He et al. Parasites & Vectors (2018) 11:452 https://doi.org/10.1186/s13071-018-3038-7

RESEARCH Open Access The MEP pathway in Babesia orientalis apicoplast, a potential target for anti- babesiosis drug development Lan He1,2,3, Pei He1,2, Xiaoying Luo1,2, Muxiao Li1,2, Long Yu1,2, Jiaying Guo1,2, Xueyan Zhan1,2, Guan Zhu4 and Junlong Zhao1,2,3*

Abstract Background: The apicomplexan parasite Babesia orientalis, the causative agent of water buffalo babesiosis in China, is widespread in central and south China, resulting in a huge economic loss annually. Currently, there is no effective vaccine or drug against this disease. Babesia bovis and Plasmodium falciparum were reported to possess an apicoplast which contains the methylerythritol phosphate (MEP) pathway inhibitable by fosmidomycin, suggesting that the pathway could serve as a drug target for screening new drugs. However, it remains unknown in B. orientalis. Methods: Primers were designed according to the seven MEP pathway genes of Babesia microti and Babesia bovis.The genes were cloned, sequenced and analyzed. The open reading frames (ORFs) of the first two enzyme genes, 1-deoxy- D-xylulose 5-phosphate synthase (BoDXS) and 1-Deoxy-D-xylulose 5-phosphate reductoisomerase (BoDXR), were cloned into the pET-32a expression vector and expressed as a Trx-tag fusion protein. Rabbit anti-rBoDXS and rabbit anti-rBoDXR antibodies were generated. Western blot was performed to identify the native proteins of BoDXS and BoDXR in B. orientalis. Fosmidomycin and geranylgeraniol were used for inhibition assay and rescue assay, respectively, in the in vitro cultivation of B. orientalis. Results: The seven enzyme genes of the B. orientalis MEP pathway (DXS, DXR, IspD, IspE, IspF, IspG and IspH) were cloned and sequenced, with a full length of 2094, 1554, 1344, 1521, 654, 1932 and 1056 bp, respectively. BoDXS and BoDXR were expressed as Trx-tag fusion proteins, with a size of 95 and 67 kDa, respectively. Western blot identified a 77 kDa band for the native BoDXS and a 49 kDa band for the native BoDXR. The drug assay results showed that fosmidomycin could inhibit the growth of B. orientalis, and geranylgeraniol could reverse the effect of fosmidomycin. Conclusions: Babesia orientalis has the isoprenoid biosynthesis pathway, which could be a potential drug target for controlling and curing babesiosis. Considering the high price and instability of fosmidomycin, further studies should focus on the screening of stable and cheap drugs. Keywords: Babesia orientalis, Apicoplast, Isoprenoid, Methylerythritol phosphate (MEP) pathway, 1-deoxy-D- xylulose 5-phosphate reductoisomerase (DXR), Fosmidomycin

* Correspondence: [email protected] 1State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, Hubei, People’s Republic of China 2Key Laboratory for Development of Veterinary Diagnostic Products, Ministry of Agriculture, Huazhong Agricultural University, Wuhan 430070, Hubei, People’s Republic of China Full list of author information is available at the end of the article

© The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. He et al. Parasites & Vectors (2018) 11:452 Page 2 of 8

