DOCSLIB.ORG

Reduced Bacteriophage T7 Infectivity of Gentamicin Treated Escherichia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Reduced Bacteriophage T7 Infectivity of Gentamicin Treated Escherichia Journal of Experimental Microbiology and Immunology (JEMI) Vol. 21: 46 – 51 Copyright © July 2017, M&I UBC Reduced Bacteriophage T7 Infectivity of Gentamicin Treated Escherichia Coli UB1005 Is Likely Not a Result of Treatment- Induced Release of Cellular Factors Into The Culture Supernatant Manveer Nagra, Rachel Miller, Freddy Francis Department of Microbiology & Immunology, University of British Columbia Pre-treatment of Escherichia coli UB1005 with sub-lethal concentrations of gentamicin has been shown to reduce the infectivity of Bacteriophage T7. However, levels of infectivity has been shown to increase after a wash following antibiotic treatment. Thus we investigated the cause for the decreased infection of Bacteriophage T7 in Escherichia Coli UB1005 after treatment with a sub-lethal concentration of gentamicin. We hypothesized that treatment with sub inhibitory concentrations of gentamicin releases a cellular factor into the supernatant that serves as a decoy receptor to prevent T7 absorption. To test this hypothesis, we transferred supernatants of gentamicin treated UB1005 to untreated UB1005 and tested T7 infection. We observed that the transfer of supernatants from gentamicin treated UB1005 to untreated UB1005 did not reduce the infection of T7 in a double agar overlay assay. These data suggest that reduced T7 infectivity of UB1005 following gentamicin treatment is not due to a released, transferrable, cellular factor in the culture supernatant. Bacteriophages are viruses that infect bacteria and may substituting the divalent cations between LPS molecules cause bacterial cell rupture through lytic replication (1). Due that are critical in maintaining membrane integrity (7). The to their antibacterial properties, bacteriophages have been destabilizing effect on Gram-negative bacteria, including E. used to treat bacterial infections since the early 1900s, a coli, has been shown to induce the release of blebs of practice termed phage therapy (2). However, research in phospholipid bilayer from the outer membrane called outer phage therapy declined with the discovery of antibiotics membrane vesicles (OMVs) (8-10). Consequently, the LPS which was a more economical method to treat bacterial on the OMV surface may bind T7 phage and reduce levels infections. Today, excessive use of antibiotics has led to of phage adsorption as well as infection (10). Garcia- selective pressures that favor the evolution and spread of Gonzales et al. also suggested that T7 phage binding to the antibiotic resistant bacteria. Phage therapy can provide a OMV LPS or soluble LPS might lead to ejection of phage practical alternative to treating multi-drug resistant bacterial genome, essentially inactivating some of the virus (3). infections. However, since phage therapy is not well However, Hardman et al observed that when E. coli studied, further research is required to understand the UB1005 was suspended in minimal (M9) media with factors that might limit its clinical use. One important solubilized LPS prior to T7 infection, it did not show consideration would be to study the effectiveness of and decreased infectivity (6). This result may have been due to possible complications arising from simultaneous treatment the fact that gentamicin treatment of E. coli does not induce with antibiotics and phage therapy. a significant release of LPS (11). Furthermore, when Bacteriophage T7 belongs to the Podoviridae family and gentamicin treated E. coli were washed prior to infection has a polyhedral head, a simple tail, and one piece of double with T7, phage infectivity increased compared to that of stranded DNA transcript (1). T7 phage primarily infects non-treated bacteria, and suggested a factor present in the Escherichia coli (E. coli) that has a rough culture supernatant that has a protective effect from lipopolysaccharide (LPS) rich surface (3). T7 phage infection, that when removed increases susceptibility to undergoes lytic replication and produces progeny virus infection. These studies suggest that an alternative soluble particles within 12 to 25 minutes at ideal incubation factor in the cell-free media of gentamicin treated cells may temperatures (3, 4). It is postulated that the viral particle tail be responsible for the observed decrease in T7 infectivity adheres to the bacterial cell surface LPS prior to injecting (6). its DNA into the host (3). In vitro, studies have shown that In this study, we tested whether the reduction in T7 phage the binding of viral particle to bacterial rough LPS is infectivity of E. coli UB1005 following pre-treatment with sufficient for the ejection of phage DNA and thus LPS has sub-lethal levels