Characterization of the Beta-Karyopherin Protein Ipo9 Function

To my sister Lilliana, my mom Olga Lora-Cruz and my dad Victor Palacios-Flores

CHARACTERIZATION OF THE BETA-KARYOPHERIN PROTEIN IPO9 FUNCTION

DURING GERM CELL DIFFERENTIATION

VICTOR M. PALACIOS

DISSERTATION/THESIS

Presented to the Faculty of the Graduate School of Biomedical Sciences

The University of Texas Southwestern Medical Center at Dallas

In Partial Fulfillment of the Requirements

For the Degree of

DOCTOR OF PHILOSOPHY

The University of Texas Southwestern Medical Center at Dallas Dallas, Texas

December 2019

Victor M. Palacios, 2019

ACKNOWLEDGEMENTS

I would like to thank my mentor Michael Buszczak for give me the opportunity of join his lab, for all the support and guidance throughout my graduate school. Additionally, I want to give him a special thanks for helping me to improve my English and communication skills in general.

I would like to thank Nancy Street for her constant support since my first day at UTSW and her friendship. Special thanks to Arnaldo Carreria-Rosario and Mayu Inaba for helping me with everything during my graduate school even when they are at long distance and for their friendship.

I would like to thank the Buszczak lab members: Courtney Goldstein, Seoyeon Jang, Chunyang

Ni and Marianne Mercer for their advice, cooperation and friendship. I want to thank my thesis committee: Helmut Kramer, Joshua Mendell and Thomas Carroll for all their valuable input to my project. The GEMS group for being an excellent community for scientific discussion and their generosity in sharing reagents. The whole fly community for sharing reagents. I want to thanks the

Betran Lab members for helping me to characterize the Ipo9KO phenotype. I want to thank the

Molecular Biology Department for the resources, facility and ideal environment for science, specially the NA8 family.

I want to thank my special friends Varsha Bhargava, Berfin Azizoğlu, Upa, Victor Cruz and Francheska Barrios for sharing good times and hard times with me and for their great support.

I want to thank my family in Austin for always welcoming me, every Thanksgiving. Finally, I want to thank all my family back in Puerto Rico. I want to thank my sister, mom and dad for always believing in me.

CHARACTERIZATION OF THE BETA-KARYOPHERIN PROTEIN IPO9 FUNCTION

DURING GERM CELL DIFFERENTIATION

VICTOR M. PALACIOS, Ph.D.

The University of Texas Southwestern Medical Center at Dallas, 2019

Supervising Professor: MICHAEL BUSZCZAK, Ph.D.

Germ cells participate in the most fascinating process in nature, the fusion of two cells that ultimately give rise to an entire organism. Errors in germ cell development directly affect the fertility of the parent organism and/or the health of their offspring. A myriad of molecules such as transcription factors, signaling pathway effectors, chromatin modifiers and meiotic related proteins play fundamental roles during germ cell development. In order for these proteins to work they need to access the nucleus, through nuclear trafficking machinery. The karyopherin family of proteins is responsible for nuclear import and export. The contribution of nuclear

trafficking during gametogenesis is not well understood. Here we demonstrated that the well conserved β-karyopherin Importin-9 (Ipo9) is essential in the germline for proper gametogenesis in female and male flies. We generated a molecular null allele of Ipo9 and showed that Ipo9 is required in females for chromosome segregation during meiosis and the accumulation of nuclear actin during egg chamber development. Additionally, Ipo9 is essential during spermatogenesis for spermatid elongation, proper elimination of histones during the transition from histone-based to protamine-based chromatin packaging, import of proteasome components and chromosome segregation during meiosis. Lastly, at the molecular level, we showed that the N-terminal domain, which is critical for nuclear import, is required for Ipo9 function during gametogenesis.

Overall, this work advances our understanding of how nuclear trafficking regulates germ cell development.

TABLE OF CONTENTS

ACKNOWLEDGEMENTS……………………………………………………………………….v

ABSTRACT……………………………………………………………………………………...vi

TABLE OF CONTENTS………………………………………………………………………..viii

PRIOR PUBLICATIONS…………………………………………………………………………x

LIST OF FIGURES……..………………………………………………………………………...xi

LIST OF TABLES.……..………………………………………………………………….……xiii

LIST OF DEFINITIONS.……..……………………………………………………………...…xiv

CHAPTER ONE: Introduction to germ cell differentiation and nuclear trafficking…….....1

Germ cells………………………………………………………………….……………...1

Drosophila oogenesis………………………………..………………………….…………2

Drosophila spermatogenesis………………………………………………………………3

Nuclear transport in the germline………………………………………………………….4

CHAPTER TWO: Materials and Methods……………………………………….…………….6

CHAPTER THREE: Loss of Importin-9 affects Drosophila fertility……………………….14

Introduction………………………………………………………………………………14

Results……………………………………………………………………………………18

Ipo9KO flies exhibit females and males sterility……………………………………….....18

Ipo9KO flies show maternal-effect lethal……………………….………………………...20

Ipo9KO male flies exhibit azoospermia……………………………….………...………..23

Germline specific knockdown of Ipo9 exhibits a similar phenotype to Ipo9KO……...….25

The N-terminal domain of Ipo9 is essential for its function during gametogenesis…….27

viii

Discussion………………………………………………………………………………..31

CHAPTER FOUR: Ipo9 mutants show defects during spermiogenesis…………………….34

Introduction………………………………………………………………………………34

Results……………………………………………………………………………………36

Ipo9KO spermatids show mitochondrial morphology, DNA arrangement and centrosome

position defects at early stages during spermiogenesis……………………...….…..……36

Ipo9KO spermatids show defects in chromatin reorganization …...……………………...38

Ipo9KO spermatids fail to individualize ……………………………….………...……….46

Discussion……………………………………………………………………..…………47

CHAPTER FIVE: Ipo9KO exhibits defects in chromosome segregation during meiosis …..52

Introduction………………………………………………………………………………52

Results……………………………………………………………………………………53

Ipo9KO flies show a defect in DNA organization during prophase I, although structural components of the chromosome do not show obvious defects………………………..…53

Ipo9KO flies show defects in chromosome segregation during meiosis.…………………54 Discussion……………………………………………………………………..…………60 Bibliography…………………………………………………………………………………….62

PRIOR PUBLICATIONS

Eliazer S, Palacios V, Wang Z, Kollipara RK, Kittler R, Buszczak M. Lsd1 regulates the size of the ovarian germline stem cell niche through multiple mechanisms. PLoS Genet. 2014 Mar; 10(3): e1004200. doi: 10.1371/journal.pgen.1004200. PubMed Central PMCID: PMC3952827.

Mottier V, Palacios V, Eliazer S, Scoggin S, Buszczak M. The Wnt pathway limits BMP signaling outside of the germline stem cell niche in Drosophila ovaries. Dev Biol. 2016 Sep 1; 417(1):50- 62. doi: 10.1016/j.ydbio.2016.06.038. PMID: 27364467; PubMed Central PMCID: PMC5001506

LIST OF FIGURES

CHAPTER THREE

Figure 3.1 Using CRISPR/Cas9 to generated Ipo9 loss of function…………………………...... 19

Figure 3.2 Ipo9KO flies show fertility defects…...………………………………………….…….20 . Figure 3.3 Ipo9KO ovarioles do not exhibit defects………..……………………………….…….21

Figure 3.4 Ipo9KO embryos contain cells with DNA bridges and extra centrosomes……….…...22

Figure 3.5 Ipo9KO testes are unable to produce mature sperm…………………………………...24

Figure 3.6 Knockdown of Ipo9 in germ cells results in fertility defects……...………….….…...26

Figure 3.7 The N-terminal domain of Ipo9 is required for its function during gametogenesis.…29

Figure 3.8 Ipo9KO ovarioles show a reduction of nuclear actin………………..…………….…..30

CHAPTER FOUR

Figure 4.1 Ipo9KO spermatids show defects at the onion stage and comet stage………….……..37

Figure 4.2 Ipo9KO spermatids show defects in H2A and H2Av removal………………..……….40

Figure 4.3 Ipo9KO spermatids exhibit defect in histone ubiquitination…………………..………41

Figure 4.4 Ipo9KO spermatids show reduction of Prosα6T in the nucleus………………..……...42

Figure 4.5 Ipo9KO spermatids show reduction of Prosα2 in the nucleus…………………..…….43

Figure 4.6 Ipo9KO spermatids show reduction of Prosα3T in the nucleus………………...…...... 44

Figure 4.7 Ipo9KO nuclei do not show some histone modifications and nucleosome component during spermiogenesis………………………………………………………………...…...….…45

Figure 4.8 Ipo9KO nuclei are unable to individualize………………………………………….....46

CHAPTER FIVE

Figure 5.1 Ipo9KO does not show major defects in meiosis machinery during early oogenesis…56

5.2 Ipo9KO does not show any obvious defects in member of the cohesin and condensin………………..………………………………………………………………...……..57

Figure 5.3 Ipo9KO oocytes at metaphase I show defects in chromosome orientation……………58

Figure 5.4 Ipo9KO spermatids exhibit chromosome segregation defects………………..……….59

LIST OF TABLES

Table 3.1 Drosophila genes containing Importin-beta, N-terminal domain…………………...…17

xiii

LIST OF DEFINITIONS

αkap4- α Karyopherin-4

CB- cystoblast

C(3)G- crossover suppressor on 3 of Gowen

C(2)M- crossover suppressor on 2 of Manheim

FISH- fluorescence in situ hybridization

GSCs- germline stem cells

Glu- gluon

HA- Human influenza hemagglutinin

HEAT- Huntingtin, elongation factor 3, protein phosphatase 2A, and the yeast kinase TOR1

H2A- Histone H2A

H2Av- Histone H2A variant

Hts- Hu li tai shou

Ipo9- Importin-9 kap-α1- karyopherin α1 kap-α3- karyopherin α3 kap-α2- karyopherin α2

NLS- nuclear localization signal

NPC- nuclear pore complex

Prosα3T- Proteasome α3 subunit, Testis-specific

Prosα2- Proteasome α2 subunit

Prosα6T- Proteasome α6 subunit, Testis-specific

xiv

RNAi- RNA interference

SMC1- Structural maintenance of chromosomes 1

Solo- sisters on the loose

Sunn- sisters unbound

SC- synaptonemal complex

CHAPTER ONE Introduction to germ cell differentiation and nuclear trafficking

Germ cells

Germ cells participate in the most fascinating process in nature, the fusion of two cells that ultimately give rise to an entire organism. In organisms that reproduce sexually, germ cells carry the genetic material to the next generation. During their maturation, germ cells go through a specialized cell division called meiosis that is characterized by one cycle of DNA replication followed by two rounds of division. Meiosis reduces the genetic material of a cell to a single copy of each chromosome, producing haploid gametes. When the sperm and egg fuse during fertilization, the chromosome number is restored to a diploid state. Error in germ cell development directly affect the fertility of the parent organism and/or the health of their offspring. The process of cytokinesis, or cell division, requires the equal segregation of chromosomes to each resulting daughter cell. Mutations that disturb chromosome segregation during meiosis result in eggs or sperm with an incorrect numbers of chromosomes (aneuploidy).

If aneuploid germ cells fuse, the fertilized eggs and the ensuing embryos may have three copies of a chromosome, trisomy, or a single copy of a chromosome, monosomy, both of which can have devastating consequences during development. In addition to DNA, the gametes or germ cells carry energetic resources, proteins, mRNAs and cell organelles to support the embryo until developmental regulation comes under zygotic control (Stetina and Orr-Weaver, 2011). Current research to identify and define the function of new genes involved in germ cell development will help to improve clinical diagnosis and treatment of infertility and diseases associated with malformed germ cells.

Germline development cannot be studied in humans because of ethical, moral and technical restrictions. Consequently, this process is best understood in model organisms.

Although the origin and timing of germ cells varies among species, many of the steps that lead to the formation of mature gametes are highly conserved across species. The reproductive system of Drosophila presents an excellent platform to identify new genes involved in germ cell differentiation due to its well-defined anatomy and our ability to employ genetic tools to manipulate gene function in the gonads. Additionally, in female Drosophila, maturation of the oocyte until prophase I occurs throughout adulthood, while in mammals this process happens during embryogenesis, making it more challenging to study (Stetina and Orr-Weaver, 2011).

Drosophila oogenesis

Oogenesis is the process of forming a mature egg cell. This process occurs in the female gonads, called ovaries. Each adult female fly has a pair of ovaries. Each ovary is composed of

16-20 individual ovarioles. Ovarioles are like egg assembly lines, where the germline stem cells

(GSCs) are located at the most anterior part and the maturing eggs are at the most posterior part.

At the tip of the ovariole is a region called the germarium; this is the home of the GSCs (Eliazer and Buszczak, 2011). Two to three GSCs reside next to the niche (Xie and Spradling, 2000).

The niche is composed of two types of somatic cells called the cap cells and terminal filament cells. When the GSCs divide, one daughter remains as a GSC, while the other daughter becomes the precystoblast. The cystoblast (CB) goes through four mitotic divisions without complete cytokinesis to form a 16-cell cyst (Eliazer and Buszczak, 2011). The cells within the cyst share cytoplasm and are also interconnected by a germline-specific endoplasmic reticulum (ER)-like structure called the fusome (Cuevas and Spradling, 1998). The cyst is wrapped by the escort cells before it enters meiosis. Only one cell of the 16-cell cyst enters meiosis to become the oocyte and the remaining 15 cells become nurse cells. While the cyst is going though meiosis it

3 becomes surrounded by another type of somatic cell, called follicle cells. As the germ cell cyst exits the germarium, it gets encapsulated by follicle cells to form an egg chamber with the oocyte at the posterior side. The nurse cells go through several endoreplications and provide nutrients, mRNAs, protein and organelles to the developing oocyte throughout oogenesis (Spradling,

1993). The oocyte is arrested at prophase I and remains diploid for most of the time during oogenesis. After meiotic maturation, the Drosophila oocyte arrests for a second time at metaphase I for ~1.5 days. Then, egg activation and completion of meiosis happens while the egg is being laid by mechanical stimulation via passage through the oviduct and rehydration

(Stetina and Orr-Weaver, 2011).

