DOCSLIB.ORG

New Data on the Family Blaberidae (Dictyoptera) from Southeast Asia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
New Data on the Family Blaberidae (Dictyoptera) from Southeast Asia ZOOSYSTEMATICA ROSSICA, 24(1): 14–30 25 JUNE 2015 New data on the family Blaberidae (Dictyoptera) from Southeast Asia: new species, morphological diversity and phylogeny on the base of ribosomal DNA sequences Новые данные о семействе Blaberidae (Dictyoptera) из Юго-Восточной Азии: новые виды, морфологическое разнообразие и филогения на основании последовательностей рибосомальной ДНК V.A. MAVROPULO, L.N. ANISYUTKIN*, M.V. ZAGOSKIN, A.S. ZAGOSKINA, S.V. LUKYANTSEV & D.V. MUKHA В.А. МАВРОПУЛО, Л.Н. АНИСЮТКИН, М.В. ЗАГОСКИН, А.С. ЗАГОСКИНА, С.В. ЛУКЬЯНЦЕВ, Д.В. МУХА V.A. Mavropulo, Vavilov Institute of General Genetics, Russian Academy of Sciences, 3 Gubkin Str., Moscow, 119991, Russia L.N. Anisyutkin, Zoological Institute, Russian Academy of Sciences, 1 Universitetskaya Emb., St Petersburg 199034, Russia. E-mails: [email protected], [email protected]. Corresponding author M.V. Zagoskin, Vavilov Institute of General Genetics, Russian Academy of Sciences, 3 Gubkin Str., Moscow 119991, Russia A.S. Zagoskina, Vavilov Institute of General Genetics, Russian Academy of Sciences, 3 Gubkin Str., Moscow 119991, Russia S.V. Lukyantsev, Tomsk State University, 36 Lenina Str, Tomsk 634059, Russia D.V. Mukha, Vavilov Institute of General Genetics, Russian Academy of Sciences, 3 Gubkin Str., Moscow 119991, Russia. E-mail: [email protected] New cockroaches of the family Blaberidae are described from Southern Sumatra: two new spe- cies of the genus Cyrtonotula Uvarov, 1939, C. secunda sp. nov. and C. tertia sp. nov. (Epilam- prinae); and one new species of the genus Paranauphoeta J.W.H. Rehn, 1951, P. pullata sp. nov. (Paranauphoetinae). Detailed morphological descriptions of the new species are given. Struc- tures of the male genitalia of the genus Cyrtonotula are described for the first time. Hypothesis on the relationships of these new taxa as well as Morphna maculata Brunner von Wattenwyl, 1865, Rhabdoblatta sp. and Pseudophoraspis sp. based on 28S ribosomal DNA sequences is discussed. Из Южной Суматры описываются новые тараканы семейства Blaberidae: два новых вида рода Cyrtonotula Uvarov, 1939, C. secunda sp. nov. и C. tertia sp. nov. (Epilamprinae), и один новый вид из рода Paranauphoeta J.W.H. Rehn, 1951, P. pullata sp. nov. (Paranauphoetinae). Для новых видов дается детальное морфологическое описание. Строение гениталий сам- цов впервые описывается у представителей рода Cyrtonotula. Обсуждается выдвинутая на основании изучения 28S рибосомальной ДНК гипотеза о родственных отношениях новых таксонов, а также Morphna maculata Brunner von Wattenwyl, 1865, Rhabdoblatta sp. и Pseudophoraspis sp. Key words: cockroaches, taxonomy, morphology, phylogeny, 28S ribosomal DNA, Southeast Asia, Dictyoptera, Blaberidae, Epilamprinae, Paranauphoetinae, Cyrtonotula, Paranauphoeta, new species Ключевые слова: тараканы, таксономия, морфология, филогения, 28S рибосомальная ДНК, Юго-Восточная Азия, Dictyoptera, Blaberidae, Epilamprinae, Paranauphoetinae, Cyr- tonotula, Paranauphoeta, новые виды © 2015 Zoological Institute, Russian Academy of Scienсes V.A. MAVROPULO ET AL. NEW DATA ON BLABERIDAE FROM SOUTHEAST ASIA 15 INTRODUCTION The ratio of “distance between eyes” to “length of eye” was measured as the in- In the present paper, new representatives terocular distance on the vertex (i.o. in Fig. of the family Blaberidae Brunner von Wat- 1A) to the dorsoventral length of eye (d.e. tenwyl, 1865 are described from Southeast in Fig. 1A). Types of the anterior margin of Asia. There are two new species of the genus fore femur armament are given according to Cyrtonotula Uvarov, 1939, belonging to the Bey-Bienko (1950) and