Background Babesia spp. are tick-borne intraerythrocytic proto- Many members of the Apicomplexa, including Plasmo- zoans and cause babesiosis globally. Babesia orientalis,a dium, Toxoplasma, Eimeria, Babesia and Theileria, con- recently identified species epidemic in China, causes tain a unique, relic, non-photosynthetic plastid-like water buffalo babesiosis. The parasite is transovarially organelle termed apicoplast [1]. The apicoplast is a transmitted by Rhipicephalus haemaphysaloides which is semi-autonomous organelle which normally contains a the only reported vector of B. orientalis, and water buf- 35 kbp circular genome. There are three pathways in the falo is the only reported host. As a member of the family apicoplast of Plasmodium and Toxoplasma, including Babesiidae, B. orientalis has a similar life-cycle with the methylerythritol phosphate (MEP) pathway for other babesiid species, including a sexual stage within R. isoprenoid biosynthesis, FAS pathway and heme operate. haemaphysaloides, followed by an asexual stage in water In B. bovis and Babesia microti, the isoprenoid biosyn- buffalo RBC. Babesiosis has become one of the most im- thesis MEP pathway is the only metabolic pathway in portant water buffalo diseases in central and south China the apicoplast [2, 3]. Isopentenyl diphosphate (IPP) and [11]. However, there is no commercial vaccine or drug dimethylallyl diphosphate (DMAPP) are two precursors available to cure the disease. While the MEP pathway to construct all the isoprenoids which are important for plays a critical role in the parasites and is reported to be a organisms. Isoprenoids comprise a large group of diverse potential drug target, little information is available on the intracellular metabolites with multiple cellular functions, MEP pathway in B. orientalis.Inthisstudy,weproved including roles in membrane structure, cellular respir- that B. orientalis has the MEP pathway, and fosmidomycin ation and cell signaling [4]. can inhibit the growth of B. orientalis. The results demon- In nature, there are two distinct biosynthetic routes to strate that the MEP pathway could serve as a potential produce IPP and DMAPP: methylerythritol phosphate target for screening anti-babesiosis drugs. (MEP) pathway and a modified mevalonate (MVA) path- way. The mevalonic acid (MVA) pathway was thought to Methods be the only IPP and DMAPP biosynthetic pathway for Parasites decades [5]. Mammals, including humans, use the MVA Babesia orientalis (Wuhan strain) was previously isolated pathway that initiates from mevalonate, whilst eubac- from Wuhan city, Hubei Province, China, and preserved in teria, cyanobacteria, plant chloroplasts and apicom- liquid nitrogen in the State Key Laboratory of Agricultural plexan parasites exploit the methylerythritol phosphate Microbiology, Huazhong Agricultural University, China. (MEP) pathway that starts from pyruvate [6]. Three one-year-old water buffaloes were purchased The MEP pathway is essential in eubacteria and proto- from a Babesia-free area. The buffaloes were tested by zoan but absent in humans and animals which could be the Giemsa staining and loop-mediated isothermal amplifi- hosts of eubacteria and protozoan. The MEP pathway was cation (LAMP) to confirm that they were Babesia free/ discovered in the 1990s [7]. In this pathway, the reaction of negative [12]. One water buffalo was used as a negative all the steps are catalyzed by seven different enzymes, in- control. The other two water buffaloes were splenecto- cluding 1-deoxy-D-xylulose 5-phosphate synthase (DXS), mized 2 weeks before infection, and subcutaneously 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR injected with 4 ml of B. orientalis positive blood (1% or IspC), 4-diphosphocytidyl-2C-methyl-D-erythritol cyti- parasitemia). Blood was collected when the parasitemia dylyltransferase (IspD), 4-diphosphocytidyl-2C-methyl-D-er of the infected buffaloes reached 3%. ythritol kinase (IspE), 2C-methyl-D-erythritol-2, 4-cyclodip hosphate synthase (IspF), 1-hydroxy-2-methyl-2-(E)-buteny DNA extraction l-4-diphosphate synthase (IspG) and 1-hydroxy-2-methyl- Blood from the jugular vein of experimentally infected 2-(E)-butenyl-4-diphosphate reductase (IspH) [6]. The sec- water buffaloes was collected in tubes containing EDTA ond enzyme DXR catalyzes step II of the conversion of (BD Vacutainer, USA). Genomic DNA was extracted 1-deoxy-D-xylulose 5-phosphate (DOXP) to 2-C-methyl-- from 200 μlofB. orientalis-infected blood using the D-erythritol 4-phosphate (MEP), which is a target for QIAamp DNA Mini Kit (Qiagen, Shanghai, China) accord- fosmidomycin [8]. Fosmidomycin, a broad-spectrum anti- ing to the manufacturer’s instructions. The DNA samples microbial agent showing the clinical promise of antimalarial were used immediately or stored at -20 °C until use. drug, inhibits the isoprenoid biosynthesis by suppressing the activity of P. falciparum DXR, a rate-limiting enzyme of RNA extraction and cDNA synthesis the MEP pathway, and the parasites will die for lack of iso- Total RNA was extracted from the purified B. orientalis prenoids (by blocking the conversion of DOXP to merozoites by using the TRIZOL reagent (Invitrogen, 2-C-methyl-D-erythritol 4-phosphate). Fosmidomycin is Shanghai, China) and treated with RNase-free DNaseI currently under Phase II clinical trials in combination with (TaKaRa, Dalian, China). RNA concentration was mea- clindamycin and piperaquine against malaria [8–10]. sured by Nanodrop 2000. The cDNA was prepared from He et al. Parasites & Vectors (2018) 11:452 Page 3 of 8

