Molecular Phylogenetics and Evolution 127 (2018) 367–375

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier.com/locate/ympev

Comprehensive molecular phylogeny of the grassbirds and allies (Locustellidae) reveals extensive non-monophyly of traditional genera, and T a proposal for a new classification ⁎ Per Alströma,b,c, , Alice Ciboisd, Martin Irestedte, Dario Zucconf, Magnus Gelangg, Jon Fjeldsåh, Michael J. Anderseni, Robert G. Moylej, Eric Pasquetf, Urban Olssonk a Department of Ecology and Genetics, Animal Ecology, Evolutionary Biology Centre, Uppsala University, Norbyvägen 18D, 752 36 Uppsala, Sweden b Swedish Species Information Centre, Swedish University of Agricultural Sciences, Box 7007, Uppsala SE-750 07, Sweden c Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China d Department of Mammalogy and Ornithology, Natural History Museum of Geneva, CP 6434, CH 1211 Geneva 6, Switzerland e Department of Bioinformatics and Genetics, Swedish Museum of Natural History, PO Box 50007, Stockholm SE-10405, Sweden f UMS MNHN/CNRS 2700 Outils et Méthodes de la Systématique Intégrative (OMSI) & UMR7205 Institut de Systématique, Evolution, Biodiversité CNRS MNHN UPMC EPHE, Sorbonne Universités, Muséum National d’Histoire Naturelle, CP 51, 57 rue Cuvier, F-75231 Paris Cedex 05, France g Gothenburg Natural History Museum, Box 7283, 402 35 Göteborg, Sweden h Center for Macroecology, Evolution and Climate, Natural History Museum of Denmark, Zoological Museum, Universitetsparken 15, DK-2100 Copenhagen, Denmark i Department of Biology and Museum of Southwestern Biology, University of New Mexico, Albuquerque, NM 87131, USA j Department of Ecology and Evolutionary Biology and Biodiversity Institute, University of Kansas, Lawrence, KS 66045, USA k University of Gothenburg, Department of Biology and Environmental Sciences, Systematics and Biodiversity, Box 463, 405 30 Göteborg, Sweden

ARTICLE INFO ABSTRACT

Keywords: The widespread Old World avian family Locustellidae (‘grassbirds and allies’) comprises 62 extant species in 11 Systematics genera. In the present study, we used one mitochondrial and, for most species, four nuclear loci to infer the Taxonomy phylogeny of this family. We analysed 59 species, including the five previously unsampled genera plus two Incongruence genera that had not before been analysed in a densely sampled dataset. This study revealed extensive dis- Species diversity agreement with current taxonomy; the genera Bradypterus, Locustella, Megalurus, Megalurulus and Schoenicola New genus were all found to be non-monophyletic. Non-monophyly was particularly pronounced for Megalurus, which was widely scattered across the tree. Three of the five monotypic genera (Amphilais, Buettikoferella and Malia) were nested within other genera; one monotypic genus (Chaetornis) formed a clade with one of the two species of Schoenicola; whereas the position of the fifth monotypic genus (Elaphrornis) was unresolved. Robsonius was confirmed as sister to the other genera. We propose a phylogenetically informed revision of genus-level tax- onomy, including one new generic name. Finally, we highlight several non-monophyletic species complexes and deep intra-species divergences that point to conflict in taxonomy and suggest an underestimation of current species diversity in this group.

1. Introduction recently extinct species (Gill and Donsker, 2017), which are widely distributed across Africa, Eurasia and Oceania. The family has a che- Sylvioid songbirds (Sylvioidea sensu Fregin et al., 2012) include for quered taxonomic history, both at the generic and species level (review example all Old World ‘warblers’ (several families), ‘babblers’ (several in Alström et al., 2013a). families), swallows (Hirundinidae), bulbuls (Pycnonotidae) and larks Only one broad phylogenetic analysis has been published (Alström (Alaudidae) (review in Alström et al., 2013a). One of the ‘warbler’ fa- et al., 2011a), which revealed several non-monophyletic genera, and milies in this assemblage is the Locustellidae (‘grassbirds and allies’). proposed a taxonomic revision. For instance, the Asian Bradypterus This family has erroneously been referred to as Megaluridae (e.g. by were synonymised with Locustella and Dromaeocercus with Bradypterus Alström et al., 2006; Johansson et al., 2008), but Locustellidae has (hence restricting the latter to African and Malagasy species), and priority (Bock, 1994: p. 152). This family consists of 62 extant and one Eremiornis and Cincloramphus were synonymised with Megalurus.

⁎ Corresponding author at: Department of Ecology and Genetics, Animal Ecology, Evolutionary Biology Centre, Uppsala University, Norbyvägen 18D, 752 36 Uppsala, Sweden. E-mail address: [email protected] (P. Alström). https://doi.org/10.1016/j.ympev.2018.03.029 Received 5 October 2017; Received in revised form 21 February 2018; Accepted 28 March 2018 Available online 03 April 2018 1055-7903/ © 2018 Elsevier Inc. All rights reserved. P. Alström et al. Molecular Phylogenetics and Evolution 127 (2018) 367–375

However, these authors stressed that the circumscription of Megalurus 2.3. Phylogenetic analyses was preliminary, as the type species (M. palustris) was sister to the Bradypterus sensu stricto clade in their analysis, albeit with low support. Sequences were aligned and checked using Geneious 7.1.9 In contrast, Dickinson and Christidis (2014) and del Hoyo and Collar (Biomatters Ltd.). For the nuclear loci, heterozygous sites were coded as (2016) split Megalurus into three genera (Megalurus sensu stricto, Poo- ambiguous. Trees were estimated by Bayesian inference using BEAST dytes and Cincloramphus) based on the results of Alström et al. (2011a). 1.8.4 (Drummond et al., 2012) with different data partitioning schemes: Oliveros et al. (2012) unexpectedly found Robsonius and Malia to be (1) all loci were analysed separately (single-locus analyses, SLAs); (2) part of Locustellidae. all sequences except RAG1 were concatenated and partitioned by locus Five genera traditionally placed in Locustellidae have not been (RAG1 excluded because only few species were available); and (3) analysed phylogenetically: Amphilais (monotypic, Madagascar), nuclear loci except RAG1 were concatenated and partitioned by locus. Megalurulus (six species, Melanesia), Buettikoferella (monotypic, Timor), All analyses were run under the best-fit models according to the Chaetornis (monotypic, Indian Subcontinent) and Elaphrornis (mono- Bayesian Information Criterion calculated in jModeltest 2.1.7 (Darriba typic, Sri Lanka) (Gill and Donsker, 2017). Here we reconstruct the et al., 2012). The following models were selected: cytb, GTR + Γ +I; phylogeny of Locustellidae, including all genera and 59 of 62 re- myo, HKY; GAPDH, LDH and RAG1, HKY + Γ; and ODC, HKY + I. An cognised species (Gill and Donsker, 2017) using mitochondrial and uncorrelated relaxed clock model with a lognormal distribution was nuclear loci. We present a chronogram, which includes multiple sub- applied to all partitions. Substitution models and clock models were species for some polytypic species, and propose a revised taxonomic unlinked. A ‘birth-death incomplete sampling’ tree prior was applied. classification of the Locustellidae. Default priors were used except for the ‘birthDeath.meanGrowthRate’, for which a normal prior with an initial value 1.0, mean 2.0 and standard deviation 1.0 was applied. Xml files were generated in the 2. Material and methods BEAST utility program BEAUti version 1.8.4. The analyses were run for 50–100 million generations and sampled every 1000 generations, and 2.1. Study group each analysis was run twice. Integrative species tree estimation was performed using *BEAST We analysed sequence data from 122 individuals of 59 extant and (Heled and Drummond, 2010) in BEAST 1.8.4, with gene trees and one recently extinct (Megalurus rufescens) species, representing all species trees estimated simultaneously. We ran analyses under the same genera and all but three species (Gill and Donsker, 2017; Supplemen- substitution models per partition as in the previous analyses, and an tary Table S1). As outgroups, we used representatives of the presumed uncorrelated lognormal relaxed clock prior (Drummond et al., 2006). A most closely related families, Bernieridae, Donacobiidae and Acroce- piecewise linear population size model with a constant root was used as phalidae (Fregin et al., 2012; Supplementary Table S1). a prior for the multispecies coalescent and a birth-death model as prior on divergence times. Default settings were used for the priors. 100–150 2.2. Lab work million generations were run in different runs, sampled every 1000 generations; the analysis was repeated four times. DNA was extracted from fresh material using the Qiagen DNA Mini In order to estimate divergence times and intraspecific variation, the Kit and following the manufacturer’s protocol. Twenty three toepad cytb data set with multiple subspecies was analysed in BEAST version samples (17 species) were obtained from museum specimens 1.8.4 (Drummond et al., 2012). Analyses were run under the GTR + Γ (Supplementary Table S1), and most of these were extracted in clean model (cf. Weir and Schluter, 2008) with a ‘birth-death incomplete aDNA-dedicated spaces, using the Qiagen DNA Micro Kit and the pro- sampling’ species tree prior with a normal distribution with mean 2.0 tocol detailed in Irestedt et al. (2006). We sequenced the mitochondrial and standard deviation 1.0. A strict clock with a mean rate of 2.1%/ cytochrome b (cytb) gene and four nuclear regions: myoglobin intron 2 million years (Weir and Schluter, 2008) and a normal prior distribution (myo), ornithine decarboxylase (mainly) introns 6–7 (ODC), glycer- with standard deviation 0.001 was applied. Default settings were used aldehyde-3-phosphodehydrogenase intron 11 (GAPDH) and lactate for the other priors. 100 million generations were run, sampled every dehydrogenase intron 3 (LDH). Amplification and sequencing of the 1000 generations. The analysis was run twice. Nodes B and I were fresh samples followed the protocols described in Fregin et al. (2012). constrained in the final analysis based on the results from the multi- The toepads were sequenced in short (150–300 bp) segments with locus analyses (cf. Fig. 1), as these clades were not supported by cytb specifically designed primers and specific ampli fication profiles (Sup- alone (and no alternative topology was strongly supported in the un- plementary Table S2). Not all loci were obtained for all species, and for constrained cytb tree). eight species only cytb was available (Supplementary Table S1). In In all BEAST and *BEAST analyses, convergence to the stationary addition, we downloaded sequences from GenBank of the recombina- distribution of the single chains was inspected in Tracer 1.6 (Rambaut tion-activating gene 1 (RAG1) for the 9 Locustellidae species for which et al., 2014). The effective sample sizes (ESS) for the joint likelihood this gene was available as well as 9 outgroup species (GenBank numbers and other parameter values were > 1000, representing good mixing of in Supplementary Fig. S4). the MCMC, except in the *BEAST analyses, where ESSs were 100–150. Authenticity of sequences obtained from toepad samples is sup- We also examined convergence and reproducibility by running each ported by several lines of evidence. (1) When independent samples analysis at least twice, with random starting points, and comparing the from the same species were included, the sequences were always highly results. In all analyses, including the *BEAST analyses with low ESSs, similar. (2) Phylogenetic relationships based on individual PCR am- the topologies (including relative branch lengths) and posterior prob- plicons were the same as those using full cytb contigs. (3) No fragment abilities (PPs) were similar across different runs. The first 25% of was identical to any other species included in this study. (4) generations were discarded as ‘burn-in’, and the PPs were calculated Overlapping forward and reverse sequence fragments were identical. from the remaining samples. Samples were combined in LogCombiner (5) The mitochondrial sequences showed no double signal in the elec- 1.8.4, and trees were summarized using TreeAnnotator version 1.8.4 tropherograms or stop codons, insertions or deletions, and a vast ma- (both included in the BEAST package), choosing ‘Maximum clade jority of nucleotide substitutions were found in the 3rd codon position credibility tree’ and ‘Mean heights’, and displayed in FigTree version and resulted in few amino acid substitutions (of which a majority also 1.4.3 (Rambaut 2002). Xml files for all multilocus analyses are avail- was found in sequences obtained from the fresh samples). The mi- able as Supplementary Table S2. tochondrial sequences from fresh samples were also validated in the The concatenated sequences (except RAG1) partitioned by locus same way. were also analysed by Maximum Likelihood bootstrapping (MLBS).