Drosophila spermatogenesis

Similar to Drosophila ovaries, Drosophila testes offer a powerful system to study spermatogenesis. Each adult male fly possesses a single pair of testes. The Drosophila testes provide the advantage of presenting all stages of male germ cell differentiation in a spatiotemporal organized manner. The structure of Drosophila testis resembles a coiled tube, where at the apical end are the GSCs. There are approximately 10 GSCs around the hub cells. The hub cells act as a niche for the GSCs in the testes (Kiger et al., 2001; Tulina and Matunis, 2001). At the most basal end of the tube are the mature sperm. Across species, male germ cells experience similar dramatic changes in size and shape during maturation, suggesting that these processes are controlled through conserved mechanisms. These morphological changes during spermatogenesis are used to mark different stages of germ cell differentiation. The differentiation process starts when the GSCs divide asymmetrically and give rise to the gonialblast, which is enveloped by two somatic cyst cells. These somatic cyst cells have a function analogous to the Sertoli cells of the mammalian

4 testes (White-Cooper, 2010). The Drosophila gonialblast goes through four incomplete mitotic divisions to form 16 spermatogonial cells. The 16 cells are interconnected by intercellular bridges called ring canals and the fusome, similar to the female germ cells. After mitotic division, the 16 cells enter pre-meiosis, where they grow and transcribe most of the genes needed for sperm formation (White-Cooper, 2010). Cells then enter meiosis where two rounds of cell division with incomplete cytokinesis give rise to 64 interconnected haploid cells. After meiosis is completed, these haploid cells enter a phase known as the onion stage. In the onion stage, the round spermatids are paired with individual hyperfused mitochondria (nebenkern) (Demarco, 2014). The nuclei, then go through an elongation process, followed by tail formation and nuclear exchanges. During this phase the sperm goes through a unique process where they transition from histone-based to protamine-based chromatin (Rathke et al, 2014). Although many players have been identified in this conserved process, we still do not know how and where histones are degraded and how this process is coordinated. In the last step to complete spermatogenesis, sperm form their own membranes in a process called individualization. They then travel toward the open end of the testis to take residence in the seminal vesicle for storage.

Nuclear transport in the germline

A myriad of molecules such as transcription factors, signaling pathway effectors, chromatin modifiers and meiotic related proteins play fundamental roles during germ cell differentiation. In order for these proteins to work, they need to access the nucleus through nuclear trafficking machinery. The karyopherin family of proteins is responsible for nuclear import and export. Karyopherins are generally separated into two groups, α-karyopherins and β-karyopherins.

The α-karyopherins function in nuclear import, while β-karyopherins have roles in nuclear import

5 and export (Lange et al., 2007). Although, the contribution of nuclear trafficking during gametogenesis is not well understood, differential expression of nucleocytoplasmic transport machinery during gametogenesis suggests that nuclear trafficking may be involved in many steps of gamete formation. (Loveland et al., 2006; Whiley et al., 2010; Major et al., 2011).

Accumulating evidence shows that karyopherins are directly linked with gonad development and infertility. For example, embryonic female gonad exposure to leptomycin B, an inhibitor of the exportin Emb/Crm1, results in partial formation of the testis cord-like structure

(Gasca et al., 2002). Additionally, the β-karyopherin importin 13 (IPO13) is transcribed at high levels during early meiosis in males and females. Knockdown of IPO13 affects germline progression through meiosis due to reduction of the SUMO-conjugating enzyme UBC9 in the nucleus. UBC9 has been shown to be essential for proper meiosis (Yamaguchi et al., 2006).

Further, the β-karyopherin importin 4 is responsible for the import of the transition protein 2 into the nucleus, which is required for sperm maturation (Pradeepa et al., 2008). Interestingly, whole body mutants of the α-karyopherins kap-α2 and kap-α1 or the β-karyopherins apl and arts, exhibit sterile phenotypes in one sex, or in some cases for both sexes (Mason et al., 2002; Pradeepa et al.,

2008; VanKuren et al., 2018). All these results highlight the central role of the nuclear transport pathway during germ cell development. Because the nuclear transport pathway is highly conserved, a better understanding of nuclear trafficking during germ cell development in

Drosophila will provide molecular insights into human fertility. In this thesis, I will present work that uses the power of Drosophila genetics and germ cell development to study how importins regulate germ cell development. Specifically, my project aimed to understand the role of the β- karyopherin, Importin-9, during germline differentiation.

CHAPTER TWO Materials and Methods

Fly Stocks

Fly stocks were maintained at 220C–250C on standard cornmeal-agar-yeast food. The following stocks were used in this study: W1118 (BL-6326), His2Av-mRFP1 (BL-23650), ProtamineB-eGFP

(BL-58406), Matalpha-gal4 (BL-80361 IIchr and IIIchr), triple-Nos-gal4 (BL-31777). UASp-HA-

Ipo9FL and UASp-HA-Ipo9ΔN was inserted into attP40(BL-25709) using phiC31 integrase

(Rainbow Transgenics). Vasa-gal4 was a gift from Y. Yamashita. Prosα6T-EGFP, Prosα3T-

EGFP and Prosα2-EGFP were gifts from Dr. John Belote. UASp-Sunn-GFP and UASp-Solo-GFP were gifts from Dr. Bruce D. McKee.

Cloning Ipo9

RNA was extracted from W1118 ovaries and made into cDNA using a SuperScript II-Strand Kit

(Life Technologies). We next performed PCR using Ipo9FL specific primers

(F5'CACCATGTCGCTGCAATTCCAAAACG and R5'CTACTTCTGCTGGACCTTGCTG)

To generate Ipo9ΔN(36-144aa) we performed PCR using these primers (F5’

(CACCATGTCGCTGCAATTCCAAAACG and R5'TTCTGTCTGCTGCAGGACTCC first &

R5'GAGGAGCGTATCTTTGAATTGGGTTCTGTCTGCTGCAGGACTCC second) for fragment 1 and (F5'CCCAATTCAAAGATACGCTCCTC and

R5'CTACTTCTGCTGGACCTTGCTG) to generate fragment 2. Then PCR SOE was performed to stitch fragment 1 with fragment 2.

PCR products were cloned into pENTR (Life Technologies) and swapped into pAHW (Drosophila

Gateway Vector Collection) using an LR reaction.

Generating the Ipo9KO Allele

To generate the Ipo9KO allele, guide RNAs were designed using http://tools.flycrispr.molbio.wisc.edu/targetFinder (Guide1

5'CTTCGCGCTATCACATGTAGTCAA/5'AAACTTGACTACATGTGATAGCGC and Guide2

5'CTTCGGTGGACAGAAAGTTGAGTA/5'AAACTACTCAACTTTCTGTCCACC) and synthesized by IDT as 5’ unphosphorylated oligonucleotides, annealed, phosphorylated, and ligated into the BbsI sites of the pU6-BbsI-chiRNA plasmid (Gratz et al., 2013). Homology arms were PCR amplified and cloned into pHD-dsRed-attP (Gratz et al.,2014) (arm1

F5'GCTACACCTGCATGCTCGCGTTCATGTGCAAGCGCAAGTC,

R5'GTCACACCTGCACTGCTACAACGGGCGTTTTGCAAGACTG arm2

F5'CGTAGCTCTTCGTATCAACTTTCTGTCCACCGTTCC)(Addgene). The pHD-dsRed-attP vector was cut with the enzymes AarI and SapI. Guide RNAs and the donor vector were co-injected into nosP Cas9 attP40 embryos at the following concentrations: 250 ng/ml pHDdsRed-attP donor vector and 20 ng/ml of each of the pU6-BbsI-chiRNA plasmids containing the guide RNAs

(Rainbow Transgenics).

PCR verification of Ipo9KOdsRed

Primers for PCR1 Ipo9Aar1outF5' CAAGCCGCAAATGATGCTGCTG and dsRedstartR5'

CATGAACTCCTTGATGACGTCCTC. PCR2 dsRedendF5'GACTACACCATCGTGGAGCAG and

Ipo9Sap1outR5'CTTTGCCTTTGGCTCAGAGAAGC.

Internal primers Exon2F5'GGAACTGGGTCCAGTAGTCATAC3' and

Exon5R5'GAGGTGGAGATTCTTGATGCAC3'.

Immunofluorescent staining in ovaries, testes and embryos

Ovaries and testes were dissected in Grace's Medium. Ovaries and testes were fixed for 10 minutes with gentle rocking in 4% formaldehyde in PBS. Fixed ovaries and testes were briefly rinsed three times and permeabilized in PBST (PBS + 0.3% Triton X-100) at room temperature for 1hr before adding primary antibody.

Drosophila embryos were stained according to (Mani et al., 2014). Embryos were dechorionated in 50% bleach for 2-3mins. Then embryos were rinsed in 1XPBS 2 times. Embryos were fixed in 50% heptane and 50% fixative solution (3 parts fixative solution, 1.33X PBS and 67 mM EGTA:1part 37% formaldehyde) for 10min. After fixation, aqueous phase (bottom) the fix was removed and replace with an equal volume of 100%methanol. Then the embryos were vortexed rigorously for 1-2mins. Embryos were rinsed with 100% methanol 2 times. Then embryos were either stored at -200C or rehydrated. To rehydrate, embryos were washed in a series of

70%MeOH: 30%PBST, 50%MeOH: 50%PBST, 30%MeOH:70% PBST and finally 100% PBST for 20 min each. Then embryos were blocked in 5% normal goat serum for 1hr at RT.

Incubation with primary antibody was in 3% bovine serum albumin (BSA) in PBST at 4

°C at least for 20hrs. Samples were washed three times for 20 min in PBST, incubated with secondary antibody in 3% BSA in PBST at room temperature for 3–5 hrs and then washed three times 20 min each in PBST. Samples were mounted in VectaShield mounting medium with DAPI

(Vector Laboratories). The following antibodies were used (dilutions noted in parentheses): mouse anti-Hts (1B1) (1:20), rat anti-VASA(1:20), mouse actin-JLA20(1:10) and LaminC- LC28.26

(1:10) (Developmental Studies Hybridoma Bank, Iowa), mouse actin-C4(1:100 MAB1501

Millipore Sigma) rat anti-HA 3F10 (1:100; Roche), rabbit anti-GFP(1:1000 Molecular Probes), rat alpha-Tub (1:100 YL1/2 Abcam), mouse anti-γ-tubulin (1:100;GTU-88, Sigma), chicken anti-

GFP (1:1000 Novus Biological) mouse anti-ubiquitin (1:100 (P4D1)Cell Signalling), rabbit acetyl anti-H3K9(1:1000, Cell Signalling) rabbit acetyl anti-H3K18(1:1000, 1:1000, Cell Signalling) rabbit acetyl anti-H3K23(1:1000, Cell Signalling) rabbit 1:1000, Cell Signalling) acetyl anti-

H4K8(1:1000 1:1000, Cell Signalling) rabbit anti-H2A(1:2000, from Dr. Robert L. Glaser Lab)

(rabbit anti-ISWI (1:100, from C. Peter Verrijzer), rhodamine phalloidin (1:200, R415 300U

Invitrogen); Cy3, Cy5, FITC (Jackson Laboratories) or Alexa 488 (Molecular Probes) fluorescence-conjugated secondary antibodies were used at a 1:200 dilution. Images were taken using a Zeiss LSM800 confocal microscope with a 40× oil immersion objective and processed using Image J.

Phase Contrast Microscopy of Live Testes (Helen White-Cooper., 2004)

1. Dissect testes from a newly eclosed male in fresh testis buffer (Testis buffer: 183 mM KCl, 47 mM NaCl, 10 mM Tris-HCl, pH 6.8 or TB1: 15 mM potassium phosphate (equimolar dibasic and monobasic), pH 6.7, 80 mM KCl, 16 mM NaCl, 5 mM MgCl2, 1% polyethylene glycol (PEG)

6000 (0–1 d old).

2. Place a drop of testis buffer on a clean microscope slide, using the surface tension of the buffer to transfer the testes to this drop.

3. Open up the testes by cutting the apical side with the forceps

4. Place a clean cover slip over the testes; this will gently squash the cells

Fertility Assays

3-7day old males and virgin females of the appropriate genotype were mated in mating cages with grape juice (3%) agar plates with a little bit of wet yeast. The flies were allowed to lay eggs for

12-24hrs at 22-250C.

Western blots

For protein extraction ovaries from fatten flies were dissected in Grace’s medium, physically disrupted and extracted with sample buffer with 20% BME using pestle followed by boiling at

900C for 10 minutes. Protein electrophoresis and wet transfer systems were used. After running the SDS-PAGE gel, the proteins were transfer to an Amersham Hybond ECL nitrocellulose membrane (GE Healthcare, RPN2020D). For blotting, the following primary antibodies were used in fresh PBST buffer (1XPBS with 0.1%Tween20 and 5% Biorad non-fat milk): mouse anti-

ActinJLA20(1:100), mouse anti-ActinC4 (1:1000 MAB1501 Millipore Sigma) and mouse anti-

HA (1:1000 5B1D10 ThermoFisher). After overnight incubation at 40C, the membranes were washed for 20mins three times in PBST buffer without milk before incubating with secondary antibodies for 2 hours at RT. HRP-conjugated anti-mouse and anti-rat secondary antibodies

(Jackson Laboratories) were used at a 1:2000 dilution. After incubation and three more washes of

20mins each, the membranes were incubated with ECL Western Blotting Detection Reagents (GE

Healthcare, RPN2106).

FISH

(A protocol adapted from the Fox lab was used with oligopaints (Beliveau et al., 2014; Beliveau et al., 2015; Beliveau et al., 2012). Oligos with fluorophores were ordered from Integrated DNA technologies.)

1. Dissect tissue and fix as desired.

2. Make sure you have one 600C and one 780C water bath ready. For squashes, submerge a metal block in the 780C water bath, but make sure that the top edge of the block is just barely above the water. Tube filled with 2X SSCT/50% formamide at 600C. Steps 3-9 are done at room temperature.

3. Wash 1X in 1X PBS for 1 min

4. Wash 1X in PBS + Tween (100 uL Tween for every 100 ml 1X PBS) for 1 min 5. Wash 1X in PBS + Triton (250 uL Triton for every 50 ml 1 X PBS) for 10 min

6. Wash 1X in PBS + Tween (100 uL Tween for every 100 ml 1X PBS) for 1 min

7. Wash 1X in .1N HCL for 5 min

8. Wash 3x in 2X SSCT for 2 min each

9. Wash in 2X SSCT/50% Formamide for 5 min

10. Wash 2X SSCT/50% Formamide at 600C for 20 min

11. During step 10, prepare hyb mix. For each sample, mix 12.5 uL 2x hyb cocktail, 12.5 uL formamide, 1 uL 10mg/ml RNase. To each of these hyb mixes, add desired probe. A total of 20-

30pmol of oligopaint probe is typically sufficient for squashes, 10X more for whole mount. Mix probes with hyb mix by vortexing and then spinning down. Protect from light until needed.

12. Add hyb mix with probe to each sample:

13. Denature the sample by incubating at 780Cfor 2.5 minutes.

14. Transfer denatured samples to a 420C water bath overnight.

15. Place a coplin jar (squashes) or epp tube (whole mount) filled with 2X SSCT/50% formamide at 600C.

16. Wash in 2X SSCT/50% formamide at 600C.

17. The remaining steps are done at room temperature in the dark. Wash in 2X SSCT/50% formamide for 10 min (3X times)

18. Wash in .2X SSC for 10 min (3X times)

19. Incubate in DAPI

20. Mount as you normally would.

Recipes:

Hyb mix : 10ml- 4ml 50% dextran sulfate solution, 2ml 20X SSC, 4ml ddH2O. Store up to 1 year at room temp.