1 μg of the total RNA using PrimeScriptTM RT reagent per lane) were separated by 12% SDS-PAGE, transferred Kit with gDNA eraser (TaKaRa, Dalian, China) accord- onto nitrocellulose membrane (Millipore, Shanghai, China) ing to the manufacturer’s instructions. and probed separately with rabbit serum raised against rBoDXS and pre-immune serum (1:100 dilution). The Cloning of the seven enzyme genes of the MEP pathway membranes were washed with PBST, and then incubated Primer pairs for the seven enzyme genes of the B. orientalis with the secondary antibody (1:5000, goat anti-rabbit IgG MEP pathway were designed based on the gene sequences HRP, Beyotime, Shanghai, China). The expression and of B. microti and B. bovis (Table 1). Complete sequences of identification of BoDXR were conducted as previously the seven genes were amplified by conventional PCR from described for BoDXS. genomic DNA and cDNA separately. PCR products were purified and ligated into the cloning vector pDM19-T Babesia orientalis in vitro cultivation and growth (TaKaRa, Dalian, China). Three positive colonies of each inhibition assay gene were sent for sequencing. The nucleotide sequences Briefly, B. orientalis in the water buffalo erythrocytes was of the seven genes were submitted to GenBank. cultured in M199 media (Gibco Life Technologies, Shang- hai, China) supplemented with 1% Albuman I (Gibco Life Sequence analysis Technologies), 2% HB101 (Irvine Scientific, Shanghai, The amino acid sequence of BoDXR was aligned with the China), 1% L-glutamine (ATLANTA Biologicals, Shanghai, amino acid sequences from other organisms, including B. China), 2% Antibiotic/Antimycotic 100× (Corning, bovis, P. falciparum, Arabidopsis thaliana and Escherichia Shanghai, China) and 20% healthy water buffalo serum coli. The alignment was performed by using the program with 10% hematocrit (HCT) at 37 °C in a microaerophi- MAFFT v7 [13] and then edited in BioEdit. Phylogenetic lous stationary phase (5% CO2,2%O2, 93% N2). The analysis of the aligned sequences was conducted using the cultures were sub-cultured every three days when the neighbor-joining algorithm in MEGA 6 [14]. parasitemia reached 2–3%. Drug stock solutions of fosmidomycin (Sigma-Aldrich, Expression and identification of BoDXS and BoDXR Shanghai, Chain) and diminazene aceturate (Sigma-Al- The open reading frame (ORF) of BoDXS was cloned drich, Shanghai, Chain) were prepared in sterile water. into the pET-32a vector and expressed in E. coli BL21 Geranylgeraniol (Sigma-Aldrich, Shanghai, Chain) stocks (DE3). The recombinant protein was purified by affinity were prepared in 100% ethanol. For the growth inhib- purification using a Ni-charged NTA column. Antisera ition assay, B. orientalis cultures (total volume, 150 μl/ against BoDXS were raised in rabbits. well) were grown in 96-well flat-bottomed plates con- In order to identify the native DXS in B. orientalis,the taining fosmidomycin in culture media. In the rescue ex- lysates of erythrocytes prepared from B. orientalis and periments, the parasites were divided into five separate Babesia-free water buffaloes (the negative control) (0.5 mg treatment groups (5 μM fosmidomycin, 5 μM fosmido- mycin plus 5 μM geranylgeraniol, 5 μM geranylgeraniol μ μ Table 1 Primers used to amplify the seven MEP pathway plus 0.4 M diminazene aceturate, 0.4 M diminazene enzyme genes of Babesia orientalis aceturate, and 0.1% ethanol). Diminazene aceturate was Primer Sequence (5′-3′) Amplicon size (bp) used as a positive control drug and ethanol was used as a blank control. DXS-F ATGGAGTTGTGTTGTAATC 2094 During the 72 h incubation of the plates, three smears DXS-R TTAGGATGCAAGGAATTGG were prepared from each well and the parasitemias were DXR-F ATGAATGCAGCAGTGAGTTTTTATG gDNA 1554 determined every 24 h by microscopy. Thin blood DXR-R TTAGTATGTGAAGCATTAATATATGTGATAG cDNA 1371 smears were air-dried, fixed with methanol, and stained IspD-F ATGTCTGTCTGGTTGGTGCAATG 1344 with Giemsa (Sigma-Aldrich, Shanghai, China) according ’ IspD-R TCACGGGAAGTATACCTCTTTTAG to the manufacturer s instructions. The cultures were prepared in triplicate. The data were analyzed by Graph- IspE-F ATGAGGCATCTCCATGTGTG 1521 Pad Prism 5 by one-way analysis of variance (ANOVA) IspE-R TCAAGAGATTAGGTCTGGAAGAAG followed by Turkey’s multiple comparison test. Error IspF-F ATGTTACTACGTTATCTTTCTATAACAG 654 bars represent standard deviations. IspF-F TTATAAAGGATATTACTTGAGCTTC IspG-F ATGACATCGTCAGACACCTTTG 1932 Results and discussion IspG-R TCACATGCTTCCACATCTGG Characterization of the enzyme genes According to the reported genome sequences of B. bovis IspH-F ATGGAGGAAAGACCGTTTACC 1056 and B. microti, the genomes encode all the seven com- IspH-R TTATGTAGTTTTCCAGATTCCTATAATCG ponents of the isoprenoid pathway, suggesting that the He et al. Parasites & Vectors (2018) 11:452 Page 4 of 8

