Proviruses with Long-Term Stable Expression Accumulate In

Article Proviruses with Long-Term Stable Expression Accumulate in Transcriptionally Active Chromatin Close to the Gene Regulatory Elements: Comparison of ASLV-, HIV- and MLV-Derived Vectors

Dalibor Miklík 1,2, Filip Šenigl 1 and Jiˇrí Hejnar 1,* 1 Institute of Molecular Genetics, Czech Academy of Sciences, Videnska 1083, CZ-14220 Prague 4, Czech Republic; [email protected] (D.M.); [email protected] (F.S.) 2 Faculty of Science, Charles University, Albertov 6, CZ-12843 Prague 2, Czech Republic * Correspondence: [email protected]

Received: 29 January 2018; Accepted: 6 March 2018; Published: 8 March 2018

Abstract: Individual groups of retroviruses and retroviral vectors differ in their integration site preference and interaction with the host genome. Hence, immediately after infection genome-wide distribution of integrated proviruses is non-random. During long-term in vitro or persistent in vivo infection, the genomic position and chromatin environment of the provirus affects its transcriptional activity. Thus, a selection of long-term stably expressed proviruses and elimination of proviruses, which have been gradually silenced by epigenetic mechanisms, helps in the identification of genomic compartments permissive for proviral transcription. We compare here the extent and time course of provirus silencing in single cell clones of the K562 human myeloid lymphoblastoma cell line that have been infected with retroviral reporter vectors derived from avian sarcoma/leukosis virus (ASLV), human immunodeficiency virus type 1 (HIV) and murine leukaemia virus (MLV). While MLV proviruses remain transcriptionally active, ASLV proviruses are prone to rapid silencing. The HIV provirus displays gradual silencing only after an extended time period in culture. The analysis of integration sites of long-term stably expressed proviruses shows a strong bias for some genomic features—especially integration close to the transcription start sites of active transcription units. Furthermore, complex analysis of histone modifications enriched at the site of integration points to the accumulation of proviruses of all three groups in gene regulatory segments, particularly close to the enhancer loci. We conclude that the proximity to active regulatory chromatin segments correlates with stable provirus expression in various retroviral species.

Keywords: retrovirus integration; provirus silencing; gene regulatory elements; genome-wide provirus distribution

1. Introduction Integration of retroviral genomic DNA into the host genome is a key step in the retroviral replication cycle. Although there are reports regarding the expression of retroviral genes from an unintegrated genome [1], effective and long-term expression occurs only from the integrated form of the retroviral genome—the provirus. However, the provirus expression is highly variable with individual proviruses either epigenetically silenced, fully expressed or alternating between these two states. The silencing of proviral expression poses a drawback for the utilization of retroviruses as vectors where long-term stable expression is the desired outcome. In the clinic, the existence of a cure-resistant reservoir of latent proviruses in HIV-infected patients is the principal obstacle of sterilizing and functional antiretroviral therapy. The question then arises to what level the chromatin surrounding the provirus determines the heterogeneity of proviral expression.

Viruses 2018, 10, 116; doi:10.3390/v10030116 www.mdpi.com/journal/viruses Viruses 2018, 10, 116 2 of 17

Most retroviruses are known to non-randomly target the host genome. Human immunodeficiency virus type 1 (HIV) and related lentiviruses preferentially integrate into active genes [2–6] whereas murine leukaemia virus (MLV) and other gammaretroviruses prefer to integrate into active transcriptional start sites (TSS) and enhancers [4,5,7]. On the other hand, avian sarcoma and leukosis virus (ASLV) display random-like integration exhibiting a weak preference for active genes [5,8,9]. These integration preferences are driven by cellular targeting factors, which bind to retroviral integrase and have affinity for certain histone marks. In this way, the retroviral intasomes tether to specific chromatin regions that are enriched at respective histone marks. For HIV, two proteins that are critical for the targeting of HIV proviruses have been identified, lens epithelium-derived growth factor (LEDGF/p75) and cleavage and polyadenylation specific factor 6 (CPSF6). LEDGF/p75 binds the integrase of HIV, enhances integration and targets intasomes to active genes [10–12] and nuclear periphery [13] while CPSF6 has been shown to interact with the capsid protein of HIV and plays an important role in the targeting of transcribed genes [14,15]. Integrase of MLV interacts with the bromodomain and extraterminal (BET) proteins, which results in MLV integration close to active promoters and enhancers [16–18]. Until recently, ASLV was thought to lack an integrase-binding partner important for the integration process. However, a recent study identified the histone chaperone FACT (FAcilitates Chromatin Transcription) complex as a cofactor of ASLV integrase promoting its integration [19]. Disruption of the interaction between the intasome and BET proteins or LEDGF/p75 has resulted in the decreased efficiency of retrovirus integration and retargeting outside the preferred genomic regions [12,20]. Hence, retargeting strategies are already being used to design the next generation of retroviral vectors [20–22] that demonstrate the decreased risk of cellular protooncogene transactivation [23]. In addition to genetic manipulation of retroviral integrase, specific HIV-1 integrase-LEDGF/p75 interaction can also be allosterically inhibited with small molecules of LEDGF/p75 inhibitors (LEDGINs), which represents a new and promising therapeutic strategy [24]. Functional studies correlating the integration site environment and provirus transcription have mostly focused on the HIV latent reservoir—a population of proviruses with epigenetically silenced expression in certain cell niches [25]. Early studies suggested the importance of the proper genomic environment for retroviral expression [26,27]. Analysis of latently infected cellular clones suggested gene deserts, centromeric heterochromatin and, surprisingly, highly active genes as target sites that promote provirus silencing [28]. At these target sites, HIV copies are assumed to be more vulnerable to the executive mechanisms of provirus silencing such as DNA methylation and histone modifications [29–31]. Nevertheless, the association of genomic features with silenced proviruses is less clear when fractions of latently HIV-infected cells have been studied in primary human T cells or a T cell line [32]. Quite recently, retargeting of HIV integration away from active genes was reported to increase the latent reservoir and reduce the reactivation by latency-reversing agents [33]. The proviral activity and reactivation potential can also correlate with the distance to H3K27 acetylated sites [34], which are markers of active promoters and enhancers. In parallel to HIV, the link between integration sites and proviral expression has also been studied in ASLV-infected mammalian cells. Non-avian cells are not permissive for ASLV [35,36] and ASLV proviruses are efficiently silenced [37,38]. Therefore, the selection of genomic sites supporting proviral expression is quite stringent. We have shown that the mechanism of ASLV silencing depends on position of the provirus in the genome. When integrated within the body of transcribed genes, proviral expression is silenced in a de novo DNA methyltransferase-dependent manner whereas outside of genes, the silencing is DNA methylation-independent [39]. Proviruses integrated in a close proximity to highly active transcription start sites remain mostly unaffected by silencing [39,40]. ASLV silencing within gene bodies can be overcome by the insertion of CpG-island core elements, which protect proviral long terminal repeats (LTR) from methylation [40,41]. In this case, stably active proviruses were found not only in the proximity to active TSS but also in distal parts of the active gene bodies and close to active enhancers. Our studies have shown that ASLV is a valuable tool for the study of Viruses 2018, 10, 116 3 of 17 the relationship between integration site and proviral expression, which must be studied in both a Viruses 2018, 10, x FOR PEER REVIEW 3 of 16 genomic and epigenomic context. In thethe study present of the study, relationship we compared between the integration patterns site of and provirus proviral expression expression, inwhich single must cell be clones studied infected with retroviralin both a vectorsgenomic derivedand epigenomic from ASLV,context. HIV and MLV. The analysis of integration sites of stably active provirusesIn the showedpresent study, that somewe compared genomic the and patterns epigenomic of provirus features, expression especially in single proximity cell clones to active regulatoryinfected segments, with retroviral correlate vectors with derived stable from provirus ASLV, expression HIV and MLV. ofvarious The analysis retroviral of integration species. sites of stably active proviruses showed that some genomic and epigenomic features, especially proximity 2. Materialsto active and regulatory Methods segments, correlate with stable provirus expression of various retroviral species. 2. Materials and Methods 2.1. Construction of the Retroviral Vectors The2.1. construction Construction of the plasmids Retroviral used Vectors for the propagation of LTR-driven enhanced green fluorescent protein (EGFP)-expressingThe construction vectorsof plasmids (EV731, used pLGfor the and propagation pAG3, see of Figure LTR-dr1A)iven derived enhanced from green HIV, MLV and ASLV,fluorescent respectively, protein was(EGFP)-expressing described previously vectors (EV731, [26,39 pLG,42 ].and HIV-1-derived pAG3, see Figure vector 1A) derived is bicistronic from with HIV, MLV and ASLV, respectively, was described previously [26,39,42]. HIV-1-derived vector is transactivating Tat gene necessary for the elongation phase of HIV-1 LTR driven transcription, internal bicistronic with transactivating Tat gene necessary for the elongation phase of HIV-1 LTR driven ribosomaltranscription, entry site internal (IRES) ribosomal and EGFP entry (Figure site (IRES)1A). and EGFP (Figure 1A).

