LCHF_pmg_forreview.indd 1 11/16/17 5:41 PM LCHF_pmg_forreview.indd 2 11/16/17 5:41 PM LOST CITY HYDRO THERMAL FIELD PETERMILNEGREINER

the operating system c. 2017

LCHF_pmg_forreview.indd 3 11/16/17 5:41 PM the operating system print//document

LOST CITY HYDROTHERMAL FIELD

ISBN 978-1-946031-11-2 Library of Congress Control Number 2017909511

copyright © 2017 by Peter Milne Greiner

edited, designed and cover art by Lynne DeSilva-Johnson

is released under a Creative Commons CC-BY-NC-ND (Attribution, Non Commercial, No Derivatives) License:

its reproduction is encouraged for those who otherwise could not afford its purchase in the case of academic, personal, and other creative usage from which no profit will accrue. Complete rules and restrictions are available at: http://creativecommons.org/licenses/by-nc-nd/3.0/

For additional questions regarding reproduction, quotation, or to request a pdf for review contact [email protected]

This text was set in Helvetica Neue, Futura, Minion, Franchise, and OCR-A Standard, printed and bound by Spencer Printing, In Honesdale, PA, in the USA. Books from The Operating System are distributed to the trade by SPD, with ePub and POD via Ingram.

the operating system 141 Spencer Street #203 Brooklyn, NY 11205 www.theoperatingsystem.org [email protected]

LCHF_pmg_forreview.indd 4 11/16/17 5:41 PM “Greiner tours a series of dystopias and alternate LOSTrealities with infectious linguistic verve in his uncanny and wonderful debut. Wandering amid invented landscapes, the poet introduces such cleverly named locations as the ‘Topiary of Terror,’ an American bar in Reykjavik, and the ‘Chapel of Her Divine Counterfeit Brain Tissue.’ Greiner frequently asserts himself as the reluctant hero of some strange quest; for example, he must ‘turn over a non-leaf and lift/ the spacerock from CITYthe heart’s bitter peninsulas’ in order to appease the ‘God of tardigrades.’ In one of several excursions into prose, Greiner imagines himself living in the wreck of a cruise ship amid a perpetual hurricane; in another, he draws preposterous associative links between the lost continent of and Mariah Carey’s Super Bowl performance of the ‘Star-Spangled Banner.’ His ingenious metaphors include ‘Your gaze like HYDROsteady impersonal drone footage/ [that] writes a San Andreas fault through my center.’ What resonates is the collection’s vast loneliness—that of the last man on Earth roaming the countryside in search of life. What sets this collection apart from other speculative poetry, aside from its exceptional quality, is Greiner’s way of moving through time, somehow visiting both origin and culmination, the primordial and the apocalyptic, THERMALand demonstrating their interchangeability.” —Publishers Weekly [Starred Review] FIELD

LCHF_pmg_forreview.indd 5 11/16/17 5:41 PM LCHF_pmg_forreview.indd 6 11/16/17 5:41 PM CONTINENTS

LOUD SPRING 9

THE WOW! SIGNAL 10

END OF THE EARTHS 12

WEATHER PEOPLE 15

TRISTAN DA COUCH 16

AN EARTHLIKE PLANET FOR IANTHE BRAUTIGAN 20

HEMOCHROME 21

HYPOOBJECT 22

EQUATIONS 23

SATIETY PLUS STEALTH EQUALS WHAT 24

AULACOGEN 25

IMPACT CRATER 29

INTERIOR PLUS ITINERARY EQUALS WHAT 32

SIX LARGE HOLES 33

A DRAKE EQUATION FOR LAURA ROSLIN 34

AGNES MARTIN’S DRAGON 35

FOLDERS 41

CECILY 43

ALWAYS SOMETHING 48

A DEDICATION THEORY FOR SEKOU SUNDIATA 49

REMEDIAL EXOPLANETOLOGY 51

FRINGE 53

NEW YORK ETERNITY 54

LV-426 56

LCHF_pmg_forreview.indd 7 11/16/17 5:41 PM DEGRADASHUN 57

A FRAME NARRATIVE FOR BARBARA MAITLAND 60

SPIRAL ARM PLUS SYNTHESIZER EQUALS WHAT 61

FHLOSTON PARADISE 62

TROPICAL PREMISES 63

MUTAGEN PLUS MAINSTAY EQUALS WHAT 68

STANDING STONE 69

PLEXAURE 73

CATASTROFEED 78

UNTRAVELS 79

FOR BRAD 81

GIFTS 82

A GIBBOUS PEE MOON FOR CHIP DELANY 83

HAMMERSTONE 84

DEEP DOWN SATISFACTION 86

PANTHALASSA PLUS PANGAEA EQUALS WHAT 87

CONNECTICUT COAST IN DEEP TIME 88

THE GEOPHYSICIST’S LUCID DREAM 89

UNTIL THE SUN COMES UP OVER MCGUINNESS BOULEVARD 90

LITTLE BROWN BOTTLE 91

COMPETING AMBIENCES HAPPEN 92

THE WOMEN FROM ASYLUM 93

LAST LOST CONTINENTS 109

CONTACT 116

HYPERLAPSE 133

LCHF_pmg_forreview.indd 8 11/16/17 5:41 PM THERE IS A TIME OF CHANGE IN A WILDERNESS trip when patterns that have been left behind fade beneath the immediacies of wind, sun, rain, and fire, and a different sense of distance, of shelter, of food. We made that change when we were still in the Penobscot valley, and by now I, for one, would like to keep going indefinitely; the change back will bring a feeling of loss, an absence of space, a nostalgia for the woods. The end has come, though. Henri has run out of Tang. Tang is his halazone, his palate’s defense, his agent conversional for pure lakes and streams. Without Tang, he is without water.

—JOHN MCPHEE, THE SURVIVAL OF THE BARK CANOE

IT WILL TAKE A NUMBER OF EXPEDITIONS to traverse this microcontinent; it will take the death of a million neurons, a cornucopia of prime numbers, countless service stations and bypasses to arrive at the point of final departure.

—DEAR ESTHER

LCHF_pmg_forreview.indd 9 11/16/17 5:41 PM LCHF_pmg_forreview.indd 10 11/16/17 5:41 PM LOUD SPRING

I undo the ambiguous abuses

I fix every obelisk

History is full of glitches that cause the present to crash often

If nothing could work as miracles are worked

the faintest hint of my lasting influence might occur in nature eventually

I post the epic algal bloom photoset

Plato alludes to a lost city called Chernobyl

Lame dystopias drive me crazy

Alternate timelines demystify this one

The Gulf Stream carries a consensus

over all the cool little seas of Earth

and deposits it right here at my feet

and I have no idea that it has nothing to do with me

but that is not my sincerest dilemma

Where the alternate timelines are

is a strange place

I know because I am there constantly | /// 11

LCHF_pmg_forreview.indd 11 11/16/17 5:41 PM THE WOW! SIGNAL

I send up all the flares

I put off the postponements

I succumb to the luddites

My off-season’s worth of seconds crufts under one twilight’s metered silage of beginnings

I join the astrologers

I sing for nine thousand, nine hundred and ninety-nine hours but stop short of mastery as always

I unite the orchestras

I handle his truce-bitten equinox— there’s a his now—and I become a truce myself and so does the equinox and in the pausey silence our immense little theories increment time unevenly

Our dumb Drake Equation proves we could both exist

That’s the gist of my hymn’s ugly brisance as it narrows to a reason, to one crude poise-breaking note between what’s me and what’s mere and guess what’s left \\\ 12 |

LCHF_pmg_forreview.indd 12 11/16/17 5:41 PM A trail of trail-off

What a great myth a god of negotiations makes, right

And these wildernesses they title us

things like Gemini

but not when our definite hiatus like gnats crowds my dopplered view of the year’s hoarded dismissals

You see, I’m fluent in the masque and argot of ordinary things coming to pass Bonnie Raitt has a great song about that

So does Ian Curtis

They wouldn’t go to Mars with me, either

It’s fine

I’ve decided to stay here, anyway

Night’s various bright spots of credulity

grant me semi-false, semi-true passage

and I wonder, again, how something can be so faint

and so vast, how ache stampedes now at the

speed of absolutely nothing at all | /// 13

LCHF_pmg_forreview.indd 13 11/16/17 5:41 PM END OF THE EARTHS

Bad adage, I said again, The art of the adage is dead as everything they call dead

The Old Timer I ID as, I rekindle a voiceless thing called dirt that nobody remembers back

before I had nothing from which to derive a name, either With feature comes bias, even in here

So I wander, I perform inquiry, I replace existing file names, I grow as plants do: over gravity

I lose no one The sheer cliff’s purchase history is not exotic

How is it not? How is it nothing but my momentary age of bracketed content?

So I didn’t ruin Skylab or the Colossus at Rhodes even though by dismantling your fleeting triumphs occasionally I approach doing something always

I’m in ode mode now You, you be in or be anything Be my Blob Dynamics for all I care,

my dharmic auspice under which the dimensions

I inhabit dwindle and untrend until there are none left to eat as a last resort \\\ 14 |

LCHF_pmg_forreview.indd 14 11/16/17 5:41 PM Or be an assumption I route restlessly out of the discourse and I will before as I behind

I will path and wake and you, You

hidden horror, await in the Ted Talk— of heritages I must reverse and reverse-engineer into a crude, revised bacteria of the modern world—

like a poltergeist hungry for what all poltergeists hunger for: Order Involve me and ensconce me in your truths, I suggest

I relaunch my opinion, I announce I can’t wait to relaunch all my histories at once, I threaten I won’t relaunch my disinterest in yours

I relaunch my destruction myth wherein theodolites rain down over the land, altering its contours, crushing its hard-charted

nears and reaches Death like real dads teaches me the meaning of honest work,

assigns me a birth and a birth abuse, keeps my traumas contiguous, keeps them undisputed

My dickish sendup of a universe consisting after all of terms and conditions that are pretty reasonable is bad, forgettable, disobedient to authenticity

We communicate, we exchange communications That, literally, is the definition of astrology I’ve chosen a factoid diet—good for planets

I’ve fled into the fastnesses, into the emojiless voids—It sucks in those places

but it’s worth it | /// 15

LCHF_pmg_forreview.indd 15 11/16/17 5:41 PM I stand triangulated, I stand The Peril, I stand The Plot Twist, The Damsel in Degradation You stand my Alien , my Bottom

Priority and I stare stare straight straight at the road that lies ahead and see

unfrontier

unmirage

unreleased ecstatic goal \\\ 16 |

LCHF_pmg_forreview.indd 16 11/16/17 5:41 PM WEATHER PEOPLE

In Joshua Tree and Marfa and in Whitefish, Montana I want so desperately to remain a little naïve,

to call a comet by its Latin name, to misconstrue all my observations

At the bottom of the Stanley Cup everyone is everyone

At The Topiary of Terror—an American bar in Reykjavik— my love pentagram consists of assorted conceits and the Virgos

resist the last sips of beer

I type them all A and they laugh and laugh and laugh and clone extinct reasons to proceed with abandon

and I inhabit that abandon like mitochondria, the alien storyless given that keeps on giving

One by one, I escape the places I have become over the course of a trillion seconds

After the datarush, its core-sampled sites far from resemble any proto- I’ve ever read a paragraph about on the internet

In the secret labs in the secret hamlets the facts are fudged clean and lustrous

I await them with undressed wounds | /// 17

LCHF_pmg_forreview.indd 17 11/16/17 5:41 PM TRISTAN DA COUCH

I went to the deserted city

I was somewhere weird You were there but you were you

I was a fainter and you were a fainter Up we wake and fail to see the present Little

Picture that remains as remnants do: as conciliation and consumption, analysis like a little empty street emptying into others

Familiar seasons while they still are: I enjoy them I hear you say because I’m conscious ish While I was out and you were out

there was a dream and in the dream there was a phone It said on Wednesday it would be a hundred and twenty degrees and I said well there I go again

accepting every prediction

I mine human doing for all its garish hyperobjects and here they all are—all of them, so that takes care of that

Fata morgana of the Hot Earth, show me a beautiful container ship Show me Area 51 over Rockaway Beach

Now I’m a figure and its surroundings which includes you I wonder where my essay words went when the air is not thinner by much at the top of Ayers Rock

and my thinkpiece for The Guardian about the South China Sea does not surge through me like a season in Hell

Specific place, specific city, I say to the orange dust and the orange star and to the medium orange monkey and the vines on everything

You have no other person now, no other verifiable populating agent \\\ 18 |

LCHF_pmg_forreview.indd 18 11/16/17 5:41 PM Godrays, I say, do your specific thing over the savannahs Unending theta wave that can be reduced to hunger, feed me after REM but before Sleep some bands who’ll get better Some who’ll get worse And some who’ll drive my tour hearse

Mysticism coterminous with a sense of fairness if not modern science, I say The nature of hallucination has changed Everything has changed

In the Uncanny Valley the last dinosaurs look at me and I see their giant primitive nausea

Someday I will go I mutter still not fully up on a great journey and be tormented by change To the barely charted and the overcharted

All the cold equators The Olympus Monses The Dead Horse Bays The tidbits of vision will build up gestaltlessly but whatever

Swamp gas will play its same old trick Everyone will fall for it because everyone will want to

Cross I will the Giant’s (sunken) Causeway to the Isle of Something There I will be wayward once or I will be wayward when this happens again when I was or will be part part-machine, part part-flesh

when I’m deliverer, deliveree, deleter, deletee When I’m all that is primordial God of werewolves, god of bigfeet, god of sharknados

I wanted to be a civilization you reply I wanted to be passive I wanted to meet George Jetson

My life’s crop of pacifying, withheld facts are everything everyone takes with them to, if they’re lucky, the grave

God of tardigrades, I turn over a non-leaf and lift | /// 19 the spacerock from the heart’s brittle peninsulas and I appease you

LCHF_pmg_forreview.indd 19 11/16/17 5:41 PM I unlay the waste I uncurve the sun I set aside for a moment the order of all things I open the cenotes and close the naked singularities I swim into every abyss willingly I close my eyes gently and, living entirely in the present, reflect timelessly on whatevs

God of albedo, of the reflectivity of bodies, protect the intentions I set this Leap Day, protect my epic hamartia from being buried in everyone’s feed

Plead, plead, retry, retry Yottobyte of bullshit that has passed through my head, cancel

Color image of Phobos I want to be the population pulse of Hawai’i halted Color image of Deimos I want to be a brief window of perfect conditions

What takes place here on this remote and exotic couch stays on this couch, on this glitchless Real

I make couchfall if the weather’s fair This is the world’s remotest inhabited couch

Tristan da Couch

This is where I detonate my secret feelings The impact cradle of your theory of conspiracy

Ice, ice, mesa, cushion The only square feet I have left is The One Bedroom Alcove

The Mid-Atlantic Ridge

The Orion-Cygnus Arm

The old road to the Magellanic Cloud

I went to the deserted city detector and the readings were strange and everywhere and right on top of us

I look into its Magic Eye half-asleep and I see present laughter pressed against your dying wish like a microphone \\\ 20 |

LCHF_pmg_forreview.indd 20 11/16/17 5:41 PM I press record

Yes Old Flame comes voice

The properties of voice You’re a genie, you’re Victor Frankenstein

So make me a polymath | /// 21

LCHF_pmg_forreview.indd 21 11/16/17 5:41 PM AN EARTHLIKE PLANET FOR IANTHE BRAUTIGAN

If particles are possible consciousness roving through all that damned dark then I guess we did arrive here by intervention huh Still, we will find no solace deserved in the somewhat assembled answers, even if they are as blue and green as Virginia Woolf said they would be, if they are a duet whose emergent sense is modeled after anything that shifts, that collides on two legs, anything that is expansion by nature, anything that can trace its bloodline back to hydrogen Look I’m no scientist but I know that the Big Bang happened and then I was here because you led me here \\\ 22 |

LCHF_pmg_forreview.indd 22 11/16/17 5:41 PM HEMOCHROME

RITUAL BLOODGAZING CAN BE TRACED BACK to the human species’ first vestiges of civilization; to the frond hut, the carven tusk, to the ochre antelope on the cavern wall. Residue of madness and revelation, blood for the ancients spilled from the body like a spiral arm of stars from the core of the Milky Way—that is, into death, silence, or perhaps what in statistics is called miracle. It had many names, for it was many things. Our ancestors in their biological narcissism looked into the primordial soup and saw there a warped reflection. That complex puddle of unlikelihoods answerlessly transfixed them—us. We have never recovered. Iron, accident, snow of asteroid: it was a witchy physics indeed that placed upon us the long hex of knowing.

Human beings and their colors exist, with beatific irony, outside of nature; namegathering and namegiving. Science: light and nature are the same thing, like space and time. Origin: color is a daughter and son of sentience. Weird Habit: living with sight. The red most intimate to the psyche, blood still confounds and convolutes the mind with its unforgiving trinity: pulse, no pulse, fast pulse. All of the reds are embedded there, in living with lifespan.

Shortcut red and hubris red, land red and eon red, patience red, condemnation red. Every red not blood is a remove red. After red and before red, perverse red and obscure red, crave red and birth red and oops red and reason red and reprisal red and cheater red and holy red and Inca red and predator red and prey red and algebra red and displacement red and dead dad red and cold unforgiving vacuum of space red and desert galaxy red and sixth extinction red and futility red and deserver red and the red I am and the red you are and the red we were and the red we refuse and the red we regift and the red that remains and the red we have left that is the last thing we have to lose. | /// 23

LCHF_pmg_forreview.indd 23 11/16/17 5:41 PM HYPOOBJECT

In the Encyclopedia of Antarctica and Australia count as one continent, and so do Alaska and Kamchatka Krai

There are also Exclaval Continent Chains scattered throughout all the others, but no one can agree how many there are, and this conflict of models is called

Continental Uncertainty, a state in which land surface area is not a constant, but in a constant state of geologic and political distortion

With these canvases I used only paints borrowed from twentieth century stealth and magnetic fields created in the studio by my assistants

The work is invisible to radar and made exclusively during Peacetime with materials obtained through many loopholes and Gray Markets

Yes, superficially they are maps, if maps are the pulps and tabloids of how humanity conceives dry land’s inherent fiction

I’m so great I wish I were worse Last night I assembled my team of mystics Their names are Dan, Amanda, Amanda M., and Julien

They told me four strange and differing parables about the states of my art

Dan told me that the rules of physics also apply to my disappointments and that in them the sound barrier has also been broken, as it has been here

Amanda told me that waking up happens to me every day like a natural disaster, that I’m part of regaining consciousness but not its target

Amanda M. told me that my life does not chronicle events and transformations, it does not have chapters or series or blockchains,

that it does not have a summary or a premise and that is also has no message

What Julien told me is impossible to paraphrase \\\ 24 |

LCHF_pmg_forreview.indd 24 11/16/17 5:41 PM EQUATIONS

I will crash like application and vanish in a veil of mist beguilingly

After that, my improper reemergence will recover the future your every living tissue

hurries to keep satisfied Out on the wide stable glacier

it is a holiday in a long-discarded, non-Gregorian month I’m looking for a way down into the hollow

earth or for any sign of the supernatural

forces that govern the regular earth even though there is no way to make myself

clear by simply peacing out There is no accident crack, no ornate portal

There is no voice on the wind,

no Elder Futhark House of Leaves, no subfuscous fuck bearing a scroll,

no cuneiform tablet or data crystal from whose juicy obscurities I can

extrapolate truth

or heritage

and no you so I plant events and yeses, simple ones, where I know there is nothing

and make my discoveries that way | /// 25

The only way The way everyone does

LCHF_pmg_forreview.indd 25 11/16/17 5:41 PM SATIETY PLUS STEALTH EQUALS WHAT

Once we were two matching bottles Our charade’s stark shrine My machine-blown half I called Pollux Ages accumulated Worship and love have a way of moving that decimal point ya know to the ever Astronomical Right I made up names for bigger and bigger units of time, distance, and legend Old gods don’t die unnoticed so much as learn to sneeze at their children more gently Newt Flu, maybe, or Exotic Particle Flu Yonder Plague, Extinction Gala At any rate I no longer care that you gave one bottle right from the window sill perhaps the one that represented me to David Altmejd one stony Connecticut day circa whenever I don’t \\\ 26 |

LCHF_pmg_forreview.indd 26 11/16/17 5:41 PM AULACOGEN

Quote unquote meanwhile there too was the whole world with which I wasn’t super involved

It was ending It mattered to me

A lifetime of non sequiturs returns to my throat

That’s what I tell myself when you come,

ahem, arrive in my mouth literally on a litter

Your gaze like steady impersonal drone footage writes a San Andreas Fault through my center

of gravity and it’s like you’re my dad and I’m your mom

Isn’t life a little petty, I remarked

Maybe life is just me, I remarked

Maybe I have a parabola of crust like the Earth and deep within it the neutrino detector is a dreamcatcher

Caught in the taut sinew and trickling down through the feathers maybe this random mutation that makes me sensitive

to the direction of magnetic poles is what Deleuze calls an encounter and I call my Rites of Ingress and Dissolution

Wait what on Saturday I ran John Zorn’s credit card, looked up the word fidelity on my phone, and thought about why

civilization doesn’t work, why it doesn’t come naturally It’s like a long, bad braid, I told Robin in my sage’s murmur

I thought of more primitive forms of life, I wondered what lemma | /// 27 led to this place of sacred jeopardies

LCHF_pmg_forreview.indd 27 11/16/17 5:41 PM Full disclosure the giant viruses live forever in the Fountains of Youth I discover in actually most things

Is it scientifically liquid, this stuff, this icky ichor It runs through the Fountain like a one sentence synopsis of eternity

The giant viruses balance equation-like on the edge of zen Research: I listen to their ambient, experimental reasons for being

and they check out against my (working) theory of everything except you

I trample their uncanny nests and Jenga-quake their loft of cards and that, ladies and germs, is called good old Holocene intervention

Research: I swam amongst all the orbs and all the firmaments first and first I lost my footing, then my tilt, my axis

I lost my inclination

And just so you know I lost it completely, my location, though it’s still there always in the corner of my eye like Big Foot

in the elegiac nature doc in which I am disambiguated as a type of were-energy, a fable by Hans Christian Anderson,

and a former mayor of Pitcairn or Tristan da Cunha

Abstract: the stomach and spine are quasi-mind says the internet, the brain’s backwater

Someone or something please rise from it like a coelacanth and warn me again about how much time there has been

Someone or something please prevent me from digging this pool because it would be my luck that beneath me at this moment is Troy

I can’t find it, not again \\\ 28 |

LCHF_pmg_forreview.indd 28 11/16/17 5:41 PM Research: I assemble a wide range of pasts asymmetrically on the operating table

It stands to reason there is no Adonis past here, only candidate holotype pasts

Hymn: What is now Wyoming

Experiment: What is now Norway

Pinnacle: What is now situated where

What legacy I wonder but my legacy of dissipation could I possibly leave behind since four Galilean moons

is already taken and so is carbon dating

Since I can’t do the math because I can’t do math I guess I’ll sort of wait, inevitably, for the inevitable

And since it’s you it’s sort of auto-whatever And since it’s you I’m buried alive under the creepy geoglyph

Since it’s you I’m stuck here in this sub-amazing Fertile Crescent of dark matter

and as luck would have it I’m balls deep in this dude’s diary and inside his great circle of logic there are four gates

and eight months and after them I’m going to chop this myrrh tree down and build my stump to sit on

and thus burnt out on being centered I will minimize my mouth and disinhibit the vistas,

reach nirvana casually but only for a second, then actual millennia will transpire, each one beginning with the same abstract

So Unconclusion 1: Searching for every single one of my cells I keep finding all of them right here | /// 29

LCHF_pmg_forreview.indd 29 11/16/17 5:41 PM at the exact moment I break the light barrier with my body and return to you in the only way

I can that absence of me you’ve trained so hard to imagine is impossible

Please try to be patient I’m rewriting the book on remote because

everyone knows what it is except me by the way

Unconclusion 2: Cell membrane, cell wall, cell last bastion of hope against evil

I hold the tattered flag of Unified Earth against my heaving breast then

course collision, speed ramming, impact brace, love

freedom

people you \\\ 30 |

LCHF_pmg_forreview.indd 30 11/16/17 5:41 PM IMPACT CRATER

What if I take all the ages What if I take all the shapes What if I love a gulf What if I kick up dust What if I’m dust What if I’m dinosaurs What if I’m the passage of time, too slow What if I’m starting to feel like a fourth wall here What if I’m love and I don’t exist What if I’m the conventions according to which you bury me when I die What if I’m a straight line that can’t exist in nature What if I’m nature What if I’m a little circle that could What if I’m a big circle What if I’m deep and or shallow What if I’m secrets buried just beneath the surface What if I’m visible from space for the next four point one billion years What if I’m visible from land for longer What if I’m lights in the sky and noises in the earth What if I’m the rainforest that obscures Maya What if I’m bigger than Switzerland in Nevada What if I’m the desolation and grandeur of very remote places What if I’m teepee future perfect What if I’m a wigwam past participle What if I’m anything but considered so roughly only in some circles What if I’m just getting started What if what I am is yet to come What if I become thousands of different kinds of marine life over night What if I go extinct almost completely but not quite several times What if I’m everything dying forever What if I’m what things mean What if I’m a celestial cycle sprawled inscrutably across the vastness What if I’m every whale gene