SSC, 20X: for 1L, dissolve 175.3 g NaCL and 88.2 g sodium citrate in 800ml ddH2O. Adjust pH to 7.0 with 1M HCl, then add ddH2O to 1L. Store up to 1 year at room temp.

SSCT, 2X: dilute 20X SSC 1:10 and add 1ml Tween

Probes: X- 5Cy3/TTTTCCAAATTTCGGTCATCAAATAATCAT Y-5Alexa488N/AATACAATACAATACATTACAATACAATAC 2- 5Cy5/AACACAACACAACACAACACAACACAACAC Oocytes preparation for meiosis I (according to Sarah Radford and Kim Mckim., 2016).

Prepare Flies

Metaphase-enriched Oocyte Collections.

1.Collect ~30 females from stock or cross cultures. Add a dab of yeast paste to the side of a vial and place 30 females each (with no males added) into the yeasted vials. Age vials for three to five days at 250C.

2.Dissect ovaries in flies in 1XPBS solution at RT.

3.Fixation

Aspirate off all liquid and immediately add 0.5 ml Fix.

Fix for 2.5 min on a nutator. Add 1 ml heptane and vortex 1 min. Let settle ~1 min.

Remove all liquid, and then add 1 ml 1x PBS. Vortex 30 sec. Let settle ~1 min.

Remove all liquid, and then fill tube with 1x PBS.

4. Removing Membranes ("Rolling")

Using coated Pasteur pipet, add 3 to 4 pairs of ovaries to a glass slide. Separate the individual ovarioles using forceps. Do not let oocytes dry out; add 1x PBS as necessary.

Place a coverslip on top of the oocytes and gently "roll" oocytes until all membranes are removed

(dragging the edge of the coverslip across the oocytes works best.) Periodically check progress under the microscope, adding more 1x PBS as necessary. Take care as too much pressure will destroy the oocytes.

5. Continue protocol for Immunofluorescent staining or FISH

Fixation Solution

Prepare formaldehyde/heptane fixation. Prepare Fixation Buffer: 1x phosphate-buffered saline

(PBS) plus 150 mM sucrose. To use, make fresh with 687.5 μl Fixation Buffer and 312.5 μl 16% formaldehyde sample.

CHAPTER THREE Loss of Importin-9 affects Drosophila fertility

Introduction

Karyopherin proteins transport cargoes between the cytoplasm and the nucleus in eukaryotic cells. In the eukaryote cell, the nuclear membrane acts as a barrier between the nucleus and cytoplasm. Molecules less than ~40-60KDa can passively move through the nuclear pore complex (NPC). However, larger molecules require active transport and binding to the karyopherin proteins (Fried and Kutay, 2003; Mahipal and Malafa, 2016). β-karyopherin can transport cargoes either by a direct interaction with the cargo or by using importin-α as an adaptor to indirectly attach to their cargo. Importin-α proteins generally recognize the classical nuclear localization signal

(NLS) within proteins. The NLS is a short positively charge motif in proteins that “tags” them for nuclear import. In Drosophila, the importin-α proteins include kap-α1, kap-α3, pen/kap-α2 and

αkap4 (flybase.org). The β-karyopherin proteins are characterized by having an importin-beta N- terminal domain that binds to the Ran GTPase and a C-terminus that is mostly composed of

"HEAT repeat" motifs. The interaction between RanGTP and β-karyopherin dictates in which compartment a given receptor will bind or release its’ cargo (Fried and Kutay, 2003). In the nucleus, β-karyopherin binds to GTPase, which induces a conformational change that causes release of the cargo. However, in the cytoplasm, hydrolysis of the GTP causes dissociation of the karyopherin, making the karyopherin available to bind to their substrates. The HEAT motifs assume different conformations to facilitate the accommodation of their binding partners. Yeast contains 14 β-karyopherin proteins, while humans have at least 20 β-karyopherin members, each functioning in distinct aspects of nuclear import, export or bidirectional transport (Quan et al.,

2008; Tran et al., 2007). Within β-karyopherin members in human, 10 are nuclear import receptors

(Trn1, 2, R 3, Imp 4, 5, RanBP5, 7, 8, 9, and 11); 7 are export receptors (CRM1/ Exp-1,

CAS/CSE1L/exportin-2, 5, 6, 7, t, and RanBP17); 2 are bi-directional receptors (Imp-13 and Exp-

4), and the function of RanBP6 is undetermined (Kimura and Imamoto, 2014).

Accumulating evidence suggests that β-karyopherin proteins may be involved in a specific process in multicellular organisms and not merely function as housekeeping genes. Additionally, some of the β-karyopherin proteins have been associated with diseases. The specificity of the β- karyopherin for the cargoes can come from their expression pattern or their ability to interact with a specific set of cargoes (Plafker and Macara et al., 2002; Quan et al., 2008; Major et al., 2011;

Gontan et al., 2009; Kimura and Imamoto, 2014). For example, in adult mouse and rat testes, importin-β1 expression was detected in spermatogonia and spermatocytes only. By contrast, importin-β3 expression was restricted to elongating spermatids (Loveland et al., 2006). Histones can bind to multiple β-karyopherins. However, the affinity and recognition sites vary within the β- karyopherins. For example, the H3 tail binds Kapβ2 and Imp5 very strongly and binds Impβ, Imp4,

Imp7, Imp9 and Impα weakly. Furthermore, mutagenic analysis shows H3 tail residues 11–27 to be the sole binding segment for Impβ, Kapβ2, and Imp4. However, Imp5, Imp7, Imp9, and Imp bind two separate elements in the H3 tail: the segments at residues 11–27 and at residues 35–40

(Soniat et al., 2016). Additionally, in a study of 12 β-karyopherins, a group of 468 cargoes were identified. Three hundred and thirty two of these 468 cargoes are unique to one β-karyopherin, which clearly suggests a division of roles among the β-karyopherin family (Kimura et al., 2015).

Moreover, evidence shows that β-karyopherin are overexpressed in multiple tumors including melanoma, pancreatic, breast, colon, gastric, prostate, esophageal, lung cancer, and lymphomas

(Turner et al., 2012; Fujii et al., 2018). Additionally, some of the karyopherin-β proteins such as exportin-1 have been implicated in drug resistance in cancer (Turner et al., 2012; Turner et al.,

2014; Mahipal and Malafa, 2016).

The Drosophila genome encodes 16 genes that carry an importin-beta domain within their

N-terminal domain, including an obvious homolog of ranbp9/CG5252. Ranbp9 is also known as importin-9, imp9 and Ipo9. Hereafter, I will refer to ranbp9 as Ipo9 (Table 3.1). To start our analysis of Ipo9, we looked at the available public RNAseq data set. At the mRNA level, Ipo9 shows high expression in ovary, testis and imaginal discs during L3, but low expression for most of the other tissues in Drosophila (flybase.org). Similar to Drosophila, Ipo9 shows high expression in rat gonads and low expression for most of the other tissues (Kortvely et al., 2005). Results of studies done in cell lines and in vitro systems, show that Ipo9 can import a variety of cargoes including the core histone proteins H2A, H2B H3 and H4 (Mühlhäusser et al., 2001; Padavannil et al., 2019), ribosome proteins such as RpS7, RpL18a, RrpL4 and RpL6 (Jakel et al., 2002), transcription factors such c-Jun, Sox2, ARID3A and the homodoimain Arx protein (Waldmann et al., 2007; Gontan et al., 2009; Liao et al., 2016; Lin et al., 2009). Additionally, it has been shown, that Ipo9 mediates nuclear actin import (Dopie et al., 2012; Belin et al.,2015). Finally, the most recent work from the Kimura group validated previous published work and expanded the list of

Ipo9-cargoes. They identified many ribosome proteins and proteins that are important for DNA packaging or nucleosome organization as Ipo9-cargoes (Kimura et al., 2015). In spite of the effort to identify cargoes of Ipo9, the role of Ipo9 in the context of multicellular organisms is largely unexplored. Studies in multicellular organisms can reveal if a protein is necessary for a particular tissue function, cell type, process or developmental stage. Because of the enrichment of Ipo9 in the gonads, we hypothesized that Ipo9 may play an important role in germ cell development.

gene Ovary Testis Importin/ Loss of function in Drosophila flies expression expression Exportin CG8219 0 52 Exportin (RNAi-knockdown) increased of Fus in the nucleus, in motor neuron and saliva gland (Jäckel et al., 2012) Impβ11/ 13 53 Importin (Mutant) died as late pupae from neuronal defects ipo11 (Insertion over Df) Lethal (Higashi-Kovtun et al., 2010; Kahsai et al., 2016) Ranbp16/ 11 8 Exportin Unknown no/extremely low Xpo7 expression (0 - 0) Apl/Imp4/5 10 29 Importin (Mutant) male sterile, partially lethal very low expression (1 - (VanKuren et al., 2018) 3) Ranbp21/ 51 24 Exportin Unknown low expression (4 - 10) Exp5 moderate expression (11 Msk/ 383 29 Importin/ (Mutant) death at late - 25) Imp7/8 Exportin embryos or early larvae moderately high (Mutant) snRNP assembly factor, survival motor expression (26 - 50) neuron, and the Cajal body marker, coilin. high expression (51 - (Baker et al., 2002; 100) Natalizion & Matera., 2013) very high Emb/ Crm1 71 5 Exportin (recessive lethal mutation) expression (101 - 1000) develop until L2 (Collier et al., 2000) extremely high Fs(2)Ket/ 116 22 Importin (Mutant) zygotic lethal expression (>1000 imp-β/ (Lippai et al., 2000) KPNB1 CG7398 74 5 Importin (RNAi-knockdown) increased of Fus in the nucleus, Tnpo/Tnpo1 in motor neuron and saliva gland /2 (Jäckel et al., 2012) Cse1/Dcas 66 5 Exportin (mutant) lethal (Hypomorphic allele) female sterile (Tekotte et al., 2002) Arts 30 5 Importin (Mutant) female sterile, defect in egg production (VanKuren et al., 2018) Cdm/ipo13 16 2 Importin (Mutant) lethal late third-instar lethality clones- affects muscle growth and formation of the subsynaptic reticulum (Giagtzoglou et al., 2009) Ebo/Xpo6 26 3 Exportin (Mutant) affect ring neurons (Ilius et al., 2009) Tnpo-SR/ 10 5 Importin/ Unknown TNPO3 Exportin Karyβ3/ 89 119 Importin (Mutant-insertion) lethal at the early larval stage CG1059 (Tsubouchi et al., 2012) Ipo9 58 51 Importin Unknown

Table 3.1 Drosophila genes containing Importin-beta, N-terminal domain

Results

Ipo9KO flies exhibit female and male sterility In an effort to have a better understanding of germ cell biology, our lab conducted a

CRISPR/Cas9 loss of function screen of genes that exhibit enriched expression in Drosophila gonads. Ipo9 fulfilled the criteria of our screen. Ipo9 shows high expression in the Drosophila gonads and low expression in most other tissues and it is conserved across species. There were not null alleles of Ipo9 available at the time of our initial study. To generate a null allele for Ipo9, we used a Gene Editing CRISPR/Cas9 strategy (Gratz et al., 2013; Gratz et al., 2014) (Fig. 3.1A). The guides used to generate the Ipo9 mutant target the beginning of exon1 and close to the end of exon5 in order to delete almost the entire coding sequence of Ipo9. The gene ORF will be replaced by a 3xP3-dsRed cassette. The 3xP3 drives the expression of the dsRed protein in eyes, which allows us to detect the presence of the insertion by an easily identifiable fluorescent eye phenotype.

A combination of primers inside and outside of the Ipo9 region and on the dsRed were used to verify that the donor cassette was inserted correctly (Fig. 3.1). Ipo9KO flies are homozygous viable and do not show any obvious phenotypes in a lab setting. This is very different from the observed phenotypes of many mutants in the β-karyopherin family (Table 3.1). However, we could not generate a homozygous mutant stock, suggesting that the fertility of Ipo9KO flies was compromised. We tested whether Ipo9KO affected female and/or male fertility by crossing them to wild-type w1118 flies. An average of 85% of eggs laid by w1118 flies hatched when they were crossed with w1118 males. However, 0% of the eggs laid from Ipo9KO females flies hatched when they were crossed with w1118 males (Fig. 3.2A). As well, 0% of the eggs laid from w1118 female flies hatched when they were crossed with Ipo9KO homozygous males (Fig. 3.2B). From these experiments we concluded that the Ipo9KO allele that we generated exhibits a female and male sterile phenotype.

Fig 3.1. Using CRISPR/Cas9 to generated Ipo9 loss of function. (A) Schematics of knock-in 3xP3-dsRed cassette to replace the majority of Ipo9 sequence. (B) PCR verification of knock-in of 3xP3-dsRed cassette in Ipo9 locus to generated Ipo9KO allele.

A) B)

Fig 3.2. Ipo9KO flies show fertility defect. (A) Percentage of hatching eggs after 5 days of being laid by w1118 or Ipo9KO females crosses with w1118 males (approximately 20 females and 10 males, 3-7 days old were in each cage). (B) Percentage of hatching eggs after 5 days of being laid by w1118 females crosses with w1118 (control) or Ipo9KO males (around 20 females and 10 males, 3-7 days old were in each cage).

Ipo9KO flies show maternal-effect lethality In an effort to understand the reason why eggs laid by Ipo9KO females did not hatch, we performed immunohistochemistry to analyze germ cell development. Staining was performed with the germline markers Vasa, an RNA helicase, and Hts (1B1), which labels a germline-specific endoplasmic reticulum-like structure called the fusome and the membranes of somatic follicle cells. The fusome is round in the germ line stem cells (GSCs) and the cystoblasts and becomes branched in the 2,4,8 and 16 cell cysts. We did not observe any obvious differences between Ipo9KO and w1118 ovarioles when staining with these markers (Fig. 3.3).

We next decided to evaluate the eggs laid by Ipo9KO female flies in more detail. We stained for Alpha-Tubulin to label microtubules and centrosomes and DAPI to label DNA. We analyzed embryos laid within a 10 to 60 minutes time period. This strongly showed that eggs laid by Ipo9KO female flies can be fertilized. However, none of the embryos reach the Syncytial blastoderm stage.

In fact, embryos from Ipo9KO mothers show defects starting of the very earliest mitotic divisions.

Embryos from Ipo9KO females do not exhibit synchronized nuclei divisions, which is a normal characteristic of early embryogenesis in Drosophila (Fig. 3.4A). As shown in this figure, some nuclei are in anaphase while others are in metaphase. The most striking phenotypes of embryos from Ipo9KO mothers are DNA bridges between nuclei, with multiple centrosomes and multipolar spindles. In addition, embryos from Ipo9KO mothers show centrosomes not associated with the nucleus (Fig. 3.4B). We concluded that Ipo9KO flies show maternal effect lethality correlated with cell division defects.