Figure 1.FigureVectors 1. Vectors and the and methodological the methodological approach approach used in in this this study study to isolate to isolate single-cell single-cell clones with clones with stable active proviruses. (A) Schematic representation of retroviral vectors. Avian sarcoma/leukosis stable active proviruses. (A) Schematic representation of retroviral vectors. Avian sarcoma/leukosis virus (ASLV)- and murine leukaemia virus (MLV)-based vectors are of the same structure containing virus (ASLV)-just the andrespective murine long leukaemia terminal repeats virus (LTR) (MLV)-based and enhanced vectors green are fluorescent of the same protein structure (EGFP)containing for just theproviral respective activity long detection. terminal The repeats human immunodeficiency (LTR) and enhanced virus (HIV green)-based fluorescent vector contains protein deleted (EGFP) for proviralfragments activity detection.of gag, env and The nef human genes, full-length immunodeficiency tat and EGFP virus genes (HIV)-based and internal ribosomal vector contains entry site deleted fragments(IRES). of gag, Transcription env and nefstartgenes, sites (T full-lengthSS) are denoted tat andby broken EGFP arrows. genes andψ, packaging internal signal. ribosomal (B) The entry site (IRES). Transcriptionworkflow in obtaining start sitesthe single-cell (TSS) are clones. denoted K562 bycell brokenline was arrows.transducedψ with, packaging low multiplicity signal. of ( B) The infection (MOI) of VSV-G-pseudotyped ASLV-, MLV- or HIV-based vectors. Three days post infection workflow in obtaining the single-cell clones. K562 cell line was transduced with low multiplicity of (dpi), Green fluorescent protein positive (GFP+) cells were single-cell sorted to a 96-well plate and infectioncellular (MOI) clones of VSV-G-pseudotyped were established. Cellular ASLV-, clones MLV- were or examined HIV-based for the vectors. percentage Three of daysGFP+ cells post 30 infection + (dpi), Greenand 60 fluorescent dpi by flow protein cytometry. positive Clones (GFP containing) cells ≥90% were of single-cellGFP+ cells were sorted subjected to a 96-well to further plate and cellularexamination clones were of established. proviral integration Cellular sites. clones were examined for the percentage of GFP+ cells 30 and 60 dpi by flow cytometry. Clones containing ≥90% of GFP+ cells were subjected to further examination of proviral2.2. Cell Culture integration and Virus sites. Propagation Propagation of retroviral vector AG3 using the AviPack packaging cell line was part of the 2.2. Cellprevious Culture andstudy Virus and Propagationis described there [39]. MLV-based LG vector was propagated as described previously [42]. Briefly, GP-293 packaging cell line (Clontech, Mountain View, CA, USA) was calcium Propagationphosphate co-transfected of retroviral with vector 50 μ AG3g pLG using and 10 the μg AviPackpVSV-G plasmids packaging (Clontech). cell line HIV-derived was part of the previousvector study was and produced is described by HEK293T there cell [39 line]. calcium MLV-based phosphate LG co-transfection vector was propagated of 10 μg of pEV731 as described previously(LTR-Tat-IRES-EGFP-LTR [42]. Briefly, GP-293 vector packaging the pHR’ cell series line (Clontech,[26]), 10 μg Mountainof psPAX2 View,(Clontech) CA, and USA) 10 wasμg of calcium pVSV-G (Clontech). Viral stocks were collected 48 h after transfection, frozen and stored in −80 °C. phosphate co-transfected with 50 µg pLG and 10 µg pVSV-G plasmids (Clontech). HIV-derived Titration of the infectious virus stock was performed by serial dilution and subsequent infection of vector was produced by HEK293T cell line calcium phosphate co-transfection of 10 µg of pEV731 (LTR-Tat-IRES-EGFP-LTR vector the pHR’ series [26]), 10 µg of psPAX2 (Clontech) and 10 µg of pVSV-G (Clontech). Viral stocks were collected 48 h after transfection, frozen and stored in −80 ◦C. Titration of the infectious virus stock was performed by serial dilution and subsequent infection of Viruses 2018, 10, 116 4 of 17

K562 cells. Three days post infection (dpi), the number of GFP-positive (GFP+) cells was counted by LSRII ﬂow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA). The GP-293 and HEK293 cell lines were maintained in D-MEM/F12 (Sigma, St. Louis, MO, USA) with 5% new-born calf serum, 5% foetal calf serum (both Gibco BRL, Waltham, MA, USA) and penicillin/streptomycin (100 mg/mL ◦ each, Sigma) in a 5% CO2 atmosphere at 37 C. K562 human myeloid lymphoblastoma cell line was maintained in RPMI 1640 supplemented with 5% new-born calf serum, 5% foetal calf serum and ◦ penicillin/streptomycin (100 mg/mL each, Sigma) in a 5% CO2 atmosphere at 37 C.

2.3. Infection and Subcloning of K562 Cells The K562 cell line was infected and single-cell sorting was performed according to the previously described protocol [40]. Cells were infected with low multiplicity of infection (MOI) to ensure that the amount of GFP+ cells 3 dpi did not exceed 1% of infected cell culture. Three dpi, GFP+ cells were sorted in single-cell sort mode using an Inﬂux cell sorter (Becton-Dickinson, Franklin Lakes, NJ, USA) into 96-well tissue culture plates to obtain single-cell clones. Expanded clones were sub-cultured by passaging 25% of the cells three times a week. The percentage of GFP+ cells was assessed 30 and 60 dpi with the LSRII cytometer. Clones containing ≥90% GFP+ cells in the clonal population 60 dpi were arbitrarily regarded as stably expressing clones. For ASLV and HIV-1 clones, genomic DNA was isolated separately from each clone. In the case of MLV, clones exhibiting stable GFP expression were pooled and collected for DNA isolation.

2.4. Cloning and Sequencing of Provirus Integration Sites The provirus-cell DNA junction sequences were amplified using the splinkerette-PCR method [43]. The protocol for the cloning and sequencing of ASLV integration sites was described previously [40]. Briefly, a splinker adapter was ligated to restriction enzyme-digested genomic DNA of each clone and nested PCR followed by Sanger sequencing was performed. For digestion of genomic DNA, different restriction enzymes compatible with the sequence of proviral DNA were chosen. For HIV, NlaIII, MseI, or a mix of SpeI, NheI and XbaI (SNX mix) was used. NlaIII was used in the first digestion reaction for MLV-transduced clones. After the ligation of splinker adaptors, PvuII (HIV) or ClaI (MLV) was used in the second digestion to prevent possible amplification of inner proviral sequences. For nested PCR, the following LTR-specific primers were used: HIV-1 spLTR: TATCTGATCCCTGGCCCTGGTGTGTAG, HIV-1 spinLTR: CTGCCAATCAGGGAAGTAGCCTTGTGTG, MLV spLTR: TTCCATGCCTTGCAAAATGGCGT, MLV spinLTR: TGGCGTTACTTAAGCTAGCTTGCC.

2.5. Mapping and Genomic Characterization of Provirus Integration Sites All junction sequences containing the end of 5’LTR and the unique cellular DNA sequence obtained from the splinkerette PCR were mapped to the Feb. 2009 human genome assembly (hg19) using BLAT found on the UCSC Genome Browser website (http://genome.ucsc.edu/). Genomic coordinates of the LTR-proximal nucleotide of the obtained genomic sequences with unique score were considered as positions of integration.

2.6. Uniquely Mapped Matched Random Controls To create a set of random genomic positions with position-to-restriction enzyme-recognized site distribution, the restrSiteUtils_1.2.8 R package was used [44]. A set of 200 matched random positions per integration site was generated. Genomic sequences covering ranges from random position to restriction enzyme-recognized site were extracted from hg19 assembly using Biostrings R package [45] for each matched random position. Sequences were mapped to hg19 assembly using BLAT and sequences with single full-length match with ≥98% identity were accepted as uniquely mapped matched random controls (umMRCs). Three umMRCs per integration site were randomly selected and used as controls in subsequent analysis. Viruses 2018, 10, 116 5 of 17

2.7. Data Source and Integration Site Analysis Genomic and epigenomic data for in silico analysis of features associated with integration sites and umMRCs were obtained from UCSC golden path (http://hgdownload.cse.ucsc.edu/goldenPath/hg19/ database/). The sources are described in more detail in [40]. Data for cap analysis of gene expression (CAGE)-peak positions (FANTOM Consortium and the RIKEN PMI and CLST (DGT)) were obtained from the web-based data source (http://fantom.gsc.riken.jp/5/). Analysis of distances from, and the frequency of, targeting of the features was performed using the GenomicRanges R package [46].

2.8. Active Genes A RefSeq Gene was considered to be active if its TSS was either within the H3K4me3 peak (for the selection of histone modiﬁcation peaks see [40]), or within the Tss chromatin segment, or within the distance of 500 bp from the nearest CAGE peak TSS (FANTOM Consortium and the RIKEN PMI and CLST (DGT)). Three groups of active genes/TSS were analysed separately.

2.9. Merged Chromatin Segments In order to simplify the analysis associating integrated proviruses to chromatin states, twenty-ﬁve chromatin segments that were generated using Hidden Markov Model-based modelling [47] were merged by the itemRGB ﬁeld to create Active chromatin segments and Regulatory segments. The active chromatin segments group contains 18 segments including Tss, TssF, PromF, PromP, Enh, EnhF, EnhW, EnhWF, DnaseD, DnaseU, FaireW, Gen5, Elon, ElonW, ElonWF, Gen3, H4K20 and Low segments. The regulatory segments group consists of 11 segments including Tss, TssF, PromF, PromP, Enh, EnhF, EnhW, EnhWF, DnaseD, DnaseU and FaireW.

2.10. Active Gene Matched Random Controls One thousand umMRCs per integration site were generated. For each umMRC, the distance to active RefSeq genes whose TSSs associated with a Tss chromatin segment was counted in the same manner as performed for integration site analysis. For each integration site, the three umMRCs with the most similar distance to an active gene when compared to integration site were randomly selected.

2.11. Statistics R software version 3.3.2. was used for statistical analysis. To count the p-value of the frequencies of targeting the features Fisher’s Exact Test for Count Data was used. To count the p-value of the distances to the features, Wilcoxon signed rank test was used.