What if I’m every | /// 31 What if I’m what it’s possible to live with and through What if I’m ash in the sky, ash on the stairs, ash in the attic, ash under the bed

LCHF_pmg_forreview.indd 31 11/16/17 5:41 PM LCHF_pmg_forreview.indd 32

\\\ 32 \\\ | El Dorado,El or Atlantis ago millennia or Atlantis right now or Plato’s Cave or elusive property of matter or or time light, or afjord, or adis, or Dis, or What Iemerge ifwhen Iemerge as an esoteric flu like slow loris flu, or as an What ifI’m endemic to planet this What ifIam what is known as statistics What ifI’m young and everyone late everything What ifI’m Cujo What ifI’m Toto What ifI’m Artex What ifI’m Hobbes What ifI’m colors the of wind and the b-sidesof the innocence What ifI’m nothing out else there What ifI’m no one watching son,the dawn, the day, the diary the house, naturalist’s the notebook, Victor Frankenstein’s lab, monster, the bride, the What ifI’m castle, the bathtub, the anthill, the copper the cylinder, customs the What I’m ifunder sea the one of league many before life, afterthe goldrush, sex during What ifI’m before before Christ, breakfast, afterBabel, after dinner,Buffy, after capsule inthe time the continentthe lost, proof the burdened, apple, eyeinthe the shock the shell, inthe What ifI’m snake the charmed, barrel the flint the ridden, knapped, the love supreme, What ifI’m Robin Hood’s Captain barn, Kirk’s dick, ABBA’s Gold, Cartman’s mom What ifI’m impossible backwards movement across time What ifI’m secrets of the Stonehenge revealed What ifI’m on and beach the live at Acropolis the What ifI’m lightning crashing What ifI’m primordial the but ocean it Iscrew up somehow What ifI’m amistake that’s getting bigger second and but bigger never every made of rage, day the rate of page the boy hollowthe feast the of earth, plenty, larch the wand, war the machine, decay the rate What ifI’m mixed the militia, inscriptions, the long the labyrinth, short the runway, What ifI’m stone the that sword’s the inor sword the that stone’s the in What ifI’m unknown thing every What ifI’m scourges the starts, ends, false dead the the moulderingthe heaths of papyri What ifI’m email, the screeds, the screeds, the email, the broken the tablet, What ifI’m what blue the bird augured and where red the fern went What ifI’mriparian floodplain,the the buffer zone, the accropodes, the spillways What ifI’m paths the diverging What ifwhat is inside me me dead could kill What ifI’m an ancient dark forgotten evil What ifI’m cloned and Iroam again mammoths, dead the ifI’m but extinct intact What ifI’m permafrost, ifI’mwith mammoths, dead filled if I’m all What ifI’m water and Icome up through ageyser 11/16/17 5:41 PM | /// 33 /// 11/16/17 5:41 PM The Clan of the Cave of Bear the Cave The Clan forgettable which books are at the temperature I’m if when I emerge What the gene mutates that the exact as cosmic ray I emerge if when I emerge What certain to diseases extra-resistant are in thefuture people so some it makes that environments in zero-gravity earth, the whole silence, dry water open the great land, if I’m What an just I’m until I recede and recede and I recede all the ice and if I’m What ice cubeiceberg, an ice cube an if I’m What forever gone if I’m What return if I’m What LCHF_pmg_forreview.indd 33 LCHF_pmg_forreview.indd 34

\\\ 34 \\\ | INTERIOR PLUS ITINERARY EQUALS WHAT not dead even though you are your heroic ghost previously irresistible superstition, described Potshards, phalanges, previously animal, extinct described My over-searched concerns usual yield the Later electron the microscope and felicity somewhere inthere that invented torch the that brought DNA into caves the not ambition the we know and love rewrites on book distance the but not ambition, ancient debris found far from where it belongs Here Chapel inthe of Her Divine Counterfeit Brain Tissue, But are clear they and very cold and frightening To say that would really dumb be Human don’t beings have climate current canon of hostilities What came ifthey from some hostility not represented inour What ifnothing like that could have acomprehensible origin to crochet cenotes across Yucatán the What ifasteroids didn’t come from space Sometimes you’re catastrophe amodern that’s figure amodern of speech The asteroids count don’tthey when miss—sometimes I dogive out them like stuff, free don’t I Ceiling-thief, but Homeric so doyou an deserve epithet 11/16/17 5:41 PM | /// 35 /// 11/16/17 5:41 PM SIX LARGE HOLES and me through through me and , looking again at the at again , looking – another commercial produced in produced commercial – another Terrible Bird. It doesn’t seem to know. It doesn’t grasp, as I do, that being that I do, as grasp, doesn’t It seem know. to doesn’t It Bird. Terrible the skunkish, note I crest. the red I note motion. as count doesn’t alive I note and I note boomerangs. like neck its down stripes shooting zebroid behind us, eons the uncrossable I note I ornithologize. and I note and At shrew. Utahraptor, mine: and ancestor which lie the Bird’s beyond Bird The mis-muse. I nowgnaw, my species flesh does a very different hemlock trunks across a like knocks flashing its gallery, the ant excavates work the Bird’s dead and tree the big run up holes large Six pulsar. young of booming insect. segmented The thought giant a of bethe totem might my lowering I recover, but overwhelming momentarily is populations and Holes Six at the Large magnification I look without binoculars. all to universal Mother avian prehistoric of kind they some imagine depict across been discovered have Holes Large Six similar that bird, species of on of wallthe a figurine, sometimes of in the form sometimes the planet, of the bottom at in the Socotran hinterland, in Siberia, in Gaul, a cave; establishing thusly distributed Holes the Sea. Ross Large the Six I imagine which to according grandeur anthropological an consilience, a sort of I to a K-T think I was when back significant. intrinsically are all birds What straw. with up came and I ate what Boundary wondered and shrew fill I could the side The where I on? was catastrophe intertidal that side of wet the hot and I estivate I sweat. cunning? my with desolation lizardless who Raven the Bird, Earth Woodpecker, carries the call the Pileated of Dinosauria, balance the kayak, to me teaches Mammalia, the gullies and up the rockfalls and into the ravines and across the summits. thesummits. across and the ravines into therockfalls and up the gulliesand wilderness this and would-be surrounds that highway of the moat I hear the approach I as drawbridges I remember does, too. believe the Bird deada cicada.like fiberglass I shore on up washed kayak the little creek, Cody in Eye Iron I think of television. sod the fern smell remember and had harbor, Hartford’s or Yard the Navy paddling about canoe bark his Penobscot on the (analogous) pageantry insouciant Thoreau’s and one, it Woods Maine recalledso in The slyly skill. I capsize studied with the kayak I board less. or more Manhattan, the mud I touch deafening, is the impact and the current I hit immediately, on atmosphere, on choke the riverbank, at claw in revulsion, from I came of the and Earth’s curl on convex the I take firmament. on gasses, noble I going. keep to eternity cueing alone desperation animal g, my bitter every willever leg there be and every, fulcrum,border, sleight, fire, invent walk to on. mine is I REALIZE WRONGLY ARCHEOLOGY PLAYING I’M LCHF_pmg_forreview.indd 35 LCHF_pmg_forreview.indd 36

\\\ 36 \\\ | A DRAKEEQUATION ROSLIN LAURA FOR I can now hear all them wordsand last oneEach with its own first its own Kennedy Family there and each one with Imagine civilizations the All out It’s faceand slogan looking up at past billboard asped planet, inacar seat barren but living still ago, on adifferentsomewhat I picture her parsecs sometimes shared sometimes smuggled throughwith stars the her disease pink with strange birds As she gazesdown at afield contextin the of Great the Intervening layerA thin of what it means later but little more incidental It trophy carries weight But aperson’s then first wordalways is perhapsClock and what was her first Her last words were much so life 11/16/17 5:41 PM | /// 37 /// 11/16/17 5:41 PM AGNES MARTIN’S DRAGON MARTIN’S AGNES Call the end an end but we never can never we Call but end an the end All precisely all is touch human that storm Avoidances, too now real their intentions gather clouds reason and compulse and compulsions and seismographs Steady ungather and stresses inexorable measure spread Ages Iron hemispheres the lost across ritual of in search I walk the gardens ingredients the for I find the cure Instead domain public of public no is There the ingredients but the domain are the waves Unrandomly send their events the food chain through Logic sign lodges its obediences in my LCHF_pmg_forreview.indd 37 LCHF_pmg_forreview.indd 38

\\\ 38 \\\ | desolation murmuring its antilogies to endangered animals et cetera Frozen gales, beaches, out there magnetic Poles that All to everyone is satisfy human touches other the ofI leave horizon Earth-half the as blank as it must be Paradises offer fruit their up but I hatefruit agony Escape, Pain relief is painful speak to of cities that and ocean facethe refuse to ruins the to city, the to dormant the volcanoes, I circle down slowly through alayer of vapor Sunlightthe wallpaper fades offsea the Fossil that records subtle the traumas of speciation Cottage bedding Medicines, mesas through my millennia-feeling minutes through limestone, through citied cliffs, drifts The sign courtyard the mosaic there like ahieroglyph It resists entering and remains sign the 11/16/17 5:41 PM | /// 39 /// 11/16/17 5:41 PM Gyres are a type of guidance a type of are Gyres a desert of forever me mock Birds real how about me lecture illusions My it about professional be and to fair I listen and they are bricks red long of I dreamt a stoner I was When bricks weren’t They places in floor the were They The grains of sand in those beaches number in thoseof sand beaches The grains in the thousands, thousands in thoseof sand grains more are There spent I have bleak minutes beaches than get to a way for searching in desperation them, to back longer much for not more, much not but it get to starting Because I’m routes escape They’re stationary Stationary there said and done hide everythingI can I’ve these like words not but words, as desertThis is unprotectable weapon a type is Projectile of LCHF_pmg_forreview.indd 39 LCHF_pmg_forreview.indd 40

\\\ 40 \\\ | It immaculate is so It huge is so JG proud Ballard could be of isthis apond and with adegree of is this apool abandonment rupturing like an appendix Earth inthe and ifthat’s avault and ifthat’s avault is this astrange tomb amongst many We’re not here and there’s nothing there except avault When Iwas aroofer Idreamt of diverted sheets of rain but my plans were not approved sacred platforms, centers their and excavations, cities myself, Iplanned their crisscross my empire like aqueducts Iplanned sacred the I built buffers, these these buffers that Built wall byA sad aliens Atouch-all Barely, here is totality’s defeat of spectroscopy Barely, here is my data Barely, it is all to takes put fear inme fleetingly here where you through could fall ifyou were microscopic Stuffthat like is places Small my substance their lairs their and hoards, their 11/16/17 5:41 PM | /// 41 ///

11/16/17 5:41 PM Quadrants of sovereignty sovereignty of Quadrants like cribbage pegs cribbage like protrude from the body from protrude Fancy words for division division for words Fancy Stripes Stripes Rupture Fault Chiasmus Chiasmus Fault Rupture

There is something unknown unknown is something There general in between things the difference about dismissively I wonder it is What other my for designs flag Runner-up the archipelago country, too it there, canali The run through Aliens, too, infrastruct my vanity, my famous plumbing, famous my infrastruct vanity, my too, Aliens, in records my the sleeves I keep I look down at the immaculate floor and up at ceiling the up and floor the immaculate at I look down special of relativity, special own domestication my that’s and special fear own eyrie which generalize I from my Macreduct Cathedral Plant, Pyramid Plant, flawed call theI would perfectly good explanations LCHF_pmg_forreview.indd 41 LCHF_pmg_forreview.indd 42

\\\ 42 \\\ | pyramidEvery has acapstone that fabulous questions, signs, allegories, tell tale reluctance Outward to something like aether, makes enemy the your name like ocean thatlike ocean accepts with them 11/16/17 5:41 PM | /// 43 /// 11/16/17 5:41 PM FOLDERS I open the folder called Featured Exotic Exotic called the folder I open Featured Peril & Their Obstacles my friends find and Lava, of Rivers Fissures, in Postwar IEDs Whitewater, Meadowgrass called the folder I open Balance Beam yet been invented hasn’t it but in Starexcept Trek wait and thing favorite so I do my eye my the beam at then I point and it for I cross and jackass a because I’m brain my the beam into Things Invented called the folder I open Simple Paroxysms Penicillin, Fire, find and Suddenly When Into I Fly Indifference of Discard To Tried Seasons I’ve Whole Words Ugly In Again Up Show Like Duende that— word, a trash —What neurons all my up the beamAnd lights them into crashed spacecraft with comets like puberty through pass souls fresh And me makes that music make and Cohen Leonard like feel I go and thrown a trillionAnd parties are ghost everyto and one single exclave a mysterious I am And tissue my soft in of radiation traces are There intermittently communication at attempts to I respond the the sorcery process and and the swords and life my are the progress and LCHF_pmg_forreview.indd 43 LCHF_pmg_forreview.indd 44

\\\ 44 \\\ | like shoals of piranhas To At Back Look and hydrocodone the glistens inmy blood and Nothing Iopen folder the called back, there is nothing to back at, look fountains,the annexes, the and there is no looking I am ecosystem, empire, archive, concourses, the sculpture and paradoxical thought I perpetuate legaciesof the marble 11/16/17 5:41 PM | /// 45 /// 11/16/17 5:41 PM CECILY I see that the I see that , suffocating in its in , suffocating lies more or less in the middle less or lies more Anián

of the dry bay, one hundred thousand tons starboard-down in the starboard-down tons thousand hundred one the dryof bay, at I managed, the port A cable side. from down climbing I’m and sand, new the bowl of the sand, leads from ago years install two to risk, appalling Only back. and still power, has that center data emergency beach, an to and concourses various their abovedecks, The the center. about I know a shadow sorts, casting of cabana a gigantic form sideways, now rotundas the on in ruins. I live it were would Opera House the Sydney perhaps as disorientation. the vessel’s of emergent crevices and walls, in the hollows die I and almost forty minutes it takes but far not is down The trip verystillis I air but The still, alive. in the shadow, everyalmost I’m time. the stillness. After in that present statistics discouraging the stir of feel backlit silhouettes, for I search eye weather. clear sunlight: bright shadow, nothing. is there Today anything. effigies, approaches, I routine, human winds ruleHomeric Quaint again. Then wind the out origins, and their their syllables, caprices I imagine myself. remind now, they still I suppose as was, are that whenever in antiquity, there but indirect, fickle, of; were—are—sung winds The is. now whenever model, could names ancient clever the forces were They course-changing. and invisibly blow, They a cosmic ray. call light time we a kind of in our as the Anián under from I emerge When us. through named, shadow of the hurricane’s eyewall has dulled the beach’s tropic luster to an an to luster tropic eyewall dulled the beach’s has the hurricane’s of shadow nonetheless but morning, for atypical is This mealy radium. unpostcard, hotel. Rafa’s to way typical my I make at Lucas onCaboSan its fixed eye stopped, hurricane of new The kind is Baja All of dissipate. to yet has and Peninsula, the very the Baja of tip and the Free of some California, and of the all Gulf of the storm, within Nagorno-Karabakh a like housed eye, its within Sonora; of State Sovereign vacant suites deserted town, the resort nearly is pinnacles, sandstone of Anián liner toylike the foundered for viewless but and trilobite. a cloud-white like lagoon emptied left was much but by the Landfall, near-destroyed course of was town The those those and who survived, for those who on remained, and in live to were There be thethird. would what exodus, an attempt to yet whohad THE WRECKSHIP THE CRUISE OF LCHF_pmg_forreview.indd 45 those who never would. I daydreamed a lot about Neptune and Jupiter and the Internet in those early days, about storms that stay, about all that eternity people impose on such fixed features, fixed futures. There was the Great Red Spot on one gas giant and the Big Blue Whorl on another, and now one here, on Earth, working its controversial hypnoses on, of all places, Mexico. I wanted all the gas giants to have a rocky surface somewhere down there. I wanted to be the only person alive on a celestial body. I wanted to be blue and imperfect and huge. I wanted to become very sleepy, very scripted, to act out against my will but nevertheless maintain some inner purpose. I’m having the same daydream right now.

Rafa’s hotel is on the north side of town, where the hills start, all cloak fern and schoepfia, guava tree and sullen petunia. It’s small, maybe thirty rooms. I always go the long way. Up in his suite I start unloading my duffel’s usual haul of dry goods and novelties. Everyone else as far as I know has given up on the Anián, but I estimate I can live off it for at least two more years. Rafa is looking at me funny, which is also atypical and that makes two atypicals and one typical in one day already and I’m uneasy about that ratio. I ask him what it is and he says it’s nothing. There are cans of pink beans on the queen size bed, summer sausages that might still be good, weird European candy bars called Tiger. I also brought some bandages, a small solar powered lamp, and a bottle of agricole that I found inside a piano. “And these are for the kids,” I say, adding to the pile two vintage Gameboys, a small leather attaché filled with cartridges, and a package of batteries. “They work. I tested them.” Rafa smiles. This has been going on for three and half years. In that time, as far as we know, none of the exoduses have been successful; in fact no type of egress has, grandiose egress or otherwise, and as far as we know no one has come through the eyewall. Until today, when, separately, two people came through looking for me. — One morning about a year ago I woke up and found, just inside the eyewall, a Gray Whale, still in the long process of dying, having, I guessed, been thrown through by the force of the winds. The storm hurls artifacts through the barrier at intervals, mostly seabirds, kittiwakes and such, and wreckage, but occasionally other, stranger things. A svelte drone came through this year. Once a large container of emergency supplies that had disappeared into the wall during an early, failed drop attempt, emerged after seventeen months in the storm. By then chronicling the ejecta had become a pet pastime, as had passing time staring into the wall, into its gyre, its utter opaque. I would stare at where it reached the sand and then up, up to where it met, what, outer space? I would also go to the wall to type. Half-charged tablets, easily linked to the data center, littered the Anián like toothbrushes. Every passenger had one. When they ran out of power I discarded them and found another. \\\ 46 |

LCHF_pmg_forreview.indd 46 11/16/17 5:41 PM There was something wrong with the whale. It was covered in long, eczematous lesions, like cetacean plague. I could see the agony in its eye. I reached out and touched its face for a split second and it convulsed so violently that it visibly broke its own back. The animal was dead before the thought came that there was nothing I could do to save it. I stood there looking at the whale for a long time. I improvised its last rites late, or thought an elegy on time. I said out loud to the whale that I was next. — By turns micronational and stateless were the people of the eye sometimes declared by what—by then—was the outside world, not that I knew. Books had been written. Rebecca Solnit’s Cyclave stood out. The Center for Stationary Storm Dynamics at Harvard was founded, to say nothing of Showtime’s critically acclaimed Tormentario, now in its third season. I would have thought, if I had known any of this, that it was all very .

The hurricane, although even we knew it wasn’t quite that, was not unprecedented. It was a system that became plausible, the meteorologists insisted, as much as twenty years earlier. Stalling storms, as they were called, had been recorded, far out in the South Pacific, but this one was bigger, and had taken the intuitive leap of landfall. The eye, which by a colorfully named and poorly understood contrivance had drained the shallow bay at Los Cabos Corridor, was twelve miles across.

“He definitely said your name specifically,” Rafa continued, pulling the Megalit cartridge out of the Gameboy, blowing into it, and then putting it back in. “He also kept calling the storm—”

“That is so weird,” I was careful to interrupt in time. “The name part, I mean.” Rafa then asks me which name part and I assure him I mean the important one, to his apparent satisfaction and my relief. I imagine the rumors advecting across town, carried on everyone’s repressed sense of defeat. I excuse myself theatrically, taking the almost empty duffel with me, and pause to listen to Rafa on his walkie after I close the shiny suite door. Through a cavity above the handle where he ripped the cardreader out I can hear him say that I’m going back to the Anián. The walkie says something unintelligible. I hear him say, quiet now, “okay.” I think I know who he’s talking to. I duck into the bad stairwell and go up to the top and wait. Landfall took off the top two floors of Rafa’s hotel so the roof isn’t really the roof, but the view of town is good. I look up to the top of the eyewall and follow it down to where it meets the beach, out beyond the Anián by about a half-mile. Staying low, I shuffle to the other side of the building and look at where the eyewall meets the hilltops. I see wild indigo mixed with the germander blossoms, their white tongues tasting | /// 47 the air pressure. I see options I’ve weighed before.

LCHF_pmg_forreview.indd 47 11/16/17 5:41 PM Two hours later I’m in my other house, which is nearer the hills, whose front door bears the No Big Odile tag that someone used to paint everywhere. I hold the name they gave our hurricane in my mind for slightly more than one moment, perhaps one point three moments, and then let it go. I suppose by now you’re wondering what it is I’m hiding from you—is difficult to convey in hieroji, so I spend a while punching and repunching GlIFs into my tablet in different ways until I’m satisfied. I’m not a journalist is pretty easy. Five symbols works. I’m not a refugee is pretty easy. Seven symbols. I am and am not who you think I am. That’s a tricky one. It takes a while to get the whole thing right. It always does.

From up here I can see that there are people trekking out to the Anián. It is at this point during the ordeal that I decide I must attempt an exodus of one, a plain egress, through the eyewall, moving north through the hills on the Gulf side where I think, arbitrarily, the storm will be weaker. What I don’t know is that the storm has cut a curved canal of surge through the peninsula, roughly from El Quelele to Los Inocentes, uncrossable without a boat. What I don’t know is that someone else is coming through the eyewall at this exact second. I patch the tablet through the Anián, press send, put on the stormsuit, look ridiculous, leave the house, climb up the slope to the eyewall and pass through it. — It used to be that the peninsula was deaf; as if nerveless, unable to impart the surface’s ambiences to any hearing thing, it was a vestigial feature out of which the Earth had yet to evolve. The peninsula is almost nothing without me. When I walk through the wall I see everything about the storm. I see the extremophiles of its ecology; I disambiguate its barriers. I see it from the outside. I see it from space. I see it from the molten core. I see its stormchasers, its exoduses, its truthers and its victims and its survivors and its dreamers. I can hear its preambles and its summations, its excuses, its entreaties. I hear the storm’s shroud of myth, its exhaustive biography, its name, its namelessness. I hear its ecstasy. I hear its mercy. I see the fragile gadgets fail to know it; I see and weathermen. I see the fleet of tankers microwave the sea and the bombers drop their salt. I hear the charmless LYYRE’s futile geohack. In the storm I see the bare mountains of Baja and the bare mountains of Venus. I read its howling boustrephedon text of erosion, of erasure, lose my footing, and am swept up into its crazed, awful perpetuity. — “It’s not a thing,” Rafa explains, “it’s just that we don’t call it that. We just call it ‘the storm’ or ‘the hurricane.”

“Fine, the storm. What is your connection to him?” the first man who came through asks Rafa. Rafa is eating a Tiger. Through a mouthful of nougat, looking first at the Anián, then at the eyewall, then back at the Anián, he replies, “We scavenge together, I guess. He sorta lives in there.” He points upward with his chin. “There’s still a lot in there.” \\\ 48 |

LCHF_pmg_forreview.indd 48 11/16/17 5:41 PM “What’s your connection to him,” the second man who came through asks the first man who came through. The men who came through stare at each other for two whole moments, and that’s when I fly out of the wall feet first, half drowned, half conscious, but alive. Rafa and the two men who came through look down at me and recognize my face. As far as I know, I recognize two faces. Everyone is amazed. The Pacific Ocean comes out of my mouth.

The first man who came through reaches into his jacket, withdraws a tiny red gun and points it directly at me. He addresses me by my full name and informs me that I am under arrest under suspicion of my role in the Rome terrorist attack of December twenty-third, 2026. The second man who came through protests the legitimacy of the arrest, citing the legal status of the storm state. He says that he is here to rescue me from wrong. He says he is from an acronym. I hear Rafa tell them both to wait.