368 P. Alström et al. Molecular Phylogenetics and Evolution 127 (2018) 367–375

Revised taxonomy 0.46/55 Bradypterus centralis 1. Bradypterus 0.58/– Bradypterus graueri 0.99/98 Bradypterus carpalis 2. Megalurus a 0.79/86 Bradypterus baboecala a 3. Catriscus Bradypterus brunneus 4. Schoenicola / 0.97/88 Amphilais seebohmi # b 1 **C b 5. Elaphrornis / Bradypterus cinnamomeus 0.55/– ** Bradypterus lopezi c c 6. Cincloramphus 0.99/ Bradypterus bangwaensis 1 * 0.38/– 7. Malia / Megalurus palustris forbesi 2 **D Megalurus palustris toklao e 8. Poodytes 0.41/– 9. Locustella 3 Schoenicola brevirostris d d 0.84 Chaetornis striata # f H 4 / E 10. Helopsaltes, /52 ** Schoenicola platyurus § g new genus 5 Elaphrornis palliseri # h 11. Robsonius 0.88/86 Megalurulus rufus # f g e 0.92/85 Megalurulus mariae # i h 0.87/92 Megalurulus whitneyi # 0.99/ Megalurus timoriensis / 0.52/– * ** A Megalurus macrurus j i 0.99/95 Megalurus mathewsi k 0.89 Buettikoferella bivittata # l 0.98/91 /54 j Megalurulus grosvenori # m k 6 l 0.33/65 Megalurulus rubiginosus # /99 m * F Megalurus cruralis n 7 Malia grata § o I 0.94/78 **/ Megalurus gramineus 8 **/ G Megalurus punctatus p Megalurus carteri o nƂ nƃ 0.38/98 Locustella chengi q 0.98/86 Locustella montis p

/ Locustella idonea / ** J1 Locustella mandelli q ** 0.52/– 0.98/71 Locustella alishanensis r 0.84/70 Locustella kashmirensis r / Locustella thoracica s 0.98/85 * * J2 Locustella davidi s 0.58/85 Locustella caudata J3 Locustella castanea 0.99/99 Locustella accentor # t / 9 / Locustella luscinioides ** J t * / ** Locustella fluviatilis ** J4 u * Bradypterus alfredi # 0.48/– 0.98/88 Locustella naevia u /99 v * J5 Locustella tacsanowskia 0.58/66 Locustella luteoventris v 0.94/ B * Locustella lanceolata w 0.99/* Locustella ochotensis w **/ Locustella pleskei 0.99/* Locustella certhiola x / Locustella pryeri y 10 ** K x / Locustella fasciolata z ** Locustella amnicola 11 Robsonius thompsoni § å y z 0.04

å

Fig. 1. *BEAST phylogeny of Locustellidae based on the mitochondrial cytb, and nuclear myo, ODC, LDH and GAPDH introns. Posterior probabilities (PP) and maximum likelihood bootstrap (MLBS) values are indicated at the nodes, in this order; * means PP 1.00/MLBS 100%. Clade labels (A–J) indicate clades discussed in the text; # indicates species not previously analysed phylogenetically; and § indicates species not analysed in previous comprehensively sampled Locustellidae phylogeny. 1 MLBS 83% for clade with Schoenicola brevirostris sister to clade C. Illustrations by Ian Lewington, Brian Small, Jan Wilczur and Tim Worfolk, from del Hoyo et al. (2006), with permission from the publishers.

MLBS (1000 replicates) was conducted with RAxML-HPC2 version and the potential scale reduction factor (PSRF) being close to 1.00 for 8.2.10 (Stamatakis, 2014). Default parameters were used. all parameters. Because Robsonius was sister to the rest of Locustellidae in all pre- Several of the BI and the MLBS analyses were run on the CIPRES liminary analyses, we tested that this genus is indeed part of this clade Science Gateway (Miller et al., 2010). and not more distantly related by analysing a dataset including re- presentatives from the primary clades within the Passerida group as revealed by previous studies (e.g. Alström et al., 2006; Fregin et al., 2.4. Song comparisons 2012; Alström et al., 2014; Moyle et al., 2016), using sequences from Alström et al. (2014). This was run in MrBayes 3.2 (Huelsenbeck and Sound recordings of territorial songs were obtained from all Ronquist, 2001; Ronquist and Huelsenbeck, 2003) using concatenated Locustella species (own recordings and from xeno-canto [www.xeno- sequences partitioned by locus and the following models: cytb and ODC canto.org] and British Library National Sound Archive). Sonograms GTR + Γ + I; myo and GAPDH HKY + Γ; and LDH GTR + Γ. Default were generated in Raven Pro 1.5 (Cornell Laboratory of Ornithology, priors in MrBayes were used. Four Metropolis-coupled MCMC chains Ithaca, USA) to graphically illustrate differences among species. All of were run for 5 million generations and sampled every 1000 genera- our own sound recordings used for this study have been deposited in tions. Convergence was checked as for the BEAST analyses, as well as by xeno-canto (www.xeno-canto.org), and detailed information is avail- the average standard deviation of split frequencies passing below 0.01 able as available as Supplementary Table S3.

369 P. Alström et al. Molecular Phylogenetics and Evolution 127 (2018) 367–375

3. Results 3.3. Morphological, vocal and behavioural differences between species in clades J and K 3.1. Species-level phylogeny Within Locustella (clade B), the species in clades J and K differ in The *BEAST phylogeny based on all sequences except RAG1 (Fig. 1) that the latter are generally larger (clade K: 13–18 cm, 12–33 g; clade J: identified Robsonius as sister to all other locustellid species, which were 12–18 cm, 9–21 g; del Hoyo et al., 2006). The lower mandible is always divided into two primary clades (A and B). Clade A (PP 1.00) comprised pale in the species in clade K, whereas it is all black in the breeding all genera except Locustella, and clade B (PP 0.94) contained all Lo- season, at least in males, in many of the species in clade J (Kennerley custella and one Bradypterus. Within clade A, five strongly supported (PP and Pearson, 2010; pers. obs.). 1.00) clades were found (C–G), each containing 1–4 genera. Clades C–E The songs of the species in clade K consist of short (c. 2–5 s) strophes plus Schoenicola brevirostris and Elaphrornis palliseri formed the poorly separated by distinct pauses (c. 2–15 s; shorter strophes when excited; supported (PP 0.84) clade H; and clades F–G formed clade I (PP 0.94). Fig. 3). All or most of the elements in the strophes are either different Clade H comprised six genera from the Afrotropical, Madagascan and from each other (in L. amnicola, L. fasciolata, L. pryeri) or arranged in a Oriental regions, and clade I included four genera mainly distributed in few to several different “blocks” of similar notes (in L. certhiola, L. the Indo-Pacific. Within clade B, two main clades (J, K) were strongly ochotensis, L. pryeri). In contrast, the songs of the species in clade J supported (PP 1.00). All of the polytypic genera were non-mono- consist of short, comparatively simple syllables, which are mono- phyletic. The Afrotropical Bradypterus clade (C) also contained the tonously repeated at very short intervals (e.g. in L. accentor, L. thoracica, monotypic genus Amphilais from Madagascar, whereas the Afrotropical L. davidi) or in drawn-out, rattling reels (e.g. in L. naevia, L. luteoventris; Bradypterus alfredi was in one of the Locustella clades (J). Megalurus and Fig. 3). The songs of the species in clade J may continue without any Megalurulus were scattered across clades D, F and G, and the monotypic distinct pauses for up to a few minutes. The song of L. pryeri in clade K Buettikoferella and Malia were also nested among these. Finally, the two may seem rather similar to that of e.g. L. tacsanowskia in clade J, but the Schoenicola species were not sisters. Instead, the Oriental S. platyurus song elements are more varied, without the regularly repeated pattern was strongly supported as sister to the monotypic Chaetornis, whereas of L. tacsanowskia and the other species in clade J (Fig. 3). In all species the position of the Afrotropical S. brevirostris was uncertain. in clade K except L. fasciolata and L. amnicola, the song is regularly The topology of the BEAST tree based on the concatenated se- delivered in a short song-flight, unlike in the species in clade J (Fig. 3; quences (except RAG1) was mostly in agreement with the *BEAST tree Kennerley and Pearson, 2010; pers. obs.). (Supplementary Fig. S1). The former found stronger support for clade B (1.00 vs. 0.94) and I (0.98 vs. 0.94) as well as a number of the re- 4. Discussion lationships within smaller clades (highlighted in blue in Supplementary Fig. S1). The position of Robsonius as sister to the rest of Locustellidae 4.1. Phylogeny was confirmed in the analysis of a broader sampling from Passeriformes (Supplementary Fig. S2). The tree based on concatenated nuclear loci Our study is the most comprehensive analysis of the Locustellidae. It (except RAG1; Supplementary Fig. S3) strongly supported relationships includes five previously unsampled monotypic genera and in total 11 among clades J1–J5 that were incongruent with those in the *BEAST previously unstudied species and three additional species that have not (Fig. 1) and cytb (Fig. 2) trees. Single-locus analyses, especially of the been analysed in a study with a large number of species. It also includes nuclear loci, were generally not well resolved (Supplementary Figs. S4 one extinct species, Megalurus rufescens. Only Bradypterus grandis, and S5). Maximum Likelihood bootstrapping of the complete dataset Megalurus albolimbatus and Megalurulus llaneae were not analysed. (except RAG1) was generally in agreement with the BI analyses, espe- The majority of nodes (∼60%) are well supported (PP ≥ 0.95). cially the BEAST analysis of concatenated sequences (Fig. 1). However, some deep relationships remain uncertain. In particular, the support is poor for clade H, and the relationships among clades C, D, E, Schoenicola brevirostris and Elaphrornis palliseri are equivocal, likely due 3.2. Dating and intraspecific variation to their short internode distances. We note that the support for the position of Schoenicola brevirostris as sister to clade C is stronger in the The chronogram based on cytb and containing subspecies of some concatenation analysis of all loci (PP 1.00; MLBS 83%) and in the species (Fig. 2) has generally wide confidence intervals. Our dating concatenation analysis of the nuclear loci (PP 1.00), and the support for suggests that Robsonius diverged from the rest of Locustellidae at clade I is stronger in the concatenation analyses of all loci (PP 0.97; 22.7 mya (95% HPD 16.9–29.2 mya), and the age of the split between MLBS 78%). This makes sense from a biogeographical point of view – S. clades A and B was estimated at 15.4 mya (95% HPD 12.1–19.0 mya). brevirostris is an Afrotropical species, like all Bradypterus. The two primary clades A and B were estimated to have diversified The lack of evidence for a close relationship between Schoenicola since around 14.5 mya (95% HPD c. 11–18 mya). Six of the main clades brevirostris and S. platyurus is surprising, because they have been treated (C, E, F, G, J, K) diversified during the period c. 7.8–11.4 my (95% HPD as conspecific due to their very similar appearances (e.g. Watson et al., c. 5.6–14.3 mya). 1986), while they differ from Bradypterus in for example their broader Several of the polytypic species included subspecies estimated to and more strongly graduated tails with pale tips (Madge, 2017). In have separated > 2 mya: Bradypterus lopezi ufipae vs. B. l. mariae contrast, Chaetornis striata, which we found as sister to S. platyurus,is (2.1 mya; 95% HPD 1.3–3.0 mya); Megalurus palustris forbesi vs. M. p. morphologically markedly different, although it shares the pale-tipped toklao (4.0 mya; 2.7–5.5 mya); and Megalurus punctatus caudatus vs. M. rectrices with the two Schoenicola species, and it occurs in the same p. vealeae (2.2 mya; 1.4–3.1 mya). Also the two samples of Locustella geographical area as S. platyurus (Indian subcontinent) (Madge, 2017). caudata unicolor were deeply diverged (2.7 mya; 1.8–3.7 mya), as were We hypothesise that S. brevirostris is sister to clade E (as suggested by the two samples of the monotypic Bradypterus brunneus (5.7 mya; cytb, although with no support), and that the plumage similarity be- 4.1–7.5 mya). In addition, Megalurus timoriensis and M. macrurus were tween S. brevirostris and S. platyurus is plesiomorphic. inferred to be non-monophyletic, with deep divergences between M. The Sri Lankan endemic Elaphrornis palliseri was previously placed timoriensis tweedalei–M. t. crex and M. macrurus macrurus–M. m. inter- in Bradypterus (e.g. Watson et al., 1986), and its move to Elaphrornis was scapularis, respectively. The non-sisters Locustella ochotensis–L. certhiola only based on it being “entirely distinct from the genus Bradypterus” were not monophyletic, as one individual of the former was nested (Dickinson, 2003). The monotypic Elaphrornis is here shown to be dis- within the latter. tinct, although a close relationship with the Bradypterus clade (C) cannot be excluded. In contrast, the Malagasy endemic Amphilais

