Expression of Mrnas for Telomeric Repeat Binding Factor (TRF)-1 and TRF2 in Atypical Adenomatous Hyperplasia and Adenocarcinoma of the Lung

Vol. 9, 1105–1111, March 2003 Clinical Cancer Research 1105

Expression of mRNAs for Telomeric Repeat Binding Factor (TRF)-1 and TRF2 in Atypical Adenomatous Hyperplasia and Adenocarcinoma of the Lung

Kuniaki Nakanishi, Toshiaki Kawai,1 positive expressions of TERF2 mRNA among low-grade Fumiyuki Kumaki, Sadayuki Hiroi, Makio Mukai, AAH, high-grade AAH, and BAC. Eiji Ikeda, Catherine Elaine Koering, and Conclusions: These results are consistent with (but are not enough to confirm) the idea that high-grade AAH is Eric Gilson closely related to BAC. Division of Environmental Medicine, National Defense Medical College Research Institute, Tokorozawa 359-8513, Japan [K. N.]; Department of Pathology, National Defense Medical College, INTRODUCTION Tokorozawa 359-8513, Japan [T. K., F. K., S. H.]; Division of AAH2 of the lung, a proliferation of alveolar epithelial Diagnostic Pathology, [M. M.] and Pathology [E. I.], Keio University cells, is usually found incidentally in lungs surgically resected School of Medicine, Tokyo 160-8582, Japan; and Laboratoire de for lung cancer, predominantly in patients with adenocarcinoma Biologie Mole´culaire et Cellulaire de l’Ecole Normale Supe´rieure de Lyon, UMR 5665 CNRS/ENSL, 69364 Lyon Cedex 07, France (1). In the 1999 WHO histological classification of lung and [C. E. K., E. G.] pleural tumors (2), AAH was classified among the preinvasive lesions along with squamous dysplasia, carcinoma in situ, and diffuse pulmonary neuroendocrine cell hyperplasia. However, ABSTRACT the relationship between AAH and pulmonary adenocarcinoma Purpose and Experimental Design: It has been suggested is not well understood. Recently, attempts have been made to that atypical adenomatous hyperplasia (AAH) may be a establish the pathogenesis of BAC by morphometric, immuno- precursor of peripheral adenocarcinoma of the lung. Telom- histochemical, and molecular studies (3, 4). The authors (3, 4) erase is a ribonucleoprotein enzyme that synthesizes telo- suggested that AAH should be regarded as representing a pre- meric DNA onto chromosomal ends. Its activity is thought to cancerous lesion or even an early-stage lesion of peripherally participate in the development of most human cancers. Te- located BAC. lomere-specific DNA-binding proteins, such as telomeric re- Telomerase is a ribonucleoprotein enzyme that synthesizes peat binding factor 1 and telomeric repeat binding factor 2, telomeric DNA at the end of chromosomes and compensates for also control telomere length in a complex interplay with the end replication problem, allowing cells to proliferate indef- telomerase. Here we investigated the expressions of the initely (5–7). Using the PCR-based telomerase repeat amplifi- mRNAs encoded by the TERF1 and TERF2 genes using in cation protocol assay, it has been shown that telomerase is situ hybridization in surgically resected specimens [28 AAHs activated in a large majority of human cancer tissues, but not in (11 lesions were interpreted as low-grade AAH, and 17 were most normal tissues or in tissues adjacent to malignant or benign interpreted as high-grade AAH) and 40 peripherally located tumors (8). Therefore, it appears that telomerase activity is a bronchioloalveolar carcinoma (BAC). useful marker for cancer detection. Results: A clear overexpression of these mRNAs was Two major subunits of the human telomerase core com- recognized in low- and high-grade AAH and BAC samples plex, namely, hTERC and hTERT, have been identified. (as compared with normal tissues) using in situ hybridiza- hTERC, which was identified first, functions as a template for tion and these mRNAs were detected in normal AAH and telomere elongation by telomerase (9–11). hTERT contains a BAC samples using reverse transcription-PCR. The expres- reverse transcriptase domain that catalyzes this reaction (12– sions of TERF1 and TERF2 mRNA detected by in situ 14). Recent studies have demonstrated that hTERC and hTERT hybridization were scored positive in 36% and 82% of form the minimum complex needed for telomerase activity (13, low-grade AAH, 65% and 83% of high-grade AAH, and 14). Therefore, up-regulation of hTERC and hTERT expres- 88% and 88% of BAC, respectively. Statistically significant sions could play an important role in human carcinogenesis. differences in TERF1 mRNA expression could be shown More recently, telomere-specific DNA-binding proteins such as between low-grade AAH and BAC and between high-grade TRF1 and TRF2 have been put forward as additional candidates AAH and BAC. There was no statistical difference in the for the role of molecules modifying telomerase activity, and they have been suggested to play key roles in the maintenance of telomere function (15–18). In fact, TRF1 negatively regulates