3. Results

3.1. Stability of Proviral Expression To examine the stability of proviral expression, we used vectors derived from HIV and MLV in a clonal assay, which is schematically depicted in Figure1B. A miniviral vector transducing EGFP as an expression marker was pseudotyped with VSV-G and used to transduce the human myeloblastoma cell line K562. Three dpi, cells that were positive for GFP expression (GFP+) were single-cell sorted and expanded to clonal populations. The established cellular clones were then examined for the number of cells expressing EGFP at 30 and 60 dpi. Clones containing at least 90% GFP+ cells 60 dpi were regarded as clones which contain stably active proviruses. For comparison, we included the dataset of K562 clones containing the ASLV-derived pAG vector. These clones were obtained in analogous experiment described by Senigl et al. [40] (pAG3 vector). The percentages of GFP+ cells were determined in 2128 ASLV, 378 HIV and 239 MLV-transduced cell clones at 30 dpi. ASLV was effectively silenced in the K562 cell line with only 11.5% of the clones (245) maintaining provirus expression. In contrast, more than 80% of HIV- and MLV-transduced Viruses 2018, 10, 116 6 of 17

Viruses 2018, 10, x FOR PEER REVIEW 6 of 16 clones (262 and 239, respectively) maintained stable expression at 30 dpi (Figure2A). The clones with stable provirus(245) maintaining expression provirus 30 dpi expression. were cultured In contrast, for more additional than 80% 30 of days HIV- and and the MLV-transduced percentage of GFP+ clones (262 and 239, respectively) maintained stable expression at 30 dpi (Figure 2A). The clones with cells was calculated again at 60 dpi. Whereas almost all MLV-transduced clones (202) maintained stable provirus expression 30 dpi were cultured for additional 30 days and the percentage of GFP+ proviruscells expression, was calculated the numbers again at 60 of dpi. clones Whereas with almo stablest ASLVall MLV-transduced and HIV expression clones (202) further maintained decreased to 3% (74)provirus and 49% expression, (136), respectively the numbers (Figureof clones2 withB). Thus, stable ASLV MLV and provirus HIV expression expression further was decreased deemed to be long-termto 3% stable. (74) and HIV 49% provirus (136), respectively expression (Figure was 2B). observed Thus, MLV to be provirus stable expression during short was deemed cultivation to be (30 dpi) but displayedlong-term gradual stable. HIV silencing provirus when expression cultured was observed for a longer to be stable period. during We short also cultivation used the (30 FACS dpi) data to assess thebut GFPdisplayed ﬂuorescence gradual silencing intensity when produced cultured byfor ASLV,a longer HIV period. and We MLV also vectorsused the inFACS clones data expanded to assess the GFP fluorescence intensity produced by ASLV, HIV and MLV vectors in clones expanded 30 dpi. HIV30 dpi. proviruses HIV proviruses displayed displayed the the highest highest GFPGFP fluorescence ﬂuorescence intensity, intensity, followed followed by MLV by and MLV ASLV and ASLV (Supplementary(Supplementary Figure Figure S1). S1).

Figure 2.FigureDifferential 2. Differential expression expression stability stability of of vectors. vectors. ( (AA) )The The percentage percentage of clones of clones with stable with stableactive active proviruses (≥90% GFP+ cells) at 30 dpi (blue columns) and 60 dpi (red columns). 100% represents the proviruses (≥90% GFP+ cells) at 30 dpi (blue columns) and 60 dpi (red columns). 100% represents the number of clones obtained after single-cell sorting of GFP+ cells 3 dpi. (B) The percentage of GFP+ cells + + numberin of single-cell clones obtainedclones analysed after at single-cell 30 and 60 dpi. sorting Each clone of GFP is represencellsted 3 dpi. by one (B )blue The (30 percentage dpi) and one of GFP cells in single-cellred (60 dpi) clonesdot at the analysed same position at 30 along and 60 the dpi. x-axis. Each In most clone cases, is represented the red dot is by lower one along blue the (30 y dpi)- and one redaxis (60 than dpi) the dot blue at dot, the which same represents position the along silenc theing x-axis.of GFP expression In most cases,between the 30 and red 60 dot dpi. is Along lower along the y-axisthe than x-axis, the clones blue are dot, ordered which by represents the percentage the of silencing GFP+ cells of at GFP 30 dpi. expression The dashed between line marks 30 andthe 60 dpi. + Along thevaluex-axis, of 90% clones of GFP are cells. ordered The numbers by the of percentage clones analysed of GFP up to+ cells60 dpi at are 30 depicted. dpi. The dashed line marks + the3.2. value Gene of Targeting 90% of GFP and Distancecells. The to TSS numbers of clones analysed up to 60 dpi are depicted.

+ 3.2. Gene TargetingCell clones and infected Distance with to ASLV-, TSS HIV- and MLV-derived vectors containing ≥90% of GFP cells at 60 dpi were subjected to splinkerette PCR in order to amplify and sequence the provirus integration Cellsites. clones ASLV- infected and HIV-transduced with ASLV-, HIV-clones andwere MLV-derived analysed individually, vectors whereas containing the MLV-transduced≥90% of GFP+ cells at 60 dpi wereclones subjected were pooled to splinkeretteand analysed PCRen masse, in order becaus toeamplify these clones and are sequence uniform theas to provirus the provirus integration stability (Figure 2B) and their individual analysis does not provide any additional information. We sites. ASLV- and HIV-transduced clones were analysed individually, whereas the MLV-transduced identified 45 HIV and 32 MLV integration sites, which are together with 46 ASLV integration sites clones weregiven in pooled Supplementary and analysed Table S1. en To masse,each set of because integration these sites, clones uniquely are mapped uniform matched as to random the provirus stabilitycontrols (Figure (umMRC)2B) and were their generated. individual These analysiscontrols ex doeshibit the not same provide distribution any of additional distances from information. the We identifiedrecognition 45 HIVsites andof a given 32 MLV restriction integration enzyme sites, and the which sequences are together of the control with site 46 ASLVfulfilled integration the sites givencriteria in Supplementaryfor uniquely mappable Table sequences S1. To each (Section set of2). integrationThree umMRCs sites, per uniquely integration mapped site were matched randomgenerated controls (Supplemen (umMRC)tary were Table generated. S2). These controls exhibit the same distribution of distances from the recognition sites of a given restriction enzyme and the sequences of the control site fulfilled the criteria for uniquely mappable sequences (Section2). Three umMRCs per integration site were generated (Supplementary Table S2). First, we analysed the frequency of integration into transcription units (TU, classified as genes in the RefSeq database) and the orientation of proviruses relative to transcription of targeted RefSeq Genes Viruses 2018Viruses, 10 2018, 116, 10, x FOR PEER REVIEW 7 of 16 7 of 17

First, we analysed the frequency of integration into transcription units (TU, classified as genes (Figurein3 A,B).the RefSeq ASLV database) and HIV and proviruses the orientation with of stable provir expressionuses relative were to transcription found to have of targeted the same RefSeq frequency Genes (Figure 3A,B). ASLV and HIV proviruses with stable expression were found to have the same of approximately 80% in RefSeq Genes, which means a signiﬁcant increase compared to umMRCs. frequency of approximately 80% in RefSeq Genes, which means a significant increase compared to On theumMRCs. other hand, On thethe frequencyother hand, of the MLV frequency stably of expressed MLV stably proviruses expressed found proviruses in RefSeq found Genes in RefSeq was lower than thatGenes of ASLVwas lower and HIVthan andthat were of ASLV comparable and HIV to and respective were comparable umMRCs. to Interestingly, respective umMRCs. the orientation of provirusesInterestingly, relative the toorientation targeted RefSeqof proviruses Genes relative showed to differenttargeted RefSeq patterns Genes for differentshowed different vectors. ASLV stablypatterns expressed for provirusesdifferent vectors. showed ASLV a preponderance stably expressed of provirusesproviruses withshowed sense a preponderance orientations toof RefSeq Genesproviruses transcription with ( psense= 0.0225, orientations Fisher’s to ExactRefSeq Test Genes for transcription Count Data). (p = HIV 0.0225, proviruses Fisher’s Exact displayed Test for an equal Count Data). HIV proviruses displayed an equal proportion of proviruses in sense or antisense proportion of proviruses in sense or antisense orientations to endogenous transcription. A striking orientations to endogenous transcription. A striking majority of MLV proviruses were found in majorityantisense of MLV orientation proviruses compared were found to that inof antisensetargeted RefSeq orientation Genes ( comparedp = 0.0489, Fisher’s to that Exact of targeted Test forRefSeq GenesCount (p = 0.0489, Data). Fisher’s Exact Test for Count Data).

Figure 3. Analysis of genomic features at the integration sites of stable active proviruses. (A) Figure 3. Analysis of genomic features at the integration sites of stable active proviruses. (A) Percentage Percentage of proviruses identified inside RefSeq Genes. (B) Orientation of proviruses inside RefSeq of proviruses identiﬁed inside RefSeq Genes. (B) Orientation of proviruses inside RefSeq Genes relative Genes relative to the transcription of targeted genes. (C) Distance of proviruses to the nearest TSS of to the transcriptionRefSeq Genes (in of targetedkb). (D) Distribution genes. (C) Distanceof proviruses of provirusesaround TSS. to The the positive nearest values TSS of mark RefSeq the Genes (in kb).distance (D) Distribution downstream of from proviruses RefSeq Gene around TSS. TSS.umMRC, The uniquely positive mapped values markmatched the random distance control. downstream from RefSeq Gene TSS. umMRC, uniquely mapped matched random control. Next, we measured the distance of stably expressed proviruses from the transcriptional start sites (TSS) of the RefSeq Genes (Figure 3C). All groups of proviruses accumulated significantly closer Next, we measured the distance of stably expressed proviruses from the transcriptional start to TSS in comparison to respective umMRCs with medians of distances well below 20 kb. We also sites (TSS)observed of the a similar RefSeq accumulation Genes (Figure close3C). to CpG All groupsislands for of provirusesASLV and MLV accumulated and, to a lesser signiﬁcantly extent, for closer to TSSHIV in comparison (Supplementary to respectiveFigure S2). We umMRCs also checked with th medianse distribution of distances of proviruses well around below TSS 20 (Figure kb. We also observed3D). a While similar ASLV accumulation and MLV proviruses close to CpG distribution islands fortended ASLV to centre and MLV in close and, proximity to a lesser of extent,the TSS, for HIV (SupplementaryHIV proviruses Figure distribution S2). We centred also checked at a distan thece distributionof 12 kb from TSS of proviruses inside the gene around body. TSS (Figure3D). While ASLVIn conclusion, and MLV proviruseswe have shown distribution the differential tended distributions to centre of in stably close expressed proximity proviruses of the TSS, of HIV ASLV, HIV and MLV. ASLV proviruses accumulated inside RefSeq Genes close to TSS and mostly in proviruses distribution centred at a distance of 12 kb from TSS inside the gene body. sense orientation to the gene transcription while proviruses of HIV also accumulated inside RefSeq InGenes conclusion, but in longer we distances have shown to TSS the and differential in both orientations. distributions There is ofno stablyoverrepresentation expressed of proviruses stably of ASLV,active HIV andMLV MLV. proviruses ASLV inside proviruses RefSeq Genes accumulated but they were inside mainly RefSeq distributed Genes around close to the TSS TSS and mostly mostly in sense orientationin the anti-sense tothe orientation. gene transcription while proviruses of HIV also accumulated inside RefSeq Genes but in longer distances to TSS and in both orientations. There is no overrepresentation of stably active3.3. MLV Stably proviruses Active Proviruses inside RefSeqAssociate Genes with Active but Genes they were mainly distributed around the TSS mostly in the anti-senseAs we orientation.have shown previously [39,40], the environment that is permissive for provirus expression can be correlated with the activity of targeted TUs. Therefore, we used a subset of RefSeq 3.3. StablyGenes, Active whose Proviruses TSS associated Associate with features with Active defining Genes active promoters, namely trimethylation of lysine