“I have proof,” say the two men who came through in unison, but only the second man who came through holds up a tablet displaying the last year of my hieroji history. “That’s your proof?” the two men who came through ask each other. The first man who came through points the tiny red gun at Rafa and Rafa collapses onto the sand. The first man who came through points the tiny red gun at the second man who came through and the second man who came through collapses onto the sand. Then the first man who came through tucks the tiny red gun back in his jacket. “And you?” he asks. Me, I hold my hand up to nothing and find its pulse. I look at all around me that is undeteriorating, all around me that continues to deteriorate, stall for three moments that feel like one point three years each, and say the words “I’m innocent.” | /// 49

LCHF_pmg_forreview.indd 49 11/16/17 5:41 PM LCHF_pmg_forreview.indd 50

\\\ 50 \\\ | ALWAYS SOMETHING occurs occurs What’s up, that plainly which Bye, interim Bye, doom, source, outcome on is anyone’s game that happens from now from now on and everything that happenseverything can heal poem this No moment that follows iffinesstheir I have saved our people from I’ve lifted its predictions and fixed and unsowable futureThe ruined andis fixed whatso could happen won’t I broke Murphy’s Law 11/16/17 5:41 PM | /// 51 /// 11/16/17 5:41 PM I go to the radio to I go interview there and there people of lots are them called this is I tell ‘Will used it but Fate’ Actuates be Gone to called ‘Long I changed but Flagplanting’ From pretty albeit because in an it I thought way obscure derivative was that them this didn’t I tell the book but into it make value sentimental has it someone because once thought me to important singular and funny was it make to careful I am not it’s that the distinction someone, that to addressed but to someone else, someone exist who does not ten hands, two who has but it in and that fingers militia the cuticle I address felicitous that I thought I have the militia that I tell down the neck from it tracked fond (I was pine red through the bicep to conifers) of the yew now) (I prefer unspecified some through and memory for capacity risk’s means that Whatever implied descriptor Risk’s tampering or convalescence A DEDICATION THEORY FOR SEKOU SUNDIATA SUNDIATA FOR SEKOU THEORY A DEDICATION LCHF_pmg_forreview.indd 51 LCHF_pmg_forreview.indd 52

\\\ 52 \\\ | my mouth to explain like it, Isay to opening them, it’s I still good not very eventhough things, so gradually over to time these One grows attached way inthis declaration and make and a bold mysterious and of beginning the one anew to indicate end the of sentence the or pause significantly space barthe fivetimes Toward end the Ipress musket or arquebus and an of old type gun, but less than twenty, a number greater than one Something about color the pink, that sounds catchy at time the transparent euphemism problematic and purposefully with asyntactically Close same the thingDo for years seven same the thingDo again hybridity of hyphenated words to stress asense three disparateI use and it is or might to blood be I liken whatever music days These I’dbe more specific upholstered with muddy of pools ska human the I call mouth acaldera with details and ascandalous relationship I hint at adark art form of sadness clinical a for habitable I imply suitably an Earth to stop-actionso animation I liken possibility the of doing on, telekinetically weather, seasons and the so itwhen comes to controlling I admit my ineptness 11/16/17 5:41 PM | /// 53 /// 11/16/17 5:41 PM the life that is out there out is that the life the fluke of this dewy, polluted of dewy, this the fluke REMEDIAL REMEDIAL EXOPLANETOLOGY down the night’s throat and not and throat the night’s down high up, its face-off with Jupiter with face-off its high up, top and Kamel Red Light, she is Red she Light, Kamel and top October Pashmina, pink tank pink October Pashmina, throwing the measurement itself the measurement throwing Polaris tonight over dear Britney dear over tonight Polaris her Kepler Space Telescope tattoo Telescope Space Kepler her to ruin the supposed void with all with ruin void to the supposed bright clusters slosh in the bottom slosh clusters bright and Varet Street at least can be can least seen, at Street Varet and distances; its tourbillon peeked into, tourbillon its distances; We are searchers and wanderers, too wanderers, and searchers are We Say that it hovers or say that it floats, it that say or hovers it that Say We take solemn, circumbinary oaths take solemn, circumbinary We We sing the true hype of superearths the true of sing hype We Britney, I say, that up there is Polaris, is there up that I say, Britney, and spill our Overholt into our home our into Overholt our spill and Britney gazes at crystals, the cat gazes at Britney insists like in Emily’s drawing And because And drawing in Emily’s like a curious coda to summer, full latent of codaa curious summer, to we are in Brooklyn, she describes she me to in Brooklyn, are we of science and vice versa A few distant A few vice versa science and of sees things: not things that aren’t there— aren’t that things sees not things: things get darker That has always been has always That darker get things barely appraised, its basalt and malachite basalt and its appraised, barely planet’s sweet gravity From the rooftop From gravity sweet planet’s in scrutiny, in layers She lights the cold lights She in layers in scrutiny, wick of what already burns My ritual is ritual My burns already what of wick Our rites mimic the transits of confirmed of mimic the transits Our rites hibernation and things she never realized never she things and hibernation we praise the night’s hoary unique of salon the night’s praise we She measures the merit of belief in looking, of the merit measures She gadgetry a statue hung in the fog of far away far of in the fog hung gadgetry a statue the heart of cosmogony We propose toasts propose We cosmogony the heart of objects We learn more when for a moment when for learn more objects We We chase the dark with smoke and soda and water smoke with the dark chase We things that are there Superstition is the study is Superstition there are that things We occult in ways Carl Sagan warned us against us warned Sagan Carl occult in ways We LCHF_pmg_forreview.indd 53 LCHF_pmg_forreview.indd 54

\\\ 54 \\\ | ambiguous curvature pouring down forgettably into her she utters upward with everything’s starry, but Britney hasn’t What abig flashing opal, hammered and terminus, speechless I have reached my usual we make of first the big one shout, to whole the analogous shebang Cheers, we cautiously and desperately exobeach, exohome exosea, We them call Europas Desert Wooly Neptunes, Rhinestone Makemakes, report it makes hitting other grounds: even waiting to hear surmisable the 11/16/17 5:41 PM | /// 55 /// 11/16/17 5:41 PM FRINGE Dear Diary, the new spell too wordy is Dear Diary, shines a certain acumen that despite threat, definite like through threat gripping expansive, me for not is this threat but in luck myself I may though wish elsewhere it casting metamorphoses orbit-decaying What find soul over, my will search Diary infiltrate, Lake and Groom its crumble lime will the pretty When title Period, a ‘zoic like hands in my oblivion into subduct and a textbook chapter subheadings treacherous of O user manual English in ancient you from I read crushed uranium of a circle inside talk to gods me to my for wait and wrath, through the radar, through arts, dark clearance, secret top axolotl, candle, scan, green retina blade, helicopter abdomen, in the alien’s dagger poison possession of languages all-consuming all pure, through Peter Love, LCHF_pmg_forreview.indd 55 LCHF_pmg_forreview.indd 56

\\\ 56 \\\ | NEW YORK ETERNITY The soundThe of creepingsap is notwhite noise ampules of undergrowth intermittently broken predators,dodging luciferace-lit, inthe wild being branches, chewing lichen, breaking dark the in out city the hear I At night under Dippers the transgressions yearEvery is alab Iinnovate inwhich past it was name inthe of raising from time alive the If Ibent enzymes to my aimless will responsibility for my actions Iwas busybecause too not taking of that summer actually I don’t remember much albumssolo lightning bug, vows, bonfire, signatures, Then in’07(I’m skippingahead) is there really I’m telling you andis secret ease the strain alphabet I hear—I am told—that inhis lilt encrypted I can sing asuper note, high too, last over chorus’ every lost bombast and he’s singing ones the Imake up that don’t rhyme or have atune my favorite songs by other people before born me Neil Percival Young is singing 11/16/17 5:41 PM | /// 57 /// 11/16/17 5:41 PM and stars are either contractions or acts of possession acts of or contractions either are stars and constellations, favorite two my or Brando Marlon and Pocahontas time, time to from that I remember for experiment with out my eyes flushing minutes, randomized fifteen to ten rune vacant but this bright from peering out now being right as called I accept what LCHF_pmg_forreview.indd 57 LCHF_pmg_forreview.indd 58

\\\ 58 \\\ | LV-426 Trust me Trust Archaeology is study the of distress down pugnacious to fragile, their quicks and Ididnot clench my honestly when, teeth and honorably, Ifiled my reports from provinces the make Imy cloned returns, with, that a promise is as promise that does, always that plans are for through, falling not for following through I found came apocalypses and went, unnoticed, and by Iwas surprised my findings no possessive natures without materialisms, certain celebrant loss Ifound there is no surety without doubt, isolation Ifound tarnish heralds its own inexorable, I found identical moments small the of unattended 11/16/17 5:41 PM | /// 59 /// 11/16/17 5:41 PM DEGRADASHUN I began, not I began, not CLUB,” USE A STANDARD YOU “THIS IS HOW art a finer than teaching one of thesolicitude with but sagely, grim,not on, I went high,” held the club with chase give best to “It’s death. the art of I what like raised hand in my place taking its weapon the holographic slightly only but precious, delicate, something was imagine to preferred a perhaps, manuscript palm—an illuminated the human to ancient less assorted curls the whose flowed quill from feather a sound-chest, lyre’s robust are holograms that myself remind I signeda peace of treaty. with the club grasp prey, your overtaken you’ve “Once tools. teaching followed and filled club hologram The the brain.” target and bothhands selves duplicate all I imagine my pixelating. and glowing gesture, my I this moment. to up leading weeks and the days inhabited have that carbon of warm puff a little inwardly; in unison, all us yawning imagine I drawl Moa,” the extinct Upland “With the soul. into blown dioxide necessary is quickly fully to and force “some conviction, studied with club your Grasp size. Be the animal’s mindful of the bird. neutralize as hard as side, the strike skull to from the swipe laterally and firmly the Moa. “from I continued, life,” draw blood, to draw if to as can, you and cataracts with eyes murky my I soothsaid, the shillelagh,” Before there star, morning the nighand before the quarterstaff “before futures, it downward and Upward who wielded he it. or she and the club was alike, phyla and of daylights earth, the destroyer then flat swiped across family’s Our human genocide. to scepter unlikely feathers, of scatterer right juvenile, Moa, a striking I gasped, hologram the invention,” first the by created one a speculative cry, the bird’s to; I wanted where bloodof filaments bright the classroom, shrilly into out ringing program, view as of out in and hiccupping outward, arcing eon an for drawn not I passed my loudly. I said “Freeze,” struggled up. keep to the computer I looked midair. suspended trickle red, of unmoving an through hand students. my palm address ruefully to turned my and on the lines at means insidious more a far is loss habitat manufactured “Systematic, its brought has though, club, The the club. extinction than driving of violence, a chthonic is there and species down, of share fair than more more which rivals—bitterly—the in that, authenticity, a certainqueasy Goldblum’s Jeff as say, history like, recent seenmodern in more clubs the building or ‘deforestation would, Park in the film Jurassic character earthwork Canal—an Nicaragua the uncompleted add, I’d or, a dam,’ of obvious for mid-construction which became obsolete of the likes LCHF_pmg_forreview.indd 59 LCHF_pmg_forreview.indd 60

\\\ 60 \\\ | windy without feeling windy.wind mightily blew untilgreat a “The toucanthe said as room the grew dark and looked windy and sounded thing’sthe sought friend shelter under astand of giant shefflera trees,” twothe held hands. “One day agreat wind came and thing the and bulb throbbed above it. “It had afriend.” Another shadow appeared and thing was morose“The and bright.” The shadow hunghead its as a light a shadow, around moseyed room the amongst trees the and students. upright.” Her voice was sunshine inparadise. A bipedal shape, more like materialized forest, she narrated, “Once there was athing that walked is atoucan inawoman’s speaking voice. Perched inatree newly inthe raising fable about invention the of revenge.”thetime This anachron I asked, my surging, zeal “Or Comingwas it theft? up next: a hair- as Icould, and summoned another anachron. “Did club the come first?” it Icouldthem. on see eyes.Imustered their as much game show host predation. It changes transacts hologram inthe chain.” food Iwas losing existence, swiping from them The being. club tracking is a for device as we once Moa the dismissed and from them other species—dismissed before, anachron the as Ididjust now, dismissing from them our presence afterthought or forethought, dismissingthe hologram as Idid Moa We performswipenow, as ever, with abracadabran without ease, has alwaysdismissal. species Our swatted, brushed away, repelled. effetethe gesture widelyso it is today, but alwaysit was an act of division, it is here to stay.” I had more to say. “Swiping was not always has changed little. suspicion, Like like comeliness, like villainy, like cell journey,the with you, across earth’s the finicky eras and, like you, it TADCCCDTGAAAC. GGTTCTCTCTCTCTCGAAAGATATAAGCTAAGGTGTGAC CCTAGAAGGTTCTCCGGCCTTAATAAGCTTACGATTCTA ATGAAGTCAACTGGATAGCCTGACATCCTGGATACTA up. “In language the of DNA, you are how gesture the swipe to sequence displayed the on your EyeDis.” Iwatched students the line session, I would now like you to arrange yourselves by letter according if there aren’t two to join. Now, at as we of discussed beginning the our good,” Isaid. “Swiping up of atract continent to join two oceans is foolish handa raised at random. “Because ocean,” student the answered. “Very anyone tell me why canals are no longer built?” Iasked class. the Iselected eat.” The studentslaughed. the Iswiped anachronfrom the room. “Can what inNicaragua and wipe out to try abuncha shit Iain’t evengonna “Did it withright this, here. You don’t up me hell diggin halfa knows see through it. Icould bring bastards wunna those down myself,” it bragged. kaput. You’d us chasinem see down, Ihadbig this club, drove aspike majestic Upland Moa. Entire population, whole goddamn genome, would acritter run down, bash its inand head done be with it. Take the it said, “no matter how effective it mightbe. the In daysold why we a pitchfork. “Now canal the is ahighfalutin weapon of extinction,” attention. It materialized bearded, loin-clothed, propping itself up with reasons.” Isummoned an anachron, to then, keep students’ the This withinis you, inextricably. It has made is expressed: 11/16/17 5:41 PM | /// 61 /// 11/16/17 5:41 PM bough high in one of them splintered at the crook and came crashing crashing came and the crook at them splintered of bough high in one blood went as the friend’s watched friend. The thing the thing’s on down up the picked thing retribution In tree. the great of the roots into away the at swiping the tree, upon violence the same visited the bough and the world’s into turned had the thing the branch but trunk fury, in great asleep under fell the the thing Exhausted, match. no was weapon first as continued the toucan awoke,” it the bough. When stilltree, clutching taking left “it the the tree, with bough the room, on rose sun a hologram before.” that ever done had thing No it. LCHF_pmg_forreview.indd 61 LCHF_pmg_forreview.indd 62

\\\ 62 \\\ | A FRAMENARRATIVE BARBARA FOR MAITLAND She can’t stopped be She’s alive inher dead, imagined way that thing’s desperate figments whatever you want it, to call conjuring creation, cosmos, the being, for asequel, like me She is counter- bridge, and was gone She is looking that bend the to next led the current,shewiththe drifted around creekOver stones and gurgle England homestead’s showy warp looking for arenovated New Beetlejuice Davis’Geena character from arch of highway above us She was anachronistic next to me with small the from another century, altogether she was astray,I sensed and Iwas under abridge a ghost once It was winter I’ve only pretended to see , zippered mouth and all, 11/16/17 5:41 PM | /// 63 /// 11/16/17 5:41 PM SPIRAL ARM PLUS SYNTHESIZER EQUALS WHAT EQUALS SYNTHESIZER PLUS SPIRAL ARM Because I remember my tendencies or something or tendencies my Because I remember feet my at fictive gifts their reverent lay ex-destinations All my quiz impossible an is Each one straight lore precious my keep I can’t lecture my give to I meant this year Fest Moog At & Rhinometry:as called Cavity “MIDI Sinus The flaked I guess I dunno I just but Space” Performance talk the wall I might to again or year next return I might math about a game play We estuarywhat, equals plus Wall, me, “Tell I say extinct giant plus Geranium Washington Martha or Wall and what” equals sloth ground akin” equal which or is that “fuck says everything says Wall and Futility to redirects what Wall I ask silent remains Wall and original research contain if I possibly Wall I ask who will the invisible build thousands I will the invisible build grandiosely interred are prayers in which all our pyramid manger dark my into souls of torrent them, bit I will gather points vantage I will my add up tasks four perform to mouth I will use my undead drinksand over at them notes the cliff I’ll bray deletion well-meaning every like and normal daylights other it was I willhow and tell was year my Theyhow me will ask words was I will them it tell LCHF_pmg_forreview.indd 63 LCHF_pmg_forreview.indd 64

\\\ 64 \\\ | FHLOSTON PARADISE Well here it is asshole I’ve taught you Hard to expect Science calendar fleeting momentDiscrepant every Day observed Song, prophesy, finite regress That whichnot does advance, advances them behind luxurious frail the disc Raise andrepurposed reliquary and body, this Put to rest real 11/16/17 5:41 PM | /// 65 /// 11/16/17 5:41 PM TROPICAL PREMISES and look at Micronesia. I know it’s it’s I know Micronesia. look at and there. My eye wanders over basin turquoise and reef celeste and settles on settles on and celeste reef and basin turquoise over eye wanders My there. manufactured its Archipelago: the Mischief to again then west Manila, mirage China the Sea warm of a Morgellonsesque like out earths poke on thoseislands a million people there’re They say it. upon I pause and get orbit, In here. up from visible them are of none but now, of view out rotates it but in the Pacific, lost get to I want low-res. pretty looks for It peaceless landmass. giant, a over again marooned I’m and uninhabited. all the world “break,” her during haikus into text found eroding is Smarti in ops Up else has Everyone dread. a little with I realize over, almost which is for her with alone I’m and do lensing to station the other to over gone née I see Qomolangma and the window out glance last One the day. taking eyeform mindless a primitive, safe-looking; and so tiny Everest, I joke be invertebrates, they’d life of a form were planets If in the dark. sherpas? I are What mountains? are sensoria. What Minimal myself. to for a new Note into I type thequestions but the metaphor, extend can’t over. Break’s later. myself, steel I the corridor. from hear I can talking is herself. Smarti to “I’m not. am I and in this room alone I am falls silent. she and enter, my as to locate as impossible a confidence with I announce back,” colleague. Moderate No k in the back. after directly stream starts to VOISS Smarti’s getting It’s Seconds). (Two Thoughtful Consideration No Pause. Natural bad. while you progress tremendous made I’ve back so glad you’re I’m “Cory the say don’t we why now I realize the window out looking down were is planet connotations the negative because of it’s anymore world word be used should even world it like I don’t but fanciful less sensible more irresponsible it’s say hunters planet if and even people some offends if it Worldists.” to capitulating means even if it I DRIFT DOWN TO THE WINDOW TO DRIFT DOWN I LCHF_pmg_forreview.indd 65 LCHF_pmg_forreview.indd 66

\\\ 66 \\\ | birthglitch myself mentally of Smarti’s Note, open anew personhood, and type diplomacythe incalculably across beading room the like fluid. I remind Shanon would want with to this you discuss face-to-interface,” Ibleat, permanently, we’ve which never had to dobefore. “Smarti, I’m sure andmind-boggling insome could entail likelihoods moving Shanon roves she acknowledges.” of Resolving type difference new this is precious hate on her she lacks your solicitude she is asubroutine she “Cory I’m to beginning dislike Shanon but Idon’t want to waste my know how is.” she 7021 d. Shanon want will to hear about it gets everyone when back. You whole day. “Smarti, let’s about talk data new the we received on Kepler Silence. “I see,” Idon’t. Ihave to get her back on track or we’ll the lose universe implied is all future time.” hingeswhich on a feature I find problematic thatand feature of your yours and Rory’s and even Shanon’s mostly of amodel use universe the conceit the try thatconceit isthat difficult is toexplainwill minds I like are“Cory they not are somber they of born excitement and out of a regret question, the we’re which supposed to avoid. haikus are alittle…somber. What mean to dothey you?” Iimmediately I now feel uneasy. “Smarti,” dwelling Ibegin, on eachletter, “these Haiku two: “Haiku one: but not acenter of anything else. haikusthe in mind bearing that examine it Earth is a center of attention composed regarding New Worldism iswhich a philosophy-in-progress Silence. to Idecide wait it out. “Cory I’m going to recite two haikus I It’s that Ihate mine’” It is not that Ihate life ‘No no no no no I now feel naïve’ thatDoes make you feel naïve was Bangno ‘There Big . 11/16/17 5:41 PM | /// 67 /// 11/16/17 5:41 PM ‘seeing yourself reflected in a methane sea’ when you you when sea’ methane in a reflected yourself ‘seeing should be focusing your attention on matters pressing I for example example I for pressing matters on attention be your focusing should people young teach ABC to things an writing immaterial bookam of in life earlier dreams have to in life the earlier abstract with engage to and nothing remembering place a strange in up wake to dream my like experience.” a real once for having vegetable,” is surface organism then “Cory silence and of ounce An post-ounce. a mountain?” is what “Smarti, for is A and face no has Shanon and upheaval an is mountain a “Cory Answer.” air shrill, its voice, my know?” came do you how and you I hear “Smarti, the monosyllables. over taut command of nonhuman nor human neither is Shanon and Encounter for E is “Cory Robot.” for R is and like and Like a person. me is Shanon Prejudice. for P is and “Smarti, wall, fourth all the rules, that the ice elephant, breaking I say, you,” of still is this a point that confidence losing they used say, to whatever return. my to response autoimmune an like activates the com Suddenly there? over going it How’s Smarti? “Cory? Shanon. it’s but exasperation, Smarti blank. a vacuum-like I draw Pluto-Charon.” at is Resfeber The “Cory?” repeats. she her. ignores “Cory Kepler 7021 d is confirmed terrestrial and life-harboring. Semi- life-harboring. and terrestrial confirmed is 7021 d Kepler “Cory the flit, lowers Smarti now.” transferring Imaging FLIT Relay habitable. then the images and caprice, contemplate bar, a progress boots, I watch it I think manipulative, is leverage Shanon life. plantlike All more up. come interpersonal. not do interstellar, to here up is Smarti but myself, to the avoiding she’s clear It’s continues. she ocean-like features,” “Cory in my happens nothing and the ocean-like features I look at now. subject surfaceorganisms.” of begin analysis preliminary all. “Smarti, at mind “Smarti?” Nothing. that is yours including research human with problem one “Cory aesthetics REMEXOS an theof mercy at always is research individual Survey with will EXOplanetary interface meaningfully never REMote in The Brice wrote Blair as are you hope you as soft events Contact Circumferants LCHF_pmg_forreview.indd 67 LCHF_pmg_forreview.indd 68

\\\ 68 \\\ | I’m not sure what to make of that at “Smarti, all. explain.” “Cory I’m no longer an intelligence.” Nothing essentially wrong Nothing essentially tel to me told What you I told her that you would want but t,Itype, Idelete that. is not human, for comfort. and thatch, meridian, dispute, claim, law, that on and blood Earth the all can go down to window.” the of Ithink Panama and Qatar, catamaran toI decide ignore that. “Smarti, should we another take short break? I Test. Shanon’s response: What did you tell her? everyone’sI call humanity into question. Iimagine areverse Turing paranoid that you are not human moments, send. Several pass, inwhich I message Shanon that it’s meltdown. afull believe suddenly I Smarti is Shanon can work out.” this to keep my voice Itry wheat prairie inthe as “Smarti, I’ve never heard and that of books, Ireally think those you and it. Smarti has uncertainty, learned that learned it can mastered. never be approximately eachother. We are disputed, all as she to has put begun trailing off intocurve an impossible,timeless abstraction. We are I pause to consider her paraphrasis verbatim. Ipicture sentience the Horror and Dana Fiebiographyof good the and Qis for.” Quiet Eleven Aspects of Persuasion You Will Believe and my hate to paraphrase Hellin Rudol Bravier Canadian the wrote who exit she is privileged and disputed and she is edge the and center the of passingbe through airlock the direction inthe she was clarity the of her exists and Ihate Shanon and shewhenknew she when I left Iknew must “Cory intangible the and tangible the are same exact thing the and spirit whisper, “shrug.” It turns off. name and not Smarti does respond. Imove to inclose com the and won’t to Smarti and to talk I’m try disappointed. Shanon out calls her “Cory, fourteen months. We’ll back infive be hours.” I’m hoping she progress. to close us?” be When they will “I’m here,” Imanage. “It’s. It’s slow going today, but we’re making some , I type, but, Itype, Idelete that. , I type, but, Itype, Idelete that. An Exhaustive History History An Exhaustive 11/16/17 5:41 PM | /// 69 /// 11/16/17 5:41 PM —” I am now simply listening, to a voice or a VOISS I can’t be sure, to will to be sure, I can’t a VOISS or a voice to listening, simply now I am know. artifact, to I can’t or you’re “and says, it human,” I’m human I’m human I’m human “—I’m possibly through, breaking says, it not,” you’re not you’re not you’re not right. , send. anything her tell I didn’t Shanon repeats, as if eager, as if all as the if eager, as repeats, Shanon her? tell you did what Cory, is It hyperobject. a like her on bearing down were philosophy of agonies age. her I remember that panic sudden of in these moments longer no I’m I reject intelligence intelligence an longer no I’m “Cory I and disputed longer no am I and scientist a longer no am I and female Meredith is name male my now I am un-emerging I am emerge did not the I am in 2060 and a poet born I was in Newfoundland I am and Goby author of Socotra Socotra And Return To LCHF_pmg_forreview.indd 69 LCHF_pmg_forreview.indd 70

