Hausladen, D. Stinky Potatoes and Their Impact on Biotic Metal Reduction
Total Page：16
File Type：pdf, Size：1020Kb
Stinky potatoes and their impact on biotic metal reduction Debra Hausladen Stanford University Microbial Diversity Course, 2012 Abstract Fermenting bacteria play an important role in supplying soluble organic carbon to metal reducing bacteria. An enrichment column of ferrihydrite-coated sand overlaying a thin layer of particulate organic carbon (POC) was constructed and monitored over time. Gammaproteobacteria and Firmicutes were observed as dominant classes over both layers after several days. Double hybridization CARD- FISH was conducted to investigate potential associations of metal reducing bacteria (MRB) and Firmicutes on a sub-micron level. Introduction Heavy metal immobilization is possible by a number of sequestration pathways including: adsorption of metal complexes on solid surfaces, structural incorporation into Fe(III) oxides, formation of secondary minerals, adsorption to biomass, and precipitation and coprecipitation. Perhaps one of the most important environmental factors influencing the biogeochemical cycling of metals is its association with ferric/ferrous iron. Metal species adsorb to the surface of Fe hydroxides, oxyhydroxides, and oxide mineral phases, hereafter referenced as Fe oxides. In the case of uranium contamination, Nico et al. (2009) and Stewart et al. (2009) demonstrated that U(VI) incorporation into Fe oxides allows for increased U stability during successive reduction and oxidation cycles. The increased stability of U occurs despite the possibility of U(VI) being released into solution during the reductive dissolution of these Fe(III) phases. The overlapping redox couples of U(VI/IV) and Fe(III/II) allow Fe to act as both an oxidant and reductant depending on environmental conditions (Ginder-Vogel et al., 2006). Often, the biotic reduction products Fe(II) and HS- are present at concentrations that may promote abiotic U(VI) reduction (Liger et al., 1999; Jeon et al., 2005). Fe(III) can also decrease the rate and extent of biotic uranium reduction by acting as a competing electron acceptor in microbial respiration. Due to overlapping redox couples, dissimilatory U(VI) and Fe(III) reduction can occur simultaneously. Wielinga et al. (2000) showed a 52% decrease in uranyl reduction by Shewanella algae BrY in the presence of ferrihydrite over 10 hours, while hematite and goethite had no effect on U reduction (Fredrickson et al, 2000). The complicated interactions between uranium and iron make the prediction of uranium speciation and mobility difficult, especially when other complexing ligands are present in the subsurface. It is critical that these biogeochemical processes and their effects on the reduction and stability of uranium are better characterized in order to develop more robust remediation strategies. The presence of organic matter has been found to play a key role in the persistence of toxic metals such as U(IV). For example, the occurrence of U(IV) in seasonally oxic, open-pit mines has been attributed to organic matter (Suzuki et al., 2005). In other cases, naturally occurring organic ligands are also known to affect the mobility of metals under both oxic and anoxic conditions. Under strict anaerobic conditions, organic acids, especially humics, have been found to dramatically enhance U(VI) reduction rates (Gu et al., 2005). In the presence of oxidants, however, humic substances increase the oxidation of U(IV) by forming soluble complexes with U(IV) (Francis and Dodge, 2008). Since uranium is radioactive and difficult to work with, this study focuses on a more simplified iron-rich system that can later be expanded to inform the biogeochemical cycling of uranium. This experiment investigates which organisms are enriched in the presence of ferric iron-rich sediment and potato as a source of particular organic carbon. Community structure of potato and soil inocula was investigated prior to addition to the enrichment column and subsequent shifts in community composition was monitored during incubation. In order to better understand the microbial organisms responsible for iron reduction in the presence of particulate organic carbon, RNA was extracted from different column depths. This study also assessed whether close spatial associations formed between fermenting and iron reducing bacteria. A CARD-FISH technique was developed to attempt to resolve these associations on a sub-micron scale. The second half of the project investigated whether Clostridia in syntrophic associations support greater activity of metal reducing bacteria than those in isolation (data not shown). Methods Column Set-up Ferrihydrite was synthesized according to Schwertmann and Cornell (1991) and mixed with quartz sand. Sand was dried for two days and then rinsed with 18 Ohm water until rinse water was clear. For the particulate organic matter layer a Russet potato was microwaved until soft before mashing 10g together 1g of soil from School Street Marsh. Five grams of soil inoculated potato was then spread in a thin layer at the bottom of a PVC tube. 13 g of sediment from School Street Marsh was then mixed with 130 g of ferrihydrite-coated sand and added on top of the potato layer. Five holes for anaerobic sampling were drilled along the tube, plugged with butyl rubber stoppers, and silicone sealed. Artificial groundwater medium was made (10 mM HEPES, 2.7 mM KCl, 0.3 mM MgSO4, 7.9 mM NaCl, and 0.4 CaCl2.2H2O; pH adjusted to 7.2) and added to saturate the artificial sediment. 