As we have shown previously [39,40], the environment that is permissive for provirus expression can be correlated with the activity of targeted TUs. Therefore, we used a subset of RefSeq Genes, whose TSS associated with features defining active promoters, namely trimethylation of lysine 4 at histone 3 (H3K4me3), a Tss chromatin segment defined by ChromHMM [48] or peaks of transcription defined by CAGE [49]. Approximately 20% of umMRCs targeted these active RefSeq Genes whereas VirusesViruses2018, 102018, 116, 10, x FOR PEER REVIEW 8 of 168 of 17

4 at histone 3 (H3K4me3), a Tss chromatin segment defined by ChromHMM [48] or peaks of the frequenciestranscription of defined proviral by integrationsCAGE [49]. Approximately were approximately 20% of umMRCs the same targeted for all RefSeq these active Genes RefSeq as well as the subsetGenes ofwhereas active RefSeqthe frequencies Genes (Figureof proviral3A, integrations Figure4A and were Figure approximately S3). The targetingthe same offor Activeall RefSeq RefSeq Genes as well as the subset of active RefSeq Genes (Figures 3A, 4A and S3). The targeting of Active Genes was signiﬁcantly higher than targeting of respective umMRCs not only for ASLV and HIV but RefSeq Genes was significantly higher than targeting of respective umMRCs not only for ASLV and also MLVHIV but (p = also 0.0148, MLV Fisher’s (p = 0.0148, Test Fisher’s for Count Test Data, for Count Figure Data,4A), Figure which 4A), was which not different was not indifferent targeting in the all RefSeqtargeting Genes the all and RefSeq respective Genes umMRCSand respective (Figure umMRCS3A). (Figure 3A).

FigureFigure 4. Transcriptionally 4. Transcriptionally active active genes genes targeted targeted by proviral by proviral integrations. integrations. (A) Percentage (A) Percentage of proviruses of proviruses identified inside RefSeq Genes associated with Tss chromatin state marking active TSS. identiﬁed inside RefSeq Genes associated with Tss chromatin state marking active TSS. Dashed whiskers Dashed whiskers show the original percentages of proviruses inside RefSeq Genes without selection show the original percentages of proviruses inside RefSeq Genes without selection for the presence of for the presence of the Tss chromatin state. (B) Distance of proviruses to cap analysis of gene B the Tssexpression chromatin (CAGE) state. peaks ( ) Distance that mark of the proviruses site of active to TSS. cap analysis(C) Transcriptional of gene expression activity of genes (CAGE) with peaks that markproviruses. the site Genes of activewere classified TSS. (C into) Transcriptional 5 groups according activity to their of mean genes read with per proviruses. kilobase per Genesmillion were classiﬁed(RPKM) into mapped 5 groups reads. according NA marks to group their meanwith no read or ve perry low kilobase transcriptional per million activity. (RPKM) Q1 to mappedQ4 groups reads. NA markscontain group the genes with with no orRPKM very ≥ low1, where transcriptional Q1 group represents activity. the Q1 lowest to Q4 groupsquartile containand Q4 the the highest genes with RPKMquartile.≥ 1, where Q1 group represents the lowest quartile and Q4 the highest quartile.

We observed the same effect at the level of distance from the TSS of active RefSeq Genes (Figure We observed the same effect at the level of distance from the TSS of active RefSeq Genes (Figure4B). 4B). Hits of umMRCs were distant to the TSSs of active RefSeq Genes in comparison to TSSs of all Hits ofRefSeq umMRCs Genes, were whereas distant proviral to the integration TSSs of active sites were RefSeq found Genes to be in of comparison similar distances to TSSs to ofTSSs all RefSeqof Genes,active whereas RefSeq proviral Genes as integration well as TSSs sites of all were RefSeq found Genes. to be of similar distances to TSSs of active RefSeq Genes asIn well order as TSSsto address of all the RefSeq activity Genes. of TUs targeted by integrations, we used publicly available RNA- Inseq order data as to described address previously the activity [40]. of Briefly, TUs targeted TUs were by divided integrations, into activity we usedgroups publicly according available to RNA-seqtheir mean data asread described per kilobase previously per million [40]. (RPKM) Brieﬂy, mapped TUs werereads dividedof RNA-seq into datasets. activity groupsIn accordingcorrespondence to their mean to the read previous per kilobaseselection perfor active million RefSeq (RPKM) Genes, mapped RNA-seq reads data of showed RNA-seq that datasets.the In correspondencetargeted TUs mostly to the exhibited previous transcriptional selection for activity active with RefSeq a RPKM Genes, ≥ 1 RNA-seq(Figure 4C). data showed that the These results demonstrated that the proviruses selected for stable transcriptional activity targeted TUs mostly exhibited transcriptional activity with a RPKM ≥ 1 (Figure4C). accumulated near the TSSs of active TUs, likely because of their active transcription-associated These results demonstrated that the proviruses selected for stable transcriptional activity chromatin environment, which is also permissive for provirus expression. accumulated near the TSSs of active TUs, likely because of their active transcription-associated chromatin3.4. Stably environment, Active Proviruses which Associate is also with permissive Active Chromatin for provirus and Active expression. Regulatory Segments

3.4. StablyEpigenetic Active Proviruses features of Associate the chromatin with Active environment Chromatin at the and site Active of integration Regulatory were Segments first described by comparing the distances of the proviruses and umMRC to peaks of eleven histone modifications Epigenetic(Supplementary features Figure of S4A) the chromatindefined for environmentthe K562 cell line at by the the site ENCODE of integration project. wereASLV, first HIV described and by comparingMLV proviruses the distances with stable of the transcriptional proviruses andactivi umMRCty accumulated to peaks in ofshort eleven distances histone to modificationspeaks of (Supplementaryepigenetic modifications Figure S4A) definedthat are for associated the K562 cellwith line active by the chromatin ENCODE but project. not with ASLV, markers HIV and of MLV provirusesheterochromatin. with stable A transcriptionalcommon feature activityof all groups accumulated of retroviral in vectors short distances was the short to peaks distance of epigeneticto the peaks of mono- and tri-methylated H3K4 and acetylated H3K9 and H3K27 histones (Figure 5A). HIV modifications that are associated with active chromatin but not with markers of heterochromatin. proviruses displayed a more relaxed pattern with the mean distance to the peaks of these four histone A common feature of all groups of retroviral vectors was the short distance to the peaks of mono- and modifications that was further way when compared to ASLV and MLV. tri-methylated H3K4 and acetylated H3K9 and H3K27 histones (Figure5A). HIV proviruses displayed a more relaxed pattern with the mean distance to the peaks of these four histone modifications that was further way when compared to ASLV and MLV. Viruses 2018, 10, 116 9 of 17

WeViruses then 2018 calculated, 10, x FOR PEER the REVIEW distances of the long-term active proviruses to the chromatin9 of segments,16 which are defined by the combination of genomic and epigenomic features that are specific for distinct functional partsWe then of genomecalculated specified the distances for of the the K562 long-ter cellm lineactive [47 proviruses]. First, we to the merged chromatin functionally segments, related which are defined by the combination of genomic and epigenomic features that are specific for chromatin segments creating broader segments of Active chromatin considering transcribed parts of distinct functional parts of genome specified for the K562 cell line [47]. First, we merged functionally genomerelated together chromatin with active segments promoters creating andbroader enhancers segments and of Active the Regulatory chromatin chromatinconsidering consideringtranscribed active promotersparts and of genome enhancers together (see Sectionwith active 2.9 promotand [40ers]) .and The enhancers stably active and the proviruses Regulatory of chromatin ASLV, HIV and MLV showedconsidering a close active association promoters withand enhancers active chromatin (see Section (Figure 2.9 and5 B[40]). top). The In stably fact, active the most proviruses stably active provirusesof ASLV, were HIV found and insideMLV showed some ofa close the 16association segments with associated active chromatin with Active (Figure chromatin.5B top). In fact, Stably the active provirusesmost were stably also active found proviruses in close were proximity found inside to the some merged of the Regulatory 16 segments segments, associated wherewith Active the highest chromatin. Stably active proviruses were also found in close proximity to the merged Regulatory mediansegments, distance where (ca 1.5 the kb) highest was median observed distance for HIV (ca 1. proviruses5 kb) was observed (Figure for5B HIV bottom). proviruses We (Figure then calculated 5B the distancesbottom). from We then all 25 calculated chromatin the statesdistances available from all (Supplementary 25 chromatin states Figure available S4B). (Supplementary In agreement with previousFigure results, S4B). theIn agreement proviruses with of previous all groups results, analysed the proviruses were of found all groups close analysed to the were chromatin found states associatedclose with to the active chromatin TSSs. states Even associated though with stably active active TSSs. HIV Even proviruses though stably showed active HIV signiﬁcantly proviruses longer distancesshowed to TSS significantly state than longer ASLV distances and MLV, to TSS these state differences than ASLV and were MLV, lost these when differences distances were to lost chromatin when distances to chromatin states flanking active TSS (TssF, PromF) were analysed. More states ﬂanking active TSS (TssF, PromF) were analysed. More interestingly, the stably active proviruses interestingly, the stably active proviruses of ASLV, HIV and MLV were found in close proximities to of ASLV,enhancer-associated HIV and MLV were chromatin found states. in close proximities to enhancer-associated chromatin states.