parasites have the MEP pathway [3, 15]. In this study, Characterization of native BoDXS and BoDXR the seven enzyme genes of the B. orientalis MEP path- The initial enzyme DXS and the rate-limited enzyme way were amplified from both gDNA and cDNA and se- DXR are the most important enzymes of the MEP path- quenced. The full lengths of DXS, DXR, IspD, IspE, IspF, way. 1-deoxy-D-xylulose 5-phosphate (DOXP), the prod- IspG and IspH were 2094, 1554, 1344, 1521, 654, 1932 uct of DXS, also participates in thiamine (vitamin B1) and 1056 bp, respectively (Fig. 1). These results indicated biosynthesis and/or pyridoxine (B6) synthesis [16, 17], that all seven genes of the MEP pathway exist in the indicating that DXS is not a committed member of the genome of B. orientalis. The nucleotide sequences of the MEP pathway. However, DXS is the first enzyme of the DXS, DXR, IspD, IspE, IspF, IspG and IspH were submit- MEP pathway, and it catalyzes pyruvate and glyceraldehyde- ted to the GenBank database under the accession num- s-3-phosphate to DOXP in the apicoplast of apicomplexan bers MH429606, MH429607, MH429608, MH448076, parasites. The second enzyme DXR, which is considered as MH429609, MH429610 and MH429611, respectively. the first committed enzyme of the MEP pathway, synthe- BoDXS is intronless, encoding 667 aa with a predicted size sizes 2-C-methyl-D-erythritol 4-phosphate (MEP) by intra- of 77 kDa. BoDXR contains a 184 bp intron because the se- molecular rearrangement and reduction of DOXP [17]. quence obtained from cDNA is shorter than that of gDNA. For biochemical characterization of BoDXS and ItistheonlyintrongeneinB. orientalis MEP pathway. BoDXR enzymes, the corresponding genes were BoDXR ORF is 1371 bp long, encoding 456 aa with a pre- over-expressed in E. coli and purified by Ni-NTA affinity dicted size of 49 kDa. The amino acid sequence of BoDXR chromatography. The purified rBoDXS and rBoDXR re- was aligned with the sequences of B. bovis (XP_001612194), vealed the two bands of 95 and 67 kDa on 10% Plasmodium falciparum (AAD03739), Arabidopsis thaliana SDS-PAGE, including an additional 18 kDa Trx-tag (NP_201085) and Escherichia coli (EGT67209) (Fig. 2). The (Fig. 3). Antibodies were generated in rabbit for detecting results indicated that DXR is highly conserved between the native BoDXS and BoDXR. After the reaction of the these organisms and most close to B. bovis. For a better un- rabbit anti-rBoDXS serum and rabbit anti-rBoDXR serum derstanding of BoDXR and its homologs from related api- with B. orientalis lysates, the specific bands of 77 and 49 complexans, a neighbor-joining tree was constructed. The kDa were yielded, but not in the reaction with the lysates results showed that BoDXR was most closely related to of the healthy bovine erythrocytes or pre-immune rabbit DXR from B. bovis. Sequence analysis indicated that BoDXR serum (Fig. 4). The results indicated that B. orientalis contains a NADB Rossmann superfamily domain and two contains the native enzymes DXS and DXR. DOXP redisom C superfamily domains. The NADB domain is found in numerous dehydrogenases of metabolic path- Fosmidomycin inhibits the growth of B. orientalis ways, and it is responsible for specifically binding a substrate The isoprenoid biosynthesis pathway generates isopren- and catalyzing the enzyme reaction. The DOXP redisom C oid precursors, and it is a promising chemotherapeutic domain is the DXR C-terminus, which is also found in the target due to the difference between mammals and api- DXR enzyme of bacteria and plants. It catalyzes the forma- complexan parasites in the seven enzymes of this path- tion of 2-C-methyl-D-erythritol 4-phosphate (MEP) from way [8]. To date, the best characterized inhibitor of the 1-deoxy-D-xylulose-5-phosphate (DOXP) in the pres- MEP pathway in parasites is the phosphonic acid anti- ence of NADPH. biotic fosmidomycin, a potential inhibitor of DXR by