370 P. Alström et al. Molecular Phylogenetics and Evolution 127 (2018) 367–375

ufipae Zambia HQ706165 * * mariae Tanzania HQ706164 Bradypterus lopezi 0.97 AY958226 * AY958225 Bradypterus barratti € mildbreadi Uganda HQ706166 0.92 Bradypterus cinnamomeus 0.82 * mildbreadi Uganda AY124541 Nigeria HQ706163 Bradypterus bangwaensis 0.55 Madagascar HQ706160 Bradypterus brunneus Madagascar ZMUC 27.941 0.88 BMNH 1931.8.18.2781 * ZMUC 27.940 Amphilais seebohmi * Kenya HQ706162 0.83 * Kenya AY958230 Bradypterus carpalis tongensis/transvaalensis South Africa DQ008473 0.99 C 0.83 * transvaalensis South Africa AY958221 Bradypterus baboecala elgonensis Kenya FJ883053 0.74 * centralis Nigera Bradypterus centralis 0.99 Uganda HQ706161 Bradypterus graueri sylvaticus South Africa AY958228 * pondoensis South Africa AY958229 Bradypterus sylvaticus € forbesi Negros, Philippines FJ883052 Megalurus palustris 0.40 H * toklao Punjab, India DQ008477 D India KJ702891 E * India BMNH 1949.Whi.1.11654 Schoenicola platyurus * India KJ702890 0.65 Nepal DZUG U1894 Chaetornis striata 0.48 Mozambique BMNH 1933.3.1.1048 * Tanzania DZUG U2466 Schoenicola brevirostris Sri Lanka YPM20205 Elaphrornis palliseri tweeddalei Negros, Philippines ZMUC 10409 0.98 * tweeddalei Luzon, Philippines HQ706170 Megalurus timoriensis interscapularis New Britain ZMUC 2033 0.42 * macrurus New Guinea JN827115 Megalurus macrurus crex Mindanao, Philippines ZMUC 452 Megalurus timoriensis 0.31 New Hebrides BMNH 1935.10.22.410 Megalurulus whitneyi 0.83 A * New Caledonia BMNH 1882.5.29.4 0.98 * New Caledonia MNHN NC92 Megalurulus mariae 0.99 New Caledonia MNHN NC93 rufus Viti Levu, Fiji KU 22572 Megalurulus rufus * rufus Viti Levu, Fiji KU 22565 Australia HQ706169 0.72 * Australia HQ706168 Megalurus mathewsi * Timor BMNH 1937.12.20.7 * Timor MNHN 1898.54 Buettikoferella bivittata 0.65 New Britain AMNH 777970 Megalurulus rubiginosus * New Britain AMNH 777969 0.50 New Britain AMNH 708127 Megalurulus grosvenori * * New Britain AMNH 777991 Australia HQ706167 Megalurus cruralis F Sulawesi JX398905 Malia grata I ssp.? Locality? ComplMt NC_029138 * 0.49 * vealeae New Zealand HQ706173 Megalurus punctatus caudatus Snares Isl., NZ AMNH 748439 * Chatham Isl., NZ MNHN1896.2372 Megalurus rufescens € * goulburni S Australia HQ333042 Megalurus gramineus * W Australia HQ706172 G * W Australia HQ706171 Megalurus carteri N Vietnam KP773442 0.97 West Bengal, India HQ706135 Locustella mandelli * Sichuan, China KP773448 0.43 S Vietnam KP773450 Locustella idonea Shaanxi, China KP773459 Sichuan, China KP773452 Locustella chengi * Hunan, China KP773456 * montis Java, Indonesia KP773440 0.70 montis Java, Indonesia HQ706137 montis Bali, Indonesia HQ706138 Locustella montis * timorensis Timor, Indonesia KP773464 0.80 timorensis Timor, Indonesia KP773463 J1 Luzon, Philippines KP773462 Locustella seebohmi € Taiwan HQ706132 * Taiwan HQ706133 Locustella alishanensis * * Sichuan, China DQ367929 Sichuan, China DQ367930 Locustella thoracica 0.99 * Qinghai, China DQ367928 Himachal Pradesh, India DQ367926 Locustella kashmirensis * * Himachal Pradesh, India DQ367927 * Hong Kong HQ706141 J2 Hebei, China (m) DQ367931 Locustella davidi * Mongolia DQ367935 Borneo LSUMZ B-52695 Locustella accentor 0.45 * Borneo LSUMZ B-52679 unicolor Mindanao, Philippines JX398901 Locustella caudata * * unicolor Mindanao, Philippines HQ706140 J3 castanea Sulawesi, Indonesia DQ367925 Locustella castanea 0.68 Mongolia HQ333037 Slovakia HQ608847 * Hebei, China (m) DQ008474 Locustella tacsanowskia * Irkutskaya Oblast, Russia HQ706146 * Sweden HQ706147 Locustella naevia * Ladakh, India HQ706174 Locustella major € J5 N Vietnam HQ706143 * * Thailand HQ706144 Locustella luteoventris 0.90 W Myanmar HQ706145 J Slovakia HQ608847 * Kenya (m) AJ004764 Locustella fluviatilis * Kenya (m) DQ008475 * Germany AJ004763 Sweden HQ706149 Locustella luscinioides * * Israel HQ706148 J4 Ethiopia USNM 568000 Bradypterus alfredi China (m?) DQ119525 Hebei, China (m) HQ706139 Locustella lanceolata * Hebei, China (m) JX398904 * B South Korea AB159191 Japan AB159188 Locustella pleskei Japan HQ706158 * Philippines (m) HQ706156 Taiwan (m) HQ706157 Locustella ochotensis * * Magadan, Russia AB261542 $ Thailand (m) HQ706155 0.99 * Hebei, China DQ008476 Locustella certhiola Ningxia, China HQ706154 China EU016091 K Japan HQ706152 Locustella pryeri * * China EU016090 Sakhalin, Russia HQ706150 * Japan Y15689 Locustella amnicola * Hebei, China (m) HQ706151 Locustella fasciolata Philippines JX398907 * Philippines KC603632 Robsonius thompsoni * Philippines JN827168 Robsonius sorsogonensis € 0.98 Philippines KC603623 Robsonius rabori € 20 15 10 5 2 0 million years ago

Fig. 2. Cytochrome b (cytb) chronogram including all species and subspecies available for this study. Dates based on a 2.1%/million years molecular clock. Species for which only cytb is available, and which are therefore not in Fig. 1, are indicated by €. Posterior probabilities (PP) are indicated at the nodes; * means PP 1.00. Clade labels (A–J) indicate clades discussed in the text. The purple line at 2 million years ago highlights the existence of several deep intraspecific divergences. seebohmi is firmly nested in Bradypterus, as sister to the Malagasy en- corroborates this is cytb, whereas analysis of a small set of RAG1 se- demic B. brunneus. Amphilais seebohmi is sometimes placed in the genus quences (Supplementary Fig. S5) strongly supports a sister relationship Dromaeocercus, together with B. brunneus (e.g. Watson et al., 1986), and between M. palustris and M. mathewsi (which is the only representative is treated as incertae sedis by Dickinson and Christidis (2014). of clade I in that analysis). The same was found by Alström et al. The position of Megalurus palustris in clade H is not strongly sup- (2011a), who discussed this at length, and concluded that inclusion of ported in any of our multilocus analyses, and the only SLA that strongly Megalurus palustris in the equivalent of clade H is surprising from both a

371 P. Alström et al. Molecular Phylogenetics and Evolution 127 (2018) 367–375

kHz Clade K 10 L. amnicola L. fasciolata L. certhiola

5

510s L. pleskei L. pryeri L. ochotensis

Clade J L. accentor L. caudatus L. alishanensis

L. mandelli L. kashmirensis L. thoracica

L. davidi L. naevia L. major

L. tacsanowskia L. luteoventris L. fluviatilis

kHz 10 L. lanceolata L. luscinioides L. alfredi

5

510s

Clade K Clade J

kHz L. pryeri L. tacsanowskia L. luteoventris 10

5

12s

Fig. 3. Sonograms of Locustella sensu lato. All of the species in clade K are shown, but not all of the ones in clade J, though the ones missing from clade J have songs that are reminiscent of species illustrated. The species in clade K have short complex strophes separated by pauses of varying length (length of pauses mainly depending on level of excitement); only in two of the individuals shown here are the pauses short enough to show two consecutive strophes. The species in clade J have “continuously flowing” songs, except L. tacsanowskia, which has well defined strophes of varying length separated by pauses of variable length. The three lowermost sonograms are shown at higher temporal resolution than the others to highlight the greater complexity and less regular structure of L. pryeri compared to L. tacsanowskia and L. luteoventris. The photos are a collage of a L. pryeri singing in song-flight, which all in clade K except L. amnicola and L. fasciolata regularly do (photos: Lars Petersson; Honshu, Japan, June 2017). See Supplementary Table S3 for details about the recordings used to create the sonograms. morphological, vocal and biogeographical point of view. If M. palustris clade I, as the two monotypic genera Malia and Buettikoferella as well as indeed belongs in clade H, the most parsimonious position would be as the five species of Megalurulus are intermixed with Megalurus. Alström sister to the others, as the strong similarities in plumage, structure, size et al. (2011a) also found the equivalent of this clade to contain a non- and voice to some of the other species in clade I could then be explained monophyletic Megalurus (see below), although they did not include as being plesiomorphic. Malia, Buettikoferella or Megalurulus. Oliveros et al. (2012) recently The non-monophyly of Megalurus is further exaggerated within discovered that Malia grata, with previously unknown affinities, is part

372 P. Alström et al. Molecular Phylogenetics and Evolution 127 (2018) 367–375 of Locustellidae; it was recovered with strong support as sister to consists of two subspecies groups (Kennerley and Pearson, 2010; del Megalurus timoriensis, which was the only representative for our clade I Hoyo and Collar, 2016), but B. l. ufipae and B. l. mariae belong to the in their study. Buettikoferella bivittata is firmly anchored in a clade with same group. However, these two taxa inhabit different montane areas Megalurus mathewsi, M. timoriensis, M. macrurus and the five Megalurulus in central and eastern Africa. The divergence within the Madagascar species, although its sister relationship with M. mathewsi is poorly endemic Bradypterus brunneus, which was estimated at 5.7 mya (95% supported. Also Megalurulus is not monophyletic; none of the relation- HPD 4.1–7.5 mya) is exceptional, as this species is considered mono- ships among the species are strongly supported by *BEAST, although typic (Dickinson and Christidis, 2014; del Hoyo and Collar, 2016; Gill the relationships among M. rufus, M. mariae and M. whitneyi are well and Donsker, 2017). supported in the BI and ML analyses of concatenated data. The divergence between Megalurus palustris forbesi from the The strong non-monophyly of Megalurus and Megalurulus is un- Philippines and northern Borneo and M. p. toklao, which is patchily expected. Except for M. carteri and male M. cruralis, the members of the distributed across southern continental Asia, is pronounced (4.0 mya; genus Megalurus, including M. palustris, form a morphologically fairly 95% HPD 2.7–5.5 mya). Much denser sampling will be needed to homogeneous group (del Hoyo et al., 2006; cf. Fig. 1). From a mor- evaluate the taxonomy of this complex. A deep split (2.2. mya; 95% phological perspective, the species in Megalurulus and Buettikoferella HPD 1.4–3.1 mya) was also found between the Megalurus punctatus bivittata are fairly similar, while they differ much from Megalurus by caudatus (confined to Snares Island, New Zealand) and M. p. vealeae their more uniform and more saturated brown plumage colorations (del (North Island, New Zealand). The former has recently been treated as a Hoyo et al., 2006; cf. Fig. 1). The differences appear to be adaptive: distinct species based on morphological characters (del Hoyo and Megalurulus species occur in understory of evergreen mesic habitats, Collar, 2016). Our single sample of the extinct M. rufescens from Cha- whereas Megalurus species are associated with grasslands or more arid tham Island, New Zealand is deeply diverged from M. punctatus. These scrubby habitats. Malia grata is highly aberrant in plumage and ecology two taxa are often treated as conspecific (e.g. Dickinson and Christidis, (mainly arboreal, social; Collar and Robson, 2017; pers. obs.) compared 2014), although del Hoyo and Collar (2016) treated them as separate to all other members of Locustellidae (cf. Fig. 1). Strongly divergent species based on morphological differences. However, the suggestion by plumages, such as the green and yellow plumage of Malia grata and the del Hoyo and Collar’s (2016) that M. rufescens might be most closely boldly patterned male Megalurus cruralis, could probably evolve fairly related to Megalurulus rufus is strongly rejected by our data. fast under strong selection, as has been suggested to have happened Megalurus timoriensis and M. macrurus are paraphyletic with respect multiple times in other families within Sylvioidea (Alström et al., to each other, with deep divergences between M. t. tweeddalei and M. t. 2011b, 2013b). Niche shifts, such as in Malia grata, have likely trig- crex and between M. m. macrurus and M. m. interscapularis, respectively. gered strong morphological divergence in some other Indonesian island The two latter taxa belong to different subspecies groups, which differ endemics (Fjeldså et al., 2010; Alström et al., 2015). However, it cannot in elevational distribution and number of tail feathers (Schodde and be excluded that phylogenetic results suggesting unexpectedly distant Mason, 1999; Dickinson and Christidis 2014; del Hoyo and Collar, relationships between morphologically similar species might be the 2016), whereas to our knowledge the other taxa have not been sug- result of stochastic processes, such as lineage sorting across multiple gested to be markedly different. A taxonomic revision may be war- speciation events (‘hemiplasy’; Avise and Robinson, 2008) rather than ranted, but more extensive research is needed. parallel evolution. Locustella certhiola, L. ochotensis and L. pleskei have long been con- Within clade B, subclades J and K are well supported and deeply sidered closely related, and have been treated variously as either con- diverged. As further support of this subdivision, there are average dif- specificordifferent species (review in Kennerley and Pearson, 2010). ferences in size and song between them (see below). Bradypterus alfredi Our study supports a sister relationship and recent divergence is well supported as sister to Locustella luscinioides + L. fluviatilis within (0.68 mya; 95% HPD 0.35–1.06 mya) between the allopatric L. pleskei clade J. It is the only Afrotropical species in clade B. and two of the three L. ochotensis, with L. certhiola and the third L. The three species of Robsonius form a strongly supported sister clade ochotensis as more deeply diverged sisters (2.9 mya; 95% HPD to the rest of Locustellidae. This agrees with Oliveros et al. (2012), who 2.0–4.0 mya). The L. ochotensis with a L. certhiola cyt b haplotype was disclosed this unexpected position of Robsonius, which was previously collected at Magadan, Russia (Takema Saitoh, in litt.). The same to- considered a “babbler” (e.g. Dickinson 2003). pology (except for paraphyly of L. ochotensis/L. certhiola) was pre- viously found using a smaller mitochondrial dataset (Drovetski et al., 4.2. Dating and intraspecific variation 2004). A more comprehensive study by Drovetski et al. (2015) also found L. certhiola as sister to the two others in a mitochondrial ND2 Recent, broadly sampled, genome-scale studies suggest generally tree, but recovered L. pleskei to be paraphyletic with respect to L. younger ages for sylvioid passerines than we recovered here (Prum ochotensis, and also identified one phenotypic L. certhiola from Kha- et al., 2015; Moyle et al., 2016). However, our results largely agree with barovsk with a L. ochotensis ND2 haplotype. In contrast, in a species tree those from a multilocus phylogenetic analysis of all Himalayan pas- based on 12 nuclear introns, the same authors recovered L. certhiola and serines, which was dated using multiple fossils and biogeographic dates L. ochotensis as sisters, with L. pleskei sister to these two, with strong (Price et al., 2014), as well as with an analysis of the modern birds support. The dating of the deepest node in their ND2 tree was con- (Neornithes) using a multigene matrix and a large number of fossil siderably younger than in our study (1.6 mya; 95% HPD 1.2–2.0 mya), calibrations (Claramunt and Cracraft, 2015). In particular the date in- and the ages estimated by the nuclear introns were even younger. ferred here for the divergence of Robsonius should be treated with caution. 4.3. Taxonomic implications Several polytypic species harbour deep cytb divergences, which are considerably deeper than between some other taxa treated as separate Alström et al. (2011a) found the genus-level taxonomy of Locus- species. Because the morphological variation within some groups is tellidae to be strongly incongruent with the phylogeny, and proposed a relatively slight and because many of the species are poorly known, it major reclassification. The present analysis, which includes 13 species seems likely that some currently recognised species are better treated as whose phylogenetic position has either not been tested previously or two (or more) species. Further studies of larger samples and using in- only in a narrower context, revealed further conflict between taxonomy dependent data, such as nuclear markers and vocalisations, are war- and phylogeny. The revised taxonomy of Alström et al. (2011a) re- ranted to shed light on the taxonomic status of these taxa. cognised only four genera: Locustella (comprising the traditional Lo- The rather widely allopatric Bradypterus lopezi ufipae and B. l. mariae custella and all Asian Bradypterus), Bradypterus (restricting this genus to are deeply diverged (2.1 mya; 95% HPD 1.3–3.0 mya). This species the African species), Schoenicola (only S. brevirostris studied) and