Figure 5. Epigenetic features at the integration sites of stably expressed ASLV, HIV and MLV proviruses. Figure 5. Epigenetic features at the integration sites of stably expressed ASLV, HIV and MLV proviruses. (A) Distances of proviruses to the peaks of selected histone modifications that are associated with active (A) Distancespromoters of provirusesand enhancers. to the(B) Distances peaks of of selected proviruses histone to merged modifications chromatin segments. that are associatedActive segments with active promotersare andchromatin enhancers. segments (B) which Distances are associated of proviruses with totranscriptionally merged chromatin active chromatin. segments. Regulatory Active segments are chromatinsegments segments are chromatin which segments are associated associated with with active transcriptionally promoters and enhancers. active chromatin. (C) Distances Regulatory of segmentsproviruses are chromatin to 4 of the segments 25 chromatin associated segments with analys activeed, Tss, promoters transcriptional and start enhancers. site segment; (C) Distances Enh, of provirusesenhancer to 4 segment, of the 25 Elon, chromatin elongation segments segment and analysed, Quies, polycomb-repressed Tss, transcriptional segment. start The site distance segment; is Enh, measured as absolute distance to the nearest peak of a histone modification or a chromatin segment. enhancer segment, Elon, elongation segment and Quies, polycomb-repressed segment. The distance is Each dot represents a single provirus. Black dots, real integrations; grey dots, umMRCs. measured as absolute distance to the nearest peak of a histone modification or a chromatin segment. Each dotTogether, represents the a analysis single provirus. of epigenomic Black dots,and realfunctional integrations; landscape grey of dots, stably umMRCs. active proviruses showed that regardless of origin of provirus, stable expression of provirus associates within the Together,proximity the to analysis the genomic of epigenomic loci driving genomic and functional transcription. landscape Although of stably stably activeactive proviruses proviruses of showed ASLV and MLV were found closer to the features associated with an active TSS than HIV proviruses, that regardless of origin of provirus, stable expression of provirus associates within the proximity to the proviruses of all three groups were found to harbour enhancer-proximal loci. the genomic loci driving genomic transcription. Although stably active proviruses of ASLV and MLV were found3.5. Enhancer closer toProximity the features Is Not a associated Function of Active with anGene active Targeting TSS than HIV proviruses, the proviruses of all three groupsAs shown were in found Figure to 5B, harbour almost all enhancer-proximal the stably active proviruses loci. of ASLV, MLV and HIV were found inside or very close to active chromatin segments, active TSS and enhancers. Furthermore, the 3.5. Enhancer Proximity Is Not a Function of Active Gene Targeting As shown in Figure5B, almost all the stably active proviruses of ASLV, MLV and HIV were found inside or very close to active chromatin segments, active TSS and enhancers. Furthermore, the majority of stably active ASLV and HIV proviruses were found in genes. Therefore, we sought to investigate Viruses 2018, 10, 116 10 of 17 if the proximity to active TSS and enhancers can be reached by preferential targeting of active genes. For thisViruses purpose, 2018, 10 another, x FOR PEER level REVIEW of matching for umMRC was added by selecting umMRCs10 thatof 16 show a similar distance to the active RefSeq Genes as integration sites of stably active proviruses. A new group majority of stably active ASLV and HIV proviruses were found in genes. Therefore, we sought to of matchedinvestigate random if the controls proximity was to then active called TSS and active enha gene-matchedncers can be reached umMRC by preferential (agMRC, targeting see Section of 2 and Supplementaryactive genes. Table For S2). this Thepurpose, targeting another of activelevel of RefSeqmatching Genes for umMRC by real was integrations added by andselecting agMRCs is shown inumMRCs Supplementary that show a Figuresimilar distance S5A and to the active distances RefSeq to Genes TSS as of integration active RefSeq sites of Genes stably areactive found in Supplementaryproviruses. Figure A new S5B. group of matched random controls was then called active gene-matched umMRC (agMRC, see Section 2 and Supplementary Table S2). The targeting of active RefSeq Genes by real Figure6A displays the statistical significance of the differences in targeting or distance to integrations and agMRCs is shown in Supplementary Figure S5A and the distances to TSS of active genomicRefSeq or epigenomic Genes are found features in Supplementary between real Figure integrations S5B. and umMRC. Figure6B exemplifies the distances ofFigure agMRC 6A and displays real integrationsthe statistical to significance selected features of the differences (for the full in overview,targeting or see distance Supplementary to Figure S6A,B).genomic Asor epigenomic a result of features matching, between the real data integrations showed and no significantumMRC. Figure difference 6B exemplifies of active the RefSeq Genes targetingdistances of between agMRC stablyand real active integrations proviruses to selected and agMRCs. features For(for ASLV,the full the overview, distances see to most histoneSupplementary modifications Figures differed S6A,B). significantly As a result betweenof matching, agMRC the data and showed stably no expressedsignificant difference proviruses, of while active RefSeq Genes targeting between stably active proviruses and agMRCs. For ASLV, the distances differences in distances to some active chromatin segments were insignificant. Most importantly, to most histone modifications differed significantly between agMRC and stably expressed the stablyproviruses, expressed while proviruses differences in of distances ASLV wereto some significantly active chromatin associated segments were with insignificant. active TSS Most and strong enhancers.importantly, For the HIVthe stably and MLVexpressed dataset, proviruses the trend of ASLV depicting were significantly the loss of significantassociated with differences active TSS between stably activeand strong proviruses enhancers. and For agMRC the HIV in and the setMLV of datase activet, chromatinthe trend depicting segments the andloss theof significant preservation of the significantdifferences difference between stably for active active TSSproviruses and enhancersand agMRC wasin the notable. set of active Interestingly, chromatin segments the data and for HIV showedthe the preservation stably active of the proviruses significant difference were significantly for active TSSassociated and enhancers to was active notable. TSS Interestingly, and enhancers as the data for HIV showed the stably active proviruses were significantly associated to active TSS and well asenhancers to the histone as well marks as to characteristicthe histone marks for char thoseacteristic regulatory for those segments—H3K4 regulatory segments—H3K4 methylation and histonemethylation acetylation. and histone acetylation.

Figure 6.FigureComparison 6. Comparison of integration of integration sites ofsites stable of stable active active proviruses proviruses and and respective respective active active gene-matched gene- matched random controls. (A) Statistical p-values of differences between agMRC and integration sites random controls. (A) Statistical p-values of differences between agMRC and integration sites are are represented by coloured circles (genes), squares (peaks of histone modifications) and triangles represented(chromatin by coloured segments) circlesand aligned (genes), with x squaresaxis. agMR (peaksCs are created of histone to match modiﬁcations) the proviral integration and triangles (chromatinsites segments)with the frequency and aligned of targeting with RefSeq x axis. Genes agMRCs with areactive created TSS part to according match the to proviralthe chromatin integration sites withsegment the frequency classification. of Thin targeting dashed RefSeq lines mark Genes the p with-values active of 0.01, TSS 0.05 part and according0.1. Values outside to the chromatinthe segmentrange classiﬁcation. from 0.01 to 0.1 Thin are located dashed at linesthe lower/uppe mark ther edgep-values of the chart of 0.01, beyond 0.05 the and dashed 0.1. lines. Values Grey outside the rangesymbols from represent 0.01 to the 0.1 p-values are located of testing at integration the lower/upper sites against edge umMRC. of the (B) Examples chart beyond of the charts the dashed representing the values of agMRCs and proviral integration sites. From left to right: Tss+RefSeqTSS, lines. Grey symbols represent the p-values of testing integration sites against umMRC. (B) Examples absolute distance; Tss+RefSeqTSS, distribution around TSS; peaks of H3K4me1 enrichment; enhancer of the chartssegments. representing the values of agMRCs and proviral integration sites. From left to right: + + Tss RefSeqTSS, absolute distance; Tss RefSeqTSS, distribution around TSS; peaks of H3K4me1 enrichment; enhancer segments. Viruses 2018, 10, 116 11 of 17

Together, these data show that when real integration sites are compared to their matched controls that mimic the active gene targeting of proviruses, the close proximity to the features that are characteristic for active TSS and enhancers are preserved as a hallmark of stably active proviruses of ASLV, HIV and MLV.