Roth (2003). The subfamily Epilamprinae Brunner von Wat- terminology of the male genital sclerites fol- tenwyl, 1865, and one new species of Pa- lows Klass (1997) but with some modifica- ranauphoeta Brunner von Wattenwyl, 1865, tions (Anisyutkin, 2014; Anisyutkin et al., belonging to the subfamily Paranauphoeti- 2013). The terminology used by Grandcolas nae J.W.H. Rehn, 1951. Ribosomal DNA se- (1996) for genital structures is given in pa- quence data of the described taxa and males rentheses following the author’s designa- of the genus Cyrtonotula are considered for tions. The terms introduced by the author the first time. A provisional hypothesis re- are given in quotation marks. garding the relationships in the studied taxa The material studied (including type is proposed on the base of the consensus specimens) is deposited at the Zoological cladogram that was inferred from the 28S Institute of the Russian Academy of Sci- ribosomal DNA fragment sequence data. ences, St Petersburg, Russia. The subfamily Epilamprinae is one of the largest and most diverse subfamilies Abbreviation used in figures of Blaberidae. It is widely distributed in (see text for further details): regions with wet tropical climate and is a.s., “additional spines”, i.e. spines bor- known since at least the Paleocene epoch dering euplantulae from inside and outside; š (Vr ansky et al., 2013). The subfamily Pa- ap.scl., “apical sclerite” of sclerite L2D in ranauphoetinae includes a single genus of the male genitalia; uncertain systematical position, Paranau- b.hla., basal membranous part of sclerite phoeta. It undoubtedly belongs to Blaberi- L3; dae, but its relationships within the fam- b.L2D, basal part of sclerite L2D in the ily are unclear (for details see: Anisyutkin, male genitalia; 2003a). There are no paleontological data b.L3, basal subsclerite of sclerite L3 in on Paranauphoeta yet. the male genitalia; c.b.m.a., “chaetae-bearing membranous MATERIAL AND METHODS area” located between right phallomere and sclerite L2D; The material studied was collected in c.b.m.l., “chaetae-bearing membranous tropical forests at light or during night lobe” located above basal part of sclerite work with the use of a flashlight on the L2D; leaves of trees and bushes. The material was c.p.R1T, caudal part of the sclerite R1T preserved in 70% ethanol. in the male genitalia; The male genitalia were processed with cr.p.R1T, cranial part of the sclerite R1T alkali by means of a standard procedure in the male genitalia; (Anisyutkin et al., 2013) for 12–24 hours d.e., dorsoventral length of the eye; for maceration of the soft tissues. The il- f.s., “folded structure” of the sclerite L3 lustrations were sketched by means of a in the male genitalia; drawing tube on a Leica MZ 16 binocular hge., groove of the sclerite L3 in the male microscope; further drawing and examina- genitalia (= hge); tion were made with an MBS–10 binocular hla, sclerotized apical part of the sclerite microscope. L3 in the male genitalia (sensu Klass, 1997); © 2015 Zoological Institute, Russian Academy of Scienсes, Zoosystematica Rossica 24(1): 14–30 16 V.A. MAVROPULO ET AL. NEW DATA ON BLABERIDAE FROM SOUTHEAST ASIA hl., hollow on the sclerite R2 in the male QIAquick Gel Extraction Kits (QIAGEN, genitalia; Hilden, Germany). Cleaned products were i.o., interocular distance on the vertex; cloned into pGEM-T Easy vectors (Pro- L2D, L3, L4U, sclerites in the male geni- mega), and transformed into Escherichia coli talia; JM109 competent cells (Promega) follow- Par., paraproct; ing the manufacturer’s protocol. Amplified pr.s., preputial spines located at the “api- DNA fragments and several clones were se- cal sclerite” of sclerite L2D of the male geni- quenced for each specimen. talia; Automated sequences were generated pv., sclerite at the base of the cerci (= pv- on