of gentamicin is due to a soluble, aqueous been recognized as the main receptor mediating phage factor released into the media. We hypothesized that a adsorption and subsequent infection (3). stress-induced transferrable aqueous factor released in Pre-treatment of E. coli with sub-lethal concentrations of gentamicin treated E. coli UB1005 culture was the causative aminoglycoside antibiotics such as kanamycin and agent for reduced T7 phage infectivity of antibiotic treated gentamicin has been shown to reduce the adsorption and bacteria. Contrary to our hypothesis, our data suggests that infectivity, respectively, of T7 phage (5, 6). These reduced bacteriophage T7 infectivity of gentamicin treated polycationic antibiotics destabilize bacterial cell walls by Undergraduate Research Article 46 Journal of Experimental Microbiology and Immunology (JEMI) Vol. 21: 46 – 51 Copyright © July 2017, M&I UBC E. coli is not a result of treatment-induced release of of 50 µL comprised of 2 µL of dNTPs, 4 µL of MgCl2, 5 µL of aqueous factors 10X PCR reaction buffer, 1 µL of Forward Primer T7 rpol Fwd, 1 µL of Reverse Primer T7 rpol Rev, 0.25 µL of Taq Polymerase, MATERIALS AND METHODS 35.75 µL of PCR grade water and 1 µL of template DNA, were set up for PCR. Following a 950 C 10 minute denaturation steps, 30 Minimum Inhibitory concentration (MIC) assay. M9 media was cycles of PCR were run. Each cycle was 5 minutes at 95 ºC used to culture E. coli strain UB1005 obtained from Hancock Lab. (denaturation), 30 seconds at 52 ºC (annealing), 30 seconds at 74 M9 media is a minimal media used to test stress factors on ºC (extension). The reaction was held at 4 ºC once the 30 cycles organisms growing in minimal (12). were completed. The PCR was run on a T100™ Thermal Cycler Preparation of M9 media. A stock solution of 10X M9 salts from Biorad. Two sets of primers were used; one targeting the rpol were prepared for storage. 60 g Na2HPO4, 30 g KH2PO4, 5 g NaCl, of the T7 phage to check for its presence, and the other targeting 10 g NH4Cl were dissolved in 1000 mL of distilled water. This the gp23 of the T4 phage to check for possible contamination of mixture was sterilized by autoclaving. A 1 M stock solution of the T7 phage isolate with T4 phage. The sequence (5’ to 3’ CaCl2 was prepared in a separate bottle and sterilize by orientation) of the primers used were as follows: T7 rpol:Fwd: autoclaving. The M9 media was prepared by mixing together 100 CGAGGGCTTAGGTACTGC, T7 rpol:Rev: mL of 10X M9 salts, 0.1 mL of 1 M of CaCl2, 50 mL of 10% GGTGAGGTGCGGAACTTC, T4gp23:Fwd: glucose, 10 mL of 0.1 M MgSO4, 50 mL of 10% casamino acids, 2 GCCATTACTGGAAGGTGAAGG, and T4gp23:Rev: mL if 10 mg/ mL vitamin B1, 2 mL of 10 mg/mL tryptophan and TTGGGTGGAATGCTTCTTTAG 790 mL of deionized water. The mixture was autoclaved and stored The amplicons from the reaction were run on a 1% agarose gel. on lab bench. 0.5 g of agarose was mixed in 50 mL of TAE buffer and heated Preparation of gentamicin stock from gentamicin sulphate. using a microwave. When the solution was thoroughly mixed, it 0.5 g of gentamicin sulphate was added to 10 mL of sterile H2O was allowed to cool to approximately 60 ºC prior to the addition of and dissolved by shaking. A 0.22 µm syringe filter was primed by 4 µL of SYBR Safe. The gel was poured in a cassette and allowed drawing 5 mL of sterile H2O, which was subsequently discarded. to cool. 9 µL of the PCR reaction was mixed with 1 µl of 10X The gentamicin solution was filter sterilized using the primed 0.22 loading buffer and loaded on the gel. 10 µL of the GeneRuler™ 1 µm filter. This stock concentration was stored in -20 0C and used Kb plus was used as a scale for the molecular bands. The gel was to make further dilutions of working concentrations. run at 110 volts for 35 minutes. Minimum Inhibitory Concentration Assays. The minimum Phage bottom agar and Phage top agar. Phage bottom agar inhibitory concentration of gentamicin for E. coli strain UB1005 (PBA) was a 1.5% M9 agar that was used for the base. Phage top grown in minimal M9 media was determined by growing the cells agar (PTA) was a 0.75% M9 agar that is used for the phage plaque in a 96 well plate Corning™ Costar™ TC-Treated 96 well overlay assay. The M9 media was prepared and the appropriate polypropylene plates (Cat. No. CLS3790) using multiple amount of agar was added and autoclaved. The mixture was cooled concentrations of gentamicin. The range of gentamicin and poured into sterile petri plates. concentrations used was from 10 µg/mL to 0 µg/mL. An overnight Phage titer plaque assay. An overnight culture of the E. coli culture of E. coli strain UB1005 grown in M9 media was inoculated strain UB1005 was set up in 5 mL of M9 media. The culture was at 1:100 dilution and incubated in 37 ºC. The cells were grown until seeded at a 1:100 dilution in the required amount of M9 media.