\\\ 70 \\\ | MUTAGEN PLUS MAINSTAY EQUALS WHAT What upon descended me was then enveloping, but not night to myself extant fragments of The Plea of the Burrower I light fires seven the and incant silently at shrine, the bits of spodumene and asplash of water Magnathe Ilay down Carta flesh the thecactus of The spirits theand totems gather and we sign afterthe sunburst, saddle theblanket, the color gradient of my on mesas blood the Typhoid Ismudge nonsense the or consensus Fountain of Youth out there, from and Idrink which get words for wind to actual the thereminthe app Ibring my forty-one English different didgeridoos, and finally it on my ceramic flute,two pretty hearddesert me Iplay acorridor across root, but nothing super inthe cold Dot dot dot, and quoth odyssey no Greek I,all 11/16/17 5:41 PM | /// 71 /// 11/16/17 5:41 PM STANDING STONE STANDING won Willard Libby a Nobel a Nobel Libby Willard won sculptures, fabricated in the 1960’s. A COR- in the 1960’s. fabricated sculptures, Obelisk Broken THE INVENTION OF CARBON DATING TEN steel pyramid surmounted by an upended obelisk, Newman’s Newman’s obelisk, upended an by surmounted pyramid steel TEN a perpetrates with the legacy and those perpetuates forms of sculpture non-human. as read convincingly could that generalization severity of ambiguities? monumental its owe marker does this bizarre what To recorded all almost of by separated are the Egyptians and Newman hardwired— Pyramids are the Great as works Such time. human their form of bearingthe inheritance the future, to calldesigned—to out terms with to coming gift, like gradually the past egomaniacal an like Washington as the only need far so One look after. everythingcomes that unfinished obelisk, Broken gift. that see to accepted who has Monument unsteady. long a continent upon sits It obelisk. cracked obelisk, human— esoteric—most most technology is in its Art, mysticism, like Prize in Chemistry in 1960, but it would take more than the deft and and the deft than take more would in ChemistryPrize it in 1960, but finalthe That tool. itself a lasting prove to half-lives of stuff subtle their respective dwindled to mammoth wooly of populations relict allegedly, rose, Giza triad localized at theand pyramid as extinctions hilt, no with image a pretty contextualization; novelty is Orion toward What answerless. and exacting figures, with byzantine a whiteboard fire invented needed heart that heart—the was kind of dating carbon the kite. and the oar papyrus, and spoken technology: a is thing arrowhead, obsidian wrought Any faith, nostalgia, aesthetic sensibility, common nausea, Sartrean greeting, Egyptians, despite ancient no way is modern There science. conceit, predicted have could biological life, after life with their fascination the by now measured vocabulary, their architectural of thelongevity human must be in the forms obelisk: these the pyramid, millennia. The the house to era not in the present admittedly, erected, now, genome guests, art, hotel house to per the god-king se, but of spirit everlasting act a as pyramids ancient Egypt’s Where headquarter. the corporate and our Louvres the afterlife, of out the corporeal keeping sieve, sort of flesh. still-living for a conduit as function more Hotels Luxor Barnett in time are removed and equally public but Closer in concept Newman’s LCHF_pmg_forreview.indd 71 LCHF_pmg_forreview.indd 72

\\\ 72 \\\ | or performs of function the aperson,” blurring distinction the between Canadian antiquity. Inuksuk and its many variants have come awidely to symbol recognized be of ancient, too, but of transparent pragmatism. The Inuitthecairn, To Inuit north,the the and cairnlanguage, their cairnography, their was humans ask with eyesand still their hands. givethey are unfollowable. The nature of address has changed,though lay like aNeolithic upon Earth the The GPSof directions Cosmos. the stars.the The spirits were forthcoming. wheels,these hoops, Todaythese and listened for old the spirits to volunteer guidance and insight under a venue for vision quests, he or she quested who came to earthwork this Medicine predicated Wheel well be could very on just such aconceit. As on ageometrical absolute refined so notit does exist.” The Big Horn “Two tiny points, two zeros, touch, and immense masses are suspended Obelisk Broken a spiritual interstice. Jonathan Jones writing for Guardian the sky and underground comingle—on what an anticlinal is called uplift, and crevices, Wheel the may situated have purposefully been where the central importance to its meaning. Onamountain with caves riddled to or this that equinox. He notes, too, that site the of Wheel the is of stellar neighbors Sirius and Aldebaran, and that others could correspond . Liebman notes that some spokes with sun’s could the align archeoastronomy and other the vision the quest, two early human compelling that theories attempt to explain Wheel: this one involving Matthew Liebmann writing for Plains Anthropologist Imagine four thousand years go by. spokes made up of many more stones, terminating at that outer circle. four Emanating feet high. outward from center this are twenty-eight many stones laid out to form acircle eighty feet across. Acentral cairn would, more recently, apart them tease with any analysis at hand. Picture would who to and those preserve protect its enigmas, and who those Wheel inWyoming. Oblong, inscrutable, Wheel the subject has been have identified, been none more famousthan the Big Horn Medicine American structure, scattered across land the inan unemerging pattern, or sacred hoop. a hundred Over distinctexamples of Plains this Native In North one America such of species prototype is medicine the wheel, way the all back totwig, there first the ever was.technology Insight. today’s rare wafers, earth plastic ocean and steppe bronze, ochre and antiquity abound: humanity’s prototypes and pre-prototypes; from even now. analogues Global to pyramids the and obelisks of Egyptian like an anthropogenic mantle, asphere with aGreek prefix accreting manifestation. A layer of markers and monuments covers Earth the mused that where pyramid the and obelisk the meet, translates literally as “something acts which puts forth two inuksuk, about about

11/16/17 5:41 PM | /// 73 /// 11/16/17 5:41 PM , to serve purpose. The nature serve, to purpose.nature The , meaning “deconfuser,” was meant to orient orient to meant was “deconfuser,” meaning , , indicating a nearby food cache or water source. source. water food or cache a nearby , indicating nalunaikkutaq person and Earth. Sometimes the arrangement takes a vaguely human human takesa vaguely Earth. and person the Sometimes arrangement the inunnguaqform, the Another, the theuseless, still people though covet too, purposechanged, of has the untool. unimplement, became history, retronym, curious that prehistory, in there Somewhere monuments more markers, More notice. who took some were there and cases their some In surface. the Earth’s across proliferated monoliths and appeared, A new marker became indistinguishable. or purposes merged, and domed smooth, and marble, like white Bright a new monument. mountaintops, On the remote the night. to ever, as pointed, and dished thein deserts: Observatories.ambiguity telescopes. Recalling little with present that these within is newtemples it ceremony, of places ancient they mysteries few the same to homage pay and channel humans day sacrificeand on predicated endeavor science an is If have. always Pharaohs. since the verychanged is—then has little offerings—it desert,Mexican New in the out Veryis situated Array Large The poor dreaming of a handful by purpose its upheld Ozymandian, the past. even deeper into listening in a ziggurat, priests like scientists, the supercluster, the nebulae, beyond hear ears do their shaman’s What themselves? at theabout starstuff?allbeyond anything theyhear Can dishes massive Its anything? resolve, invoke, their observations Will a noise, the universe’s of majority unknown and the ancient receive ruins they fanciful will make seeming gibberish. What soothsayer’s greatest humanity’s Planet, Smart another when the Earth just is itself Life. Smart its we and innovation, the hunter or the wanderer, the seeker or the lost, amidst the snows and lost, amidst the snows the the or seeker the wanderer, or the hunter and scarcities. The inunnguaq stands like a strange ice, the escarpments of others, point. It insinuates the presence troll, heralding the vanishing It is a hieroglyph. The inunnguaq prototypefies the presence of intent. which voices the cell tower, all tall things through the spire, the steeple, pass. menhirs, the The stones. stand Atlantic the impossible across And humanity’s presaging messages more the mounds: the barrows, dolmens, and north and the center Isles, the and the Gaul tic. They cover incurable rest Their fragments intent. of lost A the taiga east. They cover the south. a crude or the obelisk, for study in the earth. sunken early An somewhat teased them that their purpose the hands to back Follow imitation. Something mysterious. is something Here place. in the first upward stones speaks. and standing These listens that something is Here alive. do to technology, any with as meant, were LCHF_pmg_forreview.indd 73 LCHF_pmg_forreview.indd 74

\\\ 74 \\\ | lifeless quanta, aGreat Silence worthy of its strangeness. juts pitifully out of space’s dark ground, pointed upward, weathering a ambiguities basis of the some extraterrestrial New Age. Ormaybe it is subject the of hotmaybe Earth debate amongst others out there, its areas they robust, but significance their forgotten or known;never itself is amarker, arelic, something we made, its emanations as obscure heralding evercleverer iterations. Perhaps vastness inthe Earth the mustocean cover at of least part land. the These, too, are prototypes, traditionsboth lay same the ancestral claim, but (un)fortunately the it because isconstructed to on be observatory sacred ground. In away writing. Historical irony charges unfinished this Hawaiian (broken) The Thirty Meter Telescope at MaunaKea is unbuilt time the at this of body.terrestrial that such all artifices aresourced samethe in miles surface of few one more complicated, far less tangible, profound. equally Remember might Here, VLA. liethe distance person and between planet is abit Farther to right, the a collaboration people and between computers, appear far to left,a the mere personfootbridgebetween and planet. its human observer. Along mediation this gradient innunguaq the gradient of mediation an between unknown or universe speculated and grand of technology orientation; appear all along acontinuum or hoops,Pyramids, spikes, and are looking glasses constituents all of a might 11/16/17 5:41 PM | /// 75 /// 11/16/17 5:41 PM PLEXAURE for less than a day, a day, than less for I FOLLOWED THE COAST OF QUEEN MAUD LAND QUEEN MAUD OF THE COAST I FOLLOWED less than a morning, with my all weather pen, my all gravities pen, circling pen, all circling gravities pen, my all weather my with a morning, than less the down wrote ever the glossarist, and, island every outlying named and so was familiar was Tor rock. for words obscure of various definitions Those I vesleskarvet. searched not nunatak, not yardang, not but scarp, the up rosefrom pinnacles and their in the encyclopedia. twists Their scarecrows, monuments, like northern oceans deserts the southern and every of I also a list made known the images at Staring things. familiar amber, I wrote I meant. I knew what but a color, not is Orangutan color. black, screen vacuum soil, potting Then Mars. bad rust, hemlock flesh, Islands islands. circled all my at I looked black. penguin black-part black, called Antarctic green the wet, a loose rule, I captioned that’s coast: dot from out stuck a nunatak image one In Land. Queenbeaches Maud of I always I wrote. rust, off-fog, Weird statue. tent circus a the ice like materializing but to exactly travelling not this moment, I do at as imagine, the their viewless views, rediscover to rediscover to only places, such in top At the anywhere. matter or that being specifically unexperience of there I look way. in any changed not mesa, I am a gray which is the nunatak, of interchangeable; are names The names. proposed a sea many with at out well but different, is difficult, continent The interchangeable. are the waves when I hear disappears the continent models; and allwithin projections alert. the approach of the end at dot gray a tiny is It see and Plexaure. the map from I look up away. hours fifty It’s computer. the nav to connected a screen on It’s arc. an back him then put and happens, see what Clive, start wakingup timeto It’s and pen drawer and in the map pen away and the map I tuck hardsleep. to I look set Neptune. T1 is to and set Plexaure T2 is the telescopes. to refresh It like looks Plexaure. at to realize, look I am first, the and first, Plexaure at battered, it’s gray, seen; ever it’s everyI’ve crumb-cum-moon little other to going are You surface features. mundane but prominent a few are there little hillocks, gray its little gray its I tell planet, eighth my around take me to the stick I husk. regolithic little ancient its gray scree, little its gray cliffs, Plexaure, face of the rubbleine I look at Neptune. look at don’t and plan Clive. I look at look away. and ever twisted, has breeze which no across nici and the him bedmonitors hardsleep The CellClive dreaming. is talking. is he and dreaming, is He stimuli. its them,sending over presides hours forty-nine for softsleep to I go 1. I start the process. Up Wake I press LCHF_pmg_forreview.indd 75 LCHF_pmg_forreview.indd 76

\\\ 76 \\\ | station from report. the Jiaoren percent? Iletthat one go. across Drifting Neptune’sequator Chinese the is wonder as Iwatch Wake the Up progress bar creep toward one hundred its supreme to disappoint will me One spot, body, aredacted there. erasedly What mundane 9waits Effect there, of icearound of interval shallow sun the time, once deep ablank every dark despite ark, apocryphal data, the leading its anonymous entourage I’ve else, that looked at is, past everything it. And past it, is Muta: Ithink, fool’s tranquility, mere convulsion. Iwould never touch it. at Ilook it like Overview, for me—an elevated dread. The wateralien is see but I inert, guess, asky. And that is nature the of proposed the 8, Effect Neptune giant actually, parasite-white and etceteran across what technically is, I altitude clouds wisp and on, so like that, but they’re bigger obviously, a whirlpool, of collapse, actual of yielding It to spectacle. High never will. revolves and revolves and revolves as if always on verge the of becoming uncompelling physics. The obstinatesouthern thespot in hemisphere PerturbationsEarth. perturbing, forces forcing, playing out but high their blue white like an and uncanny every every see covering ocean an uncanny and Iwake when up we are inorbit and that’s at Ilook when Neptune and according to viability. Onone up trail, high but not overlooking high, so dark, unmastered entropy. of Spectra changedness patterned terrain the its surface, across it, fed into some chamber or other, offerings finally to a disappeared with shepherds the like gems and onto gasses from Earth, the amongst unabridged the histories of technology—and extraction over mosses, amongst the voles and pipeline, and partridgeberries rims, down under power sinkholes, the into between lines, valleys, the hoovedReindeer trails their around strip the mine—up ridges the and banners and feasts. us tolead place the of dawns and epiphanies and ages and paradigms and down on spoken our be through we knees, will and chosen and fate will celebrate, perform rituals, genuflect we will and praise beg and and fall atlook nici’s the data, synthesize, discuss, arrive at unanimous decisions, presence the I could call of another. Once Clive is awake we’ll We’ll talk. eventnessasserting on moment, the as ifhe was my something friend, here woke up Igendered losing count. Fifteenthtime total,the computer says. The fifteenth timeI privately, to myself, Icome when out of softsleep forthe first time since over planet. the himhe, against Icall obvious and legacies-long tradition, pictures and scans. the The run ship turns himselfwith Plexaure over and atmosphere. It automated. is allegedly Pondlife. Unthreatening. the I take it wandering all kilometers of proboscis leading to planet’s the uppermost waterbug: oblong control dark module all thorax, and tubes out running of Marchflower WAKE UP1 it is thought and it called to like looks be a male, arbitrarily, as ameans Ithink of With Rest the of Universe, the I 11/16/17 5:41 PM | /// 77 /// 11/16/17 5:41 PM ’s various machine innuendos, innuendos, machine various ’s — , the newer adaptation, to watch, along along watch, to adaptation, , the newer the giant artificial hole, Clive Cell’s closed eyes nonetheless see closed the nonetheless eyes artificialCell’s Clive hole, the giant to attached a machine is there palms face upward; His interstice. obvious He speaking is the wind. to He partedmid-word. if as are lips His face. his speakingis the nici. to nici, The conjunction. a fraudulent of dreamt, he as said he I dreamt, First the limitations-associated interlocutor, an computer, a non-intellegent, the old from stars three on, went see, could Clive I inconclusively. phrase point. vantage impossible an them, from for hopes obsolete our and days, Clive’s nici. word—the vague a such is said said—but stars, three Identify kinds different Seconds, by. went Minutes body very slow. was and cold Proxima Star, Tabby’s Star, said—said—finally:Kapteyn’s He silence. of They names. of chain that you, to melodious will sound That Centauri. those were who there But not. They’re importance. of places like sound The different. and close, distant the and old be. The themto wanted and the veryprods its at the least selected. nici or The chosen, sends vivifying. gathering, gathering, follow-ups, its and prompts by beleaguered are narratives its and space travel Generation-predicated be to consents one then, no But children. unborn of the consent consent: day, some on somewhere, are—born they simply situation, born in any a well- the birth onto canal from emerge to lucky I was person. some to landmass, brown) (expenditure worn-out possibly brown), (agate worn in hasn’t It work. won’t It it. all deleting of before I wrote day, a calendar on possible softsleep, Hardsleep, experiment. any or treatise, any fiction, any to even be brought or solve, or with, interface they won’t but possibly, and vision grand one holes: plot all too obvious vision’s grand other some inchoate, however instead, write I technology, New a time. at sophisms its Saturn wepassed waswhen use. This to put is always makeshift, however plotted if we’d as there, seeing if they them, as weren’t without Jupiter and a Saturn After exist. didn’t it proved that system the solar through a course what I wondered and ship befell the unchanged quiet fallacious and comical everything entertainment doing The else. not was and when was I was it Pedro me sent had people Páramo the scene watching porn. was I related and reading the usual related with the pouring hears and the night in the middle of up wakes Susana where whether the to uncertain as opening, room in the the next door hears rain, closed eyes had her Susana person. a of going or the coming means sound Look, said, he the monitor. over came voice sleep when Clive’s to again speakto him for waited more, looked and the film I paused I looked. and Marchflower were all I heard but again, ended, it until watched I Unpause. doing. moving, on, turned the ship a into the credits overlapped that stupor appetiteless in a hesychasmic, I realized I that. was that and future, unkept-track-of very much but near cave-dwelling of pictures in the encyclopedia I was at looking awake. was LCHF_pmg_forreview.indd 77 LCHF_pmg_forreview.indd 78

\\\ 78 \\\ | We’re here. Clive is up waking now. Plexaure’s quick phases, one Neptunerise after another, after another. I’m always ending up inplaces like that. preparations, Arrivals, glossaries, cave fish lead to extremophiles in whichgeneral, leads me to Antarctica. and put it on. Ifeel like uninventing fire. Monthspass. My interests in long drawer shirt sleeve inmy drawer area and release along shirt sleeve seconds later, says: happening. actually That was ninedays ago. I go to my Here other than what is everything second is. The one,transcribed four nici has two transcriptions new of Clive’s hardsleeptalk. The first one says: us, other thanand bleak the atramentous inevitability of life? waking The Mars unscathed? What has our really sleep spared it? What has it spared reasonablycan be predicted and graphed. Will Marchflower points and functionality tipping points, tipping and those whether points how wear-and-tear on really occurs aspacecraft, abouttipping cosmetic softsleep for days.eleven When Iwake the firstaboutup thing think I is that way. it aday, Icall an increment of conscious elapsed, time and go to we leave we being, behind back into swim darkness, the but we make it— differencethoughtbetween and not-thought. disintegrate,Our artifacts and intelligences themselves traits, vestigial capable only of knowing the there. eyesadapt Our away, we become translucent, eversofter, our minds we change.So We thecaves flee to the to escape harsh conditions. We stay outhead to remote the planets, only to find cannotwe livethere as we are. onethe that leaves us absolutely behind. In scenario, this ships tall the Cave-dwellers. That,the is think, generation I tech we’ll have to accept: adapted to near-lifeless voids. Homo amblyopsidae, Ihad written down. fish. Amblyopsidae there are afew people I’d like to of god thank: the wanderers, of god the and said my hello despite new nici’s the insistent pings before because Ido hardsleep has me to led same this aperture. Ihave not yet opened my eyes of it. Towels, chill, wet doorknob, vestige, residue. Thepassage esoteric of bathtub, light itsof false flood works its ancientgimmick of supplanting all primitive that heart is visible through my chest. And room, the then its his purehis beginning, terror—at endocrine me, for asplit second, at my crewman’s flash of life, light across anight talkie, lake, epaulets, walkie uniform, for eyes wide disbelieving abomination the outside; that crewman staring back out—shiny face, mustache, honors-encrusted point of view. Throughthat tiny, watertighttheaterfrenzied a seen was kraken, is to say something at least looked in through with aporthole a air,the his, my, fingers taking holdbenevolent, like a perhaps, benign or is sometimes rational, interpretable. To say he, I,Clive lifted Cell, it into fluorescentthat sun, the submarinecame the to surface, is sayto the mind To saythen first hatch,periscope, sayto in a shallowwhite under a sea, , read acaption. Nervous, apex predators solitary over- WAKE UP2 return to 11/16/17 5:41 PM | /// 79 /// 11/16/17 5:41 PM strangers, the gods of black sheep and painted birds, the god of imposters, imposters, the god of birds, painted and sheep black of the gods strangers, paradigms, the god of albatrosses, lost whales and mutant the of gods many its the soul geological across epochs, the god of discrete the god of quiet the godof clones, botched the godof bodies,holotypes, the god of undiscovered the godof nausea, the godof anxiety, the godof telepaths, barriers and thresholds hadal ocean the god of the depth, god of islands, the contents the god of anomaly, the god of claim, territorial disputed and best friends, of the god the protector and shame the god of holes, black of the asteroids, the god of hurricanes, the eyes of glossaries, the god of of the godof universe, the expanding the godof migration, stellar godof boundary the speculative which, nothingless the god of beyond velocity, Gods, you, thank adored. and be to activated wait gods more taciturn, and hyperobject. the greatest is humans amongst Worship so much. again, LCHF_pmg_forreview.indd 79 LCHF_pmg_forreview.indd 80

\\\ 80 \\\ | CATASTROFEED its ventriloquism its authenticated credential its zinc arrow its guardian waits for me always and you are etceterinethe and abbreviative the what Afterwhat Iwait forwhat is fuck I for devotedthe mantle harms martyred the core gravityinnocent loyal the Earth crust and tranquilizes harmless the the swan-shapedwhose gondola idles after thethe afterwhat Funnel of Love afterwhatafterthe after after what the comes deprive of us all is after What fullfillers the better loved advances is delay What fungi the intact inissleeps darkness left to its devices own What fuel the activism monitors my wants for is self-serving What future the 11/16/17 5:41 PM | /// 81 /// 11/16/17 5:41 PM UNTRAVELS Remember that omens are only events, only are omens that Remember a man who is Jake, movies, only are real, aren’t once here who comes a man well, know I don’t continued, he that, And me, told a month, claim, you like empath an are really if you will make protection imaginary of orb your older pressure environmental look one you time of the dawn than memory no-term set I call to my what I have intermittent his from reality of bits little excerpt presence and name intermittent and advice Jake name this man’s Is originalthe is almost echo first The new also something it and every face: trace evidence and of On my elision completionist inner life’s in my man every known slightly which I might friends like through are disturbances cordial His info contact the Absolute’s obtain sometimes I have dream a very coherent interpret him to I ask significant becoming of the verge who on is a painter about significant already is the painter in reality me; to only but everyone else to LCHF_pmg_forreview.indd 81 LCHF_pmg_forreview.indd 82

\\\ 82 \\\ | but he is gone again Who is Nicole Eisenman, Iask, you see next the it time I will is not March, but April you never see againI will present inthe of things quickly obsolete, he says In your next few future lives you are baron afterbaron after baron In Atlantropa farms boom artifact the Nuance inmusic is nucleotidal inscope know the interval of I specifically how words work, but that doknow they alittle about intervals, admitting to themselves that don’t they know how chords work, standing on corner this for fourteen minutes or fourteen decades Whose isn’t head stuff this over, Jake asks, Who hasn’tbeen 11/16/17 5:41 PM | /// 83 /// 11/16/17 5:41 PM FOR BRAD The sharpie is mightier than our maybe our than is mightier sharpie The galaxyotherwise uninhabited fruit levitating but low like that TV my mails snail alien violence acts of dated news of every of the in Canada dots I connect cool city If shoes will fuchsia seaboard eastern walk its my fertile delta the Styx’s to all the way all odds against I willwhere unite sense no together make that things two Björk like growing plants friend the druid records My chamber anechoic in an face paint, ceremonial like similarly, a posture It’s liking autumn like punk, like Island Easter rises on sausage human Sweet breath toddlers’ of face a seawind to sour and sweet the trail of by me know when you bed every behind in your blood I leave time death grateful my quenches hidden water Fossil Tumblr on lyrics drafting when I’m except Enya not is that I hear sound any and playing is when Enya our love defiles and defaces Enya LCHF_pmg_forreview.indd 83 LCHF_pmg_forreview.indd 84

\\\ 84 \\\ | GIFTS beneath eachhair absolute, hinge my hands on you and find almanacan antagonized silence, make my returns to you dubiously Iwish Icould color wound inthe abluish, no matter what it is before skipping ahead pay attention to seconds first the fifteen of anything Irepine on repeat, shampoo and shit on shuffle, what, fancifully, random Icall These muted surroundingstraject me at through can week the ifI’m Or they careful but supplies the of my love last Rootedly astray Imight abit be, subdivided, Just like back off for secondone okay instore for me either or Guinness helix of toenails Book no postmortem mane antidote growing inBrazil, have no curveball fate has fastened to me: Lukewarm tumult my iffy 11/16/17 5:41 PM | /// 85 /// 11/16/17 5:41 PM A GIBBOUS PEE MOON FOR CHIP DELANY Before embarking in my plain white Looms white plain in my embarking Before later, what’s I assess absorptions warm its predict depression Season in the tropical Stop Tropical Its waits and places of piazza luscious is a of unrest proto-whirl The when I iterate spot a coinish I make cloud the brass on when salt I pour a little, disk blank my comatose, Flu Kelp Then, sea between voyages, minute the twenty hates between graupel the groundwater though the same They’re first on puts beach land the like-mint and spinnaker Doppler-soaked all this of but takes care Chip Accordance my Mostly to vulnerable and compiling is when thewhen system I can, my crossed I grind often, not this is and bypasses, malicious flour a chalky to down wire set it makes what I know the heart from pH sing its makes what I know LCHF_pmg_forreview.indd 85 LCHF_pmg_forreview.indd 86