an ABI PRISM® 310 Genetic Analyzer sclerite); according to Sanger et al. (1977) with a Big- r.plm., right phallomere of the male geni- Dye Termination kit (Applied Biosystems). talia; Opposite strands were confirmed for all R1T, R2, R3, R4, R5, sclerites in the male templates. ABI trace files were edited and genitalia. contigs were assembled using the program ChromasPro v. 1.7.6 (http://technelysium. DNA analysis com.au/?page_id=27). DNA extraction, PCR amplification Nucleotide alignment and phylogenetic and sequencing analysis Total genomic nucleic acids were ex- Sequences from this study for Paranau- tracted from ethanol-fixed insects using phoeta pullata sp. nov., Cyrtonotula tertia a standard DNA extraction buffer (Tris– sp. nov., C. secunda sp. nov., Pseudophoras- HCl, proteinase K, SDS) according to the pis sp. and Rhabdoblatta sp. are under the protocol described in Mukha et al. (1995). accession numbers KJ194457, KJ184844, DAMS-18 (gtccctgccgtttgtacaca) and KJ194458, KJ194459 and KJ194460, re- DAMS-28 (ctactagatggttcgattagtc) prim- spectively. Furthermore for the reconstruc- ers were used for DNA amplification and tion of the phylogenetic tree, the following sequencing. The priming sites for DAMS- rDNA sequences were used: Archiman- 18 and DAMS-28 are highly conserved in drita tesselata J.A.G. Rehn, 1903 (acc. # eukaryotes; these primers are “universal” GU384924), Blaberus atropos (Stoll, 1813) and may be used for the amplification of the (acc. # AF321252), Morphna maculata (acc. corresponding ribosomal DNA fragments # KM659175), Symploce pallens (Stephens, across a broad taxonomic range of organ- 1835) (acc. # KF922887), Parathemnop- isms (Mukha & Sidorenko, 1995, 1996; teryx couloniana (Saussure, 1863) (acc. # Mukha et al., 2000; Mukha et al., 2002). KF922888), Parcoblatta lata (Brunner von PCR amplification of the analyzed rDNA Wattenwyl, 1865) (acc. # AF321247), Blat- fragments was carried out using Master Mix tella vaga Hebard, 1935 (acc. # AF321246), (2X) (Fermentas, Vilnius, Lithuania) ac- Blattella lituricollis (Walker, 1868)
Load more

Recommended publications
  • New Aspects About Supella Longipalpa (Blattaria: Blattellidae)
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Asian Pac J Trop Biomed 2016; 6(12): 1065–1075 1065 HOSTED BY Contents lists available at ScienceDirect Asian Pacific Journal of Tropical Biomedicine journal homepage: www.elsevier.com/locate/apjtb Review article http://dx.doi.org/10.1016/j.apjtb.2016.08.017 New aspects about Supella longipalpa (Blattaria: Blattellidae) Hassan Nasirian* Department of Medical Entomology and Vector Control, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran ARTICLE INFO ABSTRACT Article history: The brown-banded cockroach, Supella longipalpa (Blattaria: Blattellidae) (S. longipalpa), Received 16 Jun 2015 recently has infested the buildings and hospitals in wide areas of Iran, and this review was Received in revised form 3 Jul 2015, prepared to identify current knowledge and knowledge gaps about the brown-banded 2nd revised form 7 Jun, 3rd revised cockroach. Scientific reports and peer-reviewed papers concerning S. longipalpa and form 18 Jul 2016 relevant topics were collected and synthesized with the objective of learning more about Accepted 10 Aug 2016 health-related impacts and possible management of S. longipalpa in Iran. Like the Available online 15 Oct 2016 German cockroach, the brown-banded cockroach is a known vector for food-borne dis- eases and drug resistant bacteria, contaminated by infectious disease agents, involved in human intestinal parasites and is the intermediate host of Trichospirura leptostoma and Keywords: Moniliformis moniliformis. Because its habitat is widespread, distributed throughout Brown-banded cockroach different areas of homes and buildings, it is difficult to control.