Received 4/29/02; revised 10/29/02; accepted 11/4/02. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to 2 The abbreviations used are: AAH, atypical adenomatous hyperplasia; indicate this fact. TRF, telomeric repeat binding factor; BAC, bronchioloalveolar carci- 1 To whom requests for reprints should be addressed. Phone: 81-42- noma; RT-PCR, reverse transcription-PCR; hTERC, human telomerase 995-1505; Fax: 81-42-996-5192; E-mail: [email protected]. RNA component; hTERT, human telomerase reverse transcriptase.

the maintenance of telomere length (15, 16, 18). Although TRF2 was initially implicated in the protection of chromosome ends (15, 16), more recent reports show that TRF2 protein is a second negative regulator of telomere length (17) acting at least in part independently of telomerase by activating a degradation path- way (18). Although several investigations have been made of telomerase activity and/or the subunits of human telomerase in lung carcinomas and AAH (11, 19–24), no studies have investigated the expressions of TERF1 and TERF2 mRNAs in AAH. We therefore examined their expressions in the AAHs and peripherally located BACs (measuring 20 mm or less in the greatest diameter) that were available to us and compared the results with those obtained previously for hTERC and hTERT mRNA expressions in the same specimens. For this, we used primarily an in situ hybridization approach and also the RT-PCR.