454 Pyrosequencing Tag Pyrosequencing was performed on porewater filtered on polycarbonate membranes before addition to PowerBead tubes (0.5 ml of potato porewater and 1.0 ml of sediment porewater). Genes for the SSU rRNA was amplified using barcoded primers that contained Roche 454 Ti adaptor sequences along with individual barcode sequences on each forward primer. This primer specifically targets the 515F (5’- cgtatcgcctccctgcgccatcagxxxxxxxxgagtgycagmgccgcgtaa-3’) and 907R (5’- ctatgcgccttgccagcccgctcagggccgycattcmtttragtt-3’)region of the E. Coli 16s gene. Phusion HF polymerase (2X master mix) was used to amplify the 16s gene necessary for 16s amplification. PCR reactions were run on a MJ Thermocycler. Analysis of 454 data was performed using Qiime. Reference sequences were selected and aligned using the UCLUST algorithm via Qiime interface. RNA Extractions Total RNA was extracted from flash frozen porewater samples which were thawed and filtered on polycarbonate membranes before addition to PowerBead tubes (0.5 ml of potato porewater and 1.0 ml of sediment porewater). The MoBio Power Biofilm RNA Extraction Kit was followed according tomanufacturers protocols. Total extracted RNA was resuspended in 25μl of H2O. Extracted RNA was run unde PCR conditions with DNA primers to identify potential sources of DNA contamination post RNAse treatment of the total RNA extraction product. RNA was converted to cDNA using the Invitrogen cDNA kit. A 25 minute incubation at room temperature was followed by one hour at 72°C and 10 minutes at 85°C. The converted cDNA was then used to amplify the 16s gene. Cloning Universal 16S primers (8F, 1492R) were used to amplify the DNA from an extraction aliquot. A gel purification was used to identify and purify the PCR product. The product was then sued with the Topo cloning kit to create a clone library of 16S genes, which were sequenced by Sanger sequencing methodology. The 16S clone library sequences were aligned using the SILVA software before importing the sequences into ARB. The selected sequences were then clustered using the UCLUST algorithm via QIIME interface, and representative sequnces were selected, aligned, and used to create a maximum likelihood tree. Fluorescence in situ hybridization (FISH) Fixation and cutting Sediment mini-cores (taken in 1 ml syringes) were fixed with 70% Ethanol for 3 hours before embedding with O.C.T. for 48 hours. Cores were then frozen in liquid nitrogen and stored at -80 C. Thin sections (approx. 50 um) were mounted on slides using approx. 50um cyrosections. Hybridization was attempted directly on the thin-section mounted to the slide but successive washes resulted in too much sediment loss. Next 300 uL of fixed sediment in 10 mL 1xPBS was filtered onto polycarbonate filters. CARD-FISH The Deltaproteobacteria-probe (Delta 495a, b, c + competitor a,b,c) was used to target potential metal reducing bacteria, while LGCa394 was used to stain members of the Firmicutes. Cell permeabilization was performed by incubating the filters in 20mg/ml Lysozyme for 60 minutes at 37 C, followed by washing the samples with mQH2O and 96% EtOH. Bleaching of endogenous peroxidases was performed by incubating the filters in H2O2/Methanol mix under the hood for 30 min before rinsing again in mQH2O and 96% EtOH and air drying. Hybridization was first performed for Deltaproteobacteria probe. Filters (2 filters per vial) were hybridized for 3 hrs at 46 C. CARD was done using Alexa 594. After filters dried, the inactivation step was repeated and hybridization/CARD repeated for the LGCaXX with Alexa 488. Pictures were taken using Axio IMAGER MZ Microscope equipped with a color camera (AxioCam HRc, Zeiss) and Laser Confocal Microscopy was done using LCM 700. Batch Reactors Clostridia was isolated from School Street Marsh and, using BLAST, found to be closely related to C. acidisoli. One colony was selected from a streak plate and resuspended in X media. Methanogen enrichments were cultured by inoculating sediment from School Street Marsh into H2/CO2 flushed serum vials. Enrichments were transferred to fresh media three times. The final media contained no rifampicin. An isolate of M. hungatei was shipped from the McIrney lab at University of Oklahoma. Media was made following McInerney, 1979. 20 ml of media was transferred to 130 mL serum vials containing 0.1 g of Russet potato in an anaerobic chamber. Vials were sealed with butyl rubber stoppers and autoclaved. Four different treatments were monitored. The following additions were added in duplicate: 1 ml of liquid Clostridia isolate, 1 ml of liquid Clostridia isolate with 0.1 ml of liquid methanogen suspension, 1 ml of liquid Clostridia isolate with 0.01 ml of liquid methanogen suspension, and finally 1 ml of liquid methanogen suspension.