    [Show full text]
  • Cockroach Marion Copeland
    Cockroach Marion Copeland Animal series Cockroach Animal Series editor: Jonathan Burt Already published Crow Boria Sax Tortoise Peter Young Ant Charlotte Sleigh Forthcoming Wolf Falcon Garry Marvin Helen Macdonald Bear Parrot Robert E. Bieder Paul Carter Horse Whale Sarah Wintle Joseph Roman Spider Rat Leslie Dick Jonathan Burt Dog Hare Susan McHugh Simon Carnell Snake Bee Drake Stutesman Claire Preston Oyster Rebecca Stott Cockroach Marion Copeland reaktion books Published by reaktion books ltd 79 Farringdon Road London ec1m 3ju, uk www.reaktionbooks.co.uk First published 2003 Copyright © Marion Copeland All rights reserved No part of this publication may be reproduced, stored in a retrieval system or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording or otherwise without the prior permission of the publishers. Printed and bound in Hong Kong British Library Cataloguing in Publication Data Copeland, Marion Cockroach. – (Animal) 1. Cockroaches 2. Animals and civilization I. Title 595.7’28 isbn 1 86189 192 x Contents Introduction 7 1 A Living Fossil 15 2 What’s in a Name? 44 3 Fellow Traveller 60 4 In the Mind of Man: Myth, Folklore and the Arts 79 5 Tales from the Underside 107 6 Robo-roach 130 7 The Golden Cockroach 148 Timeline 170 Appendix: ‘La Cucaracha’ 172 References 174 Bibliography 186 Associations 189 Websites 190 Acknowledgements 191 Photo Acknowledgements 193 Index 196 Two types of cockroach, from the first major work of American natural history, published in 1747. Introduction The cockroach could not have scuttled along, almost unchanged, for over three hundred million years – some two hundred and ninety-nine million before man evolved – unless it was doing something right.
    [Show full text]
  • Studies of the Laboulbeniomycetes: Diversity, Evolution, and Patterns of Speciation
    Studies of the Laboulbeniomycetes: Diversity, Evolution, and Patterns of Speciation The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:40049989 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA ! STUDIES OF THE LABOULBENIOMYCETES: DIVERSITY, EVOLUTION, AND PATTERNS OF SPECIATION A dissertation presented by DANNY HAELEWATERS to THE DEPARTMENT OF ORGANISMIC AND EVOLUTIONARY BIOLOGY in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biology HARVARD UNIVERSITY Cambridge, Massachusetts April 2018 ! ! © 2018 – Danny Haelewaters All rights reserved. ! ! Dissertation Advisor: Professor Donald H. Pfister Danny Haelewaters STUDIES OF THE LABOULBENIOMYCETES: DIVERSITY, EVOLUTION, AND PATTERNS OF SPECIATION ABSTRACT CHAPTER 1: Laboulbeniales is one of the most morphologically and ecologically distinct orders of Ascomycota. These microscopic fungi are characterized by an ectoparasitic lifestyle on arthropods, determinate growth, lack of asexual state, high species richness and intractability to culture. DNA extraction and PCR amplification have proven difficult for multiple reasons. DNA isolation techniques and commercially available kits are tested enabling efficient and rapid genetic analysis of Laboulbeniales fungi. Success rates for the different techniques on different taxa are presented and discussed in the light of difficulties with micromanipulation, preservation techniques and negative results. CHAPTER 2: The class Laboulbeniomycetes comprises biotrophic parasites associated with arthropods and fungi.