A w1118 B ipo9KO

1B1DAPI

Fig 3.3. Ipo9KO ovarioles do not show an obvious defect. (A-B) Drosophila ovarioles stained for VASA (blue), 1B1 (green) and DAPI (red). (A) w1118 control and (B) Ipo9KO ovarioles.

A A’

w (mother) DAPI

B B’

ipo9 (mother)

Fig 3.4. Ipo9KO embryos contain cells with DNA bridges and extra centrosomes. (A-B) Embryos from w1118 (control) and Ipo9KO females stained for Alpha-Tub (green) and DAPI (red).

Ipo9KO male flies exhibit azoospermia

To determine why Ipo9KO males are sterile, we examined whether their seminal bags contain mature sperm. As expected, the seminal bag of control male flies 5>days old were full of sperm (Fig. 3.5A). However, the seminal bag from Ipo9KO male flies did not contain sperm (Fig.

3.5B). To look at spermatogenesis, we performed immunohistochemistry on Ipo9KO testes. We observed Vasa, which indicates the presence of germ cells. As well, branched cysts were observed, indicating early mitotic amplification occurred in Ipo9KO testes as in controls (Fig. 3.5C-D).

However, Ipo9KO testes have an accumulation of post mitotic germ cells. The accumulation of post mitotic cells can be observed by the increase of branched fusomes labeled by 1B1 (Fig. 3.5D).

Another major difference between control and Ipo9KO testes is the absence of clusters of elongating sperm. Although sperm from Ipo9KO testes can form cluster, they are unable to elongate (Fig. 3.5E-

F). We conclude that Ipo9KO male flies do not produce mature sperm.

A w1118 B ipo9KO

DAPI DAPI

C w1118 C’ E w1118

Vasa 1B1 DAPI DAPI DAPI D ipo9KO D’ F ipo9KO

Vasa 1B1 DAPI DAPI DAPI

PB Fig 3.5. Ipo9KO testes are unable to produce mature sperm. (A-B) w1118 (control) and Ipo9KO sperm bags stained with DAPI. (C-D) w1118 (control) and Ipo9KO Drosophila testes stained for VASA (red), 1B1 (green) and DAPI (blue). (E-F) cluster of elongating spermatids stained with DAPI from w1118 and Ipo9KO testes.

Germline specific knockdown of Ipo9 exhibits a similar phenotype to Ipo9KO

To investigate if the phenotype observed in Ipo9KO flies is cell autonomous and due to the loss of Ipo9, we knocked down Ipo9 in germ cells specifically. To knockdown ipo9 in female germ cells, two copies of maternal-alphaTub-Gal4 were used together with UAS-Ipo9RNAi. Maternal- alphaTub-Gal4 should be expressed starting from mid oogenesis and maternally loaded into eggs.

Similar to eggs laid from Ipo9KO female flies, none of the eggs laid from maternal-alphaTub-Gal4>

UAS-Ipo9RNAi female flies hatched (Fig. 3.6A-C). Additionally, embryos from maternal- alphaTub-Gal4> UAS-Ipo9RNAi female flies showed DNA bridges between nuclei in early divisions (Fig. 3.6B), reminiscent of what we observed in embryos derived from Ipo9KO mutant females. To knockdown Ipo9 in male germ cells, a triple-nosGal4> driver was used. Very similar to Ipo9KO testes, triple-nosGal4>UAS-Ipo9RNAi testes showed an expansion of post mitotic germ cells (Fig. 3.6D-E). Triple-NosGal4>UAS-Ipo9RNAi testes showed a defect in sperm maturation.

For example, while control testes have an average of nine clusters of individualizing sperm triple- nosGal4>UAS-Ipo9RNAi testes have on average of four clusters of individualizing sperm (Fig.

3.6F). Individualization is the last step of sperm maturation. With these results, we conclude that the phenotype observed in Ipo9KO flies is due to the loss of the Ipo9 gene and not to an off-target effect. In addition, we concluded that Ipo9 functions autonomously in the germline.

A A’ B) n=567 n=672 mata>+

alpha-Tub DAPI

B B’

RNAi mata>ipo9

D D’ F) triple-nos>+ Vasa 1B1 DAPI DAPI

E E’ A

RNAi

ipo9 triple-nos>

Vasa 1B1 DAPI DAPI

Fig 3.6. Knockdown of Ipo9 in germ cells results in fertility defects. (A-B) Embryos from mata-alphaTub-Gal4 (control) and mata-alphaTub-Gal4>Ipo9RNAi mothers stained for Alpha-Tub (green) and DAPI (red). (C) Percentage of hatching eggs after 5 days of being laid by maternal-alphaTub-Gal4 (control) and maternal-alphaTub-Gal4>Ipo9RNAi females crossed with w1118 males. (D-E) A triple-nosgal4 (control) and triple-nosgal4>Ipo9RNAi Drosophila testes stained for VASA (red), 1B1 (green) and DAPI (blue). (F) Number of individualizing sperm per testis from triple-nosgal4 (control) and triple-nosgal4>Ipo9RNAi males.

The N-terminal domain of Ipo9 is essential for its function during gametogenesis.

We wanted to explore whether the canonical function of Ipo9 in nuclear import is required within the germline. To address this question, we generated two transgenic flies: one carrying the full length Ipo9 and another carrying a truncated protein lacking the N-terminus domain (Fig.

3.7A). They were crossed with the germline driver, vasaGal4>, which is expressed from region 3 in the germarium until the end of oogenesis in females. In males, the expression of the vasaGal4> driver is restricted to early spermatogenesis (Fig. 3.7J-K). To test if both transgenics are expressed at similar levels, we extracted protein from the ovaries and performed western blot analysis. This analysis showed that full length and Delta-N Ipo9 proteins are expressed at similar levels (Fig.

3.7B). As well, two major cleavage products were observed for the full length and Delta-N Ipo9 proteins (Fig. 3.7B). To test the functionality of these proteins, we performed a fertility assay. As expected, eggs laid by flies carrying only the vasaGal4> hatch on average of 95% and eggs laid by flies carrying vasaGal4> in the Ipo9KO background did not hatch. However, eggs laid by vasaGal4>UAS-HA::Ipo9FL in the Ipo9KO background hatched at a rate of 90%, very similar to the control flies. By contrast, eggs laid by vasaGal4>UAS-HA::Ipo9ΔN in the Ipo9KO background did not hatch (Fig. 3.7C). At this point, we decided to stain the ovaries carrying the transgenes to visualize the protein. The HA::Ipo9FL is mainly cytoplasmic with enrichment on the nuclear membrane of the nurse cells. In addition, it shows enrichment in the oocyte (Fig. 3.7G). Although, the HA::Ipo9ΔN is also mainly in the cytoplasm, it does not enrich in the nuclear membrane as expected because it lacks the N-terminus domain, which is crucial to make contact with the nuclear pore (Fig. 3.7F). As well, the HA::Ipo9ΔN shows enrichment in the oocyte, although at lower levels than the HA::Ipo9FL (Fig. 3.7F). All together, these results conclusively demonstrate that the N- terminal domain of Ipo9 is necessary for female Drosophila fertility.

Similar to oogenesis, we decided to test whether the N-domain of Ipo9 is required for spermatogenesis. We performed the rescue experiments using the germline driver vasaGal4> in combination with the UAS-HA::Ipo9FL and UAS-HA::Ipo9ΔN in the Ipo9KO background flies. As expected, vasaGal4> alone did not show any negative effect on spermatogenesis (Fig. 3.7H). vasaGal4> alone or vasaGal4>UAS-HA::Ipo9ΔN in the Ipo9KO background did not rescue the

Ipo9KO phenotype in the testes (Fig. 3.7I-J). However, vasaGal4>UAS-HA::Ipo9FL in the Ipo9KO background was able to partially rescue the phenotype associated with the loss of Ipo9 during spermatogenesis. Even the limited expression of HA::Ipo9FL was able to reduce the number of post mitotic cells and promote sperms elongation in Ipo9KO testes (Fig. 3.7K). We conclude that the N- terminus domain of Ipo9 is required for proper spermatogenesis. In addition, these results strongly indicate that Ipo9 plays an important role within the germline.

Because the results above suggest that Ipo9 likely functions as the canonical nuclear importer in the germline, we wanted to examine if any substrate previously identified as Ipo9 cargo is altered during gametogenesis. Since Ipo9 is enriched in the oocyte during oogenesis and nuclear actin has been shown to be enriched in the oocyte as well, we decided to test if nuclear actin is affected in Ipo9KO ovarioles (Kelpsch et al., 2016). Immunofluorescence experiments using two different antibodies against Actin showed that Ipo9KO ovarioles have a significant reduction of nuclear actin in the oocyte and nurse cells (Fig. 3.8C-F). However, total actin and filament actin do not seem to be affected in Ipo9KO ovarioles (Fig. 3.8).

C A HA::Ipo9 B cargoes

UAS 150KD 3xHA N-terminal HEAT repeats domain HA::DeltaN-Ipo9 100 cargoes anti-HA

75 UAS ( ) PonceauS 3xHA HEAT repeats

HA DAPI HA HA DAPI HA DAPI

D D’ H H’ L vasa>+

E E’ I I’ N

ipo9 vasa>+;

F F’ J J’ M

ipo9 vasa>DeltaN-ipo9;

G G’ K K’ O

ipo9 vasa>ipo9;

Fig 3.7. The N-terminal domain of Ipo9 is required for its function during gametogenesis. (A) Schematic of the 3XHA full length Ipo9 and 3xHA DeltaN-Ipo9 proteins. (B) Western blot from ovaries showing HA::DeltaN-Ipo9 and HA::Ipo9 expression. (C) Percentage of hatching eggs after 5 days of been laid by vasa-gal4>;+, vasa-gal4>;Ipo9KO, vasa-gal4>DeltaN-Ipo9;Ipo9KO and vasa-gal4>Ipo9;IpoKO female crosses with w1118 males (approximately 20 females and 10 males, 3-7 days old, were in each cage). (D-G) Stage 4-5 egg chambers stained for HA (green) and DAPI (red). (H-K) Testes stained for HA (green) and DAPI (red). (L-O) Elongating sperms stained with DAPI (gray).

KO A) 18 B) 11 w ipo9 KO

11 w ipo9 VASA VASA

actin-C4 actin-JLA20

C w1118 C’ E w1118 E’

C4 DAPI C4 JLA20 DAPI JLA20 D ipo9KO D’ F ipo9KO F’

G w1118 G’

Phalloidin DAPI Phalloidin H ipo9KO H’

Fig 3.8. Ipo9KO ovarioles show a reduction of nuclear actin. (A-B) Western blot from ovaries w1118 (control) and Ipo9KO. (C-D) Stained for actinC4 (green) w1118 (control) and Ipo9KO egg chamber and DAPI (red). (E-F) Stained for actinLLA20 (green) w1118 (control) and Ipo9KO ovariole and DAPI (red). (G-H) Phalloidin (green) w1118 (control) and Ipo9KO ovariole and DAPI (red).

Discussion

Ipo9 plays a critical role in Drosophila reproduction

To search for new genes involved in germline development, we decided to perform a forward genetic screen, using publicly available RNAseq data from different tissues of Drosophila and the powerful cutting-edge CRISPR/Cas9 gene editing technique. Within the genes listed as enriched in the gonads, we choose to study Ipo9 for various reasons. First, there were no studies of Ipo9 in multicellular organisms. Second, nuclear trafficking has been shown to play a critical role in gametogenesis, since germ cells go through a special cell cycle where the nucleus is quiescent for a longer time than somatic cells and highly dependent on cytoplasmic supplies into the nucleus (Urban et al., 2014; Weng et al., 2014; Gyuricza et al., 2016). Germline specific knockdown and rescue experiments indicate that Ipo9 plays an essential role within the germline during the Drosophila reproductive cycle (Fig. 3.6 & 3.7). Surprisingly, Ipo9KO female ovaries did not show any obvious morphological defects (Fig. 3.3). However, 100% of embryos from Ipo9KO female flies show defects beginning in early mitotic divisions (Fig. 3.4). These results suggest that

Ipo9 may be critical for proper meiosis and/or involved in cell division in early embryogenesis.

Additionally, these results show that Ipo9KO female flies show some unique characteristics among the β-karyopherin family (Table 3.1). For example, the majority of the null alleles of β- karyopherin family members exhibit a lethal phenotype at early stages during development; only ebomut, aplnull and artsnull can reach adulthood. ebomut shows neuronal defects and aplnull displays a

32 male sterile phenotype. artsnull shows a female sterile phenotype. artsnull female flies produce smaller eggs that cannot be fertilized, which is a different phenotype from what we observed in

Ipo9KO female flies (Table 3.1) (Fig. 3.4). A ketel Dominant negative mutant (ketelD) shows female sterile phenotype and embryos derived from these flies exhibit phenotypes similar to those displayed by Ipo9KO mutants (Schupbach and Wieschaus., 1997; Tiria´n et al., 2000). Embryos from ketelD show defects starting with the early cell divisions, which include problems with mitotic spindle organization and DNA integrity (Tiria´n et al., 2000; Timinszky et al., 2002) These studies also revealed that embryos from ketelD show defects in nuclear envelope integrity. Whether embryos from Ipo9KO females display similar defects remains unknown. In addition, the defects with DNA integrity, spindle organization and centrosome are often observed in embryos from mothers with mutations in condensins, cohesins or genes involved in meiosis (Archambault et al.,

2007; Urban et al., 2014; Guo et al., 2016). Because of the similarity of embryos from Ipo9KO females with embryos from mothers with mutations in genes involved in meiosis and enrichment of Ipo9 in the oocyte, we decided to explore meiosis in Ipo9KO flies in more detail in the following chapters.

Ipo9KO male flies are unable to produce sperm. Although early steps during spermatogenesis in Ipo9KO testes appear roughly normal, we can detect an increase of post mitotic germ cells (Fig. 3.5). This result suggests an over proliferation of GSCs and/or a delay in entering the meiotic program, similar to the meiotic mutant twine (Lin et al., 2006; White-Cooper et al.,

1998). Nevertheless, the most prominent phenotype that we observed in Ipo9KO testes is the absence of elongated spermatids, very similar to aplnull (VanKuren et al., 2018). Because of the striking phenotype of Ipo9KO spermatids, we decided to evaluate all steps of spermiogenesis in more depth in the following chapters.

The canonical nuclear import function of Ipo9 is required during gametogenesis

The requirement of the N-terminus domain of Ipo9 suggests that the phenotype associated with the loss of Ipo9 is due to a nuclear trafficking defect (Fig. 3.7). The N-terminus domain of

β-karyopherin proteins makes contact with the nuclear pore and binds to RanGTP (Chi and Adam.,

1997; Kutay et al., 1997; Frieda and Kutayb., 2001; Stron and Weis., 2003; Bange et al., 2013).