373 P. Alström et al. Molecular Phylogenetics and Evolution 127 (2018) 367–375

Megalurus (including Eremiornis carteri, Cincloramphus cruralis and C. diagnostic morphological characters are known to us, but there are mathewsi). average differences between Helopsaltes and Locustella sensu stricto in Alström et al. (2011a) stressed that their proposed Megalurus was overall size (see Section 3.3). probably non-monophyletic, but noted that the support was based Etymology: The name means “the marsh musician”, from Greek helos mainly on cytb, and that this was contradicted by other data. Therefore, (ἕλος), marshy ground, and Greek psaltes (ψάλτης), a musician playing the authors preliminarily retained Megalurus for a potentially non- a string instrument. monophyletic group. However, Dickinson and Christidis (2014) and del Hoyo and Collar (2016), based on the same study by Alström et al. Acknowledgements (2011a), restricted Megalurus to M. palustris (type species of this genus). Moreover, Dickinson and Christidis (2014) and del Hoyo and Collar We are grateful to Joel Cracraft, Paul Sweet and Thomas J. (2016) applied the name Cincloramphus to M. cruralis, M. mathewsi, M. Trombone (American Museum of Natural History); Robert Prys-Jones timoriensis and M. macrurus (the two former species were previously and Mark Adams (The Natural History Museum, Tring); Mark Robbins, placed in this genus). They also resurrected the genus Poodytes for M. University of Kansas Biodiversity Institute; Frederick H. Sheldon (LSU gramineus, M. punctatus, M. caudatus, M. rufescens, M. carteri and M. Museum of Natural Science Collection of Genetic Resources, Louisiana albolimbatus (though M. caudatus and M. rufescens were not given spe- State University); Ulf Johansson and Peter Nilsson (Swedish Museum of cies status by Dickinson and Christidis, 2014). Megalurus albolimbatus Natural History); Christopher M. Milensky (US National Museum); has not yet been analysed phylogenetically. Richard Prum and Kristof Zyskowski (Yale Peabody Museum of Natural Our results call for further taxonomic revision, although due to the History); Jan Bolding Kristensen (Zoological Museum, University of uncertain relationships especially with respect to Megalurus, none of the Copenhagen); Staffan Andersson; Hem Sagar Baral; Geoff Carey; Paul alternative classifications are fully satisfactory. Synonymising Amphilais Leader; Ulf Ottosson; and Yoshimitsu Shigeta for providing some sam- with Bradypterus is straightforward, and so is moving Bradypterus alfredi ples. A.C. benefitted from a Collection Study Grant from the Frank M. to Locustella. Due to the strong support for a sister relationship between Chapman Memorial Fund to visit the AMNH. E.P. thanks Jean-Jérôme Chaetornis striata and Schoenicola platyurus, we propose synonymising Cassan (Direction du développement économique et de l'environnement the former genus with the latter (based on priority). As there is no de la province Nord), Anne-Claire Goarant (Direction de l'environne- unanimous support for a close relationship between these and ment de la province Sud), Romain Bonifay (Municipalité de Nouméa), Schoenicola brevirostris, we hesitantly propose reinstating the name Julien Baudat-Franceschi (Société Calédonienne d'Ornithologie), Catriscus Cabanis, 1851 for the latter (which then becomes a monotypic Almudena Lorenzo and Mariane Bonzon (Parc Zoologique et Forestier genus). Because Elaphrornis has no obvious close relatives, we suggest de Nouméa), Péguy and Jean-Pierre Drain (Nouméa) for their assistance retaining this monotypic genus. during fieldwork in New Caledonia. E.P. was supported by the grant With respect to Megalurus, we follow Dickinson and Christidis ANR Biodiversité BIONEOCAL, a project led by Philippe Grandcolas (2014) and del Hoyo and Collar (2016) in restricting this name to M. (MNHN). M.J.A. and R.G.M. thank Marika Tuiwawa, Alivereti palustris and applying the name Poodytes to clade G. We also accept the Naikatini, Sanivalati Vido, the Fiji Department of Forestry and the use of the name Cincloramphus for clade F excluding M. grata, but also Biosecurity Authority of Fiji for assistance in Fiji. We are grateful to propose to synonymise Megalurulus and Buettikoferella with Cinclor- Steven Gregory, Normand David, Ib Friis, Minna Skafte Jensen, Edward amphus. Malia grata is strongly supported as belonging to clade F, and Dickinson, Frank Gill, David Donsker, Alan Peterson and Les Christidis was estimated to have separated less than one million years before C. for advise on the new scientific name; to Josep del Hoyo, Elisa Badia cruralis diverged. Accordingly, it would be appropriate to include it in and Lynx Edicions for allowing us to publish illustrations from Cincloramphus (by priority); however, to maintain taxonomic stability Handbook of the Birds of the World; to Lars Petersson for letting us and also to highlight its morphological and ecological uniqueness, we publish his photos of Locustella pryeri; to Dave Farrow for providing a prefer to retain the name Malia. Application of the name Robsonius is sound recording of Locustella major; and to Laima Bagdonaite for sub- unproblematic. mitting the sequences to GenBank. Some of the analyses were run on Alström et al. (2011a) proposed placing all of the taxa in clade B in the CIPRES Science Gateway. P.A. was supported by the Swedish Locustella (except L. alfredi, which they did not analyse), and this was Research Council (2015-04402), Jornvall Foundation, and Mark and followed by Dickinson and Christidis (2014), del Hoyo and Collar Mo Constantine; M.I. was supported by the Swedish Research Council (2016) and Gill and Donsker (2017). However, in order to use the genus (621-2014-5113); M.J.A. and R.G.M. were supported by NSF (DEB- category in a more consistent way across the two main clades of Lo- 1557051 and DEB-1557053, respectively); and J.F. acknowledges the custellidae, we propose splitting Locustella into two genera. The name Danish National Research Foundation for support to the Center for Locustella is restricted to clade J. However, no name is available for Macroecology, Evolution and Climate (DNRF96). We are most grateful clade K. Accordingly, we here propose a new genus name for this clade: to Frank Rheindt and one anonymous reviewer for helpful comments on the manuscript. Helopsaltes, new genus Type species: Motacilla Certhiola Pallas, 1811. Gender masculine. Appendix A. Supplementary material Included taxa: All of the species in clade K in Figs. 1 and 2, which should now be named Helopsaltes certhiola, Helopsaltes ochotensis, He- Supplementary data associated with this article can be found, in the lopsaltes pleskei, Helopsaltes pryeri, Helopsaltes fasciolatus and Helopsaltes online version, at https://doi.org/10.1016/j.ympev.2018.03.029. amnicola. All species epithets except fasciolatus are invariable, and therefore must not change ending due to change of gender of the sci- References entific name. Diagnosis: The songs consist of short (c. 2–5 s) strophes separated by Alström, P., Ericson, P.G.P., Olsson, U., Sundberg, P., 2006. Phylogeny and classification – distinct pauses (c. 2–15 s; highly variable depending on level of ex- of the avian superfamily Sylvioidea. Mol. Phylogenet. Evol. 38, 381 397. Alström, P., Fregin, S., Norman, J.A., Ericson, P.G.P., Christidis, L., Olsson, U., 2011a. citement). All or most of the elements in the strophes are different from Multilocus analysis of a taxonomically densely sampled dataset reveal extensive non- each other, or arranged in different “blocks” of similar notes. The songs monophyly in the avian family Locustellidae. Mol. Phylogenet. Evol. 58, 513–526. of the species of Locustella sensu stricto are less clearly separated into Alström, P., Höhna, S., Gelang, M., Ericson, P.G.P., Olsson, U., 2011b. Non-monophyly and intricate morphological evolution within the avian family Cettiidae revealed by strophes, and consist of very fast rattling reels or monotonous repeti- multilocus analysis of a taxonomically densely sampled dataset. BMC Evol. Biol. 11, tions of rather simple syllables. See Section 3.3 and Fig. 3.No 352. Alström, P., Olsson, U., Lei, F., 2013a. A review of the recent advances in the systematics