    [Show full text]
  • Hanula Cover and Spine.Indd
    DE- AI09-00SR22188 Proceedings 2006 06-18-P THE ROLE OF DEAD WOOD IN MAINTAINING ARTHROPOD DIVERSITY ON THE FOREST FLOOR James L. Hanula, Scott Horn, and Dale D. Wade1 Abstract—Dead wood is a major component of forests and contributes to overall diversity, primarily by supporting insects that feed directly on or in it. Further, a variety of organisms benefit by feeding on those insects. What is not well known is how or whether dead wood influences the composition of the arthropod community that is not solely dependent on it as a food resource, or whether woody debris influences prey available to generalist predators. One group likely to be affected by dead wood is ground-dwelling arthropods. We studied the effect of adding large dead wood to unburned and frequently burned pine stands to determine if dead wood was used more when the litter and understory plant community are removed. We also studied the effect of annual removal of dead wood from large (10-ha) plots over a 5-year period on ground-dwelling arthro- pods. In related studies, we examined the relationships among an endangered woodpecker that forages for prey on live trees, its prey, and dead wood in the forest. The results of these and other studies show that dead wood can influence the abun- dance and diversity of the ground-dwelling arthropod community and of prey available to generalist predators not foraging directly on dead trees. INTRODUCTION (Picoides borealis), which forages for prey on live trees, its Large dead wood or coarse woody debris (CWD) with a prey, and dead wood in the forest.
    [Show full text]
  • The Control of Turkestan Cockroach Blatta Lateralis (Dictyoptera: Blattidae)
    Türk Tarım ve Doğa Bilimleri Dergisi 7(2): 375-380, 2020 https://doi.org/10.30910/turkjans.725807 TÜRK TURKISH TARIM ve DOĞA BİLİMLERİ JOURNAL of AGRICULTURAL DERGİSİ and NATURAL SCIENCES www.dergipark.gov.tr/turkjans Research Article The Control of Turkestan Cockroach Blatta lateralis (Dictyoptera: Blattidae) by The Entomopathogenic nematode Heterorhabditis bacteriophora HBH (Rhabditida: Heterorhabditidae) Using Hydrophilic Fabric Trap Yavuz Selim ŞAHİN, İsmail Alper SUSURLUK* Bursa Uludağ University, Faculty of Agriculture, Department of Plant Protection, 16059, Nilüfer, Bursa, Turkey *Corresponding author: [email protected] Receieved: 09.09.2019 Revised in Received: 18.02.2020 Accepted: 19.02.2020 Abstract Chemical insecticides used against cockroaches, which are an important urban pest and considered public health, are harmful to human health and cause insects to gain resistance. The entomopathogenic nematode (EPN), Heterorhabditis bacteriophora HBH, were used in place of chemical insecticides within the scope of biological control against the Turkestan cockroaches Blatta lateralis in this study. The hydrophilic fabric traps were set to provide the moist environment needed by the EPNs on aboveground. The fabrics inoculated with the nematodes at 50, 100 and 150 IJs/cm2 were used throughout the 37-day experiment. The first treatment was performed by adding 10 adult cockroaches immediately after the establishment of the traps. In the same way, the second treatment was applied after 15 days and the third treatment after 30 days. The mortality rates of cockroaches after 4 and 7 days of exposure to EPNs were determined for all treatments. Although Turkestan cockroaches were exposed to HBH 30 days after the setting of the traps, infection occurred.