4. Discussion The heterogeneity of proviral expression and the role of chromatin environment in proviral transcriptional activity, for example in HIV infection in vitro and in vivo, are still unclear as some controversies remain to be resolved (reviewed in [50,51]). In our study, we investigated the transcriptional stability of distinct retroviral vectors derived from ASLV, HIV and MLV and the association of long-term active proviruses with the functional genomic and epigenomic features at the site of integration. In our previous studies, we showed that most ASLV proviruses in human cells are effectively silenced and that rare transcriptionally stable proviruses strongly depend on their position in the host genome [39,40]. The long-term stable ASLV proviruses are preferentially found in close proximity downstream to active TSS. The same vectors equipped with CpG-island core sequences are less dependent on TSS-proximity but stably active proviruses are found close to the sites epigenetically characterized as active enhancers. In this study, we compared ASLV [40] with newly analysed stably active HIV and MLV proviruses. Unlike ASLV, the majority of HIV and MLV proviruses transcriptionally active early after infection were transcriptionally stable during the subsequent culturing. This confirmed the previous observation of cellular clones that were productively infected with HIV-derived vector, which kept the provirus expression stable for months after infection [52]. Our system which was based on the fluorescent reporter demonstrated that most proviruses active 3 dpi maintained their transcriptional activity for at least 30 dpi. For MLV, the majority of proviruses that were selected for reporter activity were transcriptionally stable up to 60 dpi. In contrast to ASLV, HIV and MLV are mammalian retroviruses whose LTRs contain enhancer sequences that resemble CpG-islands with Sp1 binding sites. Both HIV and MLV also preferentially integrate into specific functional regions: HIV prefers gene bodies of active TUs, whereas MLV preferentially integrates close to active TSS and enhancers. Either promoter properties or preferential integration into the transcription-permissive environment may play role in HIV and MLV stable expression and the effect of both factors should be addressed in future studies. An important issue of the splinkerette PCR is the comparison with random matched control, which normalizes the imperfect coverage of insertion sites and potentially biased amplification in multiplex PCR. Our datasets of integration sites were compared to random controls matched on several levels—the distance to restriction enzyme recognition sites, the mappability of the region and the distance to specific chromatin segment. Only significant differences compared to the random matched controls were used to draw conclusions. We found similar frequencies of stably active ASLV and HIV proviruses integrated in active RefSeq Genes. In the case of ASLV, their accumulation in active RefSeq genes results from the selection eliminating the silenced proviruses [40]. HIV proviruses are naturally targeted to these regions by the integration machinery and, correspondingly, most proviruses occur in the expression-permissive regions at the time of infection [2–5]. Unlike stably active ASLV proviruses, we found the selected HIV proviruses farther from the active TSS but in close proximity to the enhancers. We observed previously the similarly high frequency of selected proviruses in active genes and close to enhancers for the ASLV vector modified by CpG island core sequence [40]. The preference of enhancers was previously described as a hallmark of natural MLV [7,53] but not HIV integration. However, it was recently reported that active HIV proviruses compared to their silenced counterparts are closer to H3K27 acetylation-enriched regions, i.e. markers of active TSSs and enhancers. The proviruses which are silenced but can be reactivated by histone deacetylase inhibitors are found closer to H3K27 acetylation-enriched sites than the silent proviruses that do not respond to this treatment [34]. Also, Viruses 2018, 10, 116 12 of 17 Viruses 2018, 10, x FOR PEER REVIEW 12 of 16 thethe targetingtranscriptional of active activity TUs facilitated of HIV byproviruses LEDGF/p75 since seems the todisruption be important of forLEDGF/p75-integrase the transcriptional interactionactivity of HIVby LEDGINs proviruses increases sincethe the disruptionproportion ofof LEDGF/p75-integraselatent reactivation-resistant interaction reservoir by in LEDGINs the HIV proviralincreases population the proportion [33]. of latent reactivation-resistant reservoir in the HIV proviral population [33]. Stably activeactive proviruses proviruses of MLVof MLV did notdid accumulate not accumulate in active in RefSeq active Genes RefSeq but wereGenes concentrated but were concentratedaround TSSs, around with the TSSs, median with distance the median comparable distance tocomparable that observed to that in ASLVobserved and in with ASLV even and shorter with evendistances shorter around distances enhancers. around While enhancers. ASLV accumulated While ASLV close accumulated to active TSSs close and enhancersto active TSSs only afterand enhancerslong-term only selection after forlong-term proviral selection expression, for proviral MLV preferentially expression, targetedMLV preferentially active TSS targeted and enhancers active TSSdue toand the enhancers interaction due of integraseto the interaction with BET of proteins integrase [16 with–18]. BET Thus, proteins we cannot [16–18]. assess Thus, the contribution we cannot assessof selection the contribution to the distribution of selection of MLV to the proviruses distribution observed of MLV here. proviruses This could observed be studied here. This using could the beBET-independent studied using the gammaretroviral BET-independent vectors gammaretroviral that integrate vectors outside that theactive integrate TSS outside and enhancers the active [20 TSS,21]. andIn this enhancers context, a[20,21]. recent In study this [22context,] reported a recent that thestudy next-generation [22] reported BET-independent that the next-generation MLV-derived BET- independentvectors showed MLV-derived the same stability vectors of showed expression thewithout same stability genotoxicity of expression when compared without to genotoxicity a wild-type whenMLV-derived compared vector. to a wild-type MLV-derived vector. The weak preference of ASLV integration for active genes and close-to-random distribution of non-selected ASLVASLV proviruses proviruses is is advantageous advantageous for for insertional insertional tumorigenesis tumorigenesis studies. studies. Malhotra Malhotra et al. et [ 54al.] [54]compared compared the integration the integration pattern pattern of ALVs of inALVs cultured in cultured cells and cells B-cell and lymphomas, B-cell lymphomas, the most the common most commonmalignancies malignancies caused by caused ALV. by In ALV. accordance In accordance with the with clonal the hypothesis, clonal hypothesis, authors authors observed observed strong strongselection selection for proximity for proximity to TSS to during TSS during the progression the progression and evenand even metastasis metastasis of tumours. of tumours.TERT TERTand andMyb Mybgenes genes were were found found among among the the most most clonally clonally expanded expanded integrations integrations showing showing thethe link between thethe provirus provirus accumulation and and common common integration integration sites sites widely widely studied studied using using ALV ALV [55,56]. [55,56]. We We also previously studied the distribution of acutely transforming ASLV ASLV proviruses in solid tumours that grow duedue toto the the provirus/oncogene provirus/oncogene expression. expression. We We observed observed here here accumulation accumulati ofon proviruses of proviruses in genes in genestranscriptionally transcriptionally active inactive a broad in a rangebroad ofrange tissues of tissues and avoiding and avoiding of genes of transcribedgenes transcribed in a tissue-specific in a tissue- specificmanner manner [57]. [57]. Based on our comparison comparison of of stably stably active active ASLV, ASLV, HIV and MLV proviruses, we suggest that the proximity to an active TSS is important for the stablestable expression of proviruses with silencing-prone promoters such such as as ASLV ASLV and and HIV, HIV, whereas whereas the the proxim proximityity to to enhancers enhancers favours favours the the stable stable activity activity of provirusesof proviruses with with silencing-resistant silencing-resistant promoters promoters such suchas MLV as MLVor our or previously our previously described described ASLV vector ASLV artificiallyvector artificially equipped equipped with a CpG with island a CpG core island sequence core sequence[40]. Interestingly, [40]. Interestingly, transcriptionally transcriptionally active HIV provirusesactive HIV located proviruses near located enhancers near were enhancers found were inside found active inside TUs similarly active TUs assimilarly was observed as was with observed CpG- island-modifiedwith CpG-island-modified ASLV [40]. Therefore, ASLV [40]. we Therefore, can hypo wethesize can hypothesizethat the TU bodies, that the the TU most bodies, densely the CpG- most methylateddensely CpG-methylated genomic regions genomic [58,59], regions represent [58 ,a59 tr],anscription-permissive represent a transcription-permissive environment for environment proviruses thatfor proviruses are resistant that to areDNA resistant methylation, to DNA e.g. methylation, due to the presence e.g. due toof thea CpG presence island ofwithin a CpG their island LTRs within (see thetheir model LTRs in (see Figure the model 7). in Figure7).

Figure 7. TheThe model model recapitulating recapitulating the the distribution distribution of of stably stably active active proviruses proviruses with with regard regard to the genomic andand epigenomicepigenomic features features of of the the integration integration sites. sites. Yellow Yellow arrows, arrows, MLV; MLV; green, green, HIV, blue,HIV, ASLV.blue, ASLV. Although our data points to the importance of chromatin content in proviral transcriptional Although our data points to the importance of chromatin content in proviral transcriptional activity, further studies that include the analysis of a larger set of integration sites together with activity, further studies that include the analysis of a larger set of integration sites together with single-provirus expression proﬁles will be needed to conﬁrm the proposed model. Our clonal approach single-provirus expression profiles will be needed to confirm the proposed model. Our clonal used here and in previous studies offers a longitudinal record of single provirus expression and approach used here and in previous studies offers a longitudinal record of single provirus expression and correlation with the properties of respective integration site. The drawback of this method, the labour intensity and low throughput, has recently been overcome by Chen et al. [34], who coupled

Viruses 2018, 10, 116 13 of 17 correlation with the properties of respective integration site. The drawback of this method, the labour intensity and low throughput, has recently been overcome by Chen et al. [34], who coupled the single provirus approach with high-throughput methods. Also, the retargeting strategies that are now available could be used to solve the question of whether the integration site plays an important role in the stability of provirus expression. The results of this study are important particularly for the design of retroviral vectors. Our data shows that proviruses selected for their long-term expression stability accumulate at transcriptionally active chromatin in the vicinity of regulatory elements such as promoters and enhancers. This raises the risk of genotoxicity and clonal expansion, which should be taken into account and addressed in future studies.

Supplementary Materials: The following are available online at www.mdpi.com/1999-4915/10/3/116/s1. Figure S1: Relative GFP fluorescence intensity in cell clones transduced with ASLV, HIV and MLV reporter proviruses and expanded 30 dpi. The relative GFP fluorescence is calculated as median intensity of GFP+ cells/minimal median intensity of GFP- clones of the same group. All clones of a given provirus (black dots) are compared with clones selected as stable during the subsequent culture (green dots); Figure S2: Distances of proviral integration sites to the nearest CpG island. Each dot represents a single provirus. Black dots, real integrations; grey dots, umMRCs; Figure S3: Frequency of proviruses integrated in the RefSeq Genes. Percentage of proviral integration sites and umMRCs in all RefSeq Genes (All) or RefSeq Genes filtered by the overlap of RefSeq Genes TSS with markers of active TSS. Grey dashed lines mark the level of integrations into all RefSeq Genes. agMRC, active gene-matched random controls; Tss, TSS chromatin segment; H3K4me3, trimethylation of lysine 4 of histone 3; CAGE, cap analysis of gene expression peaks; Figure S4: A comprehensive overview of epigenetic features at the integration sites of stably expressed ASLV, HIV and MLV proviruses. (A) Distance of proviral integration sites and umMRCs to histone modification peaks. (B) Distance of proviral integration sites and umMRCs to chromatin segments; Figure S5: Targeting of active genes by proviral integrations and agMRCs. (A) Percentage of proviral integrations and agMRCs in all RefSeq Genes (All) or RefSeq Genes filtered by the overlap of RefSeq Genes TSS with markers of active TSS (Tss+, H3K4me3+ and CAGE+). (B) Distance to TSS of all RefSeq Genes or RefSeq Genes filtered by the overlap of RefSeq Genes TSS with marker of active TSS as in A. agMRC, active gene-matched random controls; Tss, TSS chromatin segment; H3K4me3, trimethylation of lysine 4 of histone 3; CAGE, cap analysis of gene expression peaks; Figure S6: Distance of integration sites and agMRCs to the peaks of histone modifications and chromatin segments. (A) Distance of proviral integration sites and umMRCs to histone modification peaks. (B) Distance of proviral integration sites and umMRCs to chromatin segments. agMRC, active gene-matched random controls; Table S1: The list and characterization of retrovirus integration sites analysed in this study. Retroviral vector (ASLV- HIV-, or MLV-derived), the serial number of the cell clone, targeted chromosome, integration position and orientation and restriction enzyme used for splinkerette PCR are given in the table; Table S2: The list and characterization of Matched Random Controls created for comparison with real integrations analysed in this study. The respective vector (ASLV-, HIV-, or MLV-derived), MRC type (either uniquely mapped matched random controls or active gene matched random controls), serial number of the integration site, targeted chromosome, genomic position and transcriptional orientation are given in the table. Acknowledgments: We thank Markéta Reinišová, Martina Slavková, Jan Vlasatý, Miroslav Auxt and Dana Kuˇcerová for technical assistance. This study was supported by grants Nos. 14-34873S and 15-24776S, awarded by the Czech Science Foundation. The work was also institutionally supported by RVO: 68378050 and NPU I: LO1419. Dalibor Miklík was supported by the Grant Agency of Charles University, project GAUK 816216. The funders had no role in any stage of study design, data collection or preparation of the manuscript. Author Contributions: Jiri Hejnar, Filip Šenigl and Dalibor Miklík conceived the study, designed experiments and drafted the manuscript. Dalibor Miklík and Filip Šenigl performed most of the cell culture and FACS experiments, cloned the provirus integration sites and analysed the genomic data. Dalibor Miklík created matched random control data sets and suggested the form of the data presentation. All authors carefully read and approved the final manuscript. Conflicts of Interest: The authors declare no conflict of interest.