374 P. Alström et al. Molecular Phylogenetics and Evolution 127 (2018) 367–375

of the avian superfamily Sylvioidea. Chinese Birds 4, 99–131. Gill, F., Donsker, D., 2017. IOC World Bird List (v 7.2). doi: 10.14344/IOC.ML.7.2. Alström, P., Barnes, K.N., Olsson, U., Barker, F.K., Bloomer, P., Khan, A.A., Qureshi, M.A., Heled, J., Drummond, A.J., 2010. Bayesian inference of species trees from multilocus Guillaumet, A., Crochet, P.-A., Ryan, P.G., 2013b. Multilocus phylogeny of the avian data. Mol. Biol. Evol. 27, 570–580. family Alaudidae (larks) reveals complex morphological evolution, non-mono- Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of phylogenetic trees. phyletic genera and hidden species diversity. Mol. Phylogenet. Evol. 69, 1043–1056. Bioinformatics 17, 754–755. Alström, P., Hooper, D.M., Liu, Y., Olsson, U., Mohan, D., Gelang, M., Hung, L.M., Zhao, Irestedt, M., Ohlson, J.I., Zuccon, D., Källersjö, M., Ericson, P.G.P., 2006. Nuclear DNA J., Lei, F., Price, T.D., 2014. Discovery of a relict lineage and monotypic family of from old collections of avian study skins reveals the evolutionary history of the Old passerine birds. Biol. Lett. 10, 20131067. World suboscines (Aves, Passeriformes). Zool. Scr. 35, 567–580. Alström, P., Jönsson, K., Fjeldså, J., Ödeen, A., Ericson, P.G.P., Irestedt, M., 2015. Johansson, U.S., Fjeldså, J., Bowie, R.C.K., 2008. Phylogenetic relationships within Dramatic niche shifts and morphological change in two insular bird species. Roy. Soc. Passerida (Aves: Passeriformes): a review and a new molecular phylogeny based on Open Sci. 2, 140364. three nuclear intron markers. Mol. Phylogenet. Evol. 48, 858–876. Avise, J.C., Robinson, T.J., 2008. Hemiplasy: a new term in the lexicon of phylogenetics. Kennerley, P.R., Pearson, D., 2010. Reed and Bush Warblers. Christopher Helm, London. Systematic Biol. 57, 503–507. Madge, S. 2017. Broad-tailed Grassbird (Schoenicola platyurus); Fan-tailed grassbird Bock, W.J., 1994. History and nomenclature of avian family-group names. Bull. Am. Mus. (Schoenicola brevirostris); and Bristled Grassbird (Chaetornis striata). In: del Hoyo, Nat. Hist. 222, 1–283. J., Elliott, A., Sargatal, J., Christie, D.A. & de Juana, E. (eds.). Handbook of the Birds Claramunt, S., Cracraft, J., 2015. A new time tree reveals Earth history’s imprint on the of the World Alive. Lynx Edicions, Barcelona. (retrieved from < http://www.hbw. evolution of modern birds. Sci. Adv. 1, e1501005. com/node/58724 > , and < http:// Collar, N., Robson, C. 2017. Malia (Malia grata). In: del Hoyo, J., Elliott, A., Sargatal, J., www.hbw.com/node/58722 > , respectively, on 28 July 2017). Christie, D.A. & de Juana, E. (eds.). Handbook of the Birds of the World Alive. Lynx Miller, M.A., Pfeiffer, W., Schwartz, T., 2010. Creating the CIPRES Science Gateway for Edicions, Barcelona. (retrieved from http://www.hbw.com/node/59676 on 14 inference of large phylogenetic trees. In: Proceedings of the Gateway Computing September 2017). Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA pp 1–8. Darriba, D., Taboada, G.L., Doallo, R., Posada, D., 2012. jModelTest 2: more models, new Moyle, R.G., Oliveros, C.H., Andersen, M.J., Hosner, P.A., Benz, B.W., Manthey, J.D., heuristics and parallel computing. Nat. Methods 9 772-772. Travers, S.L., Brown, R.M., Faircloth, B.C., 2016. Tectonic collision and uplift of del Hoyo, J., Collar, N.J., 2016. HBW and BirdLife International illustrated checklist of Wallacea triggered the global songbird radiation. Nat. Commun. 7, 12709. the birds of the world. Volume 2: Passerines. Lynx Edicions, Barcelona. Oliveros, C.H., Reddy, S., Moyle, R.G., 2012. The phylogenetic position of some del Hoyo, J., Elliot, A., Christies, D.A., 2006. Handbook of the Birds of the World Vol. 11 Philippine “babblers” spans the muscicapoid and sylvioid bird radiations. Mol. Old World Flycatchers to Old World Warblers, Lynx Edicions, Barcelona. Phylogenetics Evol. 65, 799–804. Dickinson, E.C., 2003. The Howard & Moore Complete Checklist of the birds of the World. Price, T.D., Hooper, D.M., Buchanan, C.D., Johansson, U.S., Tietze, D.T., Alström, P., Christopher Helm, London. Olsson, U., Ghosh-Harihar, M., Ishtiaq, F., Gupta, S.K., Martens, J.E., Harr, B., Singh, Dickinson, E.C., Christidis, L., 2014. The Howard & Moore complete checklist of the birds P., Mohan, D., 2014. Niche filling slows the diversification of Himalayan songbirds. of the world. 4th ed. Vol. 2. Aves Press, Eastbourne, U. K. Nature 509, 222–225. Drovetski, S.V., Zink, R.M., Fadeev, I.V., Nesterov, E.V., Koblik, E.A., Red'kin, Y.A., Prum, R.O., Berv, J.S., Dornburg, A., Field, D.J., Townsend, J.P., Lemmon, E.M., Lemmon, Rohwer, S., 2004. Mitochondrial phylogeny of Locustella and related genera. J. Avian A.R., 2015. A comprehensive phylogeny of birds (Aves) using targeted next-genera- Biol. 35, 105–110. tion DNA sequencing. Nature 526, 569–573. Drovetski, S.V., Semenov, G., Red'kin, Y.A., Sotnikov, V.N., Fadeev, I.V., Koblik, E.A., Rambaut, A., Suchard, M.A., Xie, D., Drummond, A.J., 2014. Tracer v1.6, Available 2015. Effects of asymmetric nuclear introgression, introgressive mitochondrial from < http://beast.bio.ed.ac.uk/Tracer >. sweep, and purifying selection on phylogenetic reconstruction and divergence esti- Ronquist, F., Huelsenbeck, J.P., 2003. MRBAYES 3: Bayesian phylogenetic inference mates in the Pacific clade of Locustella warblers. PloS One 10 (4), e0122590. under mixed models. Bioinformatics 19, 1572–1574. Drummond, A.J., Ho, S.Y.W., Phillips, M.J., Rambaut, A., 2006. Relaxed phylogenetics Schodde, R., Mason, I.J., 1999. The Directory of Australian Birds: Passerines. CSIRO and dating with confidence. PLoS Biol. [Internet] 4. Publishing, Melbourne. Drummond, A.J., Suchard, M.A., Xie, D., Rambaut, A., 2012. Bayesian Phylogenetics with Stamatakis, A., 2014. RAxML version 8: A tool for phylogenetic analysiss and post-ana- BEAUti and the BEAST 1.7. Mol. Biol. Evol. 29, 1969–1973. lysis of large phylogenies. Bioinformatics 30, 1312–1313. Fjeldså, J., Irestedt, M., Ericson, P.G., Zuccon, D., 2010. The Cinnamon Ibon Watson, G.E., Traylor Jr., M.A., Mayr, E., 1986. Familly Sylviidae. In: Mayr, E., Cottrell, Hypocryptadius cinnamomeus is a forest canopy sparrow. Ibis 152, 747–760. G.W. (Eds.), A Check-List of Birds of the World: A Continuation of the Work of James Fregin, S., Haase, M., Olsson, U., Alström, P., 2012. New insights into family relationships L. Peters, Museum of Comparative Zoology, Cambridge, Massachusetts, pp. 3–294. within the avian superfamily Sylvioidea (Passeriformes) based on seven molecular Weir, J.T., Schluter, D., 2008. Calibrating the avian molecular clock. Mol. Ecol. 17, markers. BMC Evol. Biol. 12, 157. 2321–2328.

375 Supplementary Fig. S1: 0.98/– Bradypterus carpalis 0.94/– Bradypterus centralis BEAST All loci (except RAG1) /98 Bradypterus graueri concatenated * */86 Bradypterus baboecala /88 Bradypterus brunneus / * * * Amphilais seebohmi / Bradypterus cinnamomeus /83 * * * Bradypterus lopezi / Bradypterus bangwaensis 0.56/– * * Schoenicola brevirostris 0.52/– / Chaetornis striata * * Schoenicola platyurus 0.78/52 Elaphrornis palliseri / Megalurus palustris forbesi * * Megalurus palustris toklao */86 Megalurulus rufus */85 Megalurulus mariae */92 Megalurulus whitneyi / / Megalurus timoriensis 0.66/– * * * * Megalurus macrurus Megalurulus rubiginosus 0.94/95 /65 * Megalurulus grosvenori */91 Megalurus mathewsi /99 0.63/54 Buettikoferella bivittata * Megalurus cruralis Malia grata 0.97/78 / Megalurus punctatus / * * * * Megalurus gramineus Megalurus carteri /98 Locustella chengi 0.7*9/– Locustella montis /86 Locustella idonea / * */* * * Locustella mandelli /71 Locustella alishanensis * 0.99/70 Locustella kashmirensis / Locustella thoracica /85 * * * Locustella davidi /85 Locustella caudata /99* /– * Locustella castanea * Locustella accentor /88 Locustella tacsanowskia /99 * Locustella naevia / * / * * Locustella luteoventris * * / Locustella fluviatilis / * * * * Locustella luscinioides Bradypterus alfredi 0.99/– Locustella lanceolata / * * / Locustella ochotensis / * * Locustella pleskei 0.90 / * * * * Locustella certhiola */* Locustella pryeri / Locustella amnicola * * Locustella fasciolata Robsonius thompsoni Thamnornis chloropetoides 0.99 * Hartertula flavoviridis Donacobius atricapilla Hippolais olivetorum * Acrocephalus arundinaceus

0.04 Bradypterus baboecala Locustellidae Supplementary Fig. S2: 0.99 * Bradypterus bangwaensis MrBayes Allloci (except RAG1) 0.57 Chaetornis striata concatenated * Megalurus gramineus * Megalurus mathewsi * Locustella mandelli * * Locustella naevia Locustella fasciolata Robsonius thompsoni * 0.51 Hartertula flavoviridis * Thamnornis chloropetoides * Bernieria madagascariensis 0.97 Xanthomixis apperti 0.97 Donacobius atricapilla 0.85 0.92 Acrocephalus arundinaceus Acrocephalus dumetorum * Hippolais olivetorum Pnoepyga albiventer 0.60 0.51 Ianthocincla ocellata 0.93 Malacocincla abbotti Pomatorhinus ruficollis * Chrysomma sinense * 0.93 Zosterops japonicus Cettia cetti 0.74 Phylloscopus lorenzii 0.59 Aegithalos caudatus * Alophoixus flaveolus Cisticola exilis Hirundo daurica * Melocichla mentalis Alauda arvensis 0.51 * 0.79 Panurus biarmicus 0.78 Nicator chloris Culicicapa ceylonensis Regulus regulus 0.97 Cyornis tickelliae * Muscicapa dauurica * Saxicola torquatus Turdus philomelos * Acridotheres tristis Cinclus cinclus Bombycilla garrulus 0.71 * 0.60 Hylocitrea bonensis Elachura formosa 0.54 Certhia himalayana * Troglodytes troglodytes Passerida Sitta europaea * Calcarius lapponicus 0.85 * Emberiza schoeniclus 0.76 Anthus trivialis * Leucosticte brandti * Passer rutilans Amandava amandava * * * Ploceus philippinus 0.99 Prunella fulvescens Chloropsis aurifrons * * Irena cyanogastra Aethopyga gouldiae Parus ater Chaetops frenatus 0.82 Dicrurus macrocercus * * Nucifraga caryocatactes 0.85 Rhipidura rufifrons Erpornis zantholeuca * * Oriolus oriolus Pericrocotus ethologus Orthonyx temminckii Ailuroedus crassirostris Menura novaehollandiae

0.05 0.99 Bradypterus carpalis Supplementary Fig. S3: 0.90 Bradypterus centralis BEAST Nuclear loci (except RAG1) * Bradypterus baboecala concatenated * Bradypterus graueri Bradypterus brunneus * 0.66 Amphilais seebohmi * Bradypterus cinnamomeus * * Bradypterus lopezi 0.36 Bradypterus bangwaensis Schoenicola brevirostris 0.65 Elaphrornis palliseri Chaetornis striata * Schoenicola platyurus 0.50 Megalurus palustris forbesi * Megalurus palustris toklao 0.40 Megalurulus rubiginosus * Megalurus macrurus Megalurulus grosvenori 0.84 * 0.82 Megalurulus rufus 0.52 Megalurulus mariae 0.98 0.68 Megalurulus whitneyi Megalurus timoriensis * Buettikoferella bivittata * Megalurus mathewsi * Megalurus cruralis Malia grata 0.81 * Megalurus punctatus * Megalurus gramineus Megalurus carteri * Locustella caudata * Locustella castanea * Locustella accentor * 0.60 Locustella davidi * Locustella kashmirensis * Locustella thoracica 0.99 Locustella tacsanowskia * Locustella naevia Locustella luteoventris Locustella chengi * 0.97 * Locustella montis 0.99 Locustella idonea Locustella mandelli * 0.51 Locustella alishanensis 0.98 * Locustella fluviatilis * * Locustella luscinioides Bradypterus alfredi 0.96 Locustella lanceolata * Locustella ochotensis 0.39 * Locustella pleskei * Locustella certhiola * Locustella pryeri Locustella amnicola * Locustella fasciolata Robsonius thompsoni Thamnornis chloropetoides 0.68 * Hartertula flavoviridis Donacobius atricapilla Hippolais olivetorum * Acrocephalus arundinaceus