    [Show full text]
  • RESEARCH ARTICLE a New Species of Cockroach, Periplaneta
    Tropical Biomedicine 38(2): 48-52 (2021) https://doi.org/10.47665/tb.38.2.036 RESEARCH ARTICLE A new species of cockroach, Periplaneta gajajimana sp. nov., collected in Gajajima, Kagoshima Prefecture, Japan Komatsu, N.1, Iio, H.2, Ooi, H.K.3* 1Civil International Corporation, 10–14 Kitaueno 1, Taito–ku, Tokyo, 110–0014, Japan 2Foundation for the Protection of Deer in Nara, 160-1 Kasugano-cho, Nara-City, Nara, 630-8212, Japan 3Laboratory of Parasitology, School of Veterinary Medicine, Azabu University, 1-17-710 Fuchinobe, Sagamihara, Kanagawa 252-5201 Japan *Corresponding author: [email protected] ARTICLE HISTORY ABSTRACT Received: 25 January 2021 We described a new species of cockroach, Periplaneta gajajimana sp. nov., which was collected Revised: 2 February 2021 in Gajajima, Kagoshima-gun Toshimamura, Kagoshima Prefecture, Japan, on November 2012. Accepted: 2 February 2021 The new species is characterized by its reddish brown to blackish brown body, smooth Published: 30 April 2021 surface pronotum, well developed compound eyes, dark brown head apex, dark reddish brown front face and small white ocelli connected to the antennal sockets. In male, the tegmen tip reach the abdomen end or are slightly shorter, while in the female, it does not reach the abdominal end and exposes the abdomen beyond the 7th abdominal plate. We confirmed the validity of this new species by breeding the specimens in our laboratory to demonstrate that the features of the progeny were maintained for several generations. For comparison and easy identification of this new species, the key to species identification of the genus Periplaneta that had been reported in Japan to date are also presented.
    [Show full text]
  • Cockroach Control Manual
    COCKROACHCOCKROACH CONTROLCONTROL MANUALMANUAL (Photo by J. Kalisch) Barb Ogg, Extension Educator, Lancaster County Clyde Ogg, Extension Educator, Pesticide Safety Education Program Dennis Ferraro, Extension Educator, Douglas & Sarpy Counties Extension is a Division of the Institute of Agriculture and Natural Resources at the University of Nebraska–Lincoln cooperating with the Counties and the United States Department of Agriculture. ® University of Nebraska–Lincoln Extension’s educational programs abide with the nondiscrimination policies of the University of Nebraska–Lincoln and the United States Department of Agriculture. Table of Contents 1 Chapter 1: Introduction 5 Chapter 2: Know Your Enemy 9 Chapter 3: Cockroach Biology 15 Chapter 4: Locate Problem Areas 23 Chapter 5: Primary Control Strategies: Modify Resources 31 Chapter 6: Low-Risk Control Strategies 37 Chapter 7: Insecticide Basics 45 Chapter 8: Insecticides and Your Health 53 Chapter 9: Insecticide Applications 59 Chapter 10: Putting a Management Plan Together i Cockroach Control Manual Preface It has been more than 10 years since the first edition of the Cockroach Control Manual was completed. While the basic steps for effective and safe cockroach control are still the same, there are more types of control products available than there were 10 years ago. This means you have even more choices in your arsenal to help fight roaches. The Cockroach Control Manual is a practical reference for persons who have had little or no training in insect identification, biology or control methods. We know most people want low toxic methods used inside their homes so we are emphasizing low-risk strategies even more than in the original edition.