Load more

Recommended publications
  • The Rate of T7 Phage-Mediated Lysis of Escherichia Coli Growing in Exponential Phase Is Not Affected by Deletion of Rpos
    Undergraduate Journal of Experimental Microbiology and Immunology (UJEMI) Vol. 25:1- 9 Copyright © September 2020, M&I UBC The rate of T7 phage-mediated lysis of Escherichia coli growing in exponential phase is not affected by deletion of rpoS Jingyao Zhu, Cai Lan Jennifer Huang, Kamand Doraki, Bryan Lee Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada SUMMARY RpoS is an Escherichia coli sigma factor shown to regulate genes in response to various environmental and internal stressors. Previous studies have investigated the role of RpoS in a mechanism known as a cross-protection, in which prior exposure to one stressor leads to increased tolerance to a subsequent stressor. Pre-treatment with subinhibitory levels of antibiotics have been used in several studies in an attempt to elicit a delay in phage-lysis, with varying and contradicting results. We propose that the delayed T7-mediated lysis phenotype may be growth phase dependent as the stress response sigma factor RpoS is known to be expressed in stationary phase. Here, we attempted to perform phage lysis assays on wild-type (WT) and rpoS knockout strains of Escherichia coli strains growing in stationary and exponential phase, to look for differences in the time to observe bacteriophage-mediated lysis. We did not observe differences in the time of phage-mediated lysis between wild type and rpoS knock-out strains of E. coli growing in exponential phase. An attempt was made to compare phage-mediated lysis time of E. coli grown in exponential and stationary phase, however, technical issues related to normalizing optical density prevented meaningful comparisons.
    [Show full text]
  • CRISPR/Cas9 Mediated T7 RNA Polymerase Gene Knock-In in E. Coli BW25113 Makes T7 Expression System Work Efciently
    CRISPR/Cas9 mediated T7 RNA polymerase gene knock-in in E. coli BW25113 makes T7 expression system work eciently Changchuan Ye China Agricultural University https://orcid.org/0000-0002-0683-5290 Xi Chen China Agricultural University Mengjie Yang National Feed Engineering Technology Research Centre Xiangfang Zeng China Agricultural University College of Animal Science and Technology Shiyan Qiao ( [email protected] ) China Agricultural University College of Animal Science and Technology https://orcid.org/0000-0003-4434-318X Research Keywords: E. coli, CRISPR/cas9, T7 Expression System, Fluorescent Protein, 5-Aminolevulinic Acid, promoter variants Posted Date: March 24th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-339217/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Journal of Biological Engineering on August 12th, 2021. See the published version at https://doi.org/10.1186/s13036-021-00270-9. Page 1/23 Abstract T7 Expression System is a common method of ensuring tight control and high-level induced expression. However, this system can only work in some bacterial strains in which the T7 RNA Polymerase gene resides in the chromosome. In this study, we successfully introduced a chromosomal copy of the T7 RNA Polymerase gene under control of the lacUV5 promoter into Escherichia coli BW25113. The T7 Expression System worked eciently in this mutant strain named BW25113-T7. We demonstrated that this mutant strain could satisfactorily produce 5-Aminolevulinic Acid via C5 pathway. A nal study was designed to enhance the controllability of T7 Expression System in this mutant strain by constructing a T7 Promoter Variants Library.