MATERIALS AND METHODS From 1980 to 2000, the surgical pathology service of the National Defense Medical College Hospital (Tokorozawa, Ja- pan) and Keio University Hospital (Tokyo, Japan) received specimens of 28 AAH lesions of the lung resected from 21 patients and 40 peripherally located BACs of the lung resected from 40 patients. In this study, we defined AAH lesions according to the following criteria: (a) AAH is composed of columnar or cuboidal cells arranged in a single row along the alveolar wall; (b) AAH cells are distinct from ciliated cells of the terminal bronchiolar epithelium; and (c) lung tissue surrounding Fig. 1 AAH. A, low-grade AAH; B, high-grade AAH. Scale bar, AAH does not exhibit a chronic inflammatory reaction in the 200 ␮m. interstitial alveolar wall (Fig. 1). In situ hybridization was performed essentially as described previously (25). Briefly, sections were treated with 0.2 N HCl for 20 min and then incubated in 2ϫ SSC for 10 min at The corresponding sense probe was used for the negative con- 37°C and incubated in 5 ␮g/ml proteinase K for 10 min at 37°C. trol. In situ hybridization of hTERC and hTERT mRNA was Sections were subsequently postfixed in 4% paraformaldehyde determined as described previously; the technique used and the for 5 min and then incubated in 0.1 M triethanolamine buffer (pH results in these same patients have been reported elsewhere (28). 8.0) containing 0.25% (v/v) acetic anhydride for 10 min to For analysis of reactivity, the extent of staining was scored as prevent nonspecific binding due to oxidation of the tissue. follows: (a) Ϫ, a negative reaction of tumor cells; (b) Ϯ, Յ10% Hybridization was carried out overnight at 42°C in 50% (v/v) of tumor area stained; (c) ϩ,11–25% of tumor area stained; (d) deionized formamide, 5ϫ Denhardt’s solution, 5% (w/v) dex- 2ϩ,26–50% of tumor area stained; and (e)3ϩ, Ն51% of tumor tran sulfate, 2ϫ SSC, 0.3 mg/ml salmon sperm DNA, 5 mM area stained. Those tumors in which the stained tumor cells EDTA, and 10 ng/ml biotin-labeled probes. After performing a made up Ͼ10% of the tumor were graded as positive. final stringent wash at 55°C for 20 min, hybridization was For examination of TERF1 and TERF2 mRNAs by RT- detected immunologically. PCR, total mRNAs were obtained from six normal lung tissues, pflagTRF1 (26) was digested by restriction enzymes EcoRI one high-grade AAH, and six BACs (the only suitable materials and XhoI, ligated between the EcoRI and XhoI cloning sites of available from our stock). The total RNA was isolated using pGEM7Zf (Promega), and then labeled with biotin using a RNA acid guanidinium isothiocyanate-phenol-chloroform extraction labeling kit (Boehringer Mannheim). The antisense probe was a and ethanol precipitation (29). RT-PCR was performed using an 247-bp segment of TERF1 cDNA under a SP6 promoter, and the amplification reagent kit (TaqMan EZRT-PCR kit; Applied corresponding sense probe was a 247-bp segment of TERF1 Biosystems, Alameda, CA) with TERF1, TERF2, and glyceral- cDNA under a T7 promoter. pBSKϩTRF2 (27) was digested by dehyde-3-phosphate dehydrogenase primers. Six primers were restriction enzymes PvuII and PstI, ligated between the PvuII synthesized using an automated DNA synthesizer. Sequence and PstI cloning sites of pSP72 (Promega), and then labeled information for all of the PCR primers used is listed in Table 1, with biotin using a RNA labeling kit (Boehringer Mannheim). together with the thermocycling conditions. The reaction master The antisense probe was a 1007-bp segment of TERF1 cDNA mix was prepared according to the manufacturer’s protocol to under a SP6 promoter, and the corresponding sense probe was a give final concentrations of 1ϫ reaction buffer, 300 ␮M dATP, ␮ ␮ ␮ 1007-bp segment of TERF1 cDNA under a T7 promoter. Lung 300 M dCTP, 300 M dGTP, 600 M dUTP, 3 mM Mg(OAc)2, carcinomas with telomerase activity served as a positive control. 0.1 unit/␮l rTth DNA polymerase, 0.01 unit/␮l AmpErase

Table 1 Primer sequences and thermocycle conditions used for RT-PCR Annealing Sizes of PCR mRNA Sense primer (5Ј-3Ј) Antisense primer (5Ј-3Ј) temperature (°C) Cycles products (bp) TERF1a ATGCCGACCCTACTGAGGAG AACTGGCAAGCTGTTAGACTGG 64 40 301 TERF2 AACGTGGCCCATCCTGTTAT CCTCAGAATCCTGTGCACCA 64 40 301 GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC 60 40 226 a TERF1, telomeric repeat binding factor 1; TERF2, telomeric repeat binding factor 2; GAPDH, rat glyceraldehyde-3-phosphate dehydrogenase.