    [Show full text]
  • General Pest Management: a Guide for Commercial Applicators, Category 7A, and Return It to the Pesticide Education Program Office, Michigan State University Extension
    General Pest Management A Guide for Commercial Applicators Extension Bulletin E -2048 • October 1998, Major revision-destroy old stock • Michigan State University Extension General Pest Management A Guide for Commercial Applicators Category 7A Editor: Carolyn Randall Extension Associate Pesticide Education Program Michigan State University Technical Consultants: Melvin Poplar, Program Manager John Haslem Insect and Rodent Management Pest Management Supervisor Michigan Department of Agriculture Michigan State University Adapted from Urban Integrated Pest Management, A Guide for Commercial Applicators, written by Dr. Eugene Wood, Dept. of Entomology, University of Maryland; and Lawrence Pinto, Pinto & Associates; edited by Jann Cox, DUAL & Associates, Inc. Prepared for the U.S. Environmental Protection Agency Certification and Training Branch by DUAL & Associates, Arlington, Va., February 1991. General Pest Management i Preface Acknowledgements We acknowledge the main source of information for Natural History Survey for the picture of a mole (Figure this manual, the EPA manual Urban Integrated Pest 19.8). Management, from which most of the information on structure-infesting and invading pests, and vertebrates We acknowledge numerous reviewers of the manu- was taken. script including Mark Sheperdigian of Rose Exterminator Co., Bob England of Terminix, Jerry Hatch of Eradico We also acknowledge the technical assistance of Mel Services Inc., David Laughlin of Aardvark Pest Control, Poplar, Program Manager for the Michigan Department Ted Bruesch of LiphaTech, Val Smitter of Smitter Pest of Agriculture’s (MDA) Insect and Rodent Management Control, Dan Lyden of Eradico Services Inc., Tim Regal of and John Haslem, Pest Management Supervisor at Orkin Exterminators, Kevin Clark of Clarks Critter Michigan State University.
    [Show full text]
  • A Dichotomous Key for the Identification of the Cockroach Fauna (Insecta: Blattaria) of Florida
    Species Identification - Cockroaches of Florida 1 A Dichotomous Key for the Identification of the Cockroach fauna (Insecta: Blattaria) of Florida Insect Classification Exercise Department of Entomology and Nematology University of Florida, Gainesville 32611 Abstract: Students used available literature and specimens to produce a dichotomous key to species of cockroaches recorded from Florida. This exercise introduced students to techniques used in studying a group of insects, in this case Blattaria, to produce a regional species key. Producing a guide to a group of insects as a class exercise has proven useful both as a teaching tool and as a method to generate information for the public. Key Words: Blattaria, Florida, Blatta, Eurycotis, Periplaneta, Arenivaga, Compsodes, Holocompsa, Myrmecoblatta, Blatella, Cariblatta, Chorisoneura, Euthlastoblatta, Ischnoptera,Latiblatta, Neoblatella, Parcoblatta, Plectoptera, Supella, Symploce,Blaberus, Epilampra, Hemiblabera, Nauphoeta, Panchlora, Phoetalia, Pycnoscelis, Rhyparobia, distributions, systematics, education, teaching, techniques. Identification of cockroaches is limited here to adults. A major source of confusion is the recogni- tion of adults from nymphs (Figs. 1, 2). There are subjective differences, as well as morphological differences. Immature cockroaches are known as nymphs. Nymphs closely resemble adults except nymphs are generally smaller and lack wings and genital openings or copulatory appendages at the tip of their abdomen. Many species, however, have wingless adult females. Nymphs of these may be recognized by their shorter, relatively broad cerci and lack of external genitalia. Male cockroaches possess styli in addition to paired cerci. Styli arise from the subgenital plate and are generally con- spicuous, but may also be reduced in some species. Styli are absent in adult females and nymphs.
    [Show full text]
  • PDF Hosted at the Radboud Repository of the Radboud University Nijmegen
    PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/145941 Please be advised that this information was generated on 2021-10-09 and may be subject to change. w Refined CO-Laser Photoacoustic Trace Gas Detection; Observation of Anaerobic Processes in Insects, Soil and Fruit Frans Bijnen Refined CO-laser Photoacoustic Trace Gas Detection; Observation of Anaerobic Processes in Insects, Soil and Fruit CIP-GEGEVENS KONINKLIJKE BIBLIOTHEEK, DEN HAAG Bijnen, Franciscus Godefridus Casper Refined CO-laser photoacoustic trace gas detection; observation of anaerobic processes in insects, soil and fruit Franciscus Godefridus Casper Bijnen. - [S.l. : s.n.]. - 111. Proefschrift Nijmegen. - Met lit. opg. - Met samenvatting in het Nederlands. ISBN 90-9008120-8 Trefw.: laser spectroscopy / laser techniques / trace gas detection / entomology / plant physiology / microbiology Refined CO-Laser Photoacoustic Trace Gas Detection; Observation of Anaerobic Processes in Insects, Soil and Fruit een wetenschappelijke proeve op het gebied van de Natuurwetenschappen PROEFSCHRIFT ter verkrijging van de graad van doctor aan de Katholieke Universiteit Nijmegen, volgens besluit van het College van Decanen in het openbaar te verdedigen op vrijdag 17 maart 1995, des namiddags te 1.30 uur precies door Franciscus Godefridus Casper Bijnen geboren op 10 januari 1965 te Waalre Promotor : Prof. Dr. J. Reuss Co-Promotores : Dr. F.J.M. Harren Dr. J.H.P. Hackstein This work has been made possible through the financial support of the Catholic University of Nijmegen (KUN), the European Union (EU) and the Dutch Technology Foundation (STW).