Fig. 1 PCR amplification of the seven enzymes of the B. orientalis MEP pathway. Lane M; marker. Lanes 1, 3, 5, 7, 9, 11 and 13 were amplified from B. orientalis DNA. Lane 1: BoDXS; Lane 3: BoDXR; Lane 5: BoIspD; Lane 7: BoIspE; Lane 9: BoIspF; Lane 11: BoIspG; Lane 13: BoIspH. Lanes 2, 4, 6, 8, 10, 12 and 14 were amplified from B. orientalis cDNA, respectively. Lane 2: BoDXS; Lane 4: BoDXR; Lane 6 BoIspD; Lane 8: BoIspE; Lane 10: BoIspF; Lane 12: BoIspG; Lane 14: BoIspH He et al. Parasites & Vectors (2018) 11:452 Page 5 of 8

Fig. 2 Multiple alignment and phylogenetic analysis of DXR amino acid sequence of DXR. a Multiple alignment of DXR aa sequences. Bo, Babesia orientalis;Bb,Babesia bovis (XP_001612194); Pf, Plasmodium falciparum (AAD03739); At, Arabidopsis thaliana (NP_201085); Ec, Escherichia coli (EGT67209). Similar and identical residues are shaded. Black shading indicates a similarity in four or more than four species; gray shading indicates a similarityin three species. b Neighbor-joining phylogenetic tree based on DXR aa sequences. Organism names and sequence accession numbers are indicated

Fig. 3 Expression and purification of rBoDXS and rBoDXR stained by coomassie brilliant blue. Lane M: molecular size marker; Lane 1: uninduced pET-32a-BoDXS; Lane 2: induced pET-32a-BoDXS; Lane 3: uninduced pET-32a-BoDXR; Lane 4: induced pET-32a-BoDXR; Lane 5: purified recombinant BoDXS fused with Trx-tag; Lane 6: purified recombinant BoDXR fused with Trx-tag He et al. Parasites & Vectors (2018) 11:452 Page 6 of 8