UNG, 900 nM primers, and 200 nM TaqMan probe. To perform regard, there was no statistical difference among low-grade PCR, the reverse transcription reaction was incubated at 60°C AAH, high-grade AAH, and BAC. for 30 min, followed by incubation at 95°C for 5 min to When Spearman’s correlation coefficient by rank was used, deactivate AmpErase UNG. PCR was performed using an ABI TERF1 mRNA staining scores showed a significant correlation PRISM 9600 Sequence detector (Applied Biosystems). PCR with hTERC and hTERT mRNA staining scores (P Ͻ 0.0001 products were separated by electrophoresis in a 3% agarose gel and P Ͻ 0.0001, respectively). However, there was no signifi- and stained with ethidium bromide. cant correlation between TERF2 mRNA staining scores and Statistical analysis was performed using ␹2 analysis. Re- either hTERC or hTERT mRNA staining scores. gression analysis among TERF1, TERF2, hTERC, and hTERT When RT-PCR was used, TERF1 and TERF2 mRNAs mRNA expressions was performed using Spearman’s correla- were detected in all samples examined (six normal lung tissues, tion coefficient by rank. P Ͻ 0.05 was considered significant. one high-grade AAH, and six BACs), although the strength of their expressions varied (Fig. 4). RESULTS Of the 28 AAH lesions, 17 were interpreted as high-grade DISCUSSION lesions on the basis of the finding of increased cellularity and The purpose of our investigation was to seek a better cytologic pleomorphism (Fig. 1B). In detail, low-grade AAH understanding of the relation of AAH to the pathogenesis of showed a low proliferating cell density, and the proliferating peripherally located BAC. We found previously that overex- cells formed a single row along the alveolar wall, with the cells pressions of both hTERC and hTERT mRNAs increased signif- arranged either intermittently or continuously. The nuclei were icantly from low-grade AAH through high-grade AAH to BAC, small and showed minimal variations in size and shape. In which we felt supported the idea that high-grade AAH is a high-grade AAH, the density of the proliferating cells was precursor of peripherally located BAC (28). In the present study, increased, and their nuclei were larger and exhibited greater we observed that the incidence of positive expression for TERF1 variation in terms of size, shape, and hyperchromasia. However, mRNA using in situ hybridization also increased significantly none of the cells in the 17 high-grade AAH lesions showed from low-grade AAH through high-grade AAH to BAC. This mitotic figures. By comparison with high-grade AAH, low- finding of an increasing incidence of TERF1 mRNA from grade BAC exhibited significantly greater nuclear atypia, a low-grade AAH through high-grade AAH to BAC is not, by greatly increased nuclear:cytoplasmic ratio, and hyperchroma- itself, sufficient evidence to confirm the above idea (although it sia, as well as a higher proliferating cell density. may be consistent with it). Expression of TERF1 mRNA was confined to the cyto- In the present study, TERF1 mRNA was detected only plasm of tumor cells (Fig. 2). In the normal lung, TERF1 mRNA focally in normal lung tissues (in the nonciliated cells of the was detected focally as weak to moderate staining in serous cells bronchioles and in both the serous cells and ductal cells of the and ductal cells within bronchial glands and in nonciliated cells bronchial glands) using in situ hybridization, whereas using within bronchioles. Alveolar type I and type II cells were RT-PCR, it was detected in all of the total RNA samples negative. A positive TERF1 mRNA expression was recognized obtained from six normal lung tissues. Although the reason for in 36% of low-grade AAH (4 of 11 lesions), 65% of high-grade this discrepancy is unclear, one possibility is that the probes AAH (11 of 17 lesions), and 88% of BAC (35 of 40 lesions). used for in situ hybridization may be of lower sensitivity than Statistically, the differences between low-grade AAH and BAC the primers used for RT-PCR. and between high-grade AAH and BAC were significant (P ϭ On the basis of the evidence obtained using in situ hybrid- 0.0004 and P ϭ 0.046, respectively). ization in the present study, overexpression of TERF1 mRNA is Expression of TERF2 mRNA was also confined to the found in both AAH and BAC: we found it in 54% of all AAH cytoplasm of tumor cells (Fig. 3). In the normal lung, the pattern (15 of 28 lesions), but in 88% of BAC (35 of 40 lesions). These of expression of TERF2 mRNA was essentially the same as that figures accord well with the figures obtained for the incidence of of TERF1 mRNA. That is to say, it was represented focally as overexpression of hTERC and hTERT mRNAs in our previous weak to moderate staining in serous cells and ductal cells within study (55% and 59% in AAH and 98% and 98% in BAC, bronchial glands and in nonciliated cells within bronchioles, and respectively; Ref. 28). Furthermore, we found that the staining alveolar type I and type II cells were always negative. The scores obtained for TERF1 mRNA paralleled the staining scores detection rate for positive TERF2 mRNA expression was 82% obtained for hTERC and hTERT mRNAs in these same patients in low-grade AAH (9 of 11 lesions), 83% in high-grade AAH (Spearman’s correlation coefficient by rank). Recent studies (15 of 18 lesions), and 88% in BAC (35 of 40 lesions). In this have established that hTERC and hTERT form the minimum

Fig. 2 Expression of gene encoding TRF1 (TERF1 mRNA) in (A) low-grade AAH, (B) high-grade AAH, and (C) peripherally located BAC. In situ hybridization showed TERF1 mRNA to be localized to the cytoplasm of tumor cells. D, a sense probe was not detected in TERF1 mRNA-positive adenocarcinoma. Scale bar, 200 ␮m.