    [Show full text]
  • Savannah Guides Communicator, January 2011
    PO Box 2312 Cairns QLD 4870 Phone: 0408 772 513 E-mail: [email protected] Web site: www.savannah-guides.com.au January 2011 Inside this issue: Words from our President - Ben Humphries Page 2 - New Board members Congratulations everyone on another successful year in the tourism industry. Varying reports from Cairns suggest a Page 3 - Drive North Qld! quiet year for tourism, similar reports from Kakadu, with visitor numbers down on previous years. Despite this quiet period, Savannah Guides has continued to lead the field in ‘Protecting and Interpreting the Outback’. Page 4 - Andrew Underground Highlights from 2010 include our Savannah Guide Schools, held at Undara in March and in the Tablelands in October. These Schools are fantastic opportunities to catch up with mates, develop networks and new skills, and learn more Page 5 - Tigers in the Bush from local experts on the region. A lot of work goes into planning and implementing a School and a huge thanks to all those people who were involved and committed their time to the success of our organisation. Thank you to Page 6 - Dinosaurs to Dunnarts- Andrew and his Team from Undara for hosting a terrific School in Outback Queensland in March. Biodiversity Program Congratulations to founding members who were bestowed with Life Membership Awards: Bruce Butler, Barry Kubala, Tom Warnes and Gerry Collins. John Courtenay was bestowed with the Lifetime of Leadership Award. Many Page 7 - Beautiful Cockroaches good memories were shared and we all witnessed the power of the passion within Savannah Guides as the emotions ran high.
    [Show full text]
  • Thesis (PDF, 13.51MB)
    Insects and their endosymbionts: phylogenetics and evolutionary rates Daej A Kh A M Arab The University of Sydney Faculty of Science 2021 A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy Authorship contribution statement During my doctoral candidature I published as first-author or co-author three stand-alone papers in peer-reviewed, internationally recognised journals. These publications form the three research chapters of this thesis in accordance with The University of Sydney’s policy for doctoral theses. These chapters are linked by the use of the latest phylogenetic and molecular evolutionary techniques for analysing obligate mutualistic endosymbionts and their host mitochondrial genomes to shed light on the evolutionary history of the two partners. Therefore, there is inevitably some repetition between chapters, as they share common themes. In the general introduction and discussion, I use the singular “I” as I am the sole author of these chapters. All other chapters are co-authored and therefore the plural “we” is used, including appendices belonging to these chapters. Part of chapter 2 has been published as: Bourguignon, T., Tang, Q., Ho, S.Y., Juna, F., Wang, Z., Arab, D.A., Cameron, S.L., Walker, J., Rentz, D., Evans, T.A. and Lo, N., 2018. Transoceanic dispersal and plate tectonics shaped global cockroach distributions: evidence from mitochondrial phylogenomics. Molecular Biology and Evolution, 35(4), pp.970-983. The chapter was reformatted to include additional data and analyses that I undertook towards this paper. My role was in the paper was to sequence samples, assemble mitochondrial genomes, perform phylogenetic analyses, and contribute to the writing of the manuscript.
    [Show full text]