0.0050 0.95 Megalurulus mariae MNHN NC92 0.18 Megalurulus mariae MNHN NC93 Myo 0.03 Megalurulus mariae BMNH 1882.5.29.4 0.04 Megalurus mathewsi HQ706256 0.13 0.36 Megalurus macrurus ZMUC 2033 Megalurulus rubiginosus AMNH 777970 0.97 Megalurus timoriensis HQ706257 1.00 Buettikoferella bivittata MNHN 1898.54 0.87 Buettikoferella bivittata BMNH 1937.12.20.7 0.26 Megalurulus rufus KU 22565 0.99 Megalurulus whitneyi BMNH 1935.10.22.410 1.00 Megalurulus rufus KU 22572 0.46 0.40 Megalurulus grosvenori AMNH 708127 Megalurus cruralis HQ706255 0.02 Malia grata NRM 572209 1.00 Schoenicola brevirostris HQ706254 Schoenicola brevirostris DZUG U2466 1.00 Bradypterus centralis HQ706259 0.99 Bradypterus carpalis HQ706250 0.12 1.00 Bradypterus baboecala DQ008525 0.51 Bradypterus graueri HQ706249 Bradypterus brunneus EU680593 1.00 1.00 Bradypterus cinnamomeus HQ706252 0.78 Bradypterus lopezi HQ706253 0.73 Bradypterus bangwaensis HQ706251 0.24 Amphilais seebohmi BMNH 1931.8.18.2781 0.95 0.96 Amphilais seebohmi ZMUC 27.940 1.00 Chaetornis striata DZUG U1894 Schoenicola platyurus BMNH 1949.Whi.1.11654 0.97 Megalurus gramineus HQ333074 0.20 Megalurus punctatus AMNH 748439 0.19 Elaphrornis palliseri YPM 20204 0.12 Megalurus carteri HQ706299 Megalurus palustris toklao FJ357917 0.20 Locustella mandelli HQ706233 0.11 Locustella montis HQ706234 0.04 Locustella montis DZUG 1939 0.38 0.03 Locustella caudata HQ706237 Locustella davidi HQ706238 0.01 0.07 Locustella alishanensis HQ706232 Locustella idonea KU 122801 0.10 0.04 Locustella accentor LSUMZ B-52695 1.00 Locustella kashmirensis HQ706239 0.04 0.07 Locustella thoracica HQ706240 Locustella castanea HQ706236 Locustella fluviatilis DQ008527 0.15 0.97 0.89 Locustella luscinioides HQ706243 Bradypterus alfredi USNM 568000 0.70 1.00 Locustella lanceolata HQ706235 1.00 Locustella tacsanowskia HQ333070 0.99 Locustella tacsanowskia UWBM 57938 0.89 Locustella naevia HQ706242 Locustella luteoventris HQ706241 1.00 Locustella ochotensis HQ706287 0.99 Locustella certhiola DQ008528 0.45 Locustella ochotensis DZUG U1618 Locustella pleskei HQ706288 1.00 0.81 1.00 Locustella pleskei DZUG U1356 0.57 Locustella certhiola DZUG U1389 1.00 Locustella certhiola DZUG U1384 1.00 Locustella certhiola DZUG U1388 1.00 Locustella amnicola HQ706244 0.51 Locustella fasciolata HQ706245 1.00 Locustella pryeri DZUG U1956 Locustella pryeri HQ706246 Robsonius rabori ZMUC 119548 1.00 Hartertula flavoviridis HQ706229 0.82 Thamnornis chloropetoides HQ333077 0.36 Donacobius atricapilla DQ008533 1.00 Acrocephalus arundinaceus DQ008530 Hippolais olivetorum FJ883121

0.0030 1.00 Locustella davidi HQ706316 1.00 Locustella kashmirensis HQ706317 ODC 0.45 Locustella thoracica HQ706318 0.41 Locustella accentor LSUMZ B-52695 0.98 Locustella caudata HQ706315 Locustella castanea HQ706314 0.62 1.00 Locustella montis DZUG 1939 0.96 Locustella montis HQ706312 0.99 Locustella chengi IOZ 62959 Locustella chengi BNU P1909053 0.13 0.53 0.90 Locustella chengi BNU P1909055 0.17 Locustella idonea KU 122801 0.84 Locustella mandelli HQ706311 Locustella alishanensis HQ706310 0.55 Locustella lanceolata HQ706313 0.72 Locustella luscinioides HQ706321 1.00 Locustella fluviatilis HQ121556 0.88 Locustella luscinioides DZUG U5180 1.00 Bradypterus alfredi USNM 568000 1.00 Bradypterus alfredi AMNH 592224 0.97 Locustella naevia HQ706320 0.65 Locustella naevia DZUG U1951 0.33 1.00 Locustella tacsanowskia HQ333085 Locustella tacsanowskia UWBM 51699 1.00 Locustella naevia DZUG 5183 Locustella luteoventris HQ706319 0.84 Locustella certhiola DZUG U1389 1.00 0.59 Locustella certhiola DZUG U1387 0.96 Locustella certhiola DQ008528 0.88 Locustella certhiola DZUG 5181 1.00 Locustella certhiola DZUG 5182 0.31 Locustella pleskei DZUG U1356 0.97 1.00 Locustella pleskei HQ706327 Locustella ochotensis HQ706326 0.81 Locustella pryeri HQ706324 1.00 1.00 Locustella pryeri DZUG U1955 Locustella pryeri DZUG U1956 1.00 Locustella amnicola HQ706322 Locustella fasciolata HQ706323 0.18 Megalurus macrurus ZMUC 2033 0.07 Megalurus timoriensis HQ706336 0.06 Buettikoferella bivittata BMNH 1937.12.20.7 0.09 Megalurulus grosvenori AMNH 708127 0.28 0.10 Megalurulus rubiginosus AMNH 777970 Buettikoferella bivittata MNHN 1898.54 Megalurus mathewsi HQ706335 0.86 Megalurulus mariae MNHN NC92 0.5 0.83 0.60 Megalurulus mariae MNHN NC93 Megalurulus mariae BMNH 1882.5.29.4 0.94 0.23 Megalurulus grosvenori AMNH 777991 0.58 0.96 Megalurulus rufus KU 22565 0.16 Megalurulus rufus KU 22572 Megalurulus whitneyi BMNH 1935.10.22.410 0.92 Megalurus gramineus HQ333091 0.86 Megalurus punctatus AMNH 748439 0.28 Megalurus carteri HQ706337 1.00 Megalurus palustris forbesi FJ883161 Megalurus palustris toklao EU680741 0.99 Amphilais seebohmi BMNH 1931.8.18.2781 0.11 Amphilais seebohmi ZMUC 27.940 0.15 0.68 0.16 Bradypterus graueri HQ706328 0.32 Bradypterus centralis HQ706338 1.00 0.14 Bradypterus baboecala HQ333084 Bradypterus brunneus EU680724 1.00 Bradypterus carpalis HQ706329 1.00 Bradypterus cinnamomeus HQ706331 1.00 0.54 0.23 Bradypterus lopezi HQ706332 Bradypterus bangwaensis HQ706330 1.00 Chaetornis striata DZUG U1894 0.86 0.27 Schoenicola platyurus BMNH 1949.Whi.1.11654 1 Elaphrornis palliseri YPM 20204 1.00 Schoenicola brevirostris HQ706333 Schoenicola brevirostris DZUG U2466 Megalurus cruralis HQ706334 Malia grata NRM 572209 0.46 Hartertula flavoviridis HQ706307 0.91 Thamnornis chloropetoides HQ333096 0.96 Donacobius atricapilla EU680723 0.45 1.00 Acrocephalus arundinaceus FJ883128 Hippolais olivetorum FJ883155 Robsonius rabori ZMUC 119548

0.0040 0.41 Megalurulus mariae BMNH 1882.5.29.4 0.97 GAPDH Megalurulus mariae MNHN NC93 Megalurulus mariae MNHN NC92 0.46 0.51 Megalurulus whitneyi BMNH 1935.10.22.410 0.64 Megalurulus rufus KU 22572 0.36 Megalurulus rufus KU 22565 0.48 Megalurus timoriensis HQ706298 0.46 Megalurus cruralis HQ706296 0.99 0.94 Megalurus mathewsi HQ706297 Buettikoferella bivittata BMNH 1937.12.20.7 0.94 0.41 Megalurus macrurus ZMUC 2033 0.99 Megalurulus rubiginosus AMNH 777970 Megalurulus grosvenori AMNH 708127 Malia grata NRM 572209 1.00 Amphilais seebohmi BMNH 1931.8.18.2781 0.23 Amphilais seebohmi ZMUC 27.940 0.88 0.73 Bradypterus brunneus HQ706289 0.23 Bradypterus graueri HQ706290 0.38 Bradypterus baboecala HQ333098 0.93 Bradypterus centralis DZUG U1935 0.82 1.00 Bradypterus carpalis HQ706291 Bradypterus bangwaensis HQ706292 1.00 Bradypterus cinnamomeus HQ706293 0.85 0.35 Bradypterus lopezi HQ706294 1.00 Schoenicola brevirostris HQ706295 Schoenicola brevirostris DZUG U2466 1.00 Chaetornis striata DZUG U1894 0.83 Schoenicola platyurus BMNH 1949.Whi.1.11654 1.00 Megalurus palustris forbesi ZMUC 02031 Megalurus palustris toklao FJ357917 0.22 0.99 Meg punctatus AMNH 748439 0.77 Megalurus gramineus HQ333108 Megalurus carteri HQ706299 0.22 Elaphrornis palliseri YPM 20204 0.42 Locustella mandelli HQ706273 0.83 Locustella montis DZUG 1939 1.00 Locustella montis HQ706274 0.99 Locustella alishanensis HQ706272 0.61 0.34 Locustella thoracica HQ706280 0.99 Locustella davidi HQ706278 Locustella kashmirensis HQ706279 0.53 0.42 Locustella luteoventris HQ706281 0.42 Locustella tacsanowskia HQ333099 0.50 Locustella lanceolata HQ706275 0.14 0.73 Locustella fluviatilis HQ121546 Bradypterus alfredi USNM 568000 0.97 0.17 Locustella naevia HQ706282 1.00 0.38 Locustella caudata HQ706277 1.00 Locustella accentor LSUMZ B-52695 Locustella castanea HQ706276

0.99 Locustella luscinioides HQ706204 0.44 0.34 Locustella pleskei HQ706288 1.00 Locustella ochotensis HQ706287 0.72 Locustella certhiola HQ706208 0.99 Locustella pryeri HQ706285 Locustella fasciolata HQ706284 Robsonius rabori ZMUC 119548 Donacobius atricapilla FJ357915 1.00 Acrocephalus arundinaceus HQ706300 0.54 Hippolais olivetorum HQ706270 1.00 Hartertula flavoviridis HQ706267 Thamnornis chloropetoides HQ333068

0.0060 0.20 Locustella kashmirensis HQ706199 0.18 Locustella naevia HQ706202 LDH 0.14 Locustella naevia DZUG U1951 Locustella accentor LSUMZ B-52695 0.39 0.59 Locustella davidi HQ706198 0.33 Locustella luteoventris HQ706201 Locustella caudata HQ706197 0.96 1.00 Locustella castanea HQ706196 0.29 Locustella thoracica HQ706200 Locustella thoracica 0504-4 Megalurus punctatus AMNH 748439 0.30 0.98 0.94 Megalurus gramineus HQ333060 0.37 Megalurus carteri HQ706220 0.54 Megalurus cruralis HQ706217 Megalurus mathewsi HQ706218 0.95 0.42 0.42 Megalurulus grosvenori AMNH 708127 0.97 Megalurus macrurus ZMUC 2033 1.00 Megalurulus rubiginosus AMNH 777970 Megalurus timoriensis HQ706219 1.00 Locustella fasciolata HQ706206 Locustella amnicola HQ706205 0.26 Locustella luscinioides DZUG 5178 0.39 0.31 Locustella luscinioides DZUG U5180 0.73 Locustella luscinioides DZUG 5179 0.15 Locustella luscinioides HQ706283 0.15 Locustella fluviatilis HQ706203 0.79 Bradypterus alfredi USNM 568000 0.12 0.15 Bradypterus alfredi AMNH 592224 0.21 Locustella lanceolata HQ706195 0.99 Locustalla lanceolata NRM 20006473 1.00 Locustella mandelli HQ706193 1.00 Locustella montis HQ706202 Locustella alishanensis HQ706192 0.23 Locustella tacsanowskia HQ333051 Locustella pryeri HQ706207 1.00 Amphilais seebohmi BMNH 1931.8.18.2781 0.22 Amphilais seebohmi ZMUC 27.940

0.85 0.32 Bradypterus carpalis HQ706213 0.97 Bradypterus cinnamomeus HQ706215 Bradypterus lopezi HQ706216 0.32 0.40 Bradypterus bangwaensis HQ706214 0.55 Bradypterus baboecala HQ333050 1.00 0.99 Bradypterus centralis HQ706222 Bradypterus graueri HQ706212 0.29 Schoenicola brevirostris DZUG U2466 Bradypterus brunneus HQ706211 0.19 Locustella ochotensis DZUG U1617 1.00 0.61 0.13 Locustella pleskei DZUG U1953 0.10 Locustella pleskei DZUG U1356 0.44 Locustella ochotensis DZUG U1620

0.96 Locustella ochotensis HQ706209 0.21 Locustella pleskei HQ706210 1.00 Locustella certhiola DZUG U1387 Locustella certhiola HQ706286 0.56 0.33 0.93 Locustella certhiola DZUG U1389 Locustella certhiola DZUG U1388 1.00 Megalurus palustris toklao HQ706221 0.55 Megalurus palustris forbesi FJ883089 Chaetornis striata DZUG U1894 0.95 Thamnornis chloropetoides HQ333068 0.62 Hartertula flavoviridis HQ706189 Donacobius atricapilla HQ333054 1.00 Acrocephalus arundinaceus FJ883056 Hippolais olivetorum FJ883080

0.0050 Bradypterus baboecala AY799813 RAG1 * 0.82 Bradypterus baboecala JX236420 * Bradypterus barrattii AY799814 * Bradypterus brunneus JX236428 Schoenicola brevirostris AY799821 0.84 * Megalurus palustris AY319988 0.97 Megalurus palustris JX236439 * Megalurus mathewsi AY319978

0.81 Locustella fluviatilis KJ453524 Locustella naevia EF568259 0.92 * Locustella lanceolata JX236438

Thamnornis chloropetoides AY320004 0.65 * * Bernieria madagascariensis JX236419 Xanthomixis apperti JX236459 * Donacobius atricapilla AY319979 Donacobius atricapilla FJ358147 * Acrocephalus arundinaceus KJ453461 * Acrocephalus newtoni AY319972 * Acrocephalus dumetorum FJ358146 Hippolais olivetorum KJ453503 * Hippolais icterina JX236431

0.0020 Supplementary Table S2. Primer pairs used to amplify toepad samples. Sequences for newly designed primers and references for published primers.