Interestingly, the phenotype shown by Ipo9KO flies is consistent with the perturbation of nuclear trafficking of cargoes identified for Ipo9 involved in DNA packaging (Mühlhäusser et al., 2001;

Padavannil et al., 2019; Kimura et al., 2015). As a proof of principle, we decided to test whether nuclear actin is disrupted in Ipo9KO flies. Actin has been shown to be a cargo of Ipo9 (Dopie et al.,

2012; Belin et al.,2015). Recently the Drosophila ovary has been identified as a great system to study nuclear actin (Kelpsch et al., 2016). Our results show a significant reduction of nuclear actin during oogenesis in Ipo9KO flies, while total actin remains the same compared to controls

(Fig. 3.8).

These results show that Ipo9 is an essential gene for Drosophila reproduction and potentially important across species since it is expressed in the gonads in mammals (Kortvely et al., 2005). Loss of Ipo9 shows a unique phenotype within the β-karyopherin family and is one of the few genes that are important for reproduction in both females and males. Overall, this study advances our understanding of how germ cells differentiate to form functional gametes.

CHAPTER FOUR Ipo9 mutants show defects during spermiogenesis Introduction

After meiosis II is completed during spermatogenesis, a process called spermiogenesis is initiated. The product of meiosis II is 64 rounded haploid spermatids. The 64 interconnected spermatids within each cyst undergo synchronous differentiation (Cagan, 2003). During spermiogensis, spermatids undergo dramatic morphological changes. Spermatids transform from small round cells approximately 12μm in diameter to 1.8mm long, motile sperm capable of participating in fertilization (White-Cooper; 2004; Fabian and Brill, 2012). The most notable changes during spermiogenesis include remodeling of the mitochondria and elongating nuclei.

The end of spermiogenesis occurs with the formation of individual sperm (Fabian and Brill,

2012).

The first step during spermiogenesis is called the onion stage. The onion stage is marked by mitochondrial clustering and migration of the basal body near the nuclear envelope (White-

Cooper; 2004; Fabian and Brill, 2012). After mitochondria fuse, they form what is called the nebenkern. The onion stage can be used as an indicator of failure during meiosis. For example, after proper meiosis, cells within cysts at the onion stage should have single nuclei and nebenkern that are similar in size. However, mutants that affect cytokinesis can show two or four nuclei adjacent to a single nebenkern. Mutations affecting spindle structure also result in defects in chromosome segregation and cytokinesis, marked by nebenkern that vary in size and number

(White-Cooper; 2004; Kemphues et al., 1980).

During early elongation, the cyst of 64 spermatids becomes polarized. Within the cyst, all the nuclei localize to the front end (towards the basal end) and all the growing tails localize to the back end (towards the apical end). The tail is surrounded by ER membrane as well with the

35 mitochondria from the nebenkern (Fabian and Brill, 2012). At the same time that the tails are elongating, changes in nuclear shape and chromatin condensation occur.

Spermiogenesis is marked by nuclear elongation and chromatin reorganization. Nucleus elongation is dependent on microtubules from the basal body that associate with the nucleus.

Chromatin organization switches from a histone-based to protamine-based packaging in the late elongation stage. During elongation, the nuclear envelope that is in contact with the basal body forms a cavity that becomes filled with microtubules, as a result the nucleus takes a “canoe” shape.

Extensive evidence suggests that this process is regulated by cytoskeleton proteins (Li et al., 1998;

Baker et al., 2004; Vogt et al., 2006). During chromatin reorganization, histones are first modified during the early canoe stage. The histones are then ubiquitinated by an unknown ubiquitin ligase and subsequently degraded by the proteasome at the later canoe stage, immediately before protamines are incorporated into the chromatin (Zhong and Belote, 2007; Awe and Renkawitz-

Pohl, 2010). Some of the histone modifications are H3K9 and H3K27 methylation, which are typical of transcription inactivation. The H4 hyper-acetylation observed during these stages is believed to be important for histone degradation and incorporation of protamines (Awe and

Renkawitz-Pohl, 2010). After histone removal, the transition like-proteins (Tpl) are incorporated, which facilitate protamine incorporation (Rathke et al., 2007). In Drosophila, mature sperm contain Mst35Ba (protamine A), Mst35Bb (protamine B) and Mst77F as major chromatin components (Rajas et al., 2005; Rathke et al., 2010).

After tail elongation and nuclear shaping, the final step of spermiogenesis, called individualization, takes place. During individualization, an actin cone like structure is formed around each of the 64 needle shaped nuclei. The actin cones move toward the end of the sperm tails, stripping away unneeded organelles and cytoplasm, and resolving intercellular bridges to the

“waste bag” (Cagan, 2003). Each mature sperm cell, ends up in its own plasma membrane. Then sperm are released into the testis lumen and transferred to the seminal vesicle, where they are stored until needed for fertilization (Cagan, 2003; Fabian and Brill, 2012). As described above,

Ipo9 is required for many steps during spermiogenesis.

Results Ipo9KO spermatids show mitochondrial morphology, DNA arrangement and centrosome position defects at early stages during spermiogenesis From our initial results, we observed that Ipo9KO testes do not form elongated sperm, suggesting that spermiogenesis is disrupted. To evaluate sperm elongation, we first focused on the onion stage, the first step of spermiogenesis, using a traditional squash preparation in combination with phase-contrast microscopy. The nebenkern, by phase contrast, is a dark sphere adjacent to the phase light nucleus. Control testes at the onion stage showed the expected 64 cells (Fig. 4.1A).

The 64 haploid cells have nuclei and nebenkern that are similar in size and equal in number.

However, Ipo9KO spermatids show few nuclei and more than 64 nebenkerns of different sizes at the onion stage (Fig. 4.1B). To evaluate the early elongation stage (canoe stage), we stained our samples with gamma tubulin, which labels the centrosomes and DAPI, to visualize nucleus morphology. The control spermatids showed elongated nuclei with the canoe shape. Also, the control spermatids showed polarization by having the centrosomes at the basal body at early canoe stage. Additionally, the centrosomes are not present at basal bodies at late canoe stage in control spermatids as expected (Fig. 4.1C-D). However, Ipo9KO spermatids are unorganized and their nuclei show defects in elongation. Moreover, many nuclei within the cyst are not positive for gamma tubulin and some centrosomes are not associated with nuclei (Fig. 4.1E). From these experiments, we conclude that Ipo9KO spermatids have defects in nuclear elongation and cell

37 polarization in early spermiogenesis. These results suggest that Ipo9 may be involved in mitochondria aggregation, cell division and sperm elongation.

C w1118 D w1118 E ipo9KO

Fig 4.1. Ipo9KO spermatids show defects at the onion stage and comet stage. (A-B) Phase-Contrast of live squashes of cells at the onion stage. Nuclei form white spheres and nebenkerns form black spheres. (A) w1118 spermatids and (B) Ipo9KO spermatids. (C-E) spermatids stained for gamma-Tub (green) and DAPI (blue) at the early canoe stage. (C-D) w1118 spermatids and (E) ipo9KO spermatids.

Ipo9KO spermatids show defects in chromatin reorganization.

To find the reason why Ipo9KO spermatids do not elongate, we examined several molecular markers that correlated with chromatin reorganization during the elongation process. First, we compared the transition from histone-based to protamine-based organization in control and Ipo9KO spermatids. Control spermatids showed replacement of the histone H2A and H2Av at the late elongation stage by protamine-B. Overlapping of histone H2A or H2Av with protamine-B almost was never observed in control testes. By contrast, Ipo9KO spermatids accumulated nuclear protamine-B, in the presence of histone H2A and H2Av, which were not completely removed (Fig.

4.2). From these results, we conclude that Ipo9KO spermatids have a defect in the histone switch that marks mature sperm.

The ubiquitin proteasome pathway has been implicated in histone degradation during spermiogenesis (Zhong and Belote, 2007). Because Ipo9KO spermatids have a defect in histone removal, we decided to explore if histone ubiquitination is impaired in Ipo9KO testes. Staining for polyubiquitination in control testes showed spermatids positive for ubiquitination. However, nuclei that were in transition to protamine incorporation or already with protamine, were negative for polyubiquitination. Similar to control testes, Ipo9KO testes have spermatids that were positive for ubiquitination at early elongation stage. However, Ipo9KO spermatids were negative for ubiquitination in the stage corresponding to histone ubiquitination (Fig. 4.3).

Also, we decided to test if trafficking of proteasome components into the nucleus is disrupted in Ipo9KO testes (Fig. 4.4, 4.5 & 4.6). We stained for three different components of the

19S regulatory cap subunits (outer rings) of the proteasome. The function of the 19S regulatory subunits is to recognize polyubiquitinated proteins and transfer them to the catalytic core 20S

(Dong et al., 2018). The testis specific components of the proteasome, Prosα6T and Prosα3T, and

39 the ubiquitous component, Prosα2, exhibited reduced localization to the nucleus during the onion and canoe stages in Ipo9KO testes compared with control testes (Fig. 4.4, 4.5 & 4.6). Additionally,

Ipo9KO nuclei during early canoe stage showed abnormal nuclear membrane labeled by LaminC

(Fig. 4.4, 4.5 & 4.6). Altogether, these data strongly suggest that ubiquitination of histone proteins and nuclear import of the proteasome components is disrupted in Ipo9KO testes during spermiogenesis.

Nucleosome and histone modifications are associated with the transition from histone- based to protamine-based chromatin packing (Rathke et al., 2007; Awe and Renkawitz-Pohl,

2010). We stained for ISWI, a chromatin remodeler that mediates the appropriate organization of sperm chromatin (Doyen et al., 2015). As expected, ISWI is present in the late elongation stage of control testes. Although, Ipo9KO testes show expression of ISWI in the nuclei during late elongation stage, ISWI does not associate with DNA (Fig. 4.7A-B). Elongated nuclei are characterized by acetylation of histone H3. In control, elongated nuclei, H3K9 is enriched and forms a dot in each nucleus. However, H3K9 in Ipo9KO nuclei forms multiple small dots in each nucleus (Fig. 4.7C-D). Histone H3K18 is present in control late elongated nuclei prior to protamine incorporation. However, Ipo9KO nuclei do not show H3K18 (Fig. 4.7E-F).

Nevertheless, control and Ipo9KO showed overlapping expression of H3K23 and protamine (Fig.

4.7G-H). Moreover, acetylation of histone H4K8 is present in nuclei prior to protamines incorporation in control and Ipo9KO testes. However, Ipo9KO testes also showed H4K8 after protamine being incorporated (Fig. 4.7I-J). All together, these results showed that Ipo9KO nuclei have defects in histone modification and chromatin remodeling during spermiogenesis.

A B Control ipo9KO young young elongating early canoe late canoe nuclei during elongating early canoe late canoe nuclei during nuclei stage nuclei stage nuclei individualization nuclei stage nuclei stage nuclei individualization

H2A

Prot GFP

MERGE

C Control D ipo9KO young young elongating early canoe late canoe nuclei during elongating early canoe late canoe nuclei during nuclei stage nuclei stage nuclei individualization nuclei stage nuclei stage nuclei individualization

H2Av

Prot GFP

MERGE

Fig 4.2. Ipo9KO spermatids show defects in H2A and H2Av removal. (A-D) Elongating nuclei stained for Histone (red), ProtB-GFP (green) and DAPI (blue). (A&C) w1118 nuclei are able to elongate and replace histone by protamineB (B&E) Ipo9KO nuclei are unable to elongate and properly remove histone.

A MERGE A’ A’’ Ubi A’’’ Prot

GFP Control

B B’ B’’ B’’’

KO ipo9

Fig 4.3. Ipo9KO spermatids exhibit defect in histone ubiquitination. Testes stained for ubiquitin (red), protB-GFP (green) and DNA (blue) (A-A’’’) w1118 control sperms are positive for ubiquitination prior to protamine incorporation. (B-B’’’) Ipo9KO mutant sperms ubiquitinated prior to protamine incorporation.

A w1118

LaminC

LaminC DAPI

B ipo9KO Onion Onion Stage

C w1118

LaminC

LaminC DAPI

D ipo9KO Early Canoe Stage nuclei Stage Canoe Early

Fig 4.4. Ipo9KO spermatids show reduction of Prosα6T in the nucleus. Spermatids at the onion stage and early canoe stage, stained for Prosα6T-EGFP (green), LaminC (red) and DNA (blue). (A&C) w1118 spermatids and (B&D) Ipo9KO spermatids.

A w1118

LaminC

LaminC DAPI

B ipo9KO Onion Stage

C w1118

LaminC

LaminC DAPI

D ipo9KO Early Canoe Stage nuclei Stage Canoe Early

Fig 4.5. Ipo9KO spermatids show reduction of Prosα2 in the nucleus. Spermatids at the onion stage and early canoe stage, stained for Prosα2-EGFP (green), LaminC (red) and DNA (blue). (A&C) w1118 spermatids and (B&D) Ipo9KO spermatids.

A w1118

LaminC

LaminC DAPI

B ipo9KO Onion Stage

C w1118

LaminC

LaminC DAPI

D ipo9KO Early Canoe Stage nuclei Stage Canoe Early

Fig 4.6. Ipo9KO spermatids show reduction of Prosα3T in the nucleus. Spermatids at the onion stage and early canoe stage, stained for Prosα3T-EGFP (green), LaminC (red) and DNA (blue). (A&C) w1118 spermatids and (B&D) Ipo9KO spermatids.

A w1118 A’ C w1118 C’

ISWI H3K9

B ipo9KO B’ D ipo9KO D’

E w1118 E’ G w1118 G’

H3K18 H3K23

F ipo9KO F’ FH ipo9KO FH’’

HI w1118 HI’ ’

H4K8

IJ ipo9KO IJ’’

Fig 4.7. Ipo9KO nuclei do not show some histone modifications and nucleosome component during spermiogenesis. Nuclei stained for ProtB-GFP (green), DAPI (blue) and histone modifications or nucleosome component (red or gray). (A,C,E,G and I) control nuclei. (B,D,F,H and J) Ipo9KO nuclei.

Ipo9KO spermatids fail to individualize.

To complete our evaluation of spermiogenesis, we compared sperm tail elongation and sperm individualization between control and Ipo9KO testes. Staining for α-Tubulin to label the sperm tails does not show differences between w1118 and Ipo9KO testes (Fig. 4.8A-B). To visualize the actin cones and the waste bags, two important structures during sperm individualization, we stained control and mutant samples with phalloidin (Cagan, 2003; Fabian and Brill, 2012). In w1118, testes actin cones and waste bags were observed. However, Ipo9KO testes do not have actin cone or waste bags (Fig. 4.8C-F). We conclude that Ipo9KO spermatids do not go through individualization. A w1118 A’ B ipo9KO B’

alpha-Tub DAPI alpha-Tub C w1118 C’ E ipo9KO E’

Phalloidin DAPI Phalloidin D w1118 D’ D’’ F ipo9KO F’ F’’

Fig 4.8. Ipo9KO nuclei are unable to individualize. Testes stained for alpha-Tub (green) and DAPI (red). (A-A’) w1118 testis and (B-B’) Ipo9KO testis. Testes stained for phalloidin (green) and DAPI (red). (C-D) w1118 testis and nuclei and (E-F’) Ipo9KO testis and nuclei.