References

1. Trinité, B.; Ohlson, E.C.; Voznesensky, I.; Rana, S.P.; Chan, C.N.; Mahajan, S.; Alster, J.; Burke, S.A.; Wodarz, D.; Levy, D.N. An HIV-1 replication pathway utilizing reverse transcription products that fail to integrate. J. Virol. 2013, 87, 12701–12720. [CrossRef][PubMed] 2. Elleder, D.; Pavlíˇcek,A.; Paˇces,J.; Hejnar, J. Preferential integration of human immunodeﬁciency virus type 1 into genes, cytogenetic R bands and GC-rich DNA regions: Insight from the human genome sequence. FEBS Lett. 2002, 517, 285–286. [CrossRef] Viruses 2018, 10, 116 14 of 17

3. Schröder, A.R.; Shinn, P.; Chen, H.; Berry, C.; Ecker, J.R.; Bushman, F. HIV-1 integration in the human genome favors active genes and local hotspots. Cell 2002, 110, 521–529. [CrossRef] 4. Wu, X.; Li, Y.; Crise, B.; Burgess, S.M. Transcription start regions in the human genome are favored targets for MLV integration. Science 2003, 300, 1749–1751. [CrossRef][PubMed] 5. Mitchell, R.S.; Beitzel1, B.F.; Schroder, A.R.W.; Shinn, P.; Chen, H.; Berry, C.C.; Ecker, J.R.; Bushman, J.D. Retroviral DNA integration: ASLV, HIV and MLV show distinct target site preferences. PLoS Biol. 2004, 2, e234. [CrossRef][PubMed] 6. Crise, B.; Li, Y.; Yuan, C.; Morcock, D.R.; Whitby, D.; Munroe, D.J.; Arthur, L.O.; Wu, X. Simian immunodeficiency virus integration preference is similar to that of human immunodeficiency virus type 1. J. Virol. 2005, 79, 12199–12204. [CrossRef][PubMed] 7. De Ravin, S.S.; Su, L.; Theobald, N.; Choi, U.; Macpherson, J.L.; Poidinger, M.; Symonds, G.; Pond, S.M.; Ferris, A.L.; Hughes, S.H.; et al. Enhancers are major targets for murine leukemia virus vector integration. J. Virol. 2014, 88, 4504–4513. [CrossRef][PubMed] 8. Narezkina, A.; Taganov, K.D.; Litwin, S.; Stoyanova, R.; Hayashi, J.; Seeger, C.; Skalka, A.M.; Katz, R.A. Genome-wide analyses of avian sarcoma virus integration sites. J. Virol. 2004, 78, 11656–11663. [CrossRef] [PubMed] 9. Barr, S.D.; Leipzig, J.; Shinn, P.; Ecker, J.R.; Bushman, F.D. Integration targeting by avian sarcoma-leukosis virus and human immunodeficiency virus in the chicken genome. J. Virol. 2005, 79, 12035–12044. [CrossRef] [PubMed] 10. Cherepanov, P.; Maertens, G.; Proost, P.; Devreese, B.; Van Beeumen, J.; Engelborghs, Y.; De Clercq, E.; Debyser, Z. HIV-1 integrase forms stable tetramers and associates with LEDGF/p75 protein in human cells. J. Biol. Chem. 2003, 278, 372–381. [CrossRef][PubMed] 11. Ciuffi, A.; Llano, M.; Poeschla, E.; Hoffmann, C.; Leipzig, J.; Shinn, P.; Ecker, J.R.; Bushman, F. A role for LEDGF/p75 in targeting HIV DNA integration. Nat. Med. 2005, 11, 1287–1289. [CrossRef][PubMed] 12. Vandekerckhove, L.; Christ, F.; Van Maele, B.; De Rijck, J.; Gijsbers, R.; Van den Haute, C.; Witvrouw, M.; Debyser, Z. Transient and stable knockdown of the integrase cofactor LEDGF/p75 reveals its role in the replication cycle of human immunodeficiency virus. J. Virol. 2006, 80, 1886–1896. [CrossRef][PubMed] 13. Marini, B.; Kertesz-Farkas, A.; Ali, H.; Lucic, B.; Lisek, K.; Manganaro, L.; Pongor, S.; Luzzati, R.; Recchia, A.; Mavilio, F.; et al. Nuclear architecture dictates HIV-1 integration site selection. Nature 2015, 521, 227–231. [CrossRef][PubMed] 14. Sowd, G.A.; Serrao, E.; Wang, H.; Wang, W.; Fadel, H.J.; Poeschla, E.M.; Engelman, A.N. A critical role for alternative polyadenylation factor CPSF6 in targeting HIV-1 integration to transcriptionally active chromatin. Proc. Natl. Acad. Sci. USA 2016, 113, 1054–1063. [CrossRef][PubMed] 15. Rasheedi, S.; Shun, M.C.; Serrao, E.; Sowd, G.A.; Qian, J.; Hao, C.; Dasgupta, T.; Engelman, A.N.; Skowronski, J. The cleavage and polyadenylation specificity factor 6 (CPSF6) subunit of the capsid-recruited pre-messenger RNA cleavage factor I (CFIm) complex mediates HIV-1 integration into genes. J. Biol. Chem. 2016, 291, 11809–11819. [CrossRef][PubMed] 16. Sharma, A.; Larue, R.C.; Plumb, M.R.; Malani, N.; Male, F.; Slaughter, A.; Kessl, J.J.; Shkriabai, N.; Coward, E.; Aiyer, S.S.; et al. BET proteins promote efficient murine leukemia virus integration at transcription start sites. Proc. Natl. Acad. Sci. USA 2013, 110, 12036–12041. [CrossRef][PubMed] 17. Gupta, S.S.; Maetzig, T.; Maertens, G.N.; Sharif, A.; Rothe, M.; Weidner-Glunde, M.; Galla, M.; Schambach, A.; Cherepanov, P.; Schulz, T.F. Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration. J. Virol. 2013, 87, 12721–12736. [CrossRef][PubMed] 18. De Rijck, J.; de Kogel, C.; Demeulemeester, J.; Vets, S.; El Ashkar, S.; Malani, N.; Bushman, F.D.; Landuyt, B.; Husson, S.J.; Busschots, K.; et al. The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites. Cell Rep. 2013, 5, 886–894. [CrossRef][PubMed] 19. Winans, S.; Larue, R.C.; Abraham, C.M.; Shkriabai, N.; Skopp, A.; Winkler, D.; Kvaratskhelia, M.; Beemon, K.L. The FACT complex promotes avian leukosis virus DNA integration. J. Virol. 2017, 91, e00082-17. [CrossRef][PubMed] 20. Aiyer, S.; Swapna, G.V.; Malani, N.; Aramini, J.M.; Schneider, W.M.; Plumb, M.R.; Ghanem, M.; Larue, R.C.; Sharma, A.; Studamire, B.; et al. Altering murine leukemia virus integration through disruption of the integrase and BET protein family interaction. Nucleic Acids Res. 2014, 42, 5917–5928. [CrossRef][PubMed] Viruses 2018, 10, 116 15 of 17