    [Show full text]
  • Co-Inoculation of Escherichia Coli B23 by T4 and T7 Bacteriophages Results in Competition Shown by an Overall Drop in Phage Progeny
    Journal of Experimental Microbiology and Immunology (JEMI) Vol. 18: 156 – 161 Copyright © April 2014, M&I UBC Co-inoculation of Escherichia coli B23 by T4 and T7 bacteriophages results in competition shown by an overall drop in phage progeny Khue-Tu Nguyen, Karen Simmons, Igor Tatarnikov Department Microbiology & Immunology, University of British Columbia Co-inoculation and co-infection are phenomena that occur naturally in the environment that have implications on. In order to explore competition between T4 and T7 phages, one-step assays were carried out on T4 and T7 mono- infected samples, and a sample co-inoculated by both T4 and T7. Mono-infections were performed at an MOI of 5 in order to ensure infection, and the co-inoculation had an MOI of 5 for both T4 and T7 resulting in a total MOI of 10. It was found that at 90 min post co-inoculation, the overall titer of both phages decreased with respect to their mono-infected controls, 97% for T4 and 98% for T7. This suggested that actual co-infection could have occurred and competition was carried out within the host cell. This effect demonstrated that even though there seems to be interference between the two phages in co-inoculation, neither phage out-competes the other. T4 and T7 are well-studied bacteriophage capable of from the Microbiology 421 culture collection from the infecting Escherichia coli (E. coli) (1, 2). They contain department of Microbiology and Immunology, University of double-stranded, linear, DNA genomes, with T4 having British Columbia. approximately 169 kbp coding for around 300 genes (1,3) PCR.
    [Show full text]
  • Bacteriophage T7 Gene 2.5 Protein: an Essential Protein for DNA Replication (DNA Binding Protein/Recombination/T7 DNA Polymerase) YOUNG TAE KIM* and CHARLES C
    Proc. Natl. Acad. Sci. USA Vol. 90, pp. 10173-10177, November 1993 Biochemistry Bacteriophage T7 gene 2.5 protein: An essential protein for DNA replication (DNA binding protein/recombination/T7 DNA polymerase) YOUNG TAE KIM* AND CHARLES C. RICHARDSON Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115 Contributed by Charles C. Richardson, July 22, 1993 ABSTRACT The product of gene 2.5 of bacteriophage T7, 15). Both direct and indirect evidence support an interaction a single-stranded DNA binding protein, physically interacts with between these essential replication proteins and the T7 gene the phage-encoded gene S protein (DNA polymerase) and gene 2.5 protein. 4 proteins (helicase and primase) and stimulates their activities. T7 gene 2.5 protein stimulates DNA synthesis catalyzed by Genetic analysis ofT7 phage defective in gene 2.5 shows that the the T7 DNA polymerase/thioredoxin complex on single- gene 2.5 protein is essential for T7 DNA replication and growth. stranded DNA templates (4, 5, 11, 14) and increases the T7 phages thatcontain null mutants ofgene2.5 were constructed processivity ofthe reaction (11). It has been shown by affinity by homologous recombination. These gene 2.5 null mutants chromatography and fluorescence emission anisotropy that contain either a deletion ofgene2.5 (T7A2.5) or an insertion into T7 DNA polymerase and gene 2.5 protein physically interact gene 2.5 and cannot grow in Escherichia coli (efficiency of with a dissociation constant of 1.1 ,uM (11). Similarly, inter- plating, <10-8). After infection of E. coli with T7A2.5, host action of the T7 helicase/primase with gene 2.5 protein has DNA synthesis is shut off, and phage DNA synthesis is reduced been inferred from the ability ofgene 2.5 protein to stimulate to <1% ofphage DNA synthesis in wild-type T7-infected E.
    [Show full text]
  • Promiscuous Usage of Nucleotides by the DNA Helicase Of
    Supplemental Material can be found at: http://www.jbc.org/cgi/content/full/M900557200/DC1 THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 21, pp. 14286–14295, May 22, 2009 © 2009 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Promiscuous Usage of Nucleotides by the DNA Helicase of Bacteriophage T7 DETERMINANTS OF NUCLEOTIDE SPECIFICITY*□S Received for publication, January 26, 2009, and in revised form, March 12, 2009 Published, JBC Papers in Press, March 17, 2009, DOI 10.1074/jbc.M900557200 Ajit K. Satapathy, Donald J. Crampton1, Benjamin B. Beauchamp, and Charles C. Richardson2 From the Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts 02115 The multifunctional protein encoded by gene 4 of bacterioph- to single-stranded DNA (ssDNA)3 as a hexamer and translo- age T7 (gp4) provides both helicase and primase activity at the cates 5Ј to 3Ј along the DNA strand using the energy of hydrol- replication fork. T7 DNA helicase preferentially utilizes dTTP ysis of dTTP (5–7). T7 helicase hydrolyzes a variety of ribo and to unwind duplex DNA in vitro but also hydrolyzes other nucle- deoxyribonucleotides; however, dTTP hydrolysis is optimally otides, some of which do not support helicase activity. Very little coupled to DNA unwinding (5). is known regarding the architecture of the nucleotide binding Most hexameric helicases use rATP to fuel translocation and Downloaded from site in determining nucleotide specificity. Crystal structures of unwind DNA (3). T7 helicase does hydrolyze rATP but with a the T7 helicase domain with bound dATP or dTTP identified 20-fold higher Km as compared with dTTP (5, 8).