complex required for telomerase activity (13, 14). Despite the part in the mechanism by which telomerase regulation is up-regulation of telomerase activity that occurs in activated achieved. In several studies, telomerase activity was detected normal lymphocytes, however, telomeres still shortened to some during the early phase (intestinal metaplasia to adenoma in extent, as observed when the culture was continued for many colon and stomach and dysplasia to carcinoma in situ in uterine weeks (30, 31). Furthermore, overexpression of TRF1 in the cervix) of carcinogenesis (11, 32–34). Those authors (11, 32– tetracyclin-responsive human fibrosarcoma cell line HTC75 re- 34) suggested that hTERT mRNA expression is up-regulated, sulted in a gradual decline in telomere length at a rate of ϳ10 that telomerase activation is a critical step during tumor carci- bp/population doubling (17), and the forced tethering of a large nogenesis, and that both can be recognized at an early stage in number of TRF1 molecules to a single telomere induced a the oncogenic process. In our previous study, we found hTERT shortening rate of ϳ80 bp/population doubling (18). TRF1 does mRNA expression not only in BAC but also in AAH using in not affect telomerase activity globally within the cell, but clearly situ hybridization. The incidence of hTERT mRNA expression an excess of TRF1 inhibits cis telomerase activity at the te- was higher in low-grade AAH than in normal lung tissues. lomere itself (18). Therefore, in AAH and BAC, too, overex- Likewise, in the present study using in situ hybridization, pression of TERF1 mRNA may partially counteract telomerase TERF1 and TERF2 mRNAs each showed an increased inci- activation, limiting telomere elongation. However, these find- dence in low-grade AAH (compared with normal lung tissues), ings may not necessarily indicate an acquisition of malignant and this was particularly marked in the case of TERF2 mRNA, potential. Confirmation of a role for TRF1 in the carcinogenesis although both mRNAs were detected using RT-PCR in all of the of BAC would require a large-scale study using molecular total RNA samples obtained from six normal lung tissues, one techniques showing that this parameter does indeed influence high-grade AAH, and six BACs. We could not detect TERF2 the carcinoma sequence. mRNA at all in normal lung alveolar cells, and it was detected It has been shown that telomerase activity is not present in only focally as weak to moderate staining in nonciliated bron- most normal tissues (8) and that the expression of hTERT chiolar cells using in situ hybridization. Recently, Smogor- correlates closely with telomerase activity both in vitro and in zewska et al. (17) reported that an overexpression of TRF2 in vivo (12). Furthermore, the transcription of hTERT may play a HCT75 cell lines was accompanied by a progressive shortening

Fig. 3 Expression of the gene encoding TRF2 (TERF2 mRNA) in (A) low-grade AAH, (B) high-grade AAH, and (C) peripherally located BAC. In situ hybridization showed TERF2 mRNA to be localized to the cytoplasm of tumor cells. D, a sense probe was not detected in TERF2 mRNA-positive adenocarcinoma. Scale bar, 200 ␮m.

with a short telomere length (shorter than 2 kb) exhibited a higher TRF1 expression and tended to express TRF2 more strongly than those with a long telomere length. Therefore, we suspect that in AAH, too, overexpression of TERF2 mRNA may exert a negative regulatory influence over telomere length. The fact that TERF2 mRNA expression does not correlate with telomerase expression is in agreement with the recent finding that TRF2 can shorten telomeres without inactivating telomerase (18). The important overexpression of TRF2 in precursor lesions, even in low-grade AAH, suggests that TRF2 plays a key role in the early steps of carcinogenesis, for instance by inducing telomere dysfunction and/or by altering checkpoint controls. However, these findings, as well as the expression of TRF1, Fig. 4 RT-PCR results for the mRNAs for (A) TERF1 and (B) TERF2 may not necessarily indicate the acquisition of malignant poten- in normal lung tissue, high-grade AAH, and peripherally located BAC. tial. Confirmation of a role for TRF2 in the carcinogenesis of BAC also needs further study using molecular techniques. In conclusion, although our finding of an increasing incidence of TERF1 mRNA from low-grade AAH through of telomere length, a phenotype similar to that observed with high-grade AAH to BAC (using in situ hybridization) may be TRF1. They suggested that overexpression of TRF2 may play a consistent with the idea that high-grade AAH is a lesion regulatory role in the maintenance of telomerase length in these closely associated with BAC of the lung, it is not, by itself, lesions, as does overexpression of TRF1. Furthermore, this sufficient to confirm the validity of that idea. However, the notion was supported when Matsutani et al. (35), who dealt with incidence of TERF1 mRNA and, even more markedly, that 20 gastric carcinomas using RT-PCR, showed that carcinomas of TERF2 mRNA were found to be above normal in low-