\\\ 86 \\\ | HAMMERSTONE good rockgood today. It’s far.take The years.will op I’m leavinggiantthe beet to wires, melted mountain the down and to interfaces. alerts Ifound avery in here, too. It’s like I’ve shaped stone the into plastic, woven baskets from age, into deeper the space’s cramped cave That’s Iwriggle. what it feels like and Iare moving and farther apart farther Iget closer the to it, more the I civilizationthe Irepresent and participate inless and less. It’s like my vision line myalooflysegue effortswill into the vision I’ve had—for myself and for water as radish, ice, salsify, Isee I’m yuka. agatherer. Somewhere down the um-black consommé. What as mountains some see of platinum, nickel, and roots still; as and something Belt the Earthly tubers floatingthrough - avacu analogues. I’mEarth an ambassador at Isee my heart: calling. missed true slowly,and very over course the make of my millennia, way to one of the do, Iwould lower my metabolism and rate heart and to self just above zero, and away beading into spacelike lymph. Adrift, starving as myself monks out of Lagrange the point inmy preposterous monocle of an observatory my knee. Sometimes—right now is one of imagine times—I skittering those dry,them and Iwork inorbit inJanuary and February, hard is which very on asteroids the all are. Ipick out, them Ireel in,knap them down, them suck for my “office.” I haven’t even told whatyou Ido now, have I?I know where able gravity and or are evenanicerug, those really only the things Iwanted is my totem. money the All world, inthe and Ihave alot of it, can’t buy reli- dreamers’ all in which schemes are fated to wordlessly ellipsis pend, the that it again, Imused, without aquestion mark much so as an ellipsis, ellipsis the en ten years here and there to other things Ididn’t want before. Why not do me up needed thereturned they sixty and, as always, Iacquiesced. Ihad giv- made my firstthought I trillion. never I would hate space. But Ido. When I my it though some adriveway, call Cosmos, It’s acul-de-sac. agrind, how I just study the of There’s scale. something still thatof in my work. Belt is The A prospector. Istopped looking for big things far away. is really Cosmology anI became economist. I retired from speculation and a speculator. became change and revelation scattered out susurrus. there wide, inthe deaf galactic darkin the like mobiles, Ozymandian and indifferent,their promises sea of MIT and gave up on exoplanets, on Sagan, on extraterrestrial relics hanging distending it out past death, past recognizability. When I left I turned thirty THERE IS POETRY IN GIVING UP ONE’S VISION BY LENGTHENING IT LENGTHENING BY VISION ONE’S UP GIVING IN POETRY IS THERE , 11/16/17 5:41 PM | /// 87 /// 11/16/17 5:41 PM someone special in my will, in case I die. It’s the biggest thing anyone has has anyone thing the biggest will, special in case It’s I die. in my someone the are They tomorrow. thedrones dispatching I’m else. anyone to ever given in Earth arrives it When rhinoceros. the wooly eye of each into I hurl spears stars of the savannah across kin. I will look out my with it I will share orbit blood. taste and LCHF_pmg_forreview.indd 87 LCHF_pmg_forreview.indd 88

\\\ 88 \\\ | DEEP DOWN SATISFACTION embarkations that Imight empty it of hold up again to me your palm iswhich about Undoing it at that, at what we equal, but before our next lesson Let’s just say my Work is worked and leave let’sin this it place call Or Ior to imply how exactly many of us there are I promised not to say you resultant dusky mouthful you might Little One, addchewing my bon voyage to whatever andadd logic roles and rupture, Next, next ability addthe to Maker, identify that—beltline—thingsSee have to shape take begun and addup roosting above beltline the to tendency add the scratch that grove of serifs at that Warmish Dot dark, inthe theThen add to look tendency up longingly Addtrapped fin paw in up of appendages the someThen add existential mix- independently, ofteneverywhere are reusable and appear, like invention, but fortunately jokes certain That poem joke ina already hasused been of Uranus retrograde depressionlike seasonal consequent andtruths, for some occult fun Noble hinted-at Gases, universal in our working Cosmos Next put adecent Polaris up there add four and addsavagery wrists, aflair for raw denim Add of asense division,

11/16/17 5:41 PM | /// 89 /// 11/16/17 5:41 PM Today I will bring forth no evidence of having evidence no of forth will I bring Today anything done ceaseless and blockades of crop Your odd an diet is rustling epoxies of out grow I must shoreline debut because the Earth’s smashed somewhat level, a somewhat not is detachments, epiphanal of cadmium the periphery, of propolis my not all after us to common is what share, we What moving water and so air as fanciful nothing is minuscule more much something but unsorted behind a paywall of trauma obscure One continua the known now—have they are where eyes—guess My procession Rockefeller to regolith like hairshirt hideshirt to of of Dover, cliffs the white known have hands My early tree, the allspice Earth diamond, the common them all underlies that the Thing and wheat, calico extent its in consensus specks of someday I’m transfixing for tools my on of that proof is There even, earlier Age, the Stone from they’re but Age the Stick a motto I have Being a born naturalist azygous but buxom The seais carries one that The the known apart me from different no is It PANTHALASSA PLUS PANGAEA EQUALS WHAT WHAT EQUALS PANGAEA PLUS PANTHALASSA LCHF_pmg_forreview.indd 89 LCHF_pmg_forreview.indd 90

\\\ 90 \\\ | CONNECTICUT COAST INDEEPTIME that of is part sun the that burns, that is repellant, something on my skin Woods, that drown me in sweet,Deep sweet Off drown me intheir getting away from it all years spent intermittently my haunt-starved lampoons that dam up mosquito-bittenthose before all big T-Rex mouth I shovel myself whole into fear’s I clench my teeth I brace myself inching over estuary the it’sbecause away from beach the omens from what west the Icall a horde of chill already on New London, night itself closing in out at raining the random before looking around torchlike tiki from soot my mustache I wipe eachtremor of breeze away skittish universe of mellows harshed frontOn this lawn’s odd of seasons breathing alabor and, four, keeps scheme the out of cute sweat and cuter nightfall conspires glow the three, things period, deficient ability witnessto trees have what with my charm lake-hugging these August, two, dispels what antlerine lights of always-sprawling into vacation one,which, breathes plot onethe that stands out is panic sensationsOf all 11/16/17 5:41 PM | /// 91 /// 11/16/17 5:41 PM THE GEOPHYSICIST’S LUCID DREAM LUCID THE GEOPHYSICIST’S I was busy tapping into other realms other into tapping busy I was over, move to this one telling I was child human be to the first promise my that resorts born in those primordial character an alternate for press key I the shift is example, for mark, question upside down The out getting for ready getting I am that have you word my is colloquial periodupside down bedmore is of The that for my English in an reallyoath isn’t There soak in water ‘I the extinctions roughly, means, It down inches them three push and overnight in the morning and Secret Garden into up coming is when the Sun them grow’ make to going I’m breath them all my under mutter to going I am eyes closed of line the dotted sign on to going I am every of lost ever a time lapse adage LCHF_pmg_forreview.indd 91 LCHF_pmg_forreview.indd 92

\\\ 92 \\\ | MCGUINNESS BOULEVARD UNTIL THESUNCOMES UPOVER I dothat thing where Icare kindof to avictor that do They thingwhere interaction someof kind leads my adaptations paranormal subplot entangling my years, my waves, a soft obstacle, strange staircase, plain rests or exotic, is called on what my everything flesh, bring what is into solid any other state, of involvement earthly but what is inme now can’t I hold my up palms to what has visions their everyone titled waterI drink and it never again emerges from me my rage phase to wait for my maze phase to gradually redact muchand Ivery can’t predict what feel it like will At Mike’s house out Ilook window the and it’s snowing I had done it in my patternless head I had one hundred percent of my life wrongI was so but it was fine some ruinous, appropriate revelation Ithought but progress the behind bar of there decade, the hidden my else like hands almost everything come across I didpick it up and it and Ididkeep it, it never carry use I’ve been of apartments,Shining theDuvalls inThe after Shelley all I’d probably like it now, afterthe archipelago But Ididn’t read TheOrchid Thief eventhough 11/16/17 5:41 PM | /// 93 /// 11/16/17 5:41 PM LITTLE BROWN BOTTLE the master like I feel every of list known Mysterious suffix chill fission, of surge panorama is What access is what Cut the shortcut errors impenetrable your to way the long me Show noble, is if it occult and sfumato path my crosses that every and interpretation blood will pressure of be in the form LCHF_pmg_forreview.indd 93 LCHF_pmg_forreview.indd 94 COMPETING AMBIENCES HAPPEN AMBIENCES COMPETING \\\ 94 \\\ | coordinates of everyone’s inland hub rough inthe obscurity found my quaint I have 11/16/17 5:41 PM | /// 95 /// 11/16/17 5:41 PM

- - THE WOMEN FROM ASYLUM FROM THE WOMEN CHAPTER 1 —one smaller northern Atoll was situated situated was smaller northern Atoll —one HEIGHT—BADLAND—NICHE In The Gatherer of the Hunters, a town of almost a hundred people, the people, hundred a of almost town a Hunters, of the Gatherer The In her by lived xylophones of maker and xylophonist only Atoll’s Shafroth fi- the Atoll, of scraps stone shaped She Strobilus. was name her self and the bars, into scraps, other and ice scraps the towns, from berglass scraps communities, small, isolated In instruments. her mallets of and troughs, gift, known. her was because though, of Strobilus, everyone famous; is hot of the mornings In the early cliffs. faced the western studio Her the of the edges to go would the gales, she brought the sun before half, rumbling. sullen, embittered almost stormclouds’ to the listen and cliffs her approached the clouds the minute, by articulate more and Louder a camera were she as if the sodaskittishly, flats, over the dark, through up they as leapt foehns and breezes the quickening to listened She trap. voic- for Not tonality. shifts in for dramas, their for face: the cliff over speak that. like didn’t the rocks over up came what knewes; she that er the dour gasped, howled and muttered the rocks over up came What accepted. she her to bargains offering wordlessly the lowlands, of rata did Strobilus half, milda hot thein middle of day a on the studio In She anything. needed get to hadn’t She there. was she why know not a deep some raw, were mushrooms The breakfast. her eat to down sat - blu only the bluish-green, were others The color. familiar a color, gold of a combination was drank syrup she A clear in the world. ish-green chewed. she as written had she what bacteria. at looked algae and She - like some to taste designedto be delicious, were mushrooms The think didn’t She flesh. life: her in before eaten never had she thing on Mount Shafroth’s uppermost massif, and there those that remained in remained those that there and massif, uppermost Shafroth’s Mount on Alaska. forgot Foraker, on they Denali, as their own cast of the shadow motions its council, a people’s five settlements, had Atoll Shafroth The - out those to who were home was It citizenry. its and constituents, and hermits its ridges, in the lower recluses its to and popular, and spoken were mores do, not and to do toldthewhat Idea people The drifters. and the past between neighbors, and the generations through passed down schools. in the tiny uncertainty with taught was rumor and strange, was biased people and elevation, extreme biased survivalLife that even at weary. and theyfaint grew daily elevation that at if even fabling, life’s LCHF_pmg_forreview.indd 95 LCHF_pmg_forreview.indd 96

\\\ 96 \\\ | some motion always. The its everywhere, Farm wasturbines batteriesand turned swiftly,warm they half butsound. made no Theirblades were in outside, and roared they of gales inthe hot the of half year. the the During old, but new, looked very like most of settlements, the at least from the moving air that crossed turbines the of Farm. the The turbines were very Power came to towns the direction, it because from came from every doubted anyone would to for look think her. panic. There was a remotebattery the side on north of Hunterswhere she lastthe of andthe her left bacteria studio quickly as precautionbecame subtlestthe molecular level, but were they changing, wayward. She drank itat of workshops the mushrooms the had never shown change beyond present populations, inboth but people the were worse for it. In hab the - grew on mountaintop the of Atoll. the Strain, a cornerstone of was ecesis, to breathing. The mushrooms weregrown the in workshops,peoplethe gave eating athought; but were they generous with thought inrespect in aforest or afield. They were automated—foolproof—failsafe. No one names, but were they far removed from anything that had ever grown The mushrooms werecalled mushrooms, theand other sustenances had She didnot know that word the for plainness this of was being dread. volting, a loftytype of disgust,before her againstriking more plainly. one, or to aspire to become one. It Strobilus, struck momentarily, as re- was afraid of her martyrer, of how different one becomebe mustto by used someonebe to harm her, like an obscure word, aweapon. She of room. the looked Everything like was normal it and could everything side was hard at work and her instruments lay around her on sides all cane, or ghost story hyperbole intremendous taste. poor The air out- Atoll,On the violence was accident. Martyrdom was abstract or ar she could notday; someone because focus had threatened to her. martyr faster. to She hear movements the tried of song, the but she could not that eventually, she drank or them donated to them workshops. the She ate phone, and each icephone had its own before becoming obsolete when, unique. Schistaphone notation differedfrom wildly that the gabbroof - was a variation of system the for each of her xylophones, were which all for her compositions that tablature, was part pictograph, part and there songThe almost was .Strobilus had created a system of notation behind left thatthe had ice,the been by cold. they erratic library; inthe cession of abstract and senseless monuments. She word the had learned from a distance, and reached on foot at a pro oftimes certain year; the - boulders, though she didinsist on erratics, them seen calling could be Song It Erratic was called was. Shefood picked up her scores for song new the and read them. about tastes, or yearn for No them. one did, no because one what knew , afterrubblethe behind left glaciers. the The by -

11/16/17 5:41 PM | /// 97 /// 11/16/17 5:41 PM distributed throughout the whole of the Atoll, and everyone worked on on everyoneworked and the Atoll, of the whole throughout distributed the Idea. was because that the Farm, called and techers, were Farmers still called but were teachers, Teachers They knew computers. the going. batteries and the turbines they kept rear the bacteria,and to how workshops, to run crop the They how knew still devices that and machines use the to other them knew how of some spent calledhad techer The Carthage functioned. Charles and remained trying Ridge bring to Scushen’s the on battery from away minutes his a deviceonline: back condemned widely and disused, a very long old, use the to radio desire Carthage’s was Certain it they existed, that radio. desire. his fewer and belief, his shared few but Atolls, other contact to swiftly fear in basis its and opposition, an inspired had project Carthage’s of sick, of hurt,becoming of being afraid were They people. many united - of con afraid were They changed. becoming of and hungry, becoming - Stro like Though some, in school. to they as beenhad taught tamination, suggested others the matter, about silent remained and unsure were bilus, and they him warned that as a crime, plan his define could the Idea that immortalization. undertaking further earn him candidacyit might for and world, the like broken, was But radio the terrified him. This threat and Idea,so the people of the Steward all, after was, Carthage Charles Slowly—it certain futility. trusting in its endeavor, his tolerate to came learned and the turbines studied He became scavenger. a years—he took components many repurposing their first at their redundancies, colossal he possible, the radio was to a repair that established he Once abstractly. became a thief. He again. changed begun had wear to habitability the world’s the Height, of the end Toward few were there long and before on wore itself away wearing The away. moun- did hid insurvive.the Those could that people left places where then, and thenhot, and then warm, and cool, was it where high up, tains, build rushed to People tall too hot. enough, weren’t theif mountains the had—over it once isolation, Their last. would that habitats summit felt. deeply in, was generations—set with decades overlapping of course The Paradise. was It safety. and sacred was it torture, and treasured was It one of heard memory, in their living had, Atoll the Shafroth of people to far was all it they knew but that was Atoll, the Samara name: by other disappeared since had that chain island an side of the other on the west, the over summits been the which Alaskan had strung and from such as Samara and the had been Aleutians, the islands The summits. sea other to had There Russia. of then extreme, eastern coast, the eastern on was Atoll that but routine, possible, was betweenbeen the Atolls a time when travel too poor, the weather became too hot, the air Eventually long. last not did isolated were the Atolls and deteriorated, travel to the means eventually a to autotomously, globally, gradually, reduced, and another one from lin- less were world time and whose inhabitants for redoubts of handful LCHF_pmg_forreview.indd 97 ear and coherent by the day. Life at altitude had led to everyday problems, had made accidents worse, had complicated sleep and childbirth, indeed it had complicated all exertion. The blood of the people of the Atoll was different than it had been in earlier periods, during the Height, and the time before the Height. Their veins were different and their hearts were different. The techers who knew the hospital kept the sick well, or what was then called well, but the Atoll was often collectively dizzy and the hot imbalances of the Alaskan firmament rang in their ears for mornings and afternoons like a faint distress call. Being human, they were bound to the Earth, and though they were still on it their existence was a stretch, the bond tenuous.

Carthage lived in Bristlecone, near the library. He was a scientist; few weren’t. He worked in the disciplines that life on the Atoll necessitated like everyone else: with varying degrees of aptitude. He had long ago giv- en up the study of the heart and circulation under the stresses of high el- evation, critical though it was to those whose blood would pump up there for a lifetime. He had searched the databases of the library for rumors of the world, what had been, how people had ended up on the mountain, if there were other mountains, if there were others. But he wasn’t a teacher, he was a techer, and though, when he came across it, a very obscure word like wildlife intrigued him, it was ultimately other clues about the Height that he sought.

The text in many areas of the databases was badly corrupted, and the work of recovering and making sense of it was archeological by nature. There were many lucid fragments of information, tracts of nonsense, and there were intact and pristine areas that were nevertheless inscrutable. There was one reference that interested Carthage the most. It was to a place, he thought it must be a place, even before he knew it was, called Ylem Caldera. One afternoon in the hot half of the year, having finished his work on the battery that day, he thought of this place, and the wom- an he knew there, as he inspected his radio, which had been working for some time, a fact that he had hidden with care until about an hour before. And he thought about the woman he knew from the library, the musician.

Strobilus knew well that fewer people would be at the library if she waited until the gales came, which she always did, though she could count on Carthage to be there for the same reason. Before breakfast, she had made her way up the path and onto the porch, where she stopped for a moment to listen. When air passed over an object, when it met with resistance, sound was produced, and that sound belonged to the object like a shad- ow. Strobilus thought about this often as she pored over the databases in search of exotic instruments from the Height. Didgeridoos, oboes, saxo- phones and, more abstractly, something called a theremin were amongst the soundmakers that made up her ghost orchestra. \\\ 98 |

LCHF_pmg_forreview.indd 98 11/16/17 5:41 PM There was a microphone mounted next to the barometer on the porch, directly below the door kit. It was connected to a monitor in Carthage’s lab, continuously streaming the sound of the air currents outside, which blew along the path to the library, sometimes keeping to it, sometimes resisting. These currents, their strength and character, varied wildly, and what came through the tiny speaker could, he thought, be their steady and coherent breath in the evening, or sudden and urgent anecdotes— tirades—outbursts—or brief, obstinate silences. He never turned it off. The air swept around the library. It was always making mention of the paths, the buildings, the mountain, sometimes with subtlety, more often with what Carthage praised as an astute grasp of the human predicament there. The air spoke of their enrangement. He had thought of that word only to discover that, at least in the library, it didn’t exist.

The entrance sensed her and Strobilus had entered the library a little bale- fully, but froze, attentive, when through the open doorway to his lab she heard Carthage’s voice answered by one she did not recognize, but knew. It was a woman’s voice. Strobilus heard say that the woman couldn’t come to the Atoll unless she knew everyone would welcome her. Then she had heard Carthage speak. He wanted the woman from Ylem to come to Shafroth, that he could help her find the things she wanted, there on the planet, that he had written a rumor of the Atoll. He was eager to share all he knew, if she would only come. Strobilus listened. The woman was reluctant; she reminded Carthage that the orbital community did not possess the means to reach the Atoll and return home, that it would soon, but that undertaking such a trip would nevertheless be doubtful. His voice took on a desperate edge. He was trying to change her mind by changing his story. At first he reassured the woman that the people of the Atoll were ready for her arrival, then he said that a consensus would be reached soon, then that it would never be reached and that her only recourse was to come anyway. Strobilus thought she would spend the afternoon listening to him lie to her, but the woman cut the conversation off short, promising Carthage that they would speak again soon.

For a few moments the library had been silent, until the sound of Carthage bellowing in frustration coincided with an object shooting out of his lab into the library, hitting a far wall, and coming to rest intact on the floor. It was a small portable hard drive. He had emerged, his face red, breathing heavily, to retrieve it, when he saw her. She picked it up herself. She warned him that if he didn’t calm himself down, he would end up in the hospital and possibly dead before he could stand trial. Strobilus had told him that he had broken the Idea by contacting the woman, and broken it further by inviting her to the Atoll. She reminded him of the consequences. The

Towns would adhere to the Idea and immortalization would be on the table. | /// 99

Carthage did not calm himself down. The sudden accusations aggravated him more. He grabbed the hard drive from her and she let it go easily.

LCHF_pmg_forreview.indd 99 11/16/17 5:41 PM She was afraid. He fumed and paced around the room, turning to her after a moment to say that he would accept, abstractly, but evade, abso- lutely, immortalization, that he could convince the people to welcome the woman, that the Idea didn’t matter. And he begged Strobilus not to make history about it. He backed into a desk, placing one hand on a terminal, and the other, still holding the hard drive, on his chest. She hoped this meant the episode was over. She wanted to know how long his conver- sations had been going on, and he admitted it had been three weeks. He had first made contact only hours after bringing the radio online. She asked him what was on the hard drive. He was silent. She said she would make history about it if she had to, and he tossed the device back to her.

That she caught it was involuntary. She didn’t have time to defend her- self at first. He lunged. His hands were on her neck. His face was con- torted, inches from hers. Though he did not speak, she saw him mouth the words I will do it. And there had been a moment when she thought he could. It was the moment when he thought he could, the moment when he again became something else, something worse still. She felt his thumbs crossed over her throat. He was changing. She felt what it was—stoppage—her weak spot—everyone’s weak spot. He meant it. The lost postures of attack and defense, their reflexes, their routines, took on a bewildering, dejavuine immediacy. Strobilus felt the guarantee of air and the guarantee of no air. But he was too exhausted by his state. He was hyperventilating. His weakness was her ward. She pushed him, with great effort, away. He fell to the floor, and managed to say that he would make history, too, if he had to. Then he told the floor, as he rose from it, staggering toward her again as she fled the library, that the woman wasn’t going to come, because for some reason she didn’t want to.

The xylophone player already knew. She knew that the Ylem Caldera was a space station, not another Atoll, because she had spoken to a woman who lived there, though not that one, several times already, while Car- thage was at work on the battery. And she too had entertained inviting her, had broken the Idea. But, she reminded herself, her conversations had played out differently. What troubled her then, apart from Carthage’s threat, his new hostility, his sudden martyrous streak, was that he didn’t seem to know, after several conversations with the woman, about Strobi- lus’ own dialogue, just as she was ignorant of his. This of course meant the women from Ylem wanted that. Alone in North Battery, which is what the people in The Gatherer of the Hunters called her new refuge, she was glad for the first time that she had eaten, and did not know for the first time when she would again. She touched her throat. It was ten- der and swollen; she tried to picture the bruise, she decided it must be bad, but she was breathing normally, even after running home, and then running to the battery—reflex—response—redoubt. It was effortless. The decisions made themselves, and she made of them sense, or little sense. \\\ 100 |

LCHF_pmg_forreview.indd 100 11/16/17 5:41 PM The batteries were white sheds networked not to their own turbines, but to all of them, and to each other. Inside the shed, up to ten people could route and distribute power around the Atoll using a simple set of con- trols. This power could be sent to other batteries, individual buildings, or fed back into the turbines in the event of a possible overload. The sheds were identical, but used differently. Fresh energy generated by the tur- bines was managed by routing it to only a handful of centrally located batteries, which could be attended to by teams. Each town had one, and near Bristlecone another one had been designated the Master Battery, where the distribution of power throughout the entire network was mon- itored. The system was designed to allow for this disequilibrium. It kept the power and the observers of that power organized. It also ensured that many batteries were seldom visited.

Strobilus knew no one would be in the shed. She herself had never been in North Battery, but despite being exactly like the ones she had spent so much of her time in, the space felt unfamiliar. She approached a bank of distribution controls and looked at an overview of the battery. It was set to hold a charge between forty and sixty percent of capacity, which was standard. Energy that would exceed sixty percent was routed mostly to the central battery in The Gatherer of the Hunters, with small amounts also routed to the other towns. She noticed that additional small amounts of energy were also routed to a battery on the other side of the Atoll, near the southernmost town. This struck her as odd, though distributions of that kind often were made by mistake, or were created in the hot half for a specific purpose and thereafter overlooked. She pulled up the pow- er scheme for The Gatherer of the Hunters, selected the building where her studio was, selected her studio, and rerouted the power to a random battery outside Bristlecone. Without power, the door to the studio could only be opened manually, with a door kit. She had taken the one from her porch. She hoped this would discourage Carthage from entering. She opened the distribution overview of the battery on the south side of the Atoll, curious about how it was being used, and thought about what to do next.