    [Show full text]
  • The Application of Thermophilic DNA Primase Ttdnag2 to DNA Amplifcation Received: 17 July 2017 D
    www.nature.com/scientificreports OPEN The application of thermophilic DNA primase TtDnaG2 to DNA amplifcation Received: 17 July 2017 D. Zhao1,2, Xiuqiang Chen1,2, Kuan Li3 & Yu V. Fu1,2 Accepted: 6 September 2017 For DNA replication in vivo, DNA primase uses a complementary single-stranded DNA template to Published: xx xx xxxx synthesize RNA primers ranging from 4 to 20 nucleotides in length, which are then elongated by DNA polymerase. Here, we report that, in the presence of double-stranded DNA, the thermophilic DNA primase TtDnaG2 synthesizes RNA primers of around 100 nucleotides with low initiation specifcity at 70 °C. Analysing the structure of TtDnaG2, we identifed that it adopts a compact conformation. The conserved sites in its zinc binding domain are sequestered away from its RNA polymerase domain, which might give rise to the low initiation specifcity and synthesis of long RNA segments by TtDnaG2. Based on these unique features of TtDnaG2, a DNA amplifcation method has been developed. We utilized TtDnaG2 to synthesize RNA primers at 70 °C after 95 °C denaturation, followed by isothermal amplifcation with the DNA polymerase Bst3.0 or phi29. Using this method, we successfully amplifed genomic DNA of a virus with 100% coverage and low copy number variation. Our data also demonstrate that this method can efciently amplify circular DNA from a mixture of circular DNA and linear DNA, thus providing a tool to amplify low-copy-number circular DNA such as plasmids. DNA replication is a complicated process in vivo1–3. It requires numerous components working together to syn- thesize new DNA strands.
    [Show full text]
  • Lytic Bacteriophage Have Diverse Indirect Effects in a Synthetic Cross-Feeding Community 125
    The ISME Journal (2020) 14:123–134 https://doi.org/10.1038/s41396-019-0511-z ARTICLE Lytic bacteriophage have diverse indirect effects in a synthetic cross- feeding community 1,2 2,3 2,4 5 1,2,4 Lisa Fazzino ● Jeremy Anisman ● Jeremy M. Chacón ● Richard H. Heineman ● William R. Harcombe Received: 17 July 2019 / Accepted: 15 August 2019 / Published online: 2 October 2019 © The Author(s) 2019. This article is published with open access Abstract Bacteriophage shape the composition and function of microbial communities. Yet it remains difficult to predict the effect of phage on microbial interactions. Specifically, little is known about how phage influence mutualisms in networks of cross- feeding bacteria. We mathematically modeled the impacts of phage in a synthetic microbial community in which Escherichia coli and Salmonella enterica exchange essential metabolites. In this model, independent phage attack of either species was sufficient to temporarily inhibit both members of the mutualism; however, the evolution of phage resistance facilitated yields similar to those observed in the absence of phage. In laboratory experiments, attack of S. enterica with P22vir phage followed these modeling expectations of delayed community growth with little change in the final yield of 1234567890();,: 1234567890();,: bacteria. In contrast, when E. coli was attacked with T7 phage, S. enterica, the nonhost species, reached higher yields compared with no-phage controls. T7 infection increased nonhost yield by releasing consumable cell debris, and by driving evolution of partially resistant E. coli that secreted more carbon. Our results demonstrate that phage can have extensive indirect effects in microbial communities, that the nature of these indirect effects depends on metabolic and evolutionary mechanisms, and that knowing the degree of evolved resistance leads to qualitatively different predictions of bacterial community dynamics in response to phage attack.