Discussion

Ipo9 may play an important role in mitochondrial fusion, cell division and sperm elongation.

Ipo9KO spermatids show multiple defects in early spermiogenesis (Fig. 4.1). The onion stage has been used to identify genes involved in chromosome separation, cytokinesis and mitochondria morphology. One of the most noticeable defects of Ipo9KO spermatids is their mitochondrial morphology. Ipo9KO spermatids have nebenkern (formed by mitochondrial fusion) of different sizes. Many genes involved in mitochondria fusion during spermatogenesis have been found including; fuzzy, pink1, parkin, milt, dpr1, rhomboid7 and opa1-like.

Fuzzy mutant flies produce sterile males. In fuzzy mutant testes, the mitochondria fail to fuse during nebenkern formation. However, mitochondria cluster around each other at the onion stage giving the appearance of bigger Nebenkern-like structure with irregular borders (Hales and

Fuller., 1997; Deng et al., 2010). Pink1 mutant spermatids during the onion stage show vacuolations of the nebenkern (Deng et al., 2010). Parkin mutants during spermiogenesis only have the major mitochondrial derivative, but not the minor derivative (Deng et al., 2010). Milt mutant spermatids contain nebenkern that are frequently dissociated from nuclei at the onion stage

(Aldridge et al., 2007). Primary spermatocytes in drp1 mutants contain abnormally clustered mitochondria. Additionally, mitochondrial distribution, unfurling, and elongation are affected in spermatids lacking Drp1 during spermiogenesis (Aldridge et al., 2007). Mutations in rhomboid7 and opa1-like result in nebenkern formation defects as seen in fuzzy mutants (McQuibban et al.,

2006). Although mutants associated with mitochondria integrity show irregular nebenkern shape

48 similar to Ipo9KO, there is no evidence of extra nebenkern or nuclear defects in the mitochondria mutant related genes as observed in Ipo9KO. Furthermore, Ipo9KO spermatids do not show multiple nuclei around a big nebenkern like mutants affecting cytokinesis (Brill et all., 2000; Giansanti et al., 2004). Ipo9KO spermatids share similar phenotypes with mutants that have disrupted spindle structure, like asp and testis-specific β-tubulin85D (Casal et al., 1990; Kemphues et al., 1980).

They show nuclei and nebenkern that vary in size and number, due to defects in chromosome segregation and cytokinesis. Because of the similarity of Ipo9KO phenotype with asp and β- tubulin85D mutants, it is likely that Ipo9KO have problems in chromosome segregation due to spindle defects during meiotic division. Analysis of chromosome segregation will be presented in the following chapter.

Interestingly, the Ipo9KO spermatid phenotype at the onion stage also shares similarity with lis-1 and tctex-1 mutants. All three mutants show small clusters of mitochondria beside the nebenkern (Sitaram et al., 2012). Lis-1 and Tctex-1 are part of the microtubule motor complex dynein. Additionally, lis-1 and tctex-1 mutants exhibit defects in centrosome positioning during meiosis and early spermiogenesis which causes loss of attachment between the nucleus and basal body (Sitaram et al., 2012). Furthermore, lis-1 and tctex-1 mutants also show defects in sperm elongation similar to Ipo9KO. Interestingly, Ipo9KO spermatids at the early elongating stage similar to lis-1 and tctex-1 mutants also show defects in centrosomes positioning and loss of attachment between the nucleus and basal bodies (Fig. 4.1C-D). Loss of the attachment between the nucleus and basal body, and defects in nuclear shaping is observed in other mutants related to the γ-tubulin ring complex like grip75 and grip128 (Vogt et al., 2006). All these similarities between Ipo9KO and the genes mentioned above suggest that Ipo9 may work together with the centrosome and/or with genes involved in basal body attachment to the nucleus during spermiogenesis. It is likely

49 that the centrosome defects observed in Ipo9KO spermatids, start during meiotic divisions. During cell division mitotic components require be specifically imported for spindle assembly and function previous nuclear envelop breakdown in late prophase. For example, in Drosophila centrosome are only embedded in the nuclear envelope during mitosis, which suggests that this process requires careful coordination of cytoplasmic and nuclear activities for success cell division

(Leo et al, 2012). It is possible that Ipo9 helps to coordinate the cytoplasmic and nuclear activities by bringing centrosome components into the nuclear membrane prior to cell division.

Potential roles of Ipo9 in chromatin reorganization during spermiogenesis.

We decided to explore chromatin reorganization due to the observed defects in DNA condensation and nuclei elongation observed in Ipo9KO spermatids during spermiogenesis. The transition from histone-based to protamine-based chromatin organization is the last part of the process for nuclear shaping that leads to a highly compact sperm nucleus (Renkawitz-Pohl, 2010).

Ipo9KO nuclei are able to incorporate protamine-B, however histone H2A, H2Av and H4 are not completely removed (Fig. 4.2) & (Fig. 4.7I-J). These results may partially explain why Ipo9KO nuclei are not able to elongate. Complete exchange of histone by protamine is thought to be required for the formation of highly compact sperm nuclei. In spite of protamine-B being incorporated in Ipo9KO nuclei, it will be important to test if the remainder of major chromatin components, protamine-A and Mst77F, are present in Ipo9KO nuclei (Rajas et al., 2005; Rathke et al., 2010). Mst77F has been shown to be the most crucial component for sperm elongation (Rathke et al., 2010).

Evidence of histone ubiquitination prior to transition to protamine-based incorporation and delay in histone removal in a mutant of the proteasome component highly suggest that the ubiquitin

50 proteasome pathway is involved in histone removal in spermiogenesis (Zhong and Belote, 2007;

Awe and Renkawitz-Pohl, 2010). Interestingly, Ipo9KO nuclei lose the ubiquitination signal after protamine incorporation, even though they still have nuclear histones (Fig. 4.3I). Additionally, we observed that Ipo9KO spermatids showed a significant reduction of the components of the proteasome, Prosα6T, Prosα3T and Prosα2 compared with the control spermatids (Fig. 4.4, 4.5 &

4.6). These results suggest that ligases responsible for histone ubiquitination and proteasome components are potential cargoes of Ipo9.

Nucleosome and histone modification during the early elongation stages are also critical steps of chromatin reorganization. The chromatin remodeler factor ISWI showed a reduction in

Ipo9KO nuclei compare with control nuclei (Fig. 4.7). Reduction of ISWI may also contribute to nuclear morphology defects since ISWI is required for proper sperm elongation (Doyen et al.,

2015). Even though the histone H3K9 is observed in control and Ipo9KO nuclei, it showed a different pattern in Ipo9KO nuclei. The different pattern may be a reflection of the DNA organization in ipo9KO nuclei (Fig. 4.7). The histone H3K18 is not detected in Ipo9KO nuclei (Fig.

4.7). The histone H3K23 showed similar patterns in control and Ipo9KO nuclei. Interestingly, the histone H3K23 is present in the nuclei after protamine incorporation in control and Ipo9KO(Fig.

4.7). This result may suggest that not all the histones are removed at the same time during spermiogenesis, although further experiments need to be done to rule out no specific interactions of the antibody. Moreover, acetylation of histone H4K8 is present in Ipo9KO nuclei after protamine incorporation while in control sperm it is only present prior to protamine incorporation (Fig. 4.7I-

J). These results suggest that Ipo9 may be responsible for importing ISWI or histone modifiers during spermiogenesis. Although, to rule out secondary effects, physical interaction assays between chromatin modifiers and Ipo9 have to be done. Additionally, some of the chromatin

51 modifiers are expressed at very specific stages of spermiogenesis. It is possible that Ipo9KO nuclei do not go through the normal program during spermiogenesis and perhaps this is the reason why some of these chromatin modifiers are not present in Ipo9KO.

Ipo9KO spermatids fail to go through the last step of spermiogenesis.

Ipo9KO spermatids can form tails in a similar fashion as control spermatids (Fig. 4.8A-B).

This result also showed that Ipo9KO spermatids are able to establish cell polarity at the later stages.

We evaluated if Ipo9KO spermatids are able to individualize (Fig. 4.8C-F). However, we could not detect actin cones or waste bags in Ipo9KO spermatids, which are crucial components for sperm individualization (Cagan, 2003; Fabian and Brill, 2012). It is common that male mutants for proteins required for nuclear shaping fail to individualize, because correct shaping of the nucleus is required for the normal assembly of the actin cone (Fabrizio et al., 1988).

All these results together suggest that Ipo9 is required for nuclear elongation and chromatin reorganization during spermiogenesis. It is possible that Ipo9 helps to bring members of the dynein microtubule motor complex to the nuclear membrane prior to meiotic division. Furthermore, it is likely that Ipo9 is responsible for nuclear trafficking of proteins involved in chromatin reorganization during spermiogenesis.

CHAPTER FIVE Ipo9KO exhibits defects in chromosome segregation during meiosis

Introduction

In female Drosophila, hallmarks of meiosis can be observed in region 2A of the germarium with the loading of the synaptonemal complex (SC) onto chromosomes of four nuclei within a cyst. The SC forms between homologous chromosomes and it supports meiotic recombination

(Takeo et al., 2001; Tanneti et al., 2001). The main components of the SC are C(3)G, C(2)M,

Corolla and Cona (Hughes et al., 2018). By region 3 of the germarium, only the pro-oocyte maintains full-length SC along the arms of the chromosomes, while the other 15 cells become nurse cells. The SC structure supports pairing throughout prophase I. In contrast to the SC that is specific for females in Drosophila, cohesin meiosis-specific proteins are required for both sexes.

The SC is retained until stages 7-9 when it disassembles. During stages 12-13 of oogenesis, spindle assembly occurs. At stage 14, the oocyte is arrested for the second time at metaphase I.

Chromosomes have bi-oriented spindles during metaphase I, then chromosomes are separated to opposite spindle poles at anaphase I. As the egg goes through the oviduct, it becomes activated to complete the second meiosis. During meiosis II, the sister chromatids are subsequently segregated to form four haploid nuclei (Stetina and Orr-Weaver., 2011; Hughes et al., 2018).

Besides the meiosis-specific proteins, cells going through meiosis also require the mitotic machinery including cohesin and condensing complexes (Tanneti et al., 2001). The cohesin complex contains SMC1, SCM3, Rad2 and SA and the condensin complex contains SMC2,

Glu/SMC4, Cap-D2, Cap-H2 and Cap-G. The cohesin complex holds sister chromatids together during mitotic and meiotic divisions (Losada and Hirano., 2005). It has been shown that the mitotic cohesin members also interact with meiotic specific proteins such as C(2)M, Sunn, Solo and Ord

(Hughes et al., 2018). These interactions are required for the stabilization of the SC and for proper meiosis in both sexes.

Similar to females, male meiosis starts after cyst formation. In males, all the 16-cell cysts go through meiosis. Unlike females, males do not form the SC and homologous recombination does not occur. However, meiotic specific cohesins like Ord and the centromeric specific proteins such Sunn and Solo are required for male meiosis (Balicky et al., 2002; Yan et al., 2010; Krishnan et al., 2014).

Results Ipo9KO flies show a defect in DNA organization during prophase I, although structural components of the chromosome do not show obvious defects Since the previous results suggest that Ipo9KO mutant flies may have a problem during meiosis, we decided to evaluate the meiosis specific machinery during oogenesis. We stained for members of the SC, C(3)G and C(2)M. They did not show any obvious differences between control and Ipo9KO oocytes. The SC is formed at the right stage and was stable (did not disassemble prematurely) during oocyte development in Ipo9KO flies (Fig. 5.1A-H). We also looked at the meiosis-specific centromeric proteins, Sunn and Solo, during oogenesis. Sunn and Solo associated with the centromere during early onset of meiosis in the germarium (Fig. 5.1I,K,M&O). Sunn shows one or two foci close to each other in the oocyte during prophase I until egg chamber stage

3 in both control and Ipo9KO (Fig. 5.1I-L). Solo, similar to Sunn, showed one or two foci in close proximity in control oocyte egg chamber stage 3 (Fig. 5.1N). However, in Ipo9KO oocytes stage 3

Solo showed two separate foci and in some cases three or four foci (Fig. 5.1P-R). All these results indicated that while Ipo9KO do not a have defect in SC structure, they do have defects in pairing of

54 centromeres during mid prophase. Further analysis is needed to investigate the clear difference in expression of Sunn and Solo between control and Ipo9KO flies.

Defects in chromosome segregation often are associated with cohesin and condensin proteins. Based on this, we stained for SMC1, a member of the cohesion complex, and Glu/SMC4, a member of the condensin complex, during oogenesis. SMC1 associated with DNA at the onset of meiosis and stayed associated with the karyosome during prophase I in control and Ipo9KO ovarioles (Fig. 5.2A-D). Unlike SMC1, Glu does not associate with the karyosome until metaphase I during oogenesis. Staining for Glu did not show any obvious difference between control and Ipo9KO flies during oogenesis (Fig. 5.2E-L). These results indicate that loss of Ipo9 does not disrupt the nuclear localization of the cohesin and condensin complexes during oognesis.

Ipo9KO flies show defects in chromosome segregation during meiosis To analyze chromosome segregation, we used both fluorescence in situ hybridization

(FISH) and monitored a centromeric protein to visualize chromosome distribution during and after meiosis. Oocytes at metaphase I should have homologous chromosomes oriented towards opposite poles. We used probes specific for the X chromosome (359-bp repeats near centromere) and second chromosome (AACAC(n) repeats). In the control sample, one big spot corresponding to the cluster of the two X chromosomes and two second chromosomes were observed of each pole, as expected (Fig. 5.3A,C). In contrast, 48% of the Ipo9KO oocyte showed defects including mis- distribution of the second chromosome and mono-orientation of chromosomes at metaphase I (Fig.

5.3B-C). Additionally, we looked at the distribution of the centromere identifier (CID), a centromere-specific histone H3 variant, during metaphase I in oocytes. In controls, we observed equal number of spots at each pole (Fig. 5.3E,H). However, 26% of the Ipo9KO oocyte showed a

55 defect in CID distribution (Fig. 5.3F-H). These results indicate that Ipo9KO oocytes arrested at metaphase I have defects in chromosome distribution.

Results from live testes squashes at the onion stage presented in the chapter 4 suggest that Ipo9KO spermatocytes have defects during meiosis. We first confirmed the results obtained from live squashes, using fixed samples due to a possible damage of the samples during squash preparation. We crossed Ipo9KO with a transgenic mito-GFP to visualize mitochondria morphology during spermatogenesis. Then we stained control and Ipo9KO testes with anti-GFP.