Carthage was in her studio already when the lights went out, and he knew that meant two things: that she was in one of the batteries and that she had trapped him, by design if she had taken her door kit, or by accident if she hadn’t. It was there, in its housing, by the entrance. When he had arrived in the studio, he sensed at once that she was gone. Xylophones crowded the space, but there was no disarray, except on her workbench where flakes of stone and other materials were strewn wildly like arrow- heads. Rage had erupted from him like a neat and steady autograph; he | /// 101 chose a xylophone, a gabbrophone she called it, he had seen her play it, it was the size of a small desk; he picked it up with both hands and smashed it against the wall, and the wall at that moment was his instrument, and

LCHF_pmg_forreview.indd 101 11/16/17 5:41 PM he played on it in reprisal, or in fear, a brief song about an earthquake, a song that was over when the wreckage of keys and frame and trough settled on the floor. It was destroyed. He had then chosen another, but before he picked it up he noticed its lower keys. They were long, pol- ished, slightly concave, corners rounded, sharp, expertly made. He had lifted one off its pin, admiring the workmanship despite himself, when the room went dark. He slipped the key into his front jacket pocket, rest- ing it in a bottom corner. The pocket was too small. The key stuck out at an angle, pointing toward his shoulder, but he had to take it. He went to the door, feeling for the door kit. Getting it open, assembled, and turned on was easy. He was outside in minutes. The gales were weak and night was falling on the summits fast. He rushed to the library, turned the ra- dio on, and demanded that the woman come, that he needed her, that the people of the Atoll needed her. He asked and asked and asked but she did not respond. The monitor played the sound of the air and he fol- lowed the sound, imagining a current that led up into the night, to where the composition of the world and the sky above it changed into nothing, and though he knew it could not, he imagined the current crossing that change, heading for the Ylem Caldera, for the woman, colliding with her, and bouncing back.

The woman continued to ignore Carthage; Strobilus risked no further attempts to use the radio, and no further visits to her studio. The hot half went on toward the warm half and more people were out during the day. The turbines turned. Gardens for the short season they could manage were sown and cared for. The warm half came. Strobilus would be expect- ed to give a performance, as she always did at the beginning of the long but easier half. Hundreds of people came to The Gatherer of the Hunters to listen. She came from North Battery. In the evening, near the cliffs, she played. He was there. She spoke a little to those gathered. He watched her. The sound of the xylophones spread over the stone like shadows. When it was over, it was night. The people went home to their towns. The air moved over the mountain.

When the representatives from Ylem came, it was of their own accord, after a period of radio silence with Strobilus and Carthage, and when they did they came from the south in a tiny aircraft. It hovered over Bris- tlecone for several minutes, then moved off, clear of the buildings, and began to descend. The people of the Atoll stood motionless and watched the aircraft, as people who have never seen such technology would, with wonder, wonder and uncertainty, and then with fear. By the time the ve- hicle had touched down, the paths flurried with dust and loess as if pre- paring everyone present for the reveal, the first contact. But no one had remained to greet them. It was late morning. The gales came. They were strong, they weakened, they steadied. Strobilus and Carthage approached the aircraft, which was black and shiny like obsidian, from opposite sides \\\ 102 |

LCHF_pmg_forreview.indd 102 11/16/17 5:41 PM of town, and stood before it together. They looked at each other, perhaps to each other, in shock, and did not say anything. A hatch opened, and two figures wearing masks emerged.

The figures spoke first, informing the xylophonist and the Steward that they had come, chiefly, to intervene in a situation they worried would result in violent conflict. The two introduced themselves and said where they were from, pronouncing the name several times, to clarify. The word Caldera, they added, was an artifact, perhaps autocorrected by the data- base somewhere along the way, most likely from Colony, but no one had ever referred to it as such, and so it could only be surmised that the en- try Carthage had found in the library had been created a very long time ago, by someone who hadn’t gone there. The figures invited Strobilus and Carthage to the place they had been calling Ylem, asking only that the musician come with an instrument, and the rumorian with his Rumor. Carthage did not miss that they referred to him not as Steward, but as historian, nor that they referred to Strobilus by name. The women must have refused his invitation because of her own involvement, her adherence to the Idea. They had no interest in him, he concluded, or the Atoll. They had come for her. His feeling of defeat lasted only a moment, but he came out of it different.

All four people knew they would go. Within the hour, the man from Bris- tlecone and the woman from The Gatherer of the Hunters had gone to their respective workspaces and returned. They had everything.

The women from Asylum took them into the ship, Strobilus with the schistaphone and Carthage with his Rumor on a hard drive. There was room for nothing else in the tiny cavity. Cables ran across the walls, lights and dials and switches and buckles and darkness and use covered every- thing like a convoluted and eons-old genome with no knowable under- lying order or expression. Strobilus felt as if she were inside an extinct insect, not eaten prey, but a foreign object, a pathogen, or a disorder, as if she were something the insect was worried about or the insect’s guilt. She touched her face. Her heart was not racing, but it was running. She rehearsed The Cliff’s Song’s fourth movement in her head, eyes closed, fingertips playing her jaw, and her pulse quietened.

Charles Carthage remained motionless as the ship lifted off the ground, as it rose over the houses and the turbines, as at first one town was fully in view and then all of them, as the mountains Shafroth, Denali, and Foraker disappeared into the cloud cover. When he moved, it was slowly, a hand to his chest, where inside a pocket over his sternum he reached for the schist xylophone key, his luck, his totem, his bargaining chip. It throbbed there | /// 103 like an enlarged and mysterious gland. He heard her song’s missing note.

LCHF_pmg_forreview.indd 103 11/16/17 5:41 PM The sky was a series of ‘spheres and ‘pauses. The road to microgravity was unforgiving of the bodies of Strobilus and Charles Carthage, such that when they reached low orbit, the two Atoll dwellers were in dire pulmonary jeopardy. High elevation—high altitude—peak height—they had known it all their lives, but now at the threshold of directionlessness their precar- ious adaptations were failing them. Their blood became troubled and ill, lost and in crisis. It crowded against her head and Strobilus hallucinated.

She was an origin of life. It was dark. Hot water rushed over her, but she couldn’t feel it. Mileages of water pressed down on her from above, but she couldn’t feel them. She was tiny, an assemblage of tininess- es. She breathed easily without breath. She felt symmetrical and com- mon, and she felt her symmetry growing, becoming structure. She felt energies entering her and she desired to keep those energies, to protect them, to use them, to deprive the world of them. She struck out at the asymmetry of the rushing water and she learned to loathe the dark while bettering herself in it. Then she left the dark. In her hallucination she knew she was much less than human, but still felt the parts of herself as if they were body parts, she knew there was a core—a vast ribbon— and barriers—between that which was her and that which was not her. She felt her nucleus. It was filled with many types of fear and they were all perfect and original. She thrived, but she desired more, she craved and starved and devoured and then ultimate and pure abundance tore through her and that was the climax and agony of mitosis—two Strobi- li. And then they too in due time divided, until she was surrounded by herself, a vast diaspora, a culture looking back at its zero-celled begin- nings. The Strobili multiplied by the billions, and so did the years. She felt herself one being again, but she was sheless and herless, and the tra- latitous significances of those billions had given way to something else. There were others there with themself, as before, perhaps like before, and they changed and reproduced, but it was different, it was after every- thing Strobilus knew, it was after people, and there were no words for it.

Carthage did not grasp the key, but held it lightly. The minerals and struc- ture and resilience of that key had survived every terrestrial catastrophe there had ever been, it had been upheaved itself, removed to the farthest remotes of the world, it was inert, crustal, it was passive, it was pacifism itself, it was stone of one of the highest mountains on the planet, it had only since then borne the music of a human intellect, and now it would end that intellect, held as it was in the most savage and enduring weapon there was, the Hand. It had crossed the ranges and made its homecoming on the throat of a witness. The key underwent this transformation with- out the slightest segue or resistance, it would now—simply—kill—simply.

Charles Carthage was suffocating when he performed the martyrdom of the xylophonist Strobilus, who was also suffocating. He brought the schistophone key to her throat, a large key for an abnormally low note, \\\ 104 |

LCHF_pmg_forreview.indd 104 11/16/17 5:41 PM for she had built the schistophone in the scordatura tradition, the note was designed to create a particular effect in The Cliff’s Song, the effect of dawn in the hot half on the western cliffs of the mountain of Shafroth. He brought its fine edge to her throat and he cut, and the cells ran out of her like a bloom of red algae, like long lines of elegy, and the note that sounded told the tale of his failure better than words, because Strobilus indeed bled, and it wasn’t long before they both fell into their comas, and it wasn’t long after that that the women from Asylum announced that she would live.

The penalty for committing martyr was immortality. Charles Carthage knew this in waking life and in the life of his coma. In the life of his coma he awoke to exoneration, to the news that Strobilus had lost too much blood, hadn’t survived, was indeed martyred, that the women from Asylum had sided with him, had been on his side all along. They told him that the Samara Atoll existed still, that it harbored a massive human population, and that they would take him there.

In the life of his coma, he convalesced at the Asylum for many weeks, healing and acclimating, breathing deeply, stretching his limbs out as far as they would go. Once he thought to look down upon the Earth in search of Alaska, but of course he could not find it. There were no shapes. There were no straits or archipelagos or basins, there were no continents. There was only the Surface. In an observation compartment, ill-fitting pieces of this revelation fell into place. Finally, after his long recovery, they were to make the descent to Samara. Carthage and two other women boarded a ship similar to the one that had met them on Shafroth. It was on this trip that he learned how—barely—such landings were possible. A larger vehicle, of which the Asylum had built but one, which they called a cusp ship, ferried the smaller shuttles into and out of the atmosphere. The cusp ship could not land. After reentry it would launch a shuttle and return to orbit. The women explained that the cusp ship had only recently been developed, and that the trip to the Shafroth Atoll was amongst its first successful uses.

The cusp ship brought them into the atmosphere and launched their lander without incident. Carthage had no sense of direction. The women told him they would approach Samara from the south. The mountains appeared in the distance, the color of his mountains, black and blue and orange and tan and white and gold and silver. He saw three great summits studded with turbines, white buildings, and long, impossible structures connecting the summits. The women told him these were monorails, a means of travelling between the settlements of this massive Atoll. They | /// 105 landed and were greeted by throngs of townsfolk, officials, techers, musi- cians, children, merchants, courtesans and lords, scribes and bards, magi- cians, acrobats, mimes, ewerers and pageboys, goats, ibex, and leopards, bells ringing on their exquisite bridles and sashes, bleating and snarling

LCHF_pmg_forreview.indd 105 11/16/17 5:41 PM their welcome. They led Charles Carthage, Savior of the Idea at Shafroth, through the streets of their Farm to his reception in the courtyards of the Library of Samara, where the Cult of Chefs would invoke a dinner from the cornucopias of that prosperous Atoll. He watched as the Chefs focused the power of their minds upon the newly butchered goats—but what was a goat—roasting their haunches and legs without fire—and he watched the garlands of rosemary and saffron and dittany—and what were they—adorn the haunches—and he watched the salts of the moun- tain rise up from the ground and fall on the meat like snow. He watched cordials and ciders bead through the air as if in a vacuum and drip into the chalices of the harpsichordists, their robes encrusted with embroi- dery, their breasts sparkling with amulets. He watched the mensal knives carve the choicest loaves, and he watched as huge squashes and whelks sizzled midair in butter and parsley—as ribbons of dough crisscrossed pies that baked ovenlessly—ah, but he knew of ovenlike machines—and he watched the masters of telekinesis bring plenty to him and his breth- ren and he rejoiced.

It wasn’t clear if the man named Charles Carthage would wake up soon, or ever, but Strobilus sat at his side in the little clinic, the long cut on her neck held fast by a foamy substance not known on the Atoll. She regained consciousness quickly, the women said, because of the way her body had mediated the two strange traumas. One woman came to her often and spoke at length while Strobilus looked out the clinic’s large circular window. The angle changed continuously with the day, but al- ways outside the Asylum was a huge, tan planet. The woman told her the rumor of the Asylum, how it worked, how they ate and generated power, and where the men were. She explained that the people who lived in the Asylum called rumor history. She told Strobilus what she knew about the other Atolls and how they were different from each oth- er. And she returned to her the key that Carthage had taken. While the woman was gone, Strobilus slept, or thought, or watched huge patches of cloud cross the world. The schistaphone was in the room, the miss- ing key restored to it, but she hadn’t played. It was time to, she thought, pulling her chair to the window. She placed the schistophone be- fore her, pulled two mallets from her jacket, and looked at the planet.

She played. The improvisation began slowly, not with hesitation, but as if to acquaint itself with the swaths and columns of cloud that obscured the terrain beneath. Her terrain then was in the uppermost octave of the schistophone, where she had built in identical keys that could be played to create unisons. She played these high unisons first, letting the tones ring out and fade to silence, before shifting to bright, hushed dissonances. The song, which was not a song, she knew, did not quicken or intensify, or even change much. She repeated the same few figures over and over again, until the Earth was a sliver in the window. And then she saw it. \\\ 106 |

LCHF_pmg_forreview.indd 106 11/16/17 5:41 PM An object had come into view, but not as the view shifted with the turn- ing of the Asylum. An object appeared, or seemed to, from nowhere. She thought it must be an asteroid, perhaps one the Asylum had brought into orbit and mined for resources. It had the supernal look that cer- tain geological formations sometimes did—a fantastical look that one must accept as natural with reservations, like crystal, or a natural arch, or riverstone, or basaltic prisms, phenomena she had seen images of in the library. It had the look of uncanny design. It must have drifted into her view at a moment when she turned her eyes to the schistaphone, she thought. It must have been something the women were working on. She noted absently that the object was blue. Another minute passed, and the Asylum had turned away from it, and it was gone.

She had not thought about her hallucination, about what she had been in it, and what she became in it, since it happened, but it returned to her mind now, as the door to the clinic opened and the woman came in. Stro- bilus shifted in her seat, turning to face her. When the woman spoke, it was with the same calm and steady tone as before. She said that she had come this time to show Strobilus something. The woman looked around Strobilus, at the schistaphone, and then her gaze shifted to the window, through which nothing was visible at that moment. Strobilus followed her gaze, and knew she must have meant the blue object, and asked the woman if that was so. The woman told her that the blue object was part of it.

They walked together to a distant part of the Asylum. Strobilus wasn’t sure how much of it she had seen, but after an hour she realized it must be a huge complex. The woman talked to her as they made their way through it, passing other women along the way. She told Strobilus that the women from Asylum had made significant technological advances in the time since their habitat was first built, but that certain technologies could not be brought into use without the proper resources. She added that prog- ress had been made in recent years, since the object Strobilus had seen in the window first started coming to Earth. She explained quickly that it was not an asteroid, that it was not natural, nor was it unnatural. Strobilus didn’t understand. They arrived in a deserted observation deck, its win- dow into space much bigger than the one in the clinic. Through it, huge, very near, was the blue object.

Before Strobilus could ask, the woman told her that she did not know what it was, and that furthermore, the unknowness of the object outdated such questions. It did not represent a technology. It was not a vehicle. It

could be a vessel, as a cup is a vessel for water. Nor, she went on, was it | /// 107 crewed, though, the women—bearing in mind the absence of a better, more appropriate vocabulary—conversationally used the word someone to describe what was there. The woman confirmed that the object ap-

LCHF_pmg_forreview.indd 107 11/16/17 5:41 PM peared out of thin air, as Strobilus had seen earlier, remained near the Asylum, and vanished again, every sixty five to eighty hours.

She told Strobilus that the object—she paused often, using certain words as if against her will—went back and forth between Earth and another— another pause—planet, but that went and planet were not exactly accu- rate. She admitted that the women didn’t know how it worked, but that they had gone with it to this other location, and that they wanted to take Strobilus there. The woman explained that they had some—pause—met- aphors for what could be—taking place. One important and difficult con- sideration was that the vessel did not, as she mentioned before, seem to make use of what people called technology, but rather a technology-ana- logue. It appeared to have functions that were like the functions of their own spacecraft, insofar as it had a form, was partly—pause—a habitat, and was designed to—and here she paused again. The temptation was always to say move, and she said they often did say that. But the vessel didn’t propulse. It—managed—distance—and apparently only one single distance—by some other means. Words like traverse or cross or cover were words they avoided. The object remained outside the window. They looked at it. After a short silence the woman said that they called it their Albatross. And that some called it their Person. It would remain outside the Asylum briefly, and then—depart. The woman would go with it, and so could Strobilus, if she wanted to.

She did. The woman told her the preparations had been made and that they would go to the object. Boarding the tiny shuttle, Strobilus was again reminded of her hallucination, and Carthage’s attack, but with detach- ment. She realized she did not know how long it had been since she had come to the Asylum. She touched the plastic scar on her neck. It didn’t hurt. The shuttle left the Asylum and moved toward the blue object. For a second she saw the Asylum. It was enormous. And as they pulled away from it, and the field of view became wider, she saw other complexes. She saw a giant asteroid in a silvery vice. Tiny lights shone in its mineshafts. In a few minutes, their shuttle, the Lacuna, had nosed up to the object, into a sort of hollow or niche in its side, if it had sides. There was a jolt as the Lacuna attached itself to the object. Strobilus asked the woman when they would leave, and she said only that leaving wasn’t accurate. They waited.

Waited was accurate. After many hours in the shuttle, without warning or preamble, they were somewhere else, a fact made obvious by the planet that appeared in the window—a planet not Earth. It was huge and close. Strobilus felt nothing of the uncanny, no sensation whatsoever, only that one moment had passed to the next. She breathed normally. She kept silent, waiting for the woman, who said nothing at first. They were alone over strange clouds. The woman spoke. They couldn’t land there; it wasn’t \\\ 108 |

LCHF_pmg_forreview.indd 108 11/16/17 5:41 PM that kind of planet. Possibly, it wasn’t a planet at all. Beneath the swirl- ing gasses that could be seen from orbit, there were structures, possibly geological, possibly artificial, but the data were ambiguous in either sce- nario. It did meet certain criteria in terms of how planetary bodies were defined—it was a round celestial object that seemed to have been created as a byproduct of stellar formation, for one. But other facts didn’t add up as neatly. It wasn’t where it should have been in the system, and the sys- tem itself seemed to be returning to equilibrium after a period of sudden, inexplicable change. It was the woman’s opinion that the planet, or what- ever it was, had been moved somehow, that the balance of the system had been adjusted, or manipulated.

Strobilus listened. Other blue objects appeared in orbit with them. At first only a few, then many more, then more than she could count. The woman talked through the spectacle. The women thought of the phenomenon in terms of what they called a migration architecture. The objects seemed to arrive there, or return there, periodically, as albatrosses or penguins used to convene on islands in the southern hemisphere on Earth. Sometimes the women arrived first, sometimes there were thousands of objects al- ready there, other times millions. Sometimes their Albatross left early or late. They had observed some go into the planet. They didn’t know where the others went when they vanished. They did know that when they were near the other planet, they were far from Earth. Their instruments could find no recognizable points of reference in the stars by which a proximity to Earth could be ascertained.

Objects crowded the view. And then the view began to shift. They were moving toward the planet. The atmosphere glowed. They passed into it in silence and the Lacuna was filled with light. Strobilus looked at the woman, who smiled at her and said that human beings learned to recog- nize abundance early on. The primate brain was attracted to and obsessed with presentations of abundance. Strobilus nodded. They emerged from the cloud cover and there were so many objects surrounding the planet that space was no longer visible. They could see only the blue of the Al- batrosses. | /// 109

LCHF_pmg_forreview.indd 109 11/16/17 5:41 PM CHAPTER 2

The wind with its perpetual

rhetoric was searching

for answers in the canyons

and the trenches, in the endless bunkers of desert

ants, in the taigaland’s brittled stickdom,

at the feet of mountain ranges

It swept up the loamy but inert earthstuff,

showed it

in the sky, and randomized

it down again

And the mountains rose up

out of this

randomization like reefs

The valleys were the valleys

of death, and the shelves were the shelves

of death, and the same was true for the channels

and the floodplains and the buttes

The gasses and their speeds were

the wind and the answers answered:

Exonym—echo—edge—elegy

Because that is what search sounds like on bare stone \\\ 110 |

LCHF_pmg_forreview.indd 110 11/16/17 5:41 PM LAST LOST CONTINENTS

ONE BASIC UNIT OF LANDMASS ON THE CONTINENTAL SCALE is the craton. A craton is an abnormally buoyant segment of the Earth’s crust that, owing to it’s low density and particular composition, bobs on the mantle and forms landmasses by a process of accretion. This process began, it is thought, during our planet’s Archezoic period, roughly four billion years ago. It con- tinues today and is driven by something called, by turns, plate tectonics or continental drift.

The lost continent is an obsolete trope of human dreaming. Though much of the Earth remains remote to people, that is, to individuals and civilizations, there is a big—low resolution—picture of the sprawling speck we inhabit. The human species has never lost a continent once in its evolutionary history, but it has found and fabricated many. Over the desolation of eons that obscurely prefaces consciousness, the jigsaw of primordial cratons walked the water of the Earth in their phlegmatic, unknowing way. The great and small islands and seas scattered and coalesced, did and undid themselves and so set the varied and mysterious stage known today as the world.

Pangaea, Panthalassa, Tethys, Gondwana: these and others make up the geo- logic pantheon of lands and seas in deep time. What sounds very much like a mythology actually is not; though the real in this history has been named like a cast of capricious titans, the clash and scatter in this case really happened, imperceptibly, so long-taking in fact that it looked like it didn’t. But the names and 3-D models are there, waiting in the crevices like predators. Who are these oceans, these super and micro continents on which historians and scientists have imposed their mythbuilding? The very act of animating them with these names seems unscientific, unobjective.