grade AAH using in situ hybridization. Interestingly, over- 12. Meyerson, M., Counter, C. M., Eaton, E. N., Ellisen, L. W., Steiner, expression of TRF1, but not of TRF2, appears to correlate P., Caddle, S. D., Ziaugra, L., Beijersbergen, R. L., Davidoff, M. J., Liu, with telomerase activation, suggesting distinct effects of Q., Bacchetti, S., Haber, D. A., and Weinberg, R. A. hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells TRF1 and TRF2 during carcinogenesis in BAC of the lung. and during immortalization. Cell, 90: 785–795, 1997. TRF1 and TRF2 interact with other factors that regulate 13. Weinrich, S. L., Pruzan, R., Ma, L., Ouellette, M., Tesmer, V. M., telomere length [reviewed in Mergny et al. (36)]. These Holt, S. E., Bodnar, A. G., Lichtsteiner, S., Kim, N. W., Trager, L. B., include a second enzyme, tankyrase (which binds TRF1), Taylor, R. D., Carlos, R., Andrews, W. H., Wright, W. E., Shay, J. W., PinX1 and TIN2 (two negative regulators of telomerase’s Harley, C. B., and Morin, G. B. Reconstitution of human telomerase interaction with TRF1), and hRAP1 (which interacts with with the template RNA component hTR and the catalytic protein subunit hTRT. Nat. Genet., 17: 498–502, 1997. TRF2). Clearly, additional studies will be required to exam- 14. Nakayama, J., Tahara, H., Tahara, E., Saito, M., Ito, K., Nakamura, ine the alterations in the complete set of telomere-associated H., Nakanishi, T., Tahara, E., Ide, T., and Ishikawa, F. Telomerase proteins in the course of neoplastic transformation in high- activation by hTRT in human normal fibroblasts and hepatocellular grade AAH. carcinomas. Nat. Genet., 18: 65–68, 1998. 15. van Steensel, B., and de Lange, T. Control of telomere length by the human telomeric protein TRF1. Nature (Lond.), 385: 740–743, 1997. ACKNOWLEDGMENTS 16. van Steensel, B., Smogorzewska, A., and de Lange, T. TRF2 We thank Dr. Robert Timms for correcting the English version of protects human telomeres from end-to-end fusions. Cell, 92: 401–413, the manuscript. The work in E. G.’s laboratory is supported by La Ligue 1998. Nationale Contre le Cancer. 17. Smogorzewska, A., van Steensel, B., Bianchi, A., Oelmann, S., Schaefer, M. R., Schnapp, G., and de Lange, T. Control of human telomere length by TRF1 and TRF2. Mol. Cell. Biol., 20: 1659–1668, REFERENCES 2000. 18. Ancelin, K., Brunori, M., Bauwens, S., Koering, C. E., Brun, C., 1. Shimosato, Y., Kodama, T., and Kameya, T. Morphogenesis of Ricoul, M., Pommier, J. P., Sabatier, L., and Gilson, E. A. Targeting peripheral type adenocarcinoma of the lungs. In: Y. Shimosato, M. R. assay to study the cis functions of human telomeric proteins: evidence Melamed, and P. Nettesheim (eds.), Morphogenesis of Lung Cancer, for an inhibition of telomerase by TRF1 and for activation of telomere Vol. 1, pp. 65–89. Boca Raton, FL: CRC Press, 1982. degradation by TRF2. Mol. Cell. Biol., 22: 3474–3487, 2002. 2. Travis, W. D., Colby, T. V., Corrin, B., Shimosato, T., and Bram- 19. Kumaki, F., Kawai, T., Hiroi, S., Shinomiya, N., Ozeki, Y., Ferrans, billa, E. Histological Typing of Lung and Pleural Tumours, 3rd ed., p. V. J., and Torikata, C. Telomerase activity and expression of human 36. WHO, Springer-Verlag, 1999. telomerase RNA component and human telomerase reverse transcriptase 3. Kitamura, H., Kameda, Y., Ito, T., and Hayashi, H. Atypical ade- in lung carcinomas. Hum. Pathol., 32: 188–195, 2001. nomatous hyperplasia of the lung. Am. J. Clin. Pathol., 111: 610–622, 20. Fujiwara, M., Okayasu, I., Takemura, T., Tanaka, I., Masuda, R., 1999. Furuhata, Y., Noji, M., Oritsu, M., Kato, M., and Oshimura, M. Telom- 4. Mori, M., Rao, S. K., Popper, H. H., Cagle, P. T., and Fraire, A. E. erase activity significantly correlates with chromosome alterations, cell Atypical adenomatous hyperplasia of the lung: a possible forerunner in differentiation, and proliferation in lung adenocarcinomas. Mod. the development of adenocarcinoma of the lung. Mod. Pathol., 14: Pathol., 13: 723–729, 2000. 