    [Show full text]
  • Translational Control Induced by Bacteriophage T7 (Enzyme Synthesis/Uncoupled System/Initiation Factors/RNA Shut-Off/Gene UV Sensitivities)
    Proc. Nat. Acad. Sci. USA Vol. 71, No. 4, pp. 1088-1092, April 1974 Translational Control Induced by Bacteriophage T7 (enzyme synthesis/uncoupled system/initiation factors/RNA shut-off/gene UV sensitivities) P. HERRLICH, H. J. RAHMSDORF, S. H. PAI, AND M. SCHWEIGER Max-Planck-Institut far Molekulare Genetik, Berlin-Dahlem, Germany Communicated by F. Lynen, November 20, 1973 ABSTRACT Phage T7 discontinues host gene expres- ine, triphosphopyridine nucleotide, and flavine adenine sion by translational and transcriptional control mech- anisms. Translational control is exerted by the T7 trans- dinucleotide were omitted from the incubation mixture and lational-repressor. This protein inhibits the synthesis of MgCl2 and Tris HCl were used instead of Mg-acetate and ft-galactosidase (EC 3.2.1.23) in vivo and in vitro and the Tris-acetate. synthesis of the T3 enzyme S-adenosylmethioninehydro- lase (EC 3.3.1.-). The translational-repressor does not Assay of Enzyme Activity. The tests for S-adenosylmeth- interfere with T7-specific enzyme synthesis. The T7 trans- ioninehydrolase (EC 3.3.1.-), lysozyme (EC 3.2.1.17), T7 lational-repressor purifies with the initiation factors. The RNA polymerase (EC 2.7.7.6), and DNA ligase (EC 6.5.1.1) repressor interacts with the initiation of translation of host have been described (9). The assay for g3-galactosidase (EC enzymes. The translational-repressor gene is close to the promotor for RNA polymerase of Escherichia coli. 3.2.1.23) activity was performed as described by Zubay (10). Infection of E. coli. E. coli strains specified in the individual The mechanisms involved in the control of gene expression are experiments were grown at 300 in rich medium or M9 minimal at the center of interest in modern molecular biology.
    [Show full text]
  • The Arginine Finger of Bacteriophage T7 Gene 4 Helicase: Role in Energy Coupling
    The arginine finger of bacteriophage T7 gene 4 helicase: Role in energy coupling Donald J. Crampton, Shenyuan Guo*, Donald E. Johnson, and Charles C. Richardson† Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115 Contributed by Charles C. Richardson, February 10, 2004 The DNA helicase encoded by gene 4 of bacteriophage T7 couples subsequently identified in other NTP-hydrolyzing enzymes such DNA unwinding to the hydrolysis of dTTP. The loss of coupling in as the F1-ATPase (19). the presence of orthovanadate (Vi) suggests that the ␥-phosphate An arginine finger is recognized as an arginine residue that of dTTP plays an important role in this mechanism. The crystal coordinates the ␥-phosphate of a bound nucleotide, with the structure of the hexameric helicase shows Arg-522, located at the arginine residue being located distal to the nucleotide-binding subunit interface, positioned to interact with the ␥-phosphate of site. The arginine can reside on a distinct activator protein, as in bound nucleoside 5؅ triphosphate. In this respect, it is analogous to the case of GAP-Ras (20, 21), an adjacent subunit of an arginine fingers found in other nucleotide-hydrolyzing enzymes. oligomeric protein such as the F1-ATPase (17), or a distinct When Arg-522 is replaced with alanine (gp4-R522A) or lysine domain within the protein itself (22). Arginine fingers contribute (gp4-R522K), the rate of dTTP hydrolysis is significantly decreased. to NTP hydrolysis through stabilization of the transition state of dTTPase activity of the altered proteins is not inhibited by Vi, the reaction and as a trigger for conformational changes after suggesting the loss of an interaction between Vi and gene 4 hydrolysis of dTTP (19, 23, 24).