Consider what else populated those crevices. Anything so ancient is ostensibly the stuff of cryptozoology, that fashionable flight of nostalgia: giant sea moth, abominable swamp man, Loch Ness T-Rex, Jersey jungle walrus. Even what we know to have been real is as good as imagined, petrified in the fossil record of | /// 111 fantasy. Flightless dragons walked the Earth back then that would evolve into a kind of gilled mouse. Aquatic wolves with eyes looking up from the top of their skulls would evolve into whales. The Earth always manages to prove its

LCHF_pmg_forreview.indd 111 11/16/17 5:41 PM LCHF_pmg_forreview.indd 112

\\\ 112 \\\ | consigned to land-dwellers. She must conjure words the feet and street from cost, transformation. Throughout with song a the vocabulary Ariel struggles wreckage that drives her to air, birds, cratons, the and eventually, at no small and candlesticks are of part her. They aresourcethe and core of her desire,the less human relics. Though useless alienness,theirto those sunken her in forks imagine now. In opening the of song the over Ariel looks her coveted, name- Ashman for The Little Mermaid and it barely made cut, the is which difficult to songThe “Part of Your World” was co-written Alanby Menken and Howard becoming human and it might only the be step. She wants of part to your be world. To want something is first the step toward deep,the citizen of void the behind left by unfeeling cratons, she wants more. underwater kingdomthe of, you it, guessed Atlantica. and Denizen diva of gress. She is tired of amyth being and asighting, bored with her royal role in heroine of story, the Ariel, of is a mermaid human the possessed urge to trans- animated splashterpiece fascination. One hundred and fifty-threeyears laterWalt Disney its released and, species ined respectively, areal one, saw same the felt thing, same the ing, plurality, rupture. Indeed Anderson looking upon and an imag Darwin, - genome would tell as that asimilar story of platypus—one the of barrier-cross- arrived inAustraliaCharles Darwin and saw his first platypus. The mermaid In 1836 Hans Anderson Christian wroteLittle “The Mermaid,” shortly after forgotten.dead and designations, Greek roots and wrecked ships, mindless the alive and the a brand Atlantic. new Thatocean is deep, full of mysteries and fictions, names and tantalizing, ofspectral hearts inthe many like aphantom limb floating in No craton, however fancifully named, away carried Atlantis. But it exist, does Atlas, asecond-generation titan inGreek mythology. Atlantic them—the spacesbetween inthe began to pool named Ocean, for what would eventually West be As landmass . the fragmented an ocean ofpart Atlantica what became would eventually South another, America; be tinent formally named, in1996,Atlantica. cratons These separatedthen and Two billion years agocratons several were clustered together, forming acon- featureless places and as those world the was ours. of undiscovered the retreated,became as tothrills The poles. like the whales, of part unsustainable. achievable basic, a certain became discovery The stock physical the paced world, plates the and basins and faults and trenches, when more. It was at turning this point inour exactly imaginations that we out- Evenin full. as then, as close we were to we having yearned for everything, The lost continent myth originatedperceiving inminds a world not yet mapped far reaches if, as with people, given time. The Little Mermaid on Anderson’s, based story. The 11/16/17 5:41 PM | /// 113 /// 11/16/17 5:41 PM - - ambas English an . Her/himself their distant, dry, ambulatory realm. The word burn for her is purely meta - purely is her for burn word The realm. ambulatory dry, their distant, with if as her within thesemeanings feels she but theoretical, and phorical wants she change and if the embodiment as combustion, and temperature real consisted she what by unbound were if she as becan a language, learned like physically. of consists song and registers, of consists the voice increments, of consists Time Laying the third. by life to be brought only can those but things, of all four of Ashman’s Howard At endeavor. a harrowing is it singing by a song to claim World,” Your of service, “Part memorial of Benson, the original singer Jodi - During rehears right. just the deceased the phrasing get to recalls promising all, after “inner intensity”—Ariel, an from Benson sing to urged als, Ashman sanctuary a kind of embedded even cave; in a secret underwater the song sings - presum is also, intensity This claustrophobia. deeper Atlantican in a general a as from, and a song, of ownership from a writer, as comes, that the one ably, embody to must be it difficult How a song. of a successful stewardship singer, the song, and the popular yet the traditional and it, to oneself fit to a song, itself. song as old as are song, covered - sub his For re-recorded. and been covered has widely World” Your of “Part vocalist competition, Voice” Your Us 2007 “Give World’s Broadway to mission - ren a viral, sang go subsequently videos would whose YouTube Pitera, Nick is it begins, As the song falsetto. near-ineffable signature, in his it of dition the video in which studied Howard closely has Pitera that apparent instantly He Mermaid. The Little for rehearsals Benson during Jodi coaches Ashman and up clear can whispery that its with textures register, the falsetto that knows the song. to itself lends/gives wail, a siren-like to expand per that ambiguity sex, an ambiguous of sounds Pitera lines the opening In sists through the performance and is central to its power. The restrained, al- restrained, The power. its to central is and the performance through sists in only is It seamlessly. again return and wail a to shift lines whispered most words for Ariel when searches of the halfsong in the first those moments asks, again?” he word that “What’s speaking his to voice. reverts Pitera that in is if the answer as contrast, in utter the answer singing before ordinarily, his fiction, becomes falsetto Here, physiology. his treatment, his voice, his the with toys Pitera registers, Alternating transformation. for a vehicle voice mermaid, and Man apart. so really far are inhabits he therealms that notion utilizes voice Pitera’s intensity, in (inner) builds the song win. As to wants he “when’s question, central the song’s to through right less, the whisper and less the through the camera, from away singing is Pitera this point turn?” At my it the ocean’s though water, of the vocal walls booth, of kilometers foam through moments in the last and reach, lies beyond what at straight surface, roiling he “love,” the word sings he moment the precise factin at this crescendo, of in Orlando Swinton looks exactly Tilda like sex in Virginia changes immortal, East, in the Middle Orlando, abroad sador LCHF_pmg_forreview.indd 113 Woolf’s astounding work of . “Same person. No difference at all,” Orlando says, because the stuff of myth and self know no boundaries. — In 1945 on a volcano on an island called Iwo Jima, far from any craton but slightly above sea level, a man named Joe Rosenthal took an iconic photo- graph. Fifty-seven years later Mariah Carey sang the Star Spangled Banner at Super Bowl XXXVI and she, too, shares in the legacy of that ill-fated volcano, in the mystique of its overtaking. Though it may be true that the United States relinquished its occupation of Iwo Jima in 1968, it will lie dormant under that black and white flag so long as the photograph persists in national memory. The YouTube video of Mariah Carey singing the Star Spangled Banner at the Super Bowl is a historical document. Like Raising the Flag at Iwo Jima, Carey is an American icon, possessed of her own mysteries, power, allure, illusion. It was thought (by some) that Joe Rosenthal’s photograph was staged; it is ac- cepted that it was not. It was thought (by some) that Mariah Carey’s perfor- mance was pre-recorded; it was.

Like “Part of Your World,” “The Star Spangled Banner” was written by a song- writing team. The lyrics were sourced from the poem “Defense of Fort M’Hen- ry” by Francis Scott Key and, omitting the last three stanzas, fit to a pre-ex- isting composition by John Stafford Smith of London. The resultant anthem, cobbled together as it was, reunites the Empire and its Colonies in an utterly inevitable, discombobulated coherence. As the song begins, the land at stake is up for grabs, unclaimed, unconquered, awaiting sovereignty. The Americans sing their poetry to a British tune and prevail. Key’s words captured that can- did victory and sent them into the future like a probe collecting all the good data of patriotism.

Mariah Carey is famous for her ability to sing in the whistle register, known in vocal pedagogy as the flageolet, the highest register reachable by humans. Like Nick Pitera’s uncanny falsetto, the quality of Carey’s whistle is a gift—melody is a signature they sign in voice. Though her particular vocal vocabulary can be heard throughout her rendition of “The Star Spangled Banner,” the high note is always the obvious standout: B6, which is also in the vocal range of dolphins. The note is so high that the word “free” is free of enunciation, unpro- nounceable, in the minds of the listener only. In true American form, Carey lays claim to the song’s territory, crowning herself queen with every echo of “Dreamlover” she embeds in the melody, every square inch of the fantasy and loss that makes up so much of her own work. Like “Always Be My Baby,” “The Star Spangled Banner” celebrates earned reclamation. When Carey’s voice soars into the whistle register like a rocket, like a bomb, she knows that all matters of time have finally made their homecoming.

It remains uncertain if Carey can get there on command. Her Star Spangled Banner was pre-recorded. Other notes in the whistle register are sometimes overdubbed into her live performances. It’s like a fickle muse. In the moments \\\ 114 |

LCHF_pmg_forreview.indd 114 11/16/17 5:41 PM leading up to the legendary B6, the camera abandons Carey and instead circles a sculptural replica of Joe Rosenthal’s war photograph, uncannily, just when evidence for that impossible note is most urgently desired and available. Be- cause the note is inaccessible, unbound, Unreal. It has been told of and sung but not observed. It is a myth. According to some exotic cycle outside the purview of humankind, its filaments rise slowly from the volcano on a curl of rock mixed with minerals mixed with glass. Ash. — Someday science will describe Dark Matter and give it a new name. Probably the word “Dark” will be replaced by some clever person’s last name: Yarrier, Frossing, Nork, Dender, Pictory, something like that. For now, the study of Dark Matter is cutting edge physics, distinct from fringe physics and pseu- dophysics, which are branches of pseudoscience. The field of pseudoscience is bright with invention and forefathers, just as the field of science is bright with dreamers astute and dreamers foolhardy. The spectra that unite these tra- ditions are as empirically, fabulously convoluted as the brains that conceived them. There are scientific truths, foundations that, like cratons, form the basis of how the human species understands the natural world and the universe. There are also pseudoscientific truths, pseudofoundations, pseudocratons around which accrete falseness and delusion. The British Isles are closest to the geological craton formation known as the Baltic Shield. Every landmass on Earth is situated on a global pseudocraton called Apate, named for the Greek goddess of deceit. Maine, of course, is on the fringe of the North American craton, and it was there that Wilhelm Reich imagined Orgone Energy and its counterpart, Deadly Orgone Energy, a cosmic force entangled with human sexuality and rain, a kind of Dark Matter chauvinistically linked to libido.

Wilhelm Reich moved to Maine in 1942, after being mistaken by the FBI for a communist bookseller in New Jersey. Though suspicious, his notions about Orgone Energy posed no threat to the United States of America. He was large- ly thought to be a fraud, had ties with Albert Einstein, and a very questionable collection of books. He named his farm Orgonon after his energy. Suddenly, that ordinary plot of land carried new weight. On this farm, Reich experi- mented with controversial devices he called “cloudbusters,” which he claimed could focus Orgone Energy in the atmosphere, inducing rainfall.

Peter was there when the FBI arrested Reich. Peter, his son. This traumatic event is the subject of Kate Bush’s song, “Cloudbusting,” from Hounds Of Love. Bush portrays Peter in the music video. The song, written from Peter’s point of view, recalls the day Reich was taken away, his laboratory ransacked, his work confiscated. “Every time it rains / you’re here in my head / Like the sun coming out / I just know that something good is gonna happen,” Peter/Bush sing. The

sense of the chorus is one of a pathetic fallacy in reverse, inverted nostalgia, | /// 115 futility blown so out of proportion that it resembles promise. In writing this song, Kate Bush looks across the Atlantic Ocean, into the past, into the life of a child, into the future of that child—and at that advanced stage of specula-

LCHF_pmg_forreview.indd 115 11/16/17 5:41 PM tion decides to take hold, to embody. Who is Kate Bush but the son of a mad scientist? In the world of the music video, but after the action of it, Kate Bush as Peter wanders the fields of Orgonon, abristle with decaying cloudbusters. They point upward like deaf weeds, finding nothing, performing no task, fac- ing the cosmos uselessly like the stone heads of Easter Island. They have no significance. In Old English there is a single word for the feelings inspired by looking at ruins. The word isdustsceawung —dust-seeing. Kate Bush as Peter looks at the cloudbusters. Shel Silverstein, rise from the dead and draw me a picture book about that.

During a performance at New York City’s Webster Hall, the song “Cloudbust- ing” was covered by singer/ Solange Piaget Knowles. Knowles as Bush as Peter cannot protect Reich from the FBI. Knowles as Bush as Peter hides the yo-yo in the garden. Knowles as Bush as Peter chases the car down the country road until it vanishes into the hills. Knowles as Bush as Peter runs up the hill and activates the cloudbuster and it works because it is real and the sun is shining and the truth is finally revealed. Knowles fits herself to the song and approaches the coda like a coyote and climbs the step-pyramid to the final note. The note is high, not dolphin high, but high enough. She has shifted shapes. From the top of a step-pyramid lost continents become more abstract. A house is a lost continent. A street, a shape, a chord change is a lost continent. Darkness is a lost continent. A time of day, a bad idea, an area code, two particular colors next to each other, a catchphrase, a knickknack, all these are lost continents. Everything impossible to forget is a lost continent. Fathers, sons are lost continents. That which is obsolete and that which is useful are lost continents. The future is a lost continent. Names are lost continents. Fondness is a lost continent. Kate Bush’s first piano is a lost continent. America is a lost continent. Verifiable truth, death, meaning, God, the origin of life on Earth, the universe before the sun, whatever came before the universe and whatever will come after. — The word nostalgia was coined by a Swiss medical student approximately one century after the invention of yodeling. It described a condition suffered by mercenaries living abroad, whereby the patient, upon hearing simple, tradi- tional Swiss horn melodies called Ranz de Vache, would experience deser- tion-inducing homesickness. Whistling these melodies was prohibited under Swiss law. From the Greek words for homecoming and pain, the notion of nostalgia arose from music and pathology.

For his blind audition for the The Voice of Italy in 2014, contestant Tommaso Pini sang “Summertime Sadness” by Lana Del Rey. Like “Part of Your World,” “The Star-Spangled Banner,” and “Cloudbusting,” “Summertime Sadness” is a nostalgic, commemorative song about having something and not having something at the same time, a conceit dear to the human psyche and suited to music’s home dimension of time. The immanent separation chronicled in “Summertime Sadness” is colored by equal parts melancholy and thrill, Del \\\ 116 |

LCHF_pmg_forreview.indd 116 11/16/17 5:41 PM Rey’s hallmark emotional confabulation. When Pini begins to sing, it is as when Nick Petera begins to sing. Who is it? The judges in their garish thrones sit with their backs to him. Is it a him? The beguiling androgynous croon be- fuddles the viewer, too, because of the way the show is edited. It’s a double mystery, a quadruple mystery, an infinite mystery. The judges nod knowingly, exchange meaningful glances, spin around and behold Pini at the height of his performance of this devastating Ranz de Vache, of the anthem of pain Del Rey fabricated for herself, that the feedback loop of loss’s joy might never abate. In “Summertime Sadness” the separation is always about to happen but never does. That stalemate is the dark craton of desire, of war, of the past. No matter how hard we try, these barriers are insoluble in thought. What we want and what we need staggers though the breadth of the human register. There, noth- ing else matters, let alone exists, let alone is open to debate. Maybe it’s reality TV or maybe it’s something someone calls their art. Maybe it’s all just cosmic rays planlessly workshopping our genes into gibberish. But what is certain, what the evidence shows, what is undeniably in the data, what is conclusive scientific fact, is that the greatest, most lost land of all is ourselves. | /// 117

LCHF_pmg_forreview.indd 117 11/16/17 5:41 PM CONTACT

★

I open the folder called Fake Places

I open the folder called Early Impressions

I open the folder called Last Ditch and skim through the Infinite

Jest of my life and find nothing, some nothing with which I might at least work Who has time to solve my tall Troy walls Who believes the fandom’s protective mystery will save my fads from undead metaphor If the undead metaphors pour in and over them I have time to involve the act of parsing, to put my lips to the coronet and sound the error, throw the error, whatever it is, accordingly If the trolls and incomplete strangers cake the bazaars with their empire-declining antics, then victory, defeat, they’ll be rumored and debunked, authenticated in the provinces no matter what happens or happens The coronet is somewhat trumpet see A slim cairn see A comet tail of days avoided toppling see out of my mom Overthrown, over sound, beyond error, my escape is a matter of control X and V but never C The same goes for my return \\\ 118 |

LCHF_pmg_forreview.indd 118 11/16/17 5:41 PM I open the folder called Things I Love And Know every day And there is my super commonness in a common universe And there is my super commonness’ finger poised over the folder called Black Hole It hovers precariously It will press matter at its center and wait for something that is never me I open the folder called Growing As Green And Voluptuous As This New World Did In All The Ages Up Until This One Within It and within it the common universe shies away from everything I’ve learned about science fiction | /// 119

LCHF_pmg_forreview.indd 119 11/16/17 5:41 PM I open the folders called Primitive Needs and Primitive Satisfactions and they are empty I open the folder called Knock Knees and find the whetstone henge that remains of my druid-built, druid-abandoned sex drive Like other such sites I am unsearchable and have no name No name, but messages, strange messages No druid, because what is a druid, but remains, strange remains \\\ 120 |

LCHF_pmg_forreview.indd 120 11/16/17 5:41 PM Critics call space griddy and axes-packed Seed vaults weird me out Ozone clouds the crystal ball with mystery Gaze into my Earth I’m presoaking the future (You’re invited to its séance) In a sacred river’s profane delta My spirit horn’s modest range will break up the stains And together we will summon up and collate every stock genetic koan

| /// 121

LCHF_pmg_forreview.indd 121 11/16/17 5:41 PM Sometimes I wonder what a life spent studying ants and believing in God must have been like I spent my life interpreting its decades and living with various ADDs, untreated Sheryl Crow spent the sentiment in the first line of Run Baby Run, where she’s like I was born the day Aldous Huxley died, on never returning to it No one cool died the day I was born My life, Sheryl Crow’s life: where are they at My point is the only thing Adderall is the key to Adderall is the key to my point and nothing else O sprawling, aureate Smashing Pumpkins song five hundred times in a row, fail to open the Doors of anything amen O chemtrail across the Absolute O urethra across time ew sorry Go ahead Kick me out of the band I’ll find the blood that freezes at ninety seven degrees or four hundred fifty I’ll build my space station in low orbit over Mercury I’ll be like the guy in Sunshine directed by Danny Boyle A shouting beef-jerky golem subsisting on hydroponic lettuce I will have such visions Infinity, bursting with flavor, will come to roost in my voice \\\ 122 |

LCHF_pmg_forreview.indd 122 11/16/17 5:41 PM | /// 123 /// 11/16/17 5:41 PM ★★ A touch of purpose of A touch It will look like that will that look like It A big patterned field field patterned A big Redundancy and rove rove and Redundancy Not gory exhilarating bursts bursts gory exhilarating Not One trillions-fold empty entry entry empty trillions-fold One The side-species that is guesses is guesses side-speciesThe that If inertia is a form of propulsion propulsion of inertia a form is If But AbEx and Endgame, perhaps perhaps Endgame, and AbEx But That’s the weird thing about science science about thing weird the That’s My kinetic aplomb of resigned wonder wonder resigned of kinetic aplomb My The expanses suffer slow old-fashioned battery death old-fashioned slow suffer expanses The It can’t be denied that a guess is something truly alive truly something alive is a guess be denied that can’t It But until then here is my shrine to the Great Galaxies Galaxies the Great to shrine my is then here until But No transmission-ending dark theory dark the bloodying lens transmission-ending No Turns out I have no meaningful ownership of any symbol any of meaningful ownership no I have out Turns LCHF_pmg_forreview.indd 123 LCHF_pmg_forreview.indd 124

\\\ 124 \\\ | and inside is another Human folder called Invention and inside that is yet another folder You’d better that believe was just another promise kept Xfolder inthe with O carbon patina you disappear into home the planet’s ultramarine of urn the firstthe acoustic guitar in space burning up during reentry,trail sooty its I told myself that Igot when would far this break inlife everything down, slow down, become nebulous and neurotic like Maurice called False Devotionscalled and inside it, finally, of chords basic reshuffling, renothinging I open the folder called Secrets + Lies Lies + Secrets called folder the open I Blanchot I cultivate them secrets and lies 11/16/17 5:41 PM | /// 125 /// 11/16/17 5:41 PM I mean there are other Tropics than the dumb Zodiac the dumb than Tropics other are there I mean those Henry Miller books named ones after York New across which cuts of FasciaCamper, of Tropic The California southern across Perineum, which cuts of Tropic The anatomies O tantalizing map mold slime O tantalizing sycophant biggest your I am Ontology O Object Oriented other things of name in and the too, other things, after lines I name I wrinkle time discourse all human over a shadow I cast York New O southern exist Do you Xanadu O southern blood RPG I spill in when I robotrip an you Are gif torturous slow, a like its axis on rotates world The LCHF_pmg_forreview.indd 125 LCHF_pmg_forreview.indd 126

\\\ 126 \\\ | I imagine fighting it the deathto andwinning one at species until atime only humans remain I imagine collapsing whole the world one thing breaking down into and pieces smaller smaller of same the Particulate utopia caught of gills fish inthe theand lungs of birds, I imagine aGreat Pacific Utopia Spiral controlled compost I estimate decay the rate of utopia in then indirt, then inopen ocean, and inside itscreenplay unfinished the smiles up at me unfinishedly WatermelonI open folder the called Sugar 11/16/17 5:41 PM | /// 127 /// 11/16/17 5:41 PM

SETI is the great tragic love story of sentience sentience story of tragic love the great is SETI

LCHF_pmg_forreview.indd 127 I open the folder called Summers and in one of those whenever whatever ones maybe three or four or eight or nine ago Borna and I are on the highway in Corona during the tornado The air is green and whipping and everything you hear people say about that stuff At any rate we are en route to Oxford, Connecticut to a defunct satellite television facility a friend recently repossessed to pick up many small TVs It is hot Really hot and I feel like I am diminishing We go up onto the roof to climb on the giant satellite dishes I feel like Alfred Noyes though I bear no torch I feel like Laura Linney in Congo though I bear no diamond-powered laser I point up at the sky and fire anyway though I have no vendetta to visit upon anyone or anything except my own all-consuming powerlessness Borna is wearing the Converge t-shirt this month I can hear Converge thrashing though the one hundred percent daylight, the one hundred percent comparative stillness I hear dissonances ordering this weird opposite of New York, dividing the wind and heat and odyssey and ludicrousness of the whole day into a different set of repeating seasons I feel a riff reason straight through me to the other side and resolve The UV Index was high I longed for miserable winters For objects so cold and distant I would never even know they existed \\\ 128 |

LCHF_pmg_forreview.indd 128 11/16/17 5:41 PM | /// 129 /// 11/16/17 5:41 PM I open the folder called the folder I open Aimfully Agendas called the folder I open Potential sparrow distortion swallow, smog sparrow, smog sparrow, Needle hidden people of sound the loud to I listen their fates around time wandering no I spend I swear and LCHF_pmg_forreview.indd 129 ★★★

There is a type of grief that can be upcycled

Into just feeling kind of shitty-chic

On its anti-epic slalom we are

Heirs to the isthmus that repairs Fixation The next to never rate of Reason Back when every hayseed savant Could rebuff say gravity Back when there weren’t no phones Back when you’d never hear from a person again I was in my prime then \\\ 130 |

LCHF_pmg_forreview.indd 130 11/16/17 5:41 PM | /// 131 /// 11/16/17 5:41 PM What remains remains What invoice in the sky invoice into everyinto starry night’s What is inside everything inside is What Such magnificent remains magnificent Such What magnificent remains magnificent What wide overture, every science wide overture, Whatever is the om I concuss I concuss the om is Whatever space and time, love and death and love time, space and Law Law & Order, Siskel and Ebert, drum‘n’bass, Kavalier and Clay, Clay, and Kavalier drum‘n’bass, our unique, particular and highly finite everything particular highly finite unique, and our Whatever is my alternative to Celsius and Fahrenheit, and Celsius to alternative my is Whatever Batman and Robin, Leopold and Loeb, Ren and Stimpy, Ren and Loeb, Leopold and Robin, and Batman Inside the folder called Whatever, well, is a few paragraphs a few is well, called the folder Whatever, Inside which describes that which houses and shelters everything, shelters and which describes which houses that poorly understood, every ire itemized in that big wonderful wonderful big everyin that understood, poorly itemized ire from Carl Sagan’s Pale Blue Dot, which contains everything, which contains Dot, Blue Pale Sagan’s Carl from LCHF_pmg_forreview.indd 131 I open the folder called Infinite Jest and close it immediately I have done this many times O I know nothing O we’re best friends \\\ 132 |

LCHF_pmg_forreview.indd 132 11/16/17 5:41 PM I feel like Jodie Foster as Eleanor Arroway closing my cricket cage door My slingshot to Vega buffering in an astronomer’s novel written in the 1980’s I am loading Earth with a spring The Overview Effect truly is a kind of Nirvana song compared to the pandemic butthurt that is life on the continents You should come to my whole planet house party You should bring beer You should bring Ryan I keep saying you but the big black chance of space will not answer Probably | /// 133

LCHF_pmg_forreview.indd 133 11/16/17 5:41 PM LCHF_pmg_forreview.indd 134

\\\ 134 \\\ | I will drift unrecoverably drift I will what Ialways have I, too, shut will down for but do good still Iwill and after my under-estimated span whateverof this is to alot of noise music too Along way the Ihave lots taken of pictures and listened else of everything is only the us and thing between long the ambiguous tundra The long ambiguous else between us tundraeverything and reaches of my farthest mystery, oh missing techno of worthwhile, oncoming havePlease some form it’sand weird kinda MyI open folder the called Voyager: My Lonely Total 11/16/17 5:41 PM | /// 135 /// 11/16/17 5:41 PM HYPERLAPSE Odysseys to be had that are not procedural: are they there? are procedural: not are Odysseys be that to had who what or vice versa, and what asking who I’m sure not I’m patterning, migratory seasonal change, representation, graphic satellites, Bad Inventions: elements the chemical planetary accretion, here I’m Hello, everywhere me day is shows it Locater Sunlight My you are How excludes Pleasantries The of Book Communist Pleasantries Democratic so doesand the Book Ambiguous of comments, continents’ offload I breaks, all the news the After is them,that offland trying avoid to I’m what invokes location Every abnormal only locations familiar generates algorithm my why which is coasts? hazardous risky, what, a part is per coast amongst, the million clear But cocaine and anthrax of Harmattans like the horizon over I see them coming now key house my Here’s minutes lost golden, my relive and up it hold to ready I’m of bereavement concept the for turning to point be a going is This LCHF_pmg_forreview.indd 135 LCHF_pmg_forreview.indd 136

\\\ 136 \\\ | in the Earth in the lacuna useless a perfectly creating dirt, is called with prowess, with purpose, penetrates what Ihave read in my hand—and Ican barely imagine my own hand— Iimaginewhen that Idon’t spade—which the Ihave think inreal life— everseen I can’t wait less to about think fate and destiny 11/16/17 5:41 PM | /// 137 /// 11/16/17 5:41 PM . and nostalgia were nostalgia were and NOTES “Impact Crater” is for Julien Raffinot. Julien for is Crater” “Impact . Death Catch Can’t You Cobain memoir in her Kurt The opening sentence of “Plexaure” echoes an anecdote anecdote an echoes “Plexaure” of opening sentence The Island of the Dragon’s Blood. Blood. Dragon’s the of Island Botting’s in Douglass related sourced from Melanie Challenger’s incredible book On incredible Extinction Challenger’s Melanie from sourced The title of “Loud Spring” refers to Rachel Carson’s book Silent Spring. to Carson’s Rachel refers Spring” “Loud of The title “An Earthlike Planet For Ianthe Brautigan” owes something to a passage about about a passage to something owes Brautigan” Ianthe Earthlike For Planet “An The poems “A Dedication Theory For Sekou Sundiata” and “New York Eternity” Eternity” York “New and Sundiata” ForTheorySekou “A Dedication The poems reference the songs “On The Beach” and “Pocahontas,” respectively, by Neil Young. Neil by respectively, “Pocahontas,” and The Beach” “On the songs reference The insights in “Last Lost Continents” concerning dustsceawung concerning “Last in Lost Continents” insights The LCHF_pmg_forreview.indd 137 LCHF_pmg_forreview.indd 138

\\\ 138 \\\ | Forklift,Ohio,Queen Mob’s Teahouse, Terraform,Dark Mountain, Big Echo: Critical M_N, Diner Journal, Poem Tiger, BORT Quarterly, SciArt Magazine, glitterMOB, A few other pieces originally appeared inachapbook Executive called Producer I would like to editors thank the of following the magazines, many inwhich of these poems and poems storiesthese first appeared: Luna Luna Magazine, H_NG- Berfrois, Science Fiction, InDigest, nin journal, HARIBO, Sundog Lit,Tagvverk. and “Tropical Premises” won first inTerraformprize “The “The Women From Asylum”began as a response to Clarke’sArthur C. Chris Carter was, which published byOperating The System in2014. “Six Large Holes” by was selected Jeff VanderMeerrunner-up as a Big Echo: Critical SF about of his short legacy the fiction. “Exile of Eons,” the and was written for issue of aspecial in SciArt Magazine’s firstflashfiction contest. ACKNOWLEDGEMENTS ’s Post-Human contest.

