use a standard red/black tree or splay tree to get (worst-case or expected) O(log n) implementations of each. A Catch ● Suppose we want to store a set of strings. ● Comparing two strings of lengths r and s takes time O(min{r, s}). ● Operations on a balanced BST or splay tree now take time O(M log n), where M is the length of the longest string in the tree.
    [Show full text]
  • Suffix Trees and Suffix Arrays in Primary and Secondary Storage Pang Ko Iowa State University
    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 2007 Suffix trees and suffix arrays in primary and secondary storage Pang Ko Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Bioinformatics Commons, and the Computer Sciences Commons Recommended Citation Ko, Pang, "Suffix trees and suffix arrays in primary and secondary storage" (2007). Retrospective Theses and Dissertations. 15942. https://lib.dr.iastate.edu/rtd/15942 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Suffix trees and suffix arrays in primary and secondary storage by Pang Ko A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Computer Engineering Program of Study Committee: Srinivas Aluru, Major Professor David Fern´andez-Baca Suraj Kothari Patrick Schnable Srikanta Tirthapura Iowa State University Ames, Iowa 2007 UMI Number: 3274885 UMI Microform 3274885 Copyright 2007 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, MI 48106-1346 ii DEDICATION To my parents iii TABLE OF CONTENTS LISTOFTABLES ................................... v LISTOFFIGURES .................................. vi ACKNOWLEDGEMENTS. .. .. .. .. .. .. .. .. .. ... .. .. .. .. vii ABSTRACT....................................... viii CHAPTER1. INTRODUCTION . 1 1.1 SuffixArrayinMainMemory .
    [Show full text]
  • Finger Search Trees
    11 Finger Search Trees 11.1 Finger Searching....................................... 11-1 11.2 Dynamic Finger Search Trees ....................... 11-2 11.3 Level Linked (2,4)-Trees .............................. 11-3 11.4 Randomized Finger Search Trees ................... 11-4 Treaps • Skip Lists 11.5 Applications............................................ 11-6 Optimal Merging and Set Operations • Arbitrary Gerth Stølting Brodal Merging Order • List Splitting • Adaptive Merging and University of Aarhus Sorting 11.1 Finger Searching One of the most studied problems in computer science is the problem of maintaining a sorted sequence of elements to facilitate efficient searches. The prominent solution to the problem is to organize the sorted sequence as a balanced search tree, enabling insertions, deletions and searches in logarithmic time. Many different search trees have been developed and studied intensively in the literature. A discussion of balanced binary search trees can e.g. be found in [4]. This chapter is devoted to finger search trees which are search trees supporting fingers, i.e. pointers, to elements in the search trees and supporting efficient updates and searches in the vicinity of the fingers. If the sorted sequence is a static set of n elements then a simple and space efficient representation is a sorted array. Searches can be performed by binary search using 1+⌊log n⌋ comparisons (we throughout this chapter let log x denote log2 max{2, x}). A finger search starting at a particular element of the array can be performed by an exponential search by inspecting elements at distance 2i − 1 from the finger for increasing i followed by a binary search in a range of 2⌊log d⌋ − 1 elements, where d is the rank difference in the sequence between the finger and the search element.
    [Show full text]
  • Lecture Notes of CSCI5610 Advanced Data Structures
    Lecture Notes of CSCI5610 Advanced Data Structures Yufei Tao Department of Computer Science and Engineering Chinese University of Hong Kong July 17, 2020 Contents 1 Course Overview and Computation Models 4 2 The Binary Search Tree and the 2-3 Tree 7 2.1 The binary search tree . .7 2.2 The 2-3 tree . .9 2.3 Remarks . 13 3 Structures for Intervals 15 3.1 The interval tree . 15 3.2 The segment tree . 17 3.3 Remarks . 18 4 Structures for Points 20 4.1 The kd-tree . 20 4.2 A bootstrapping lemma . 22 4.3 The priority search tree . 24 4.4 The range tree . 27 4.5 Another range tree with better query time . 29 4.6 Pointer-machine structures . 30 4.7 Remarks . 31 5 Logarithmic Method and Global Rebuilding 33 5.1 Amortized update cost . 33 5.2 Decomposable problems . 34 5.3 The logarithmic method . 34 5.4 Fully dynamic kd-trees with global rebuilding . 37 5.5 Remarks . 39 6 Weight Balancing 41 6.1 BB[α]-trees . 41 6.2 Insertion . 42 6.3 Deletion . 42 6.4 Amortized analysis . 42 6.5 Dynamization with weight balancing . 43 6.6 Remarks . 44 1 CONTENTS 2 7 Partial Persistence 47 7.1 The potential method . 47 7.2 Partially persistent BST . 48 7.3 General pointer-machine structures . 52 7.4 Remarks . 52 8 Dynamic Perfect Hashing 54 8.1 Two random graph results . 54 8.2 Cuckoo hashing . 55 8.3 Analysis . 58 8.4 Remarks . 59 9 Binomial and Fibonacci Heaps 61 9.1 The binomial heap .