CYTB P0167 BradB0F CTCCCAGCCCCATCC P0267 BradB140R CTCCGTTTGCGTGTAGGT P0367 BradB100F GACACCGCCCTAGCTTTCTCAT P0467 BradB225R CTACGTTTCAGGTTTCTTTGTTTA P0567 BradB190F TATTGGCCGAGGTATCTA P0667 BradB410R GAATCGGGTGAGTGTTGG P1367 DromB0F CTCCCAGCCCCATCC P1467 DromB180R GCTCCGTTTGCGTGTA P1567 DromB135F GACACTGCCCTAGCCTTCTCATC P1667 DromB270R ACTCCGACGTTTCAGGTTTCTTT P1767 DromB250F CGGCCGAGGAATTTACTACG P1867 DromB420R ATCCTCCTCATATTCATTCTACTA P1967 DromB415F CCATCCCCTACATCGGTCAAAC P2067 DromB595R ACGGAGTAGTATGGGTGGAATGG P2167 DromB540F ACCCTGGTCCACCTCATCCTC P2267 DromB680R CTGGGTCGCCTAGAAAGTTGG P4977 BseeB85F GGCACCCAACCTTCGTAAAAAC P5077 BseeB240R GATGAGAAAGCTAGGGCGGTGTC P5177 BseeB120F TCATCAACGACTCCCTAATC P5277 BseeB225R GGCGGTGTCTGCTGTGTA P5377 BseeB215F ATCATCACAGGGCTATTA P5477 BseeB310R GGCTCCGTTTGCGTGTA P2782 Mrubcb130F ACCGCCCTAGCCTTCTCATC P2882 Mrubcb260R CGTTTCAGGTCTCTTTGTTT P2982 Mrubcb210F ACGGAGCCTCTTTCTTCTTC P3082 Mrubcb350R TACTGTAGCACCTCAAAATG P3182 Mrubcb310F AGTCATCCTCTTGCTCTTAC P3282 Mrubcb450R TCGGGTTAGTGTGGGGTTGT P3382 Mrubcb420F TCGGCCAGACCTTAGTAGAA P3482 Mrubcb580R ATGGGATTTTGTCGCAGTC P3582 Mrubcb530F TAACATTAGTCCACCTCACC P3682 Mrubcb640R ATGCCGACTAGAAGAATAAG P3782 Mrubcb620F CCCTATTACTCCACAAAAGA P3882 Mrubcb640R AGGATGGCGTAGGCAAATAG P3982 Mrubcb760F CAAACCCGAATGATACTT P4082 Mrubcb920R AGGACGTTTGCGACTA P3183 MtimB0F CAGCCCCATACAACATCT P3283 MtimB240R TAGGTAGGAGCCGTAGTAAAT P3383 MtimB275F ACGGCTCCTACCTAAACAAAGAAA P3483 MtimB470R TAGGAGGAAGTGGATAGCGAAGAA P3583 MtimB800F CTCCGATCAATCCCAAACAAAC P3683 MtimB1025R CGAGTGGGAAGAGGATTAGGATG P5583 MpunB270F ACTACGGCTCATACCTAAACAAAG P5683 MpunB420R CTCACGCTCATTCTACTAAGGTCT P1998 MegtimCyb945F AGTCGCAAACGTCCTAATCTT P2098 MegtimCyb1080R AGGGTGGAGTCTTCAGTTTTT P2198 BalfCyb95F CACCGCCCTAGCCTTCTCAT P2298 BalfCyb420R CGGGTTAGTGTGGGGTTGTCT L14841 Kocher et al., 1989 cytb-R271 TAGCCTACGAAGGCRGTTGCTAT cytb-F198 GAATCTACTACGGCTCNTACCT cytb-R541 TGGAATGGGATTTTGTCGCAGTC cytb-F506 ACAGGATCCAACAACCCCCTAGG cytb-R787 AAGAATAGGACGAGKACKGAGGC cytb-F742 CGATCCATCCCAAACAAACTAGG H15915 Kocher et al. (1989) Cytb-OWWF4 GTATGAGGCGGATTCTCAGTAGA Cytb-OWWR4 GTAGTATGGGTGGAATGGGATTTTrTC Cytb-OWWF3 AACAAAGAAACCTGAAACATCGGAGT Cytb-remizF3 CCTCCATGAAACAGGMTCCAACAA Cytb-OWWR3 GAGGAAGTGGATGGCGAAGAATC Cytb-remizF4 ACTCCCCCCCACATTAAACCCGA Cytb-remizR3 GGAGGATGGCGTATGCAAAIAGGAA Supplementary Table S2. Primer pairs used to amplify toepad samples. Sequences for newly designed primers and references for published primers.

Cytb-remizF1b CGATACACTATACAGCAGACAC Cytb-RemizR1c TCAGAATGATATTTGTCCTCAGG

GAPDH P1365 G3P0F GCGCTGAACGACCAT P1465 G3P140R GAAGCAATCTCACTCCAC P1763 G3P180F TTACCTGAAATTAGCATAGC P1863 G3P280R TGGGGACAGAAAACAAG P4965 G3P0F AAGTCCACAACACG P5065 BalfG210R CACACCTCCAGTCTC P4965 G3P0F AAGTCCACAACACG P5365 Drom150R CTTCTTCCCCCTCTGG G3P14b Fjeldså et al. (2003) G3PintL1 Fjeldså et al. (2003) GRPLucF1 ATTGCTACTTACCTGAAATTACTATAG GRPLucR1 ATCCCACACAAGTGAACTCCCAT

LDH P1765 DromL130F TTGGCATTGAAAAAG P1865 DromL310R YGGGTGTTGAAAGTA P7582 MegmarLDH70F CTCCCCCTCCTGCTGAC P7682 MegmarLDH190R GCTCCCTGTAACTCCTGTAT P7782 MegmarLDH290F AAGCCAGCACCATCTCATAG P7882 MegmarLDH410R AATTTGGGGCTTGTTTAGTA P8182 MegmarLDH540F ATGCCAAATTCCAAGAGTTC P8282 MegmarLDH660R CGGCAGCGTGTTCCT P7183 Meg50Fldh AAGATCGTGGCAGACAAAG P7283 Meg175Rldh AACTCACCCCAACTCACAC P7383 Meg370Fldh CTCTCAACACCCACATACT P7483 Meg530Rldh CACAGGGGAGAAGACAGAG myo P3965 BalfM0F CCACCAAGCACAAGAT P4065 BalfM290R TGCATAGGCTGGTTTA P4165 BalfM610F GGAGGGCCTACTGAAT P4265 BalfM730R AGGACCTTGATAATGACT P6783 Meg320Fmyo GCATGCCTGGGAAACTGTATTA P6883 Meg460Rmyo GGCCCTTTCCACTTTTTGTCT P6983 Meg170Fmyo TCAAGCCTAAGTTCTGTGT P7083 Meg340Rmyo GTCCCTTGTGTCCCATCA MyoAWF1 ATCTGGAGGTATGGAAAAGGGCA MyoAWR1 TTGGATATTCACATACCATTTGCATA MyoAWF2 TTTACTGATGACTAGTTGGACTTC MyoAWR2 AGTCCTTATGTAATACAGTTTCCCA MyoLeiH2 TTGATCTGCTTCATGACCTTGAGT MyoLeiL2 TGACCAACCCTTGACAACAATAAA MyoAWF4 AAAAAGTGGAAAGGGCCATGGT MyoAWR4 TCAGAAAAGCCAGACTAAGAAATAG Myo2 Slade et al. (1993) Myo344H Irestedt et al. (2006) Myo309L Irestedt et al. (2006) Myo3F Heslewood et al. (1998)

ODC P5783 Meg25Fodc AGCAGTTTGTCGTCTCA P5883 Meg170Rodc AAAGGCATCTCTGTTGTC P5983 Meg300Fodc TGTACAGACCCAGAGACC P6083 Meg440Rodc CAACATGAAGCCAGTGA Supplementary Table S2. Primer pairs used to amplify toepad samples. Sequences for newly designed primers and references for published primers.

P6183 Meg415Fodc GCAAAATGGAATGAGGTGT P6283 Meg520Rodc TGAGCTGCCAATTTTAGTGC P6383 Meg520Fodc TGGCAAAACTCATCTACAG P6483 Meg690Rodc AAGCCAAGTTCAGCCTAAA OD6 Allen & Omland, 2003 ODC-R172 CTCATGTCATCACATGCAAAGGC ODC-F115 TTCTTTAAATGGTCTACYTGACA ODC-R364 CATTTTGCCACAACAGTTGAGCA ODCLucF1 TTGTCGTCTCAGTGTTAAATTTGGA ODCLucR1 GAAACTACAAAAGGATACAAAATATCAG ODCLucF2 GACAATAGAGATGCCTTTGCATGT ODCLucR2 CAGAGAAAGTAGAGCTAGACTTAC ODCLucF3 ATGCCCGCTGTGTGTTTGATATG ODCLucR3 AGTCATTTGAGTTTGAGCTGCCA ODCLucF4 GCAAAACTCATCTACAGATGCAC ODCLucR4 AAGCAGATACATACTGAAGCCAAG ODintF2 Irestedt et al. (2006) ODintR3 Irestedt et al. (2006) ODintF1 Irestedt et al. (2006) ODintR4 Irestedt et al. (2006)

References Heslewood, M. M., Elphinstone, M. S., Tidemann, S. C. & Baverstock, P. R., 1998. Myoglobin intron variation in the Gouldian Finch Erythura gouldiae assessed by temperature gradient gel electrophoresis. Electrophoresis 19, 142-151.

Irestedt. M., Ohlson, J. I., Zuccon, D., Källersjö, M. & Ericson, P. G. P., 2006. Nuclear DNA from old collections of avian study skins reveals the evolutionary history of the Old World suboscines (Aves, Passeriformes). Zool. Scr., 35, 567-580.

Kocher, T. D., Thomas, W. K. Meyer, A., Edwards, S. V., Pääbo, S., Villablanca, F. X., Wilson, A. C., 1989. Dynamics of mitochondrial DNA evolution in animals: Amplification and sequencing with conserved primers Proc. Natl. Acad. Sci. USA 86: 6196-6200.