Control testes at the onion stage have nebenkern with similar sizes (Fig. 5.4A). Mito-GFP staining confirmed that loss of Ipo9 results in uneven sizes of nebenkern at the onion stage (Fig. 5.4B). In addition, the DNA is less condensed in Ipo9KO nuclei compared to control nuclei during the onion stage (Fig. 5.4B). Next, we performed FISH analysis in control and Ipo9KO testes to study chromosome segregation. We used probes specific for the X, second and Y chromosomes

(AATAC(n) repeats). We found that 3.09% of the control nuclei showed a chromosome segregation defect (Fig. 5.4C). By contrast 23.44% of the Ipo9KO nuclei exhibited chromosome segregation defects (Fig. 5.4D-F). Altogether, these data suggest that Ipo9 is required for chromosome segregation during meiotic division.

St1 St4 St3 St5 A w1118 B w1118 E w1118 F w1118

5 μm C2M 5 μm KO C Ipo9KO D Ipo9KO G Ipo9KO H Ipo9KO

C3G 5 μm 5 μm

I I’ J J’

/TM3

Sunn::GF

Ipo9 actin> SunnGFP 10 μm 10 μm

K K’ L L’

Sunn::GF

Ipo9 actin> SunnGFP

M M’ N N’

/TM3

Solo::GF

Ipo9 vasa> SoloGFP

O O’ P P’ Q

P KO

5 μm Solo::GF

Ipo9 R vasa> SoloGFP 5 μm Fig 5.1 Ipo9KO does not show major defects in meiosis machinery during early oogenesis. (A-H) Stain for the SC at different stages during oogenesis. (A-D) Stained for C(3)G. (A-B) w1118 or (C-D) Ipo9KO. (E-H) Stained for C(2)M. (E-F) w1118 or (G-H) Ipo9KO. (I-N) Stained for meiotic cohesion at stage 1 and stage 3 during oogenesis. (I-L) Stained for SunnGFP (green) and DAPI (red). (I-J) control or (K-L) Ipo9KO. (M-R) Stained for SoloGFP (green) and DAPI (red). (M-N) Control or (O-R) Ipo9KO.

A A’ B B’

11 W

10 μm SMC1 10 μm

C C’ D D’

KO Ipo9

10 μm 10 μm

E F G K control K’ contorl

20 μm 20 μm 20 μm H I J Glu-Flag 5 μm KO 5 μm

Ipo9 L Ipo9KO L’

20 μm 20 μm 20 μm

5 μm 5 μm

Fig 5.2 Ipo9KO does not show any obvious defects in member of the cohesin and condensin. (A-D) Stained for the cohesin SMC1(green) and DAPI (red) at stage 1 and 3 during oogenesis (A- B) w1118 and (C-D) Ipo9KO. (E-J) Stained for the condensin Glu-Flag (green) and DAPI (red) at germarium, egg chamber st3 and st5 during oogenesis. (E-G) control and (H-J) Ipo9KO. (K-L) oocytes arrest at metaphase I, egg chamber st14. (K) control and (L) Ipo9KO.

metaphase I A w1118 B Ipo9KO C Ipo9KO D n=30 n=37

w 1118 i p o 9 d s . R e d . 1

Xchr2chrDAPI 18 KO 11

Ipo9 i p o 9 d s . R e d . 1 i p o 9 d s . R e d . 1

1118 KO KO E w F Ipo9 G Ipo9 H n=33 n=30

CID-GFPDAPI

18 1118 KO KO w Ipo9 11 I I’ J J’ w Ipo9

TubDAPI Tub 23/24 Normal 18/18 Normal

Fig 5.3 Ipo9KO oocytes at metaphase I show defects in chromosome orientation. (A-C) FISH using a X chromosome probe (red) and second chromosome probe (green) on oocytes metaphase I, DAPI (blue). (A) W1118 and (B-C) Ipo9KOoocyte. (D & H) Quantification of percentage of oocyte showing chromosome orientation defects. (E-G) Stained for CID-GFP (green) on oocytes metaphase I, DAPI (blue) (E) control and (F-G) Ipo9KOoocyte. (I-J) Stained oocyte at metaphase I for Tub (green) and DAPI (blue). (I) w1118 and (J) Ipo9KO.

mitoGFP mitoGFP, Ipo9KO A DAPI B DAPI C w1118 D Ipo9KO

XchrYchr2chr E F A’ B’

Ipo9KO Ipo9KO

A’’ DAPI B’’ DAPI

Fig 5.4 Ipo9KO spermatids exhibit chromosome segregation defects. (A-B) Spermatids at the onion stage. Stained GFP (green) and DAPI (red). (A) control shows 1:1 ratio of condensed nuclei and rounded nebenkern. (B) ipo9KO show nebenkerm number and size defects. As well the DNA is less condensed than the control (C-F) FISH using a X chromosome probe (red), Y chromosome probe (green) and second chromosome (white) and DAPI (blue) on spermatids at the onion stage. (C) w1118 and (D-F) Ipo9KO spermatids.

Discussion

Ipo9 is required for chromosome segregation during meiosis

Observations from previous chapters suggest that Ipo9KO flies have defects in meiosis and

DNA condensation. We first looked at meiotic specific machinery involved in sister chromosome pairing and DNA condensation. Staining with antibodies to detect the SC proteins, C(3)G and

C(2)M did not show any obvious differences between control and Ipo9KO ovarioles (Fig. 5.1A-

H). Furthermore, Ipo9KO ovarioles did not show localization defects for member of the cohesin, condensin and meiotic cohesin complex, SMC1, Glu and Sunn respectively (Fig. 5.1-5.2).

However, Solo, a member of the meiotic centromere cohesion showed more than two spots in the oocyte in Ipo9KO egg chamber stage 3 (Fig. 5.1P-R). This result suggested that chromosome organization is different in Ipo9KO oocyte than in the control. However, further work will be needed to fully elucidate the degree to which Ipo9 influences chromosome organization in mid prophase

I during oogenesis.

Evaluation of chromosome orientation during metaphase I showed that Ipo9 is required for proper chromosome segregation during oogenesis. Ipo9KO showed defects in metaphase I including mono-orientation and mis-orientation of the chromosomes (Fig. 5.3A-H). However, tubulin staining did not show a defect in microtubules in Ipo9KO karyosome at metaphase I (Fig.

5.3I-J). These results suggest that other proteins involved in chromosome segregation during meiosis may be affected in Ipo9KO flies. Furthermore, analysis of chromosome segregation in male spermatids at the onion stage showed that Ipo9KO male flies also possess defects in chromosome segregation during meiosis (Fig. 5.4C-F). However, we did not observe spermatids containing X and Y chromosomes Ipo9KO flies, which suggests that many of the defects observed in chromosome segregation may occur during meiosis II.

BILIOGRAPHY

Aldridge, A. C., L. P. Benson, M. M. Siegenthaler, B. T. Whigham, R. S. Stowers and K. G. Hales (2007). "Roles for Drp1, a dynamin-related protein, and milton, a kinesin-associated protein, in mitochondrial segregation, unfurling and elongation during Drosophila spermatogenesis." Fly (Austin) 1(1): 38-46.

Archambault, V., X. Zhao, H. White-Cooper, A. T. Carpenter and D. M. Glover (2007). "Mutations in Drosophila Greatwall/Scant reveal its roles in mitosis and meiosis and interdependence with Polo kinase." PLoS Genet 3(11): e200.

Awe, S. and R. Renkawitz-Pohl (2010). "Histone H4 acetylation is essential to proceed from a histone- to a protamine-based chromatin structure in spermatid nuclei of Drosophila melanogaster." Syst Biol Reprod Med 56(1): 44-61.

Baker, J. D., S. Adhikarakunnathu and M. J. Kernan (2004). "Mechanosensory-defective, male- sterile unc mutants identify a novel basal body protein required for ciliogenesis in Drosophila." Development 131(14): 3411-3422.

Baker, S. E., J. A. Lorenzen, S. W. Miller, T. A. Bunch, A. L. Jannuzi, M. H. Ginsberg, L. A. Perkins and D. L. Brower (2002). "Genetic interaction between integrins and moleskin, a gene encoding a Drosophila homolog of importin-7." Genetics 162(1): 285-296.

Balicky, E. M., M. W. Endres, C. Lai and S. E. Bickel (2002). "Meiotic cohesion requires accumulation of ORD on chromosomes before condensation." Mol Biol Cell 13(11): 3890-3900.

Belin, B. J., T. Lee and R. D. Mullins (2015). "DNA damage induces nuclear actin filament assembly by Formin -2 and Spire-(1/2) that promotes efficient DNA repair. [corrected]." Elife 4: e07735.

Brill, J. A., G. R. Hime, M. Scharer-Schuksz and M. T. Fuller (2000). "A phospholipid kinase regulates actin organization and intercellular bridge formation during germline cytokinesis." Development 127(17): 3855-3864.

Cagan, R. L. (2003). "Spermatogenesis: borrowing the apoptotic machinery." Curr Biol 13(15): R600-602.

Casal, J., C. Gonzalez, F. Wandosell, J. Avila and P. Ripoll (1990). "Abnormal meiotic spindles cause a cascade of defects during spermatogenesis in asp males of Drosophila." Development 108(2): 251-260.

Chi, N. C. and S. A. Adam (1997). "Functional domains in nuclear import factor p97 for binding the nuclear localization sequence receptor and the nuclear pore." Mol Biol Cell 8(6): 945-956.

Collier, S., H. Y. Chan, T. Toda, C. McKimmie, G. Johnson, P. N. Adler, C. O'Kane and M. Ashburner (2000). "The Drosophila embargoed gene is required for larval progression and encodes the functional homolog of schizosaccharomyces Crm1." Genetics 155(4): 1799-1807. de Cuevas, M. and A. C. Spradling (1998). "Morphogenesis of the Drosophila fusome and its implications for oocyte specification." Development 125(15): 2781-2789.

Demarco, R. S., A. H. Eikenes, K. Haglund and D. L. Jones (2014). "Investigating spermatogenesis in Drosophila melanogaster." Methods 68(1): 218-227.

Deng, H., M. W. Dodson, H. Huang and M. Guo (2008). "The Parkinson's disease genes pink1 and parkin promote mitochondrial fission and/or inhibit fusion in Drosophila." Proc Natl Acad Sci U S A 105(38): 14503-14508.

Dong, Y., S. Zhang, Z. Wu, X. Li, W. L. Wang, Y. Zhu, S. Stoilova-McPhie, Y. Lu, D. Finley and Y. Mao (2019). "Cryo-EM structures and dynamics of substrate-engaged human 26S proteasome." Nature 565(7737): 49-55.

Dopie, J., K. P. Skarp, E. K. Rajakyla, K. Tanhuanpaa and M. K. Vartiainen (2012). "Active maintenance of nuclear actin by importin 9 supports transcription." Proc Natl Acad Sci U S A 109(9): E544-552.

Doyen, C. M., G. E. Chalkley, O. Voets, K. Bezstarosti, J. A. Demmers, Y. M. Moshkin and C. P. Verrijzer (2015). "A Testis-Specific Chaperone and the Chromatin Remodeler ISWI Mediate Repackaging of the Paternal Genome." Cell Rep 13(7): 1310-1318.

Eliazer, S. and M. Buszczak (2011). "Finding a niche: studies from the Drosophila ovary." Stem Cell Res Ther 2(6): 45.

Fabian, L. and J. A. Brill (2012). "Drosophila spermiogenesis: Big things come from little packages." Spermatogenesis 2(3): 197-212.

Fabrizio, J. J., G. Hime, S. K. Lemmon and C. Bazinet (1998). "Genetic dissection of sperm individualization in Drosophila melanogaster." Development 125(10): 1833-1843.

Fried, H. and U. Kutay (2003). "Nucleocytoplasmic transport: taking an inventory." Cell Mol Life Sci 60(8): 1659-1688.

Fujii, K., Y. Miyata, I. Takahashi, H. Koizumi, H. Saji, M. Hoshikawa, M. Takagi, T. Nishimura and H. Nakamura (2018). "Differential Proteomic Analysis between Small Cell Lung Carcinoma (SCLC) and Pulmonary Carcinoid Tumors Reveals Molecular Signatures for Malignancy in Lung Cancer." Proteomics Clin Appl 12(6): e1800015.

Gasca, S., J. Canizares, P. De Santa Barbara, C. Mejean, F. Poulat, P. Berta and B. Boizet- Bonhoure (2002). "A nuclear export signal within the high mobility group domain regulates the nucleocytoplasmic translocation of SOX9 during sexual determination." Proc Natl Acad Sci U S A 99(17): 11199-11204.

Giagtzoglou, N., Y. Q. Lin, C. Haueter and H. J. Bellen (2009). "Importin 13 regulates neurotransmitter release at the Drosophila neuromuscular junction." J Neurosci 29(17): 5628- 5639.

Giansanti, M. G., R. M. Farkas, S. Bonaccorsi, D. L. Lindsley, B. T. Wakimoto, M. T. Fuller and M. Gatti (2004). "Genetic dissection of meiotic cytokinesis in Drosophila males." Mol Biol Cell 15(5): 2509-2522.

Gontan, C., T. Guttler, E. Engelen, J. Demmers, M. Fornerod, F. G. Grosveld, D. Tibboel, D. Gorlich, R. A. Poot and R. J. Rottier (2009). "Exportin 4 mediates a novel nuclear import pathway for Sox family transcription factors." J Cell Biol 185(1): 27-34.

Gratz, S. J., A. M. Cummings, J. N. Nguyen, D. C. Hamm, L. K. Donohue, M. M. Harrison, J. Wildonger and K. M. O'Connor-Giles (2013). "Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease." Genetics 194(4): 1029-1035.

Gratz, S. J., F. P. Ukken, C. D. Rubinstein, G. Thiede, L. K. Donohue, A. M. Cummings and K. M. O'Connor-Giles (2014). "Highly specific and efficient CRISPR/Cas9-catalyzed homology- directed repair in Drosophila." Genetics 196(4): 961-971.

Guo, Z., O. Batiha, M. Bourouh, E. Fifield and A. Swan (2016). "Role of Securin, Separase and Cohesins in female meiosis and polar body formation in Drosophila." J Cell Sci 129(3): 531-542.

Gyuricza, M. R., K. B. Manheimer, V. Apte, B. Krishnan, E. F. Joyce, B. D. McKee and K. S. McKim (2016). "Dynamic and Stable Cohesins Regulate Synaptonemal Complex Assembly and Chromosome Segregation." Curr Biol 26(13): 1688-1698.

Hales, K. G. and M. T. Fuller (1997). "Developmentally regulated mitochondrial fusion mediated by a conserved, novel, predicted GTPase." Cell 90(1): 121-129.

Higashi-Kovtun, M. E., T. J. Mosca, D. K. Dickman, I. A. Meinertzhagen and T. L. Schwarz (2010). "Importin-beta11 regulates synaptic phosphorylated mothers against decapentaplegic, and thereby influences synaptic development and function at the Drosophila neuromuscular junction." J Neurosci 30(15): 5253-5268.