    [Show full text]
  • String Algorithm
    Trie: A data-structure for a set of words All words over the alphabet Σ={a,b,..z}. In the slides, let say that the alphabet is only {a,b,c,d} S – set of words = {a,aba, a, aca, addd} Need to support the operations Tries and suffixes trees • insert(w) – add a new word w into S. • delete(w) – delete the word w from S. • find(w) is w in S ? Alon Efrat • Future operation: Computer Science Department • Given text (many words) where is w in the text. University of Arizona • The time for each operation should be O(k), where k is the number of letters in w • Usually each word is associated with addition info – not discussed here. 2 Trie (Tree+Retrive) for S A trie - example p->ar[‘b’-’a’] Note: The label of an edge is the label of n A tree where each node is a struct consist the cell from which this edge exits n Struct node { p a b c d n char[4] *ar; 0 a n char flag ; /* 1 if a word ends at this node. b d Otherwise 0 */ a b c d a b c d Corresponding to w=“d” } a b c d a b c d flag 1 1 0 ar 1 b Corr. To w=“db” (not in S, flag=0) S={a,b,dbb} a b c d 0 a b c d flag ar 1 b Rule: a b c d Corr. to w= dbb Each node corresponds to a word w 1 “ ” (w which is in S iff the flag is 1) 3 In S, so flag=1 4 1 Finding if word w is in the tree Inserting a word w p=root; i =0 Recall – we need to modify the tree so find(w) would return While(1){ TRUE.
    [Show full text]
  • Pointer-Machine Algorithms for Fully-Online Construction of Suffix
    Pointer-Machine Algorithms for Fully-Online Construction of Suffix Trees and DAWGs on Multiple Strings Shunsuke Inenaga Department of Informatics, Kyushu University, Japan PRESTO, Japan Science and Technology Agency, Japan [email protected] Abstract. We deal with the problem of maintaining the suffix tree indexing structure for a fully-online collection of strings, where a new character can be prepended to any string in the collection at any time. The only previously known algorithm for the problem, recently proposed by Takagi et al. [Algorithmica 82(5): 1346-1377 (2020)], runs in O(N log σ) time and O(N) space on the word RAM model, where N denotes the total length of the strings and σ denotes the alphabet size. Their algorithm makes heavy use of the nearest marked ancestor (NMA) data structure on semi-dynamic trees, that can answer queries and supports insertion of nodes in O(1) amortized time on the word RAM model. In this paper, we present a simpler fully-online right-to-left algorithm that builds the suffix tree for a given string collection in O(N(log σ + log d)) time and O(N) space, where d is the maximum number of in-coming Weiner links to a node of the suffix tree. We note that d is bounded by the height of the suffix tree, which is further bounded by the length of the longest string in the collection. The advantage of this new algorithm is that it works on the pointer machine model, namely, it does not use the complicated NMA data structures that involve table look-ups.
    [Show full text]
  • Algorithm for Character Recognition Based on the Trie Structure
    University of Montana ScholarWorks at University of Montana Graduate Student Theses, Dissertations, & Professional Papers Graduate School 1987 Algorithm for character recognition based on the trie structure Mohammad N. Paryavi The University of Montana Follow this and additional works at: https://scholarworks.umt.edu/etd Let us know how access to this document benefits ou.y Recommended Citation Paryavi, Mohammad N., "Algorithm for character recognition based on the trie structure" (1987). Graduate Student Theses, Dissertations, & Professional Papers. 5091. https://scholarworks.umt.edu/etd/5091 This Thesis is brought to you for free and open access by the Graduate School at ScholarWorks at University of Montana. It has been accepted for inclusion in Graduate Student Theses, Dissertations, & Professional Papers by an authorized administrator of ScholarWorks at University of Montana. For more information, please contact [email protected]. COPYRIGHT ACT OF 1 9 7 6 Th is is an unpublished manuscript in which copyright sub ­ s i s t s , Any further r e p r in t in g of its contents must be approved BY THE AUTHOR, Ma n sfield L ibrary U n iv e r s it y of Montana Date : 1 987__ AN ALGORITHM FOR CHARACTER RECOGNITION BASED ON THE TRIE STRUCTURE By Mohammad N. Paryavi B. A., University of Washington, 1983 Presented in partial fulfillment of the requirements for the degree of Master of Science University of Montana 1987 Approved by lairman, Board of Examiners iean, Graduate School UMI Number: EP40555 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.
    [Show full text]