Slade, R. W., Moritz, C., Heideman, A. & Hale, P. T., 1993. Rapid assessment of single-copy nuclear DNA variation in diverse species. Mol. Ecol., 2, 359- 373. Taxa (Gill & Donsker, 2017) New taxonomy (this study) Sample Locality CYTB MYO ODC GAPDH LDH Amphilais seebohmi Bradypterus seebohmi BMNH 1931.8.18.2781 Madagascar MH035642 MH035612 MH089154 MH089188 MH089209 Amphilais seebohmi Bradypterus seebohmi ZMUC 27.940 Madagascar MH035643 MH035613 MH089155 MH089189 MH089210 Bradypterus alfredi alfredi Locustella alfredi USNM 568000 Ethiopia MH035644 MH035614 MH089156 MH089190 MH089211 Bradypterus alfredi ssp. Locustella alfredi AMNH 59222 "German East Africa" MH089157 MH089212 Bradypterus baboecala tongensis/transvaalensis South Africa DQ008473 DQ008525 HQ333084 HQ333098 HQ333050 Bradypterus baboecala transvaalensis South Africa AY958221 Bradypterus bangwaensis Nigeria HQ706163 HQ706251 HQ706330 HQ706292 HQ706214 Bradypterus barrattii South Africa AY958225 Bradypterus barrattii South Africa AY958226 Bradypterus brunneus Madagascar HQ706160 EU680593 EU680724 HQ706289 HQ706211 Bradypterus brunneus ZMUC 27.941 Madagascar MH035645 Bradypterus carpalis Kenya AY958230 Bradypterus carpalis Kenya HQ706162 HQ706250 HQ706329 HQ706291 HQ706213 Bradypterus centralis centralis DZUG U1935 Nigeria HQ706159 HQ706259 HQ706338 x HQ706222 Bradypterus centralis elgonensis Kenya FJ883053 Bradypterus cinnamomeus cinnamomeus Tanzania HQ706252 HQ706331 HQ706293 HQ706215 Bradypterus cinnamomeus mildbreadi Uganda HQ706166 Bradypterus cinnamomeus mildbreadi Uganda AY124541 Bradypterus graueri Uganda HQ706161 HQ706249 HQ706328 HQ706290 HQ706212 Bradypterus lopezi mariae Tanzania HQ706164 Bradypterus lopezi ufipae Zambia HQ706165 HQ706253 HQ706332 HQ706294 HQ706216 Bradypterus sylvaticus pondoensis South Africa AY958229 Bradypterus sylvaticus sylvaticus South Africa AY958228 Buettikoferella bivittata Cincloramphus bivittata MNHN 1898.54 Timor, Indonesia MH035646 MH035615 MH089158 Buettikoferella bivittata Cincloramphus bivittata BMNH 1937.12.20.7 Timor, Indonesia MH035647 MH035616 MH089159 MH089191 Chaetornis striata Schoenicola striata DZUG U1894 Nepal MH035648 MH035617 MH089160 MH089192 MH089213 Elaphrornis palliseri YPM 20204 Sri Lanka MH035649 MH035618 MH089161 MH089193 Locustella accentor LSUMNS B-52679 Borneo MH035650 MH035619 MH089162 MH089194 MH089214 Locustella accentor LSUMNS B-52695 Borneo MH035651 Locustella alishanensis Taiwan HQ706133 HQ706232 HQ706310 HQ706272 HQ706192 Locustella alishanensis Taiwan HQ706132 Locustella amnicola Helopsaltes amnicola Russia HQ706150 HQ706244 HQ706322 HQ706205 Locustella amnicola Helopsaltes amnicola Japan Y15689 Locustella castanea Sulawesi, Indonesia DQ367925 HQ706236 HQ706314 HQ706276 HQ706196 Locustella caudata Mindanao, Philippines HQ706140 HQ706237 HQ706315 HQ706277 HQ706197 Locustella caudata Mindanao, Philippines JX398901 Locustella certhiola ssp. Helopsaltes certhiola Hebei, China (m) DQ008476 DQ008528 HQ706286 Locustella certhiola ssp. Helopsaltes certhiola Kazakhstan HQ706208 Locustella certhiola ssp. Helopsaltes certhiola Ningxia Aut. Prov., China HQ706154 HQ706325 Locustella certhiola ssp. Helopsaltes certhiola Thailand (m) HQ706155 Locustella certhiola minor Helopsaltes certhiola DZUG U1384 Muriovka, Russia MH035620 Locustella certhiola minor Helopsaltes certhiola DZUG U1387 Ningxia Aut. Prov., China MH089163 Locustella certhiola ssp. Helopsaltes certhiola DZUG U1388 Ningxia Aut. Prov., China MH035621 Locustella certhiola ssp. Helopsaltes certhiola DZUG U1389 Ningxia Aut. Prov., China MH035622 Locustella chengi IOZ 62959 Shaanxi Prov., China KP773459 MH089164 Locustella chengi Sichuan Prov., China KP773452 Locustella chengi Hunan Prov., China KP773456 Locustella chengi BNU P1909053 Guizhou Prov., China MH089165 Locustella chengi BNU P1909055 Guizhou Prov., China MH089166 Locustella davidi Hebei Prov., China (m) DQ367931 HQ706238 HQ706316 HQ706278 HQ706198 Locustella davidi Hong Kong HQ706141 Locustella davidi Mongolia DQ367935 Locustella fasciolata Helopsaltes fasciolatus Hebei Prov., China (m) HQ706151 HQ706245 HQ706323 HQ706284 HQ706206 Locustella fluviatilis Kenya (m) DQ008475 DQ008527 HQ121546 HQ706203 Locustella fluviatilis Uncertain HQ121556 Locustella fluviatilis Kenya (m) AJ004764 Locustella fluviatilis Slovakia HQ608847 Locustella idonea KU 122801 S Vietnam KP773450 MH035623 x Locustella kashmirensis Himachal Pradesh, India DQ367926 HQ706239 HQ706317 HQ706279 HQ706199 Locustella kashmirensis Himachal Pradesh, India DQ367927 Locustella lanceolata Hebei Prov., China (m) HQ706139 HQ706235 HQ706313 HQ706275 HQ706195 Locustella lanceolata China (m?) DQ119525 Locustella lanceolata China (m?) JX398904 Locustella lanceolata NRM 20006473 Sweden MH089215 Locustella luscinioides luscinioides Sweden HQ706149 HQ706243 HQ706321 HQ706204 HQ706283 Locustella luscinioides luscinioides Germany AJ004763 Locustella luscinioides ssp. Israel (m) HQ706148 Locustella luscinioides fusca DZUG U5178 Xinjiang Prov., China MH089216 Locustella luscinioides fusca DZUG U5179 Xinjiang Prov., China MH089217 Locustella luscinioides fusca DZUG U5180 Xinjiang Prov., China MH089218 Locustella luteoventris Thailand HQ706144 HQ706241 HQ706319 HQ706281 HQ706201 Locustella luteoventris W Myanmar HQ706145 Locustella luteoventris N Vietnam HQ706143 Locustella major India HQ706174 Locustella mandelli West Bengal, India HQ706135 HQ706233 HQ706311 HQ706273 HQ706193 Locustella mandelli N Vietnam KP773442 Locustella mandelli Sichuan Prov., China KP773448 Locustella montis montis Java, Indonesia HQ706137 HQ706234 HQ706312 HQ706274 HQ706194 Locustella montis montis Java, Indonesia KP773440 Locustella montis montis DZUG 1939 Bali, Indonesia HQ706138 MH035624 MH089167 MH089195 Locustella montis timorensis Timor, Indonesia KP773463 Locustella montis timorensis Timor, Indonesia KP773464 Locustella naevia naevia DZUG 1951 Sweden HQ706147 HQ706242 HQ706320 HQ706282 HQ706202 Locustella naevia naevia DZUG 5183 Sweden MH089168 MH089219 Locustella naevia naevia DZUG 5184 Sweden MH089169 Locustella ochotensis Helopsaltes ochotensis Philippines (m) HQ706156 HQ706326 Locustella ochotensis Helopsaltes ochotensis Philippines (m) HQ706247 HQ706287 Locustella ochotensis Helopsaltes ochotensis Russia HQ706209 Locustella ochotensis Helopsaltes ochotensis Russia AB261542 $ Locustella ochotensis Helopsaltes ochotensis Taiwan (m) HQ706157 Locustella ochotensis Helopsaltes ochotensis DZUG U1618 Philippines (m) MH035625 Locustella ochotensis Helopsaltes ochotensis DZUG U1617 Philippines (m) MH089220 Locustella ochotensis Helopsaltes ochotensis DZUG U1620 Philippines (m) MH089221 Locustella pleskei Helopsaltes pleskei Japan HQ706158 Locustella pleskei Helopsaltes pleskei Japan HQ706248 HQ706327 HQ706288 HQ706210 Locustella pleskei Helopsaltes pleskei Japan AB159188 Locustella pleskei Helopsaltes pleskei South Korea AB159191 Locustella pleskei Helopsaltes pleskei DZUG U1356 Miyake Isl., Japan MH035626 MH089170 MH089222 Locustella pryeri Helopsaltes pryeri Japan HQ706152 Locustella pryeri Helopsaltes pryeri Japan HQ706246 HQ706324 HQ706285 HQ706207 Locustella pryeri Helopsaltes pryeri China EU016090 Locustella pryeri Helopsaltes pryeri China EU016091 Locustella pryeri Helopsaltes pryeri DZUG U1955 Japan MH089171 Locustella pryeri Helopsaltes pryeri DZUG U1956 Jiangxi Prov., China MH035627 MH089172 Locustella seebohmi Luzon, Philippines KP773462 Locustella tacsanowskia Mongolia HQ333037 HQ333085 HQ333051 Locustella tacsanowskia Irkutskaya Obl., Russia HQ706146 HQ333070 Locustella tacsanowskia Hebei Prov., China (m) DQ008474 HQ333099 Locustella thoracica Sichuan Prov., China DQ367929 HQ706240 HQ706318 HQ706280 HQ706200 Locustella thoracica Sichuan Prov., China DQ367930 Locustella thoracica Qinghai Prov., China DQ367928 Malia grata Sulawesi, Indonesia JX398905 Malia grata NRM 572209 Sulawesi, Indonesia MH035628 MH089173 MH089196 Megalurulus grosvenori grosvenori Cincloramphus grosvenori AMNH 708127 New Britain MH035652 MH035629 MH089177 MH089197 MH089223 Megalurulus grosvenori grosvenori Cincloramphus grosvenori AMNH 777991 New Britain MH035653 MH089178 Megalurulus mariae Cincloramphus mariae MNHN NC92 New Caledonia MH035654 MH035630 MH089174 MH089198 Megalurulus mariae Cincloramphus mariae MNHN NC93 New Caledonia MH035655 MH035631 MH089175 MH089199 Megalurulus mariae Cincloramphus mariae BMNH 1882.5.29.4 New Caledonia MH035656 MH035632 MH089176 x Megalurulus rubiginosus Cincloramphus rubiginosus AMNH 777970 New Britain MH035657 MH035633 MH089179 MH089200 MH089224 Megalurulus rubiginosus Cincloramphus rubiginosus AMNH 777969 New Britain MH035658 Megalurulus rufus Cincloramphus rufus KU 22565 Viti Levu, Fiji MH035659 MH035634 MH089180 MH089201 Megalurulus rufus Cincloramphus rufus KU 22572 Viti Levu, Fiji MH035660 MH035635 MH089181 MH089202 Megalurulus whitneyi Cincloramphus whitneyi BMNH 1935.10.22.410 New Hebrides MH035661 MH035636 MH089182 MH089203 Megalurus carteri Poodytes carteri Australia HQ706171 HQ706258 HQ706337 HQ706299 HQ706220 Megalurus carteri Poodytes carteri Australia HQ706172 Megalurus cruralis Cincloramphus cruralis Australia HQ706167 HQ706255 HQ706334 HQ706296 HQ706217 Megalurus gramineus goulburni Poodytes gramineus South Australia HQ333042 HQ333074 HQ333091 HQ333108 HQ333060 Megalurus macrurus interscapularis Cincloramphus macrurus ZMUC 1961–1963, nr. 2033 New Britain MH035662 MH035637 MH089183 MH089204 MH089225 Megalurus macrurus macrurus Cincloramphus macrurus New Guinea JN827115 Megalurus mathewsi Cincloramphus mathewsi Australia HQ706168 HQ706335 HQ706297 HQ706218 Megalurus mathewsi Cincloramphus mathewsi Australia HQ706169 HQ706256 Megalurus palustris forbesi Negros, Philippines FJ883052 FJ883161 JX236290 FJ883089 Megalurus palustris toklao Punjab, India DQ008477 DQ008529 EU680741 FJ357917 HQ706221 Megalurus punctatus caudatus Poodytes punctatus AMNH 748439 Snares Island, New Zealand MH035663 MH035638 MH089184 MH089205 MH089226 Megalurus punctatus ssp. Poodytes punctatus ? ComplMt NC_029138 Megalurus punctatus vealeae Poodytes punctatus New Zealand HQ706173 Megalurus rufescens Poodytes rufescens MNHN 1896.2372 Chatham Isl., New Zealand MH035664 Megalurus timoriensis crex Cincloramphus timoriensis ZMUC 1951-1952, nr 452 Mindanao, Philippines MH035665 Megalurus timoriensis tweeddalei Cincloramphus timoriensis Luzon, Philippines HQ706170 HQ706257 HQ706336 HQ706298 HQ706219 Megalurus timoriensis tweeddalei Cincloramphus timoriensis ZMUC 10409 Negros, Philippines MH035666 Robsonius rabori Philippines KC603623 Robsonius sorsogonensis Philippines JN827168 Robsonius thompsoni Philippines KC603632 Robsonius thompsoni Philippines JX398907 Robsonius thompsoni ZMUC 119548 Philippines MH035639 MH089185 MH089206 Schoenicola brevirostris Catriscus brevirostris DZUG U2466 Tanzania MH035667 MH035640 MH089186 MH089207 MH089227 Schoenicola brevirostris Catriscus brevirostris Kenya HQ706254 HQ706333 HQ706295 Schoenicola brevirostris Catriscus brevirostris BMNH 1933.3.1.1048 Mozambique MH035668 Schoenicola platyurus BMNH 1931.11.16.1 India MH035669 MH035641 MH089187 MH089208 Schoenicola platyurus India KJ702890 Schoenicola platyurus India KJ702891

$ - This L. ochotensis has a L. certhiola haplotype. m - collected away from breeding ground

AMNH - American Museum of natural History, New York, USA BMNH - The Natural History Museum, Tring, UK DZUG - Department of Biology and Environmental Sciences, University of Gothenburg, Sweden IOZ - Institute of Zoology, Chinese Academy of Sciences, Beijing, China KU - KU Biodiversity Institute and Natural History Museum, Lawrence, Kansas, USA LSUMNS - LSU Museum of Natural Science, Louisiana State University, Baton Rouge, Louisiana, USA MNHN - Muséum National d’Histoire Naturelle, Paris, France NRM- Swedish Museum of Natural History, Stockhom, Sweden USNM - US National Museum, Washington, D.C., USA YPM - Yale Peabody Museum of Natural History, New Haven, Connecticut, USA ZMUC - Zoological Museum, University of Copenhagen, Denmark

Toepad samples highlighted in blue. Sequences from different individuals combined in phylogenetic analyses highlighted in grey. GenBank numbers in bold italic are new for this study.