    [Show full text]
  • Amino Acid Residues Critical for the Interaction Between Bacteriophage T7 DNA Polymerase and Escherichia Coli Thioredoxin
    Amino Acid Residues Critical for the Interaction between Bacteriophage T7 DNA Polymerase and Escherichia coli Thioredoxin The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Himawan, Jeff S., and Charles C. Richardson. 1996. “Amino Acid Residues Critical for the Interaction between Bacteriophage T7 DNA Polymerase andEscherichia coliThioredoxin.” Journal of Biological Chemistry 271 (33): 19999–8. https://doi.org/10.1074/ jbc.271.33.19999. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:41483387 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 271, No. 33, Issue of August 16, pp. 19999–20008, 1996 © 1996 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Amino Acid Residues Critical for the Interaction between Bacteriophage T7 DNA Polymerase and Escherichia coli Thioredoxin* (Received for publication, March 28, 1996) Jeff S. Himawan‡ and Charles C. Richardson§ From the Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts 02115 Upon infection of Escherichia coli, bacteriophage T7 nificantly by mutation, then complex formation with the second annexes a host protein, thioredoxin, to serve as a pro- protein would be destroyed. Theoretically, a productive com- cessivity factor for its DNA polymerase, T7 gene 5 pro- plex could be formed once again by an alteration in the second tein.
    [Show full text]
  • Modification of RNA Polymerase After T3 Phage Infection of Escherichia Coli B (DEAE-Cellulose, Phosphocellulose, and DNA-Cellulose Chromatography/H' Subunit)
    Proc. Nat. Acad. Sci. USA Vol. 70, No. 10, pp. 2845-2849, October 1973 Modification of RNA Polymerase after T3 Phage Infection of Escherichia coli B (DEAE-cellulose, phosphocellulose, and DNA-cellulose chromatography/h' subunit) B. DHARMGRONGARTAMA, S. P. MAHADIK, AND P. R. SRINIVASAN Columbia University, College of Physicians & Surgeons, Department of Biochemistry, New York, N. Y. 10032 Communicated by Erwin Chargaff, June 25, 1973 ABSTRACT E. coli B cells infected with T3 phage con- 0.15 M KCl, 125,ug of bovine-serum albumin, 25 ug of calf- tain a modified host RNA polymerase in addition to the thymus DNA or E. coli DNA or 10 of either T2 or T3 normal RNA polymerase found in uninfected cells. The /Ag modified RNA polymerase behaves differently in its elution DNA, 0.2 mM "4C-labeled nucleoside triphosphate (ATP or properties from the normal enzyme on DEAE-cellulose, GTP, 1 Ci/mol), and 0.2 mM (each) of the other three un- phosphocellulose, and DNA-cellulose column chroma- labeled triphosphates, and enzyme. Incubation was at 370 for tography. The modified enzyme also differs from the 10 min. The specific activity is expressed as units per mg of normal polymerase in some of its enzymatic parameters. 1 of incorporated into The specific activity of the modified RNA polymerase is protein; one unit equals nimol [14C]GTP markedly lower (i.e., 1/4) than that of the normal enzyme. RNA in 10 min at 370 with native calf-thymus DNA as The decrease in activity is probably due to an alteration in template.
    [Show full text]
  • Communication Between Subunits Critical to DNA Binding by Hexameric Helicase of Bacteriophage T7
    Communication between subunits critical to DNA binding by hexameric helicase of bacteriophage T7 Seung-Joo Lee, Udi Qimron, and Charles C. Richardson* Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115 Contributed by Charles C. Richardson, April 2, 2008 (sent for review January 31, 2008) The DNA helicase encoded by bacteriophage T7 consists of six identical subunits that form a ring through which the DNA passes. Binding of ssDNA is a prior step to translocation and unwinding of DNA by the helicase. Arg-493 is located at a conserved structural motif within the interior cavity of the helicase and plays an important role in DNA binding. Replacement of Arg-493 with lysine or histidine reduces the ability of the helicase to bind DNA, hydrolyze dTTP, and unwind dsDNA. In contrast, replacement of Arg-493 with glutamine abolishes these activities, suggesting that positive charge at the position is essential. Based on the crystal- lographic structure of the helicase, Asp-468 is in the range to form a hydrogen bonding with Arg-493 on the adjacent subunit. In vivo complementation results indicate that an interaction between Asp-468 and Arg-493 is critical for a functional helicase and those residues can be swapped without losing the helicase activity. This study suggests that hydrogen bonding between Arg-493 and Asp-468 from adjacent subunits is critical for DNA binding ability of the T7 hexameric helicase. Fig. 1. Motif 4 within the central core of the hexameric gene 4 helicase. DNA replication ͉ hydrogen bonding ͉ subunit interaction ͉ Amino acid sequences of loop II and motif 4 from several DnaB-like family residue swappping helicases (T7 phage, E.
    [Show full text]