72–84, 2001. 21. Marchetti, A., Bertacca, G., Buttitta, F., Chella, A., Quattrocolo, G., 5. Blackburn, E. H. Structure and function of telomeres. Nature Angeletti, C. A., and Bevilacqua, G. Telomerase activity as a prognostic (Lond.), 350: 569–573, 1991. indicator in stage I non-small cell lung cancer. Clin. Cancer Res., 5: 2077–2081, 1999. 6. Counter, C. M., Avilion, A. A., LeFeuvre, C. E., Stewart, N. G., Greider, C. W., Harley, C. B., and Bacchetti, S. Telomerase short- 22. Hiyama, K., Hiyama, E., Ishioka, S., Yamakido, M., Inai, K., ening associated with chromosome instability is arrested in immortal Gazdar, A. F., Piatyszek, M. A., and Shay, J. W. Telomerase activity in cells which express telomerase activity. EMBO J., 11: 1921–1929, small-cell and non-small cell lung cancers. J. Natl. Cancer Inst. (Be- 1992. thesda), 87: 895–902, 1995. 7. Blasco, M. A., Funk, W., Villeponteau, B., and Greider, C. W. 23. Albanell, J., Lonardo, F., Rusch, V., Engelhardt, M., Langenfeld, J., Functional characterization and developmental regulation of mouse Han, W., Klimstra, D., Venkatraman, E., Moore, M. A. S., and telomerase RNA. Science (Wash. DC), 269: 1267–1272, 1995. Dmitrovsky, E. High telomerase activity in primary lung cancers: association with increased cell proliferation rates and advanced pathologic 8. Kim, N. W., Piatyszek, M. A., Prowse, K. R., Harley, C. B., West, stage. J. Natl. Cancer Inst. (Bethesda), 89: 1609–1615, 1997. M. D., Ho, P. L. C., Coviello, G. M., Wright, W. E., Weinrich, S. L., and Shay, J. W. Specific association of human telomerase activity 24. Taga, S., Osaki, T., Ohgami, A., Imoto, H., and Yasumoto, K. with immortal cells and cancer. Science (Wash. DC), 266: 2011– Prognostic impact of telomerase activity in non-small cell lung cancers. 2015, 1994. Ann. Surg., 230: 715–720, 1999. 9. Blasco, M. A., Rizen, M., Greider, C. W., and Hanahan, D. Differ- 25. Kawai, T., Hiroi, S., and Torikata, C. Expression in lung carcino- ential regulation of telomerase activity and telomerase RNA during mas of platelet-derived growth factor and its receptors. Lab. Investig., multi-stage tumorigenesis. Nat. Genet., 12: 200–204, 1996. 77: 431–436, 1997. 10. Avilion, A. A., Piatyszek, M. A., Gupta, J., Shay, J. W., Bacchetti, 26. Vassetzky, N., Gaden, F., Brun, C., Gasser, S. M., and Gilson, E. S., and Greider, C. W. Human telomerase RNA and telomerase activity Taz1P and Teb1p, two telobox proteins in Schizosaccharomyces pombe in immortal cell lines and tumor tissues. Cancer Res., 56: 645–650, recognize different telomere-related DNA sequences. Nucleic Acids 1996. Res., 27: 4687–4694, 1999. 11. Yashima, K., Litzky, L. A., Kaiser, L., Rogers, T., Lam, S., Wist- 27. Bilaud, T., Brun, C., Ancelin, K., Koering, C. E., Laroche, T., and suba, I. I., Milchgrub, S., Srivastava, S., Piatyszek, M. A., Shay, J. W., Gilson, E. Telomeric localization of TRF2, a novel human telobox and Gazdar, A. F. Telomerase expression in respiratory epithelium protein. Nat. Genet., 17: 236–239, 1997. during the multistage pathogenesis of lung carcinomas. Cancer Res., 57: 28. Nakanishi, K., Kawai, T., Kumaki, F., Hiroi, S., Mukai, M., and 2373–2377, 1997. Ikeda, E. Expression of human telomerase mRNA component (hTERC)