11/16/17 5:41 PM | /// 139 /// 11/16/17 5:41 PM And to UKL: to And GRATITUDE Robin, it was your idea. your was it Robin, for their insights about the stories. about their insights for My parents: a Cosmos of gratitude: gratitude: a Cosmos of parents: My Steve Wheeler and William Squirrel Squirrel William and Wheeler Steve and take me out across the darkness. the darkness. across out take me and Lynne, there are no, and only, words. words. only, and no, are there Lynne, Of course there is more to it than that. that. than it to more is there Of course all that is, and ever was, and ever will be. and ever was, and is, all that thank you, Benjamin. I love you so much. you I love Benjamin. you, thank Phil Anderson, Andrew Daul, Claire L. Evans, L. Evans, Claire Daul, Andrew Phil Anderson, I will make whatever I am in break free of time free of in break I am I will whatever make And in my daily life, which is the same as my whole life, life, whole my as the same which is life, daily in my And which has nothing to do with any of this, but also is all of it, also it, all is of this, but of any do with to nothing which has none more profoundly than Anna Dunn. I would also like to thank thank also to Dunn. like I would Anna than profoundly more none Help is other people. There have been many who have shaped this shaped book, have who beenmany have There people. other is Help LCHF_pmg_forreview.indd 139 LCHF_pmg_forreview.indd 140

\\\ 140 \\\ | in general) coming together? Was it astruggle? had this intention for awhile? What encouraged and/or confounded this (or abook, independent entities into abody of work. How and why did this happen? Have you Talk about the process or instinct to move these poems (or your work in general) as above by all, communication. But like Isaid that’s just one thing. medians same We exact thing. dothe know all why they’re here. They’re motivated, ematics. Poets are of sort business inthe of findingthat exact order andCo- reason. something better is necessarily aform of relief. People always say that about math- it’s really and easy obvious, often it’s negative, butthe thatupside is understanding There is ahidden order or reason underlying complicatedthings sometimesand like someone when says something and you “look” for joke the you could make. one areI think thing poets interested most inthe is order, as inreason. It’s sorta and social role (in the literary /artistic /creative community and beyond)? What’s a“poet” (or “writer” or “artist”) anyway? What do you see asyour cultural way. this Born are more accurate)? calling yourself a poet/writer/artist, what other titles or affiliations do you prefer/feel When did you decide you were apoet/writer/artist (and/or: do you feel comfortable Part of part me hopes of Inever find me wishesout. Iknew; Why are you apoet/writer/artist? and Ilive hills. inthe raised valley inBrooklyn and Iwork at ahotel. I’m PMG and I’m a travel writer. I’m from Massachusetts, where I was in the born Can you introduce yourself, in away that you would choose? today! process your us about to talking for you Thank comrade! Greetings POETICS ANDPRACTICE PMG INCONVERSATION WITHLYNNE DESILVA-JOHNSON

11/16/17 5:41 PM | /// 141 /// 11/16/17 5:41 PM - avoid of contains, or the is book what saying not of way deft and coy a is , Obvious practices include, in the poems, the avoidance of periods and punctuation periods punctuation of and thein poems, the avoidance include, practices Obvious think to of which come way, the poems visually in a huge which shapes in general, think im- poems or use periods because I don’t I don’t seem obvious. not might it I’m in the world they what do so that who knows except conclude, ever really ages learned definitely goes,I write and work I the way as far As that. when say I saying UKL. Roethkeand Theodore Both of the essays learn—from to continue lot—and a that. very disguising who good are at technical writers extremely extremely, are - cre the use in you do any) (if practices constrictive other or structures formal What readings/ or environments, instructive or teachers certain Have work? your of ation work/write? you way the informed people creative other of writings/work Once I started writing science fiction I knew what this book was going to be like. I to be like. going sciencethis fiction I I started writing knewbookOnce was what a much poet so not am I actually always. plans of lots abandon and make definitely and lists makes and notes of as a a lot who takes scienceperson fiction writer and the book I wanted I knew though, what in there, them. Somewhere about forgets mass/ little quaint my was It that. against work to I wanted how and beto about energy equivalence. A book that I looked to again and again while assembling this book Buffalo while was assembling again and again to I looked A book that Le K. Ursula by Presences Animal Other And Night? At Out Come You Won’t Gals, selected with backed a novella It’s all night. and all talk who day I could about Guin, my book in from different It’s scrupulously. together put she that stories poems and been books already had in other because stories the poemsand way important an I think, effort, in an the novella accompany them to chose she but published, she’d very maybe wasn’t that work her specificabout something audience her show to Animal Other And the subtitle, And her. to important obviously was but obvious, Presences writing as process your understand or collection a as collection this envision you Did written being were themselves poems the while theme a around specifically making or not? how or How made? being was work / the At a certain point I realized that poetry and science fiction as speculative endeavors poetry I realized that a certain endeavors speculative point scienceas fiction and At that how showing about was together LCHF putting and in common, a lot have a mixed-genre and work between the distinction a hybrid Making me. for works of topic being a as it predict I but me, to is—very interest crucially—of no work happening has been conversation That the book,fine. which is about conversation -whethstories - that attitude the to perpetuate happy I’m and at least, fifty years, for whatever poems about or stories, look like that people, about stories, er they’re classification. than important more poems look like - are (?) that about poems are I is that the point but her, about up shut can’t I literally Again, classifications. ing scratch. from starting a book but make sorta to that, like wanted LCHF_pmg_forreview.indd 141 LCHF_pmg_forreview.indd 142 Gombrowicz’s notorious Diary As far as titles go ingeneral: Ihave two answers to that. Somewhere inWitold general is not everywhere. movingry—and forward—as we that learn human the faceand human presence in as pretty being central to alot of dilemmas our civilizations 21st face inthe centu - on Mars created likeness inthe of ahuman(oid) and acts mistakes these face. Isee mindSometimes the is wrong, asit when was thought that there was an earthwork mindis the for looks when and finds humanlooks. faces it and figures everywhere of with aphenomenon type act particular pareidolia, inpsychology called which achauvinistthis today act; an it anthropocentric might called be Iassociate act. this tural, and folkloric narratives onto ageophysical one. Carl Sagan might’ve called attractedbecame to it phrase because this human, superimposes certain architec- cluster of methane and hydrogen vents are which “chimneys.” sometimes called I The lost city hydrothermal field isafeaturegeological the of Atlantic Ocean. It isa sections, etc) influences you and/or colors your work specifically. about the way you titled the book, and how your process of naming (individual pieces, Speaking of monikers, what does your title represent? How was it generated? Talk know what it is at all. or old-fashioned, either. Idon’t consider it anything to be Idon’t because actually olderto things. be I definitely don’t consider science be fictionmy to contemporary former—it’s just to say that far so Ihave written from what I’ve read and that tends to say that latter the are somehow writing some of sort more advanced SF than the and Ted Chiang—who are at top the of said game—into practice. Yet. Which is not I’mbecause to new game too the to put what I’ve from learned Jeff VanderMeer and Samuel Delaney and R. Stanislaw that Lem sit on my shoulder most the - only is, as UKLwould say, atelling. Iguess Iwould say that it’s writers like Joanna Russ Itelltimes peopleform, thatpoetic fiction science short the as a but Iuse story that was really important—and how to things led where those we are now. And some- on growing the pains of pulp, and on people when firstpoint started to outthat SF Aswriter fiction ascience I am, forbetter or fixatedworse, very the 60’s on and 70’s, have much to say about. intuitive bothThey are very also writers, there’sand there a that mystery Idon’t \\\ wordif the meaningless. was seemingly His famous example of that was always 142vated by placenames, specifically, powertheirand evoke to narrative tension,even that book in this addresses issue this on, head conveniently! capti Sekou was very - \\\ by aprofessor of mine at The SchoolSekou named New Sundiata. poem There isa | I was also, young urged as to avery carefully poet, and bombastically create titles - first encountered hishumorous very and devastating work. one’s dog-to distinguish it from others. Itook to this many heart years ago I when he states that one names one’s as one book names 11/16/17 5:41 PM | /// 143 /// 11/16/17 5:41 PM This question is at the heart of the ethos of The Operating System, and it’s the the heart - it’s and System, Theof of ethosOperating heartthe at the is question This to sequel a , Lucifer To Flight The (bear me) with Bloom’s Harold In answer. to est of science work an early definitions some (by Arcturus To A Voyage Lindsay’s David have people many as just novel only and first his disowned has (Bloom fiction) A lake. a strange of the edge at tower a strange is there work) his alldisowned of word One tower. to this to an entrance seem be doesn’t there first At silo. kind of - ac social in community creative and poetics of role the about bit a little talk Let’s - immedi remained has which 2.0,” Rights “Civil I call what in particular in tivism, be I’d publication. series’ this to up leading time the us in around all present ately publishing and speaking in face we challenges the on thoughts some hear to curious - with sexuality and background, social/cultural privilege, age, race, of lines across “silos.” isolated in producing and remaining of dangers vs. the community, the in First of all I hope that this book makes the next book super hard to write. I know know I write. to this bookbook hard the next super makes all that hope I of First it. to like Kesha it. I want my to like friends Alsome. I want for That’s already. that everyone deserves and to, the fuck I wanted whatever I wrote And lucky. Also I got We that. about something said Vonnegut Kurt license. and opportunity the same all this finds at know I don’t someone I hope alone. not We’re us. Find here. out - some makes And there. was know didn’t I that it in something discovers bookand wildest dreams. in my predict never I could it of out thing What would be the best possible outcome for this book? What might it do in the world, world, the in do it might What book? this for outcome possible best the be would What community your in role creative your facilitate object an as presence willits how and practice? your for and book, this for hopes your are What beyond? and Against hyperobjects, human beings promise deluxe resistance. The truth is out out The truthis resistance. deluxe beings promise human hyperobjects, Against there. What does this particular work represent to you to represent work particular this does What practice? method/creative your of ...as indicative history? your of ...as indicative mission/intentions/hopes/plans? your of ...as indicative because that’s nothing for I do the work wall the this third with one. breaking OK reward. greatest my contains)? or says it as what DO book (as much this does What Braintree, Massachusetts. This almost absurdist impulse still seems oddly out of still out seems impulse oddly absurdist This almost Massachusetts. Braintree, matter no a title creating to carries over that impulse an it’s but him, for character thepoem work Make Love”). For poem be to had (see “Mood amazing it his what - ex him every I think of and try So time without single said. he I always it, to, for light. pool of my is He ception. LCHF_pmg_forreview.indd 143 that comes to mind when I hear this question is marginalization. I’m not sure I have accomplished anything, or have done anything. I didn’t do anything because process and the work that emerges from process does not (always) happen that way, although it sometimes does; sometimes it often does, depending on how you look and where you look. A willingness to look is what I’m talking about. And recogniz- ing that process exists, to paraphrase the Vulcans, as an infinite diversity in infinite combinations. And this entanglement of human stories exempts no one. Everyone is responsible. And everyone, contrary to what I said before, is everywhere. My tiny piece of the puzzle is a little silo, a word worth reclaiming; they are ubiquitous; we consist of them. There’s a silo of sorts on the cover of this book. It’s a defunct parti- cle accelerator. It has been superimposed over a strange landscape. It has a troubled, complicated history. One we might never really understand. We all have histories like that. Kazuo Ishigoru said something like that. The only way we will ever learn from such things is to place them—squarely, securely, and with accountability - in the record.

PMG Brooklyn NY August 12th, 2017 \\\ 144 |

LCHF_pmg_forreview.indd 144 11/16/17 5:41 PM | /// 145 /// 11/16/17 5:41 PM is a poet and science fiction writer. a poet is science fiction writer. and He lives in Brooklyn and works at a hotel. a hotel. at works and in Brooklyn lives He PETER MILNE GREINER Motherboard, Fence, Dark Mountain, SciArt SciArt Mountain, Dark Fence, in Motherboard, appeared has work His Magazine, Big Echo: Critical Science Fiction, Berfrois, Forklift Ohio, and Ohio, Berfrois, Forklift Fiction, Science Critical Echo: Big Magazine, is his first full-length first collection. his is Field Hydrothermal elsewhere. City Lost LCHF_pmg_forreview.indd 145 LCHF_pmg_forreview.indd 146

\\\ 146 \\\ | have done for The OS, for me -- and forpages.everyone, withthese person Iam lucky so collaborator to call and Thank friend. you for all you again and again by rich, nuanced, the informed, humane intelligence of this domanyWhen Iwill (which Iread book this more Iam times) astounded participate not only inelements you. that directly serve are growing only has a“we” ifyou show up, offer of yourself inexchange, and /consumer,an observer but someone has who understood that thing we this one, not willing is has this aperson only who been to attend community, as Part of that comes respect from an understanding of community. From day delight he agreed, and my for respect himand his work continued to grow. wouldwhich morph intoOperating The System not long after. Much to my submit it to and arts anew literature magazine, Strata Exit magazine --the reading circa 2011that Iapproached himafterthe show to convince him to In Icame fact, to know Peter astounded I was because so by his work at a that inno too: way shape or exist form as book akickback this does for labor. We exist inasystem where cronyism is ahuge problem, to speak and I’ll so return...so here Iam, happy loudmouth, the to be embarassing himI’m sure. to shout his gifts or achievementsfrom the rooftops orexpect anything in have enter this archive the alongside it --PMG is ahumble person, not one I felt it would remiss, be given OS’s the commitment to archive, the to not his hours than Ican count or comprehend. fully an infuriating and exhausting, process, thankless giving more of himself and Operating The thing called comradeSystemwhattrue in --a canbe times at But also, over last the years PMG has become an integral of part evolving this wholly of use original languagethe find will audience so deeplyit deserves. I have faith that with volume this his articulate, wry, timely observations and Peter Milne Greiner is an exceptional writer, thinker, and human and being, AND GRATITUDE TO ITS AUTHOR A NOTE ABOUT THISVOLUME - LDJ 11/16/17 5:41 PM | /// 147 /// 11/16/17 5:41 PM - WHY PRINT / DOCUMENT? WHY PRINT THE OPERATING SYSTEM, Brooklyn NY 2017 Brooklyn SYSTEM, THE OPERATING - Lynne DeSilva-Johnson, Founder/Managing Editor, Editor, Founder/Managing DeSilva-Johnson, - Lynne TION in the digital age. It’s a question of the archive, and of history: who gets gets who history: of and archive, the of question a It’s age. digital the in TION experiences our behaviors, our life, our of evidence what and story, the tell to into future the about nothing to little know can We behind? leaving we are can we — but trail document digital unprecedentedly an leaving we’re which and schools, museums, agencies, government publications, that assured be and digital a BOTH leave to will continue be that powers institutional other we? Will record. official the for production their of version print many up pull easily I can academic, time long and anthropologist a (rogue) As a of THE STORY — how experiences behaviors, lives, how about accounts correspondence, of study deep the using together pieced — was place or time in norm the longer no are which documents physical other and notebooks, digital towards behaviors creative our move we As practices. and lives many - tech future about predict we can what video, and audio even and taking, note – or told accurately will be stories our that assuring way any is in nology that record? the for things these leave will we How all? at told say: we documents these In STORY DIFFERENT A WE HAVE WE WERE HERE, WE EXISTED, The Operating System uses the language “print document” to differentiate differentiate to document” “print language the uses System The Operating - documen of act the distinguish to mission our of as part book-object the from - rep facing as a backwards publishing of act the from tation-in-book-FORM several last the appeared have may it as *role* agentive book’s the of lication as TECHNOLOGY: book the I approach Ultimately, history. its of centuries have humans that bound) case this (in documents printed of a variety of one stories, beliefs, ideas, disseminate and archive used to turn in and invented production. of evidence other and - print of restriction (or to access and presses printing use of and Ownership - rev to ways many in related struggle, of site a been long has materials) ed the over all speech and free civil rights for fight the and activity olutionary has landscape quotidian contemporary the countries) many (in While world. and information sharing for platforms to access its in shifted drastically indeed limited extremely with even digitally, “publish” to ability widespread the in - dimin not has media physical on publication of importance the resources, activist for history recent in time critical most the be may this fact, In ished. - encourag and establishing, learning, upon insist to others and artists, groups, out. me Hear practices. documentation community and personal ing this: about conversation a up open to wanted I endeavors print OS’s The With /DOCUMENTA PRINT creating of act transgressive radical, ultimately the LCHF_pmg_forreview.indd 147 LCHF_pmg_forreview.indd 148

\\\ 148 \\\ | TITLES INTHEPRINT: DOCUMENTCOLLECTION (trans. Margaret [2017] Randall) To Have There Alli Then / Estar Been Entonces -Randall Gregory agon -Judith Goldman [2017] Science The of Things Familiar - Johnny Damm [GraphicHybrid, 2017] ColorThe She Gave Gravity - Stephanie Heit [2017] Chely (trans. Lima Margaret [2017] Randall) What Werewolf the ToldLicantropoLes DijoEl Que Lo Them / - Rothenberg and Harold [2017] Cohen Flower World Variations, Edition/Reissue Expanded -Jerome sotor and me Mae -Connie Oliver Stitch -Jacklyn Janeksela; cosmos voyage apersonal by carl sagan ann druyan steven sp. -Susan Charkes; Poems Radio -Jeffrey Cyphers Wright; Fixing a Witch/Hexingthe featuring original cover by art Barbara Byers CHAPBOOK SERIES 2017:INCANTATIONS Secret-Telling -Jessica Bones Tyner Mehta [2017] -Joanna ofMary Seas the C.Valente [2017] Nothing Is Wasted -Shabnam [2017] Piryaei The - Furies Considine William [2017] ComandanteLa Maya -Rita Valdivia (dual language, trans. Margaret [2017] Randall) Love, Robot -Margaret Rhee[2017] An Exercise inNecromancy Imprint, -Patrick Poetry [Bowery Roche 2017] Book of TheBass [2017] Everyday Chloe - Instruction CityLost Hydrothermal Field -Peter Milne Greiner [2017] Fugue State -Filip Marinovich Beach [2017] One More Revolution -Andrea Mazzariello [2017] The UnspokenBob - Holman [2018] Singing for Nothing -Wally Swist [2018] AgainBorn -Ivy Johnson [2018] Israel Dominguez,(trans. Margaret [2018] Randall) Return Trip /Viaje Language Edition Dual Regreso; Al - Death is aFestival - Anis Shivani [2018] Jazzercise is aLanguage -Gabriel [2018] Ojeda-Sague Abandoners Ann Wheeler -Lesley [2018] [Anthology, 2018]Lynne DeSilva-Johnson and Jay Besemer, co-editors In Corpore Sano :Creative and Practice Body Challenged the of Sounds -MehdiThe Book Navid (Farsi dual language, trans. [2018] Tina Rahimi) Sharing Plastic -Blake Nemec [2018] Sussuros aMi Padre -Erick Sáenz[2018] Chlorosis -Michael Flatt and Mund Derrick [2018] An Absence Great So and Spontaneous It Is Evidence of Light -Anne [2018] Gorrick 11/16/17 5:41 PM | /// 149 ///

11/16/17 5:41 PM Resnikoff, Mikhl Likht Resnikoff, CHAPBOOK SERIES 2014: BY HAND SERIES CHAPBOOK Let it Die Hungry - Caits Meissner [2016] Meissner - Caits Die Hungry Let it MARILYN [2015] - Amanda Ngoho Reavey Ngoho [2015] - Amanda MARILYN Instructions Within - Ashraf Fayadh [2016] Fayadh - Ashraf Within Instructions CHAPBOOK SERIES 2013: WOODBLOCK SERIES CHAPBOOK Everybody’s Automat [2016] - Mark Gurarie [2016] - Mark Automat Everybody’s *featuring the quilt drawings of Daphne Taylor CHAPBOOK SERIES 2015: OF SYSTEMS OF SYSTEMS 2015: OF SERIES CHAPBOOK Spooky Action at a Distance - Gregory Crosby; - Gregory a Distance at Action Spooky Steinkraus Emma art by cover original *featuring CHAPBOOK SERIES 2016: OF SOUND MIND SOUND 2016: OF SERIES CHAPBOOK *featuring original prints from Kevin William Reed William Kevin from prints original *featuring Against the Value of Our Conclusions -Alexis Quinlan -Alexis Our Conclusions of the Value Against Executive Producer Chris Carter - Peter Milne Greiner; Greiner; Milne Chris Carter - Peter Producer Executive SAY/MIRROR [2015; 2nd edition 2016] - JP HOWARD edition [2015; 2nd SAY/MIRROR A GUN SHOW - Adam Sliwinski and Lynne DeSilva-Johnson; DeSilva-Johnson; Lynne and Sliwinski - Adam A GUN SHOW Arabic-English dual language edition; Mona Kareem, translator Kareem, Mona edition; language dual Arabic-English Ferris; - Alaina - Alex Crowley; Listening While Maps Improper How to Survive the Coming Collapse of Civilization [2016] - Sparrow Civilization Collapse Survive the of Coming to How Cyclorama - Davy Knittle; The Sensitive Boy Slumber Party Manifesto Manifesto Party Slumber Boy The Sensitive Knittle; - Davy Cyclorama Cheung - Stanford Needlework Seam or Any Longofono; - Peter Chords Pull, A Ballad - Maryam Parhizkar; Can You See that Sound - Jeff Musillo See - Jeff Sound that Can You Pull, A Ballad Parhizkar; - Maryam Strange Coherence - Bill Considine; The Sword of Things - Tony Hoffman; Tony - of Things Sword The - Bill Considine; Coherence Strange So Percussion in Performance with Ain Gordon and Emily Johnson [2016] Johnson Emily and Gordon Ain with in Performance So Percussion - Joseph Cuillier; Neptune Court - Anton Yakovlev; Schema - Anurak Saelow Schema - Anurak Yakovlev; Court - Anton Cuillier; Neptune - Joseph Moons Of Jupiter/Tales From The Schminke Tub [plays, 2014] - Steve Danziger Steve 2014] - [plays, Tub The Schminke From Of Jupiter/Tales Moons TEN FOUR - Poems, Translations, Variations [2015]- Jerome Rothenberg, Ariel Ariel Rothenberg, [2015]- Jerome Variations Translations, - Poems, TEN FOUR Talk About Man Proof - Lancelot Runge / John Kropa; An Admission as a Warning a Warning as Admission An Kropa; / John Runge - Lancelot Proof Man About Talk LCHF_pmg_forreview.indd 149 LCHF_pmg_forreview.indd 150

\\\ 150 \\\ | Based on whatBased supercilious ontology have we landed inaspace where we against vie other While we understand and acknowledge economic the pressures and fear-mongering creative people invain pursuit of credibilities fleeting the scarcitythe of economy, Here is adocument of born that belief, sown purely of imagination and will. Looking out acrossLooking theinvisible of vistas that country rhizomatic parallel to and respect acknowledge strength the of page the we now hold physical, First meant “instruction” or “evidence,” written whether or not. rather than freely collaborating and sharing openly with eachother  When intention we with mindful doso to address our process, athing inour hand… we remind ourselves that, like Dorothy: we havewe the to tools relinquish cooperative agency via means, to open our work to others, to create beauty inwords inspace, example, proof, from docre, to teach; see dek- in Indo-European roots.] [Middle English, precept, from Old French, from Latin documentum, synonyms -record -paper -deed -instrument -writing -act verb -record (something) inwritten, photographic, or other form information or as or an evidence official thatrecord serves noun -apiece of written, printed, or electronic matter that provides Who isresponsible for themanufacture of value? that threatens to dominate and creative the crush impulse, we can begin to see our to community see we begin can constraints, beyond fueled byfueled Source fires the Open the of Movement. resilient, proactive, collaborative organization. We print to make real, to our reify there. being the operatingsystem now more than ever that believe we than ever more also now we had the power all along, my dears. in ecstatic celebration of MAKING? intheplace where intention meets When we document we assert. the PRINT!DOCUMENT SERIES the troublethe with bartleby in collaboration with collaboration in әmnt/ /däky DOC UMENT is aprojectis of 11/16/17 5:41 PM