21. El Ashkar, S.; De Rijck, J.; Demeulemeester, J.; Vets, S.; Madlala, P.; Cermakova, K.; Debyser, Z.; Gijsbers, R. BET-independent MLV-based vectors target away from promoters and regulatory elements. Mol. Ther. Nucleic Acids 2014, 29, e179. [CrossRef][PubMed] 22. El Ashkar, S.; Van Looveren, D.; Schenk, F.; Vranckx, L.S.; Demeulemeester, J.; De Rijck, J.; Debyser, Z.; Modlich, U.; Gijsbers, R. Engineering next-generation BET-independent MLV vectors for safer gene therapy. Mol. Ther. Nucleic Acids 2017, 7, 231–245. [CrossRef][PubMed] 23. Hacein-Bey-Abina, S.; Von Kalle, C.; Schmidt, M.; McCormack, M.P.; Wulffraat, N.; Leboulch, P.; Lim, A.; Osborne, C.S.; Pawliuk, R.; Morillon, E.; et al. LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 2003, 302, 415–419. [CrossRef][PubMed] 24. Schrijvers, R.; De Rijck, J.; Demeulemeester, J.; Adachi, N.; Vets, S.; Ronen, K.; Christ, F.; Bushman, F.D.; Debyser, Z.; Gijsbers, R. LEDGF/p75-independent HIV-1 replication demonstrates a role for HRP-2 and remains sensitive to inhibition by LEDGINs. PLoS Pathog. 2012, 8, e1002558. [CrossRef][PubMed] 25. Jordan, A.; Bisgrove, D.; Verdin, E. HIV reproducibly establishes a latent infection after acute infection of T cells in vitro. EMBO J. 2003, 22, 1868–1877. [CrossRef][PubMed] 26. Jordan, A.; Defechereux, P.; Verdin, E. The site of HIV-1 integration in the human genome determines basal transcriptional activity and response to Tat transactivation. EMBO J. 2001, 20, 1726–1738. [CrossRef] [PubMed] 27. Skupsky, R.; Burnett, J.C.; Foley, J.E.; Schaffer, D.V.; Arkin, A.P. HIV promoter integration site primarily modulates transcriptional burst size rather than frequency. PLoS Comput. Biol. 2010, 6, e1000952. [CrossRef] [PubMed] 28. Lewinski, M.K.; Bisgrove, D.; Shinn, P.; Chen, H.; Hoffmann, C.; Hannenhalli, S.; Verdin, E.; Berry, C.C.; Ecker, J.R.; Bushman, F.D. Genome-wide analysis of chromosomal features repressing human immunodeficiency virus transcription. J. Virol. 2005, 79, 6610–6619. [CrossRef][PubMed] 29. Blažková, J.; Trejbalová, K.; Gondois-Rey, F.; Halfon, P.; Philibert, P.; Guiguen, A.; Verdin, E.; Olive, D.; Van Lint, C.; Hejnar, J.; et al. CpG methylation controls reactivation of HIV from latency. PLoS Pathog. 2009, 5, e1000554. [CrossRef][PubMed] 30. Kauder, S.E.; Bosque, A.; Lindqvist, A.; Planelles, V.; Verdin, E. Epigenetic regulation of HIV-1 latency by cytosine methylation. PLoS Pathog. 2009, 5, e1000495. [CrossRef][PubMed] 31. Trejbalová, K.; Kováˇrová, D.; Blažková, J.; Machala, L.; Jilich, D.; Weber, J.; Kuˇcerová, D.; Vencálek, O.; Hirsch, I.; Hejnar, J. Development of 5’LTR DNA methylation of latent HIV-1 provirus in cell line models and in long-term-infected individuals. Clin. Epigenet. 2016, 8, e19. [CrossRef][PubMed] 32. Sherrill-Mix, S.; Lewinski, M.K.; Famiglietti, M.; Bosque, A.; Malani, N.; Ocwieja, K.E.; Berry, C.C.; Looney, D.; Shan, L.; Agosto, L.M.; et al. HIV latency and integration site placement in five cell-based models. Retrovirology 2013, 10, e90. [CrossRef][PubMed] 33. Vranckx, L.S.; Demeulemeester, J.; Saleh, S.; Boll, A.; Vansant, G.; Schrijvers, R.; Weydert, C.; Battivelli, E.; Verdin, E.; Cereseto, A.; et al. LEDGIN-mediated Inhibition of Integrase-LEDGF/p75 Interaction Reduces Reactivation of Residual Latent HIV. EBioMedicine 2016, 8, 248–264. [CrossRef][PubMed] 34. Chen, H.C.; Martinez, J.P.; Zorita, E.; Meyerhans, A.; Filion, G.J. Position effects influence HIV latency reversal. Nat. Struct. Mol. Biol. 2017, 24, 47–54. [CrossRef][PubMed] 35. Svoboda, J.; Hejnar, J.; Geryk, J.; Elleder, D.; Vernerová, Z. Retroviruses in foreign species and the problem of provirus silencing. Gene 2000, 261, 181–188. [CrossRef] 36. Lounková, A.; Dráberová, E.; Šenigl, F.; Trejbalová, K.; Geryk, J.; Hejnar, J.; Svoboda, J. Molecular events accompanying rous sarcoma virus rescue from rodent cells and the role of viral gene complementation. J. Virol. 2014, 88, 3505–3515. [CrossRef][PubMed] 37. Hejnar, J.; Svoboda, J.; Geryk, J.; Fincham, V.J.; Hák, R. High rate of morphological reversion in tumor cell line H-19 associated with permanent transcriptional suppression of the LTR, V-SRC, LTR provirus. Cell Growth Differ. 1994, 5, 277–285. [PubMed] 38. Hejnar, J.; Plachý, J.; Geryk, J.; Machon, O.; Trejbalová, K.; Guntaka, R.V.; Svoboda, J. Inhibition of the rous sarcoma virus long terminal repeat-driven transcription by in vitro methylation: Different sensitivity in permissive chicken cells versus mammalian cells. Virology 1999, 255, 171–181. [CrossRef][PubMed] Viruses 2018, 10, 116 16 of 17

39. Šenigl, F.; Auxt, M.; Hejnar, J. Transcriptional provirus silencing as a crosstalk of de novo DNA methylation and epigenomic features at the integration site. Nucleic Acids Res. 2012, 40, 5298–5312. [CrossRef][PubMed] 40. Šenigl, F.; Miklík, D.; Auxt, M.; Hejnar, J. Accumulation of long-term transcriptionally active integrated retroviral vectors in active promoters and enhancers. Nucleic Acids Res. 2017, 45, 12752–12765. [CrossRef] [PubMed] 41. Šenigl, F.; Plachý, J.; Hejnar, J. The core element of a CpG island protects avian sarcoma and leukosis virus-derived vectors from transcriptional silencing. J. Virol. 2008, 82, 7818–7827. [CrossRef][PubMed] 42. Kalina, J.; Šenigl, F.; Miˇcáková, A.; Mucksová, J.; Blažková, J.; Yan, H.; Poplštein, M.; Hejnar, J.; Trefil, P. Retrovirus-mediated in vitro gene transfer into chicken male germ line cells. Reproduction 2007, 134, 445–453. [CrossRef][PubMed] 43. Uren, A.G.; Mikkers, H.; Kool, J.; van der Weyden, L.; Lund, A.H.; Wilson, C.H.; Rance, R.; Jonkers, J.; van Lohuizen, M.; Berns, A.; et al. A high-throughput splinkerette-PCR method for the isolation and sequencing of retroviral insertion sites. Nat. Protoc. 2009, 4, 789–798. [CrossRef][PubMed] 44. Berry, C.C. Restrsiteutils: Restriction Site Distances and Matched Samples. R Package Version 1.2.8. 2017. Available online: http://www.bioconductor.org/packages/2.12/bioc/html/Restrsiteutils.html (accessed on 28 January 2018). 45. Pagès, H.; Aboyoun, P.; Gentleman, R.; DebRoy, S. Biostrings: Efficient Manipulation of Biological Strings. R Package Version 2.46.0. 2017. Available online: http://www.bioconductor.org/packages/2.12/bioc/html/ Biostrings.html (accessed on 28 January 2018). 46. Lawrence, M.; Huber, W.; Pagès, H.; Aboyoun, P.; Carlson, M.; Gentleman, R.; Morgan, M.T.; Carey, V.J. Software for computing and annotating genomic ranges. PLoS Comput. Biol. 2013, 9, e1003118. [CrossRef] [PubMed] 47. Ernst, J.; Kellis, M. Discovery and characterization of chromatin states for systematic annotation of the human genome. Nat. Biotechnol. 2010, 28, 817–825. [CrossRef][PubMed] 48. Ernst, J.; Kellis, M. ChromHMM: Automating chromatin-state discovery and characterization. Nat. Methods 2012, 9, 215–216. [CrossRef][PubMed] 49. Kanamori-Katayama, M.; Itoh, M.; Kawaji, H.; Lassmann, T.; Katayama, S.; Kojima, M.; Bertin, N.; Kaiho, A.; Ninomiya, N.; Daub, C.O.; et al. Unamplified cap analysis of gene expression on a single-molecule sequencer. Genome Res. 2011, 21, 1150–1159. [CrossRef][PubMed] 50. Lusic, M.; Siliciano, R.F. Nuclear landscape of HIV-1 infection and integration. Nat. Rev. Microbiol. 2017, 15, 69–82. [CrossRef][PubMed] 51. Hughes, S.H.; Coffin, J.M. What Integration Sites Tell Us about HIV Persistence. Cell Host Microbe 2016, 19, 588–598. [CrossRef][PubMed] 52. Mok, H.P.; Lever, A.M. Chromatin, gene silencing and HIV latency. Genome Biol. 2007, 8, e228. [CrossRef] [PubMed] 53. LaFave, M.C.; Varshney, G.K.; Gildea, D.E.; Wolfsberg, T.G.; Baxevanis, A.D.; Burgess, S.M. MLV integration site selection is driven by strong enhancers and active promoters. Nucleic Acids Res. 2014, 42, 4257–4269. [CrossRef][PubMed] 54. Malhotra, S.; Winans, S.; Lam, G.; Justice, J.; Morgan, R.; Beemon, K. Selection for avian leukosis virus integration sites determines the clonal progression of B-cell lymphomas. PLoS Pathog. 2017, 13, e1006708. [CrossRef][PubMed] 55. Justice, J.F.; Morgan, R.W.; Beemon, K.L. Common Viral Integration Sites Identified in Avian Leukosis Virus-Induced B-Cell Lymphomas. MBio 2015, 6, e01863. [CrossRef][PubMed] 56. Pajer, P.; Peˇcenka,V.; Králová, J.; Karafiát, V.; Pru˚ková, D.; Zemanová, Z.; Kodet, R.; Dvoˇrák, M. Identification of potential human oncogenes by mapping the common viral integration sites in avian nephroblastoma. Cancer Res. 2006, 66, 78–86. [CrossRef][PubMed] 57. Plachý, J.; Kotáb, J.; Divina, P.; Reinišová, M.; Šenigl, F.; Hejnar, J. Proviruses selected for high and stable expression of transduced genes accumulate in broadly transcribed genome areas. J. Virol. 2010, 84, 4204–4211. [CrossRef][PubMed] Viruses 2018, 10, 116 17 of 17

58. Weber, M.; Hellmann, I.; Stadler, M.B.; Ramos, L.; Paabo, S.; Rebhan, M.; Schübeler, D. Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat. Genet. 2007, 39, 457–466. [CrossRef][PubMed] 59. Hodges, E.; Smith, A.D.; Kendall, J.; Xuan, Z.; Ravi, K.; Rooks, M.; Zhang, M.Q.; Ye, K.; Bhattacharjee, A.; Brizuela, L.; et al. High definition profiling of mammalian DNA methylation by array capture and single molecule bisulfite sequencing. Genome Res. 2009, 19, 1593–1605. [CrossRef][PubMed]

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).