and telomerase reverse transcriptase (hTERT) mRNA in atypical ade- 33. Maruyama, Y., Hanai, H., Fujita, M., and Kaneko, E. Telomerase nomatous hyperplasia of the lung. Hum. Pathol., 33: 697–702, 2002. length and telomerase activity in carcinogenesis of the stomach. Jpn. 29. Chomczyski, P., and Sacchi, N. Single-step method of RNA isola- J. Clin. Oncol., 27: 216–220, 1997. tion by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. 34. Yashima, K., Ashfag, R., Nowak, J., von Gruenigen, V., Michgrub, Biochem., 162: 156–159, 1987. S., Rathi, A., Albores-Saavedra, J., Shay, J. W., and Gazder, A. F. 30. Bodmar, A. G., Kim, N. W., Effros, R. B., and Chiu, C. P. Mech- Telomerase activity and expression of its RNA component in cervical anism of telomerase induction during T-cell activation. Exp. Cell Res., lesions. Cancer (Phila.), 82: 1319–1327, 1998. 228: 58–64, 1996. 35. Matsutani, N., Yokozaki, H., Tahara, E., Tahara, H., Kuniyasu, H., 31. Weng, N. P., Palmer, L. D., Levine, B. L., Lane, H. C., June, C. H., Haruma, K., Chayama, K., Yasui, W., and Tahara, E. Expression of and Hodes, R. J. Tales of tails: regulation of telomere length and telomeric repeat binding factor 1 and 2 and TRF1-interacting nuclear telomerase activity during lymphocyte development, differentiation, protein 2 in human gastric carcinomas. Int. J. Oncol., 19: 507–512, activation and aging. Immunol. Rev., 160: 43–54, 1997. 2000. 32. Tahara, H., Kuniyasu, H., Yokozaki, H., Yasui, W., Shay, J. W., Ide, 36. Mergny, J. L., Riou, J. F., Mailliet, P., Teulade-Fichou, M. P., and T., and Tahara, E. Telomerase activity in preneoplastic and neoplastic Gilson, E. Natural and pharmacological regulation of telomerase. Nu- gastric and colorectal lesions. Clin. Cancer Res., 1: 1245–1251, 1995. cleic Acids Res., 30: 839–865, 2002.

Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2003 American Association for Cancer Research. Expression of mRNAs for Telomeric Repeat Binding Factor (TRF)-1 and TRF2 in Atypical Adenomatous Hyperplasia and Adenocarcinoma of the Lung

Kuniaki Nakanishi, Toshiaki Kawai, Fumiyuki Kumaki, et al.

Clin Cancer Res 2003;9:1105-1111.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/9/3/1105

Cited articles This article cites 35 articles, 8 of which you can access for free at: http://clincancerres.aacrjournals.org/content/9/3/1105.full#ref-list-1

Citing articles This article has been cited by 15 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/9/3/1105.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/9/3/1105. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.