Hughes, S. E., D. E. Miller, A. L. Miller and R. S. Hawley (2018). "Female Meiosis: Synapsis, Recombination, and Segregation in Drosophila melanogaster." Genetics 208(3): 875-908.

Ilius, M., R. Wolf and M. Heisenberg (2007). "The central complex of Drosophila melanogaster is involved in flight control: studies on mutants and mosaics of the gene ellipsoid body open." J Neurogenet 21(4): 321-338.

Jackel, S., A. K. Summerer, C. M. Thommes, X. Pan, A. Voigt, J. B. Schulz, T. M. Rasse, D. Dormann, C. Haass and P. J. Kahle (2015). "Nuclear import factor transportin and arginine methyltransferase 1 modify FUS neurotoxicity in Drosophila." Neurobiol Dis 74: 76-88.

Jakel, S. and D. Gorlich (1998). "Importin beta, transportin, RanBP5 and RanBP7 mediate nuclear import of ribosomal proteins in mammalian cells." Embo j 17(15): 4491-4502.

Jayaramaiah Raja, S. and R. Renkawitz-Pohl (2005). "Replacement by Drosophila melanogaster protamines and Mst77F of histones during chromatin condensation in late spermatids and role of sesame in the removal of these proteins from the male pronucleus." Mol Cell Biol 25(14): 6165- 6177.

Kahsai, L., G. H. Millburn and K. R. Cook (2016). "Phenotypes Associated with Second Chromosome P Element Insertions in Drosophila melanogaster." G3 (Bethesda) 6(8): 2665- 2670.

Kiger, A. A., D. L. Jones, C. Schulz, M. B. Rogers and M. T. Fuller (2001). "Stem cell self- renewal specified by JAK-STAT activation in response to a support cell cue." Science 294(5551): 2542-2545.

Kimura, M. and N. Imamoto (2014). "Biological significance of the importin-beta family- dependent nucleocytoplasmic transport pathways." Traffic 15(7): 727-748.

Kimura, M., Y. Morinaka, K. Imai, S. Kose, P. Horton and N. Imamoto (2017). "Extensive cargo identification reveals distinct biological roles of the 12 importin pathways." Elife 6.

Kortvely, E., P. Burkovics, S. Varszegi and K. Gulya (2005). "Cloning and characterization of rat importin 9: implication for its neuronal function." Brain Res Mol Brain Res 139(1): 103-114.

Krishnan, B., S. E. Thomas, R. Yan, H. Yamada, I. B. Zhulin and B. D. McKee (2014). "Sisters unbound is required for meiotic centromeric cohesion in Drosophila melanogaster." Genetics 198(3): 947-965.

Kutay, U., E. Izaurralde, F. R. Bischoff, I. W. Mattaj and D. Gorlich (1997). "Dominant-negative mutants of importin-beta block multiple pathways of import and export through the nuclear pore complex." Embo j 16(6): 1153-1163.

Lange, A., R. E. Mills, C. J. Lange, M. Stewart, S. E. Devine and A. H. Corbett (2007). "Classical nuclear localization signals: definition, function, and interaction with importin alpha." J Biol Chem 282(8): 5101-5105.

Leo, M., D. Santino, I. Tikhonenko, V. Magidson, A. Khodjakov and M. P. Koonce (2012). "Rules of engagement: centrosome-nuclear connections in a closed mitotic system." Biol Open 1(11): 1111-1117.

Li, K., E. Y. Xu, J. K. Cecil, F. R. Turner, T. L. Megraw and T. C. Kaufman (1998). "Drosophila centrosomin protein is required for male meiosis and assembly of the flagellar axoneme." J Cell Biol 141(2): 455-467.

Liao, T. T., W. H. Hsu, C. H. Ho, W. L. Hwang, H. Y. Lan, T. Lo, C. C. Chang, S. K. Tai and M. H. Yang (2016). "let-7 Modulates Chromatin Configuration and Target Gene Repression through Regulation of the ARID3B Complex." Cell Rep 14(3): 520-533.

Lin, T. Y., S. Viswanathan, C. Wood, P. G. Wilson, N. Wolf and M. T. Fuller (1996). "Coordinate developmental control of the meiotic cell cycle and spermatid differentiation in Drosophila males." Development 122(4): 1331-1341.

Lin, W., W. Ye, L. Cai, X. Meng, G. Ke, C. Huang, Z. Peng, Y. Yu, J. A. Golden, A. M. Tartakoff and T. Tao (2009). "The roles of multiple importins for nuclear import of murine aristaless-related homeobox protein." J Biol Chem 284(30): 20428-20439.

Lippai, M., L. Tirian, I. Boros, J. Mihaly, M. Erdelyi, I. Belecz, E. Mathe, J. Posfai, A. Nagy, A. Udvardy, E. Paraskeva, D. Gorlich and J. Szabad (2000). "The Ketel gene encodes a Drosophila homologue of importin-beta." Genetics 156(4): 1889-1900.

Losada, A. and T. Hirano (2005). "Dynamic molecular linkers of the genome: the first decade of SMC proteins." Genes Dev 19(11): 1269-1287.

Loveland, K. L., C. Hogarth, A. Szczepny, S. M. Prabhu and D. A. Jans (2006). "Expression of nuclear transport importins beta 1 and beta 3 is regulated during rodent spermatogenesis." Biol Reprod 74(1): 67-74.

Mahipal, A. and M. Malafa (2016). "Importins and exportins as therapeutic targets in cancer." Pharmacol Ther 164: 135-143.

Major, A. T., P. A. Whiley and K. L. Loveland (2011). "Expression of nucleocytoplasmic transport machinery: clues to regulation of spermatogenic development." Biochim Biophys Acta 1813(9): 1668-1688.

Mason, D. A., R. J. Fleming and D. S. Goldfarb (2002). "Drosophila melanogaster importin alpha1 and alpha3 can replace importin alpha2 during spermatogenesis but not oogenesis." Genetics 161(1): 157-170.

McQuibban, G. A., J. R. Lee, L. Zheng, M. Juusola and M. Freeman (2006). "Normal mitochondrial dynamics requires rhomboid-7 and affects Drosophila lifespan and neuronal function." Curr Biol 16(10): 982-989.

Muhlhausser, P., E. C. Muller, A. Otto and U. Kutay (2001). "Multiple pathways contribute to nuclear import of core histones." EMBO Rep 2(8): 690-696.

Natalizio, A. H. and A. G. Matera (2013). "Identification and characterization of Drosophila Snurportin reveals a role for the import receptor Moleskin/importin-7 in snRNP biogenesis." Mol Biol Cell 24(18): 2932-2942.

Padavannil, A., P. Sarkar, S. J. Kim, T. Cagatay, J. Jiou, C. A. Brautigam, D. R. Tomchick, A. Sali, S. D'Arcy and Y. M. Chook (2019). "Importin-9 wraps around the H2A-H2B core to act as nuclear importer and histone chaperone." Elife 8.

Plafker, S. M. and I. G. Macara (2002). "Ribosomal protein L12 uses a distinct nuclear import pathway mediated by importin 11." Mol Cell Biol 22(4): 1266-1275.

Pradeepa, M. M., S. Manjunatha, V. Sathish, S. Agrawal and M. R. Rao (2008). "Involvement of importin-4 in the transport of transition protein 2 into the spermatid nucleus." Mol Cell Biol 28(13): 4331-4341.

Quan, Y., Z. L. Ji, X. Wang, A. M. Tartakoff and T. Tao (2008). "Evolutionary and transcriptional analysis of karyopherin beta superfamily proteins." Mol Cell Proteomics 7(7): 1254-1269.

Rathke, C., W. M. Baarends, S. Awe and R. Renkawitz-Pohl (2014). "Chromatin dynamics during spermiogenesis." Biochim Biophys Acta 1839(3): 155-168.

Rathke, C., W. M. Baarends, S. Jayaramaiah-Raja, M. Bartkuhn, R. Renkawitz and R. Renkawitz-Pohl (2007). "Transition from a nucleosome-based to a protamine-based chromatin configuration during spermiogenesis in Drosophila." J Cell Sci 120(Pt 9): 1689-1700.

Rathke, C., B. Barckmann, S. Burkhard, S. Jayaramaiah-Raja, J. Roote and R. Renkawitz-Pohl (2010). "Distinct functions of Mst77F and protamines in nuclear shaping and chromatin condensation during Drosophila spermiogenesis." Eur J Cell Biol 89(4): 326-338.

Rudolph, J. E., M. Kimble, H. D. Hoyle, M. A. Subler and E. C. Raff (1987). "Three Drosophila beta-tubulin sequences: a developmentally regulated isoform (beta 3), the testis-specific isoform (beta 2), and an assembly-defective mutation of the testis-specific isoform (B2t8) reveal both an ancient divergence in metazoan isotypes and structural constraints for beta-tubulin function." Mol Cell Biol 7(6): 2231-2242.

Schupbach, T. and E. Wieschaus (1991). "Female sterile mutations on the second chromosome of Drosophila melanogaster. II. Mutations blocking oogenesis or altering egg morphology." Genetics 129(4): 1119-1136.

Sitaram, P., M. A. Anderson, J. N. Jodoin, E. Lee and L. A. Lee (2012). "Regulation of dynein localization and centrosome positioning by Lis-1 and asunder during Drosophila spermatogenesis." Development 139(16): 2945-2954.

Soniat, M., T. Cagatay and Y. M. Chook (2016). "Recognition Elements in the Histone H3 and H4 Tails for Seven Different Importins." J Biol Chem 291(40): 21171-21183.

Spradling, A. C. (1993). "Germline cysts: communes that work." Cell 72(5): 649-651. Strom, A. C. and K. Weis (2001). "Importin-beta-like nuclear transport receptors." Genome Biol 2(6): Reviews3008.

Takeo, S., C. M. Lake, E. Morais-de-Sa, C. E. Sunkel and R. S. Hawley (2011). "Synaptonemal complex-dependent centromeric clustering and the initiation of synapsis in Drosophila oocytes." Curr Biol 21(21): 1845-1851.

Tekotte, H., D. Berdnik, T. Torok, M. Buszczak, L. M. Jones, L. Cooley, J. A. Knoblich and I. Davis (2002). "Dcas is required for importin-alpha3 nuclear export and mechano-sensory organ cell fate specification in Drosophila." Dev Biol 244(2): 396-406.

Timinszky, G., L. Tirian, F. T. Nagy, G. Toth, A. Perczel, Z. Kiss-Laszlo, I. Boros, P. R. Clarke and J. Szabad (2002). "The importin-beta P446L dominant-negative mutant protein loses RanGTP binding ability and blocks the formation of intact nuclear envelope." J Cell Sci 115(Pt 8): 1675-1687.

Tirian, L., J. Puro, M. Erdelyi, I. Boros, B. Papp, M. Lippai and J. Szabad (2000). "The Ketel(D) dominant-negative mutations identify maternal function of the Drosophila importin-beta gene required for cleavage nuclei formation." Genetics 156(4): 1901-1912.

Tran, E. J., T. A. Bolger and S. R. Wente (2007). "SnapShot: nuclear transport." Cell 131(2): 420.

Tulina, N. and E. Matunis (2001). "Control of stem cell self-renewal in Drosophila spermatogenesis by JAK-STAT signaling." Science 294(5551): 2546-2549.

Turner, J. G., J. Dawson, C. L. Cubitt, R. Baz and D. M. Sullivan (2014). "Inhibition of CRM1- dependent nuclear export sensitizes malignant cells to cytotoxic and targeted agents." Semin Cancer Biol 27: 62-73.

Turner, J. G., J. Dawson and D. M. Sullivan (2012). "Nuclear export of proteins and drug resistance in cancer." Biochem Pharmacol 83(8): 1021-1032.

Urban, E., S. Nagarkar-Jaiswal, C. F. Lehner and S. K. Heidmann (2014). "The cohesin subunit Rad21 is required for synaptonemal complex maintenance, but not sister chromatid cohesion, during Drosophila female meiosis." PLoS Genet 10(8): e1004540.

VanKuren, N. W. and M. Long (2018). "Gene duplicates resolving sexual conflict rapidly evolved essential gametogenesis functions." Nat Ecol Evol 2(4): 705-712.

Vishal, K., D. S. Brooks, S. Bawa, S. Gameros, M. Stetsiv and E. R. Geisbrecht (2017). "Adult Muscle Formation Requires Drosophila Moleskin for Proliferation of Wing Disc-Associated Muscle Precursors." Genetics 206(1): 199-213.

Vogt, N., I. Koch, H. Schwarz, F. Schnorrer and C. Nusslein-Volhard (2006). "The gammaTuRC components Grip75 and Grip128 have an essential microtubule-anchoring function in the Drosophila germline." Development 133(20): 3963-3972.

Von Stetina, J. R. and T. L. Orr-Weaver (2011). "Developmental control of oocyte maturation and egg activation in metazoan models." Cold Spring Harb Perspect Biol 3(10): a005553.

Waldmann, I., S. Walde and R. H. Kehlenbach (2007). "Nuclear import of c-Jun is mediated by multiple transport receptors." J Biol Chem 282(38): 27685-27692.

Weng, K. A., C. A. Jeffreys and S. E. Bickel (2014). "Rejuvenation of meiotic cohesion in oocytes during prophase I is required for chiasma maintenance and accurate chromosome segregation." PLoS Genet 10(9): e1004607.

Whiley, P. A., Y. Miyamoto, R. I. McLachlan, D. A. Jans and K. L. Loveland (2012). "Changing subcellular localization of nuclear transport factors during human spermatogenesis." Int J Androl 35(2): 158-169.

White-Cooper, H. (2004). "Spermatogenesis: analysis of meiosis and morphogenesis." Methods Mol Biol 247: 45-75.

White-Cooper, H. (2010). "Molecular mechanisms of gene regulation during Drosophila spermatogenesis." Reproduction 139(1): 11-21.

White-Cooper, H. and I. Davidson (2011). "Unique aspects of transcription regulation in male germ cells." Cold Spring Harb Perspect Biol 3(7).

White-Cooper, H., M. A. Schafer, L. S. Alphey and M. T. Fuller (1998). "Transcriptional and post-transcriptional control mechanisms coordinate the onset of spermatid differentiation with meiosis I in Drosophila." Development 125(1): 125-134.

Yamaguchi, Y. L., S. S. Tanaka, K. Yasuda, Y. Matsui and P. P. Tam (2006). "Stage-specific Importin13 activity influences meiosis of germ cells in the mouse." Dev Biol 297(2): 350-360.

Yan, R., S. E. Thomas, J. H. Tsai, Y. Yamada and B. D. McKee (2010). "SOLO: a meiotic protein required for centromere cohesion, coorientation, and SMC1 localization in Drosophila melanogaster." J Cell Biol 188(3): 335-349.

Zhong, L. and J. M. Belote (2007). "The testis-specific proteasome subunit Prosalpha6T of D. melanogaster is required for individualization and nuclear maturation during spermatogenesis." Development 134(19): 3517-3525.