Fig. 4 Identification of native BoDXS and BoDXR enzymes in B. orientalis merozoite lysates. a Identification of native BoDXS. Lysates of B. orientalis- infected water buffalo erythrocytes and lysates of uninfected water buffalo erythrocytes were both probed with the serum from rabbit immunized with rBoDXS (Lane 1 and Lane 3, respectively) and the pre-immune rabbit serum (Lane 2 and Lane 4, respectively). b Identification of native BoDXR. Lysates of B. orientalis-infected water buffalo erythrocytes and lysates of uninfected water buffalo erythrocytes were both probed with the serum from rabbit immunized with rBoDXR (Lane 1 and Lane 3, respectively) and the pre-immune rabbit serum (Lane 2 and Lane 4, respectively)

blocking the conversion of DOXP to 2-C-methyl-D-ery- parasitemias were examined by Giemsa staining and thritol 4-phosphate [18]. Fosmidomycin is under Phase light microscopy every 24 h. The results indicated that II clinical trials as a potential antimalarial chemothera- fosmidomycin was effective in inhibition of B. orientalis peutic agent in combination with clindamycin and growth after 24 h (Fig. 5), which is consistent with previ- piperaquine [8, 10]. The parasite Babesia is similar to ous studies in Babesia bovis and Plasmodium falciparum Plasmodium in many aspects, and fosmidomycin was [8, 15]. We found that both fosmidomycin and dimin- reported to be able to inhibit the intracellular growth of azene aceturate exhibited anti-babesiosis activity at 48 B. divergens at pharmacologically relevant concentra- h and 72 h. The relative growth of fosmidomycin and tions [19]. However, there is no report about the inhib- negative controls were significant different at 48 h ition of B. orientalis growth by fosmidomycin. (ANOVA, F(3, 8) = 23.07, P =0.0015)and72htreat- In the present study, B. orientalis was cultured and ment (ANOVA, F(3, 8) = 73.21, P < 0.0001). However, treated separately with 5 μM fosmidomycin, 5 μM fos- there was no notable difference between fosmidomy- midomycin plus 5 μM geranylgeraniol, 5 μM geranylger- cin plus geranylgeraniol and control groups (both aniol plus 0.4 μM diminazene aceturate, 0.4 μM negative control and 0.1% ethanol) (Fig. 6). The diminazene aceturate, and 0.1% ethanol. Diminazene effects of fosmidomycin were reversed by medium aceturate was used as a positive drug control. Ethanol supplemented with a downstream isoprenol geranyl- was used as a control because geranylgeraniol was geraniol, confirming that they are specific to isopren- soluble in ethanol (treated concentration 0.1%). The oid blockade.

Fig. 5 Fosmidomycin and geranylgeraniol treated parasites arrest during in vitro cultivation of B. orientalis. The parasites were treated separately with fosmidomycin (FSM), fosmidomycin plus geranylgeraniol (GG-ol), diminazene aceturate (DA), diminazene aceturate plus geranylgeraniol, and ethanol (control). Negative control without any treatment was also included. The parasitemias were determined by Giemsa staining every 24 h. PPE, percent parasitized erythrocytes He et al. Parasites & Vectors (2018) 11:452 Page 7 of 8

Fig. 6 Efficacy of fosmidomycin on the growth of B. orientalis. In vitro cultured B. orientalis were treated separately with fosmidomycin (FSM), fosmidomycin plus geranylgeraniol (GG-ol), diminazene aceturate (DA), and diminazene aceturate plus geranylgeraniol. The growth of parasites was evaluated every 24 h for each treatment. 0.1% ethanol was used as the control. *P < 0.05, **P < 0.01, ***P < 0.001

Plasmodium falciparum was reported to utilize the potential drug target for screening anti-babesiosis drugs. non-mevalonate isoprenoid biosynthesis in the apico- Further research should focus on the biological function plast which is essential to the parasites [8, 20, 21]. Our of the MEP pathway in B. orientalis and the screening of previous work demonstrated that B. orientalis contains new drugs using the E. coli model due to its identical iso- an apicoplast with a 34 kpb circular genome [22], but prenoid biosynthesis pathway with apicomplexan parasites whether the isoprenoid biosynthesis pathway exists in and easiness in manipulation. this parasite remains unknown. In this study, the inhibi- tory effect of fosmidomycin and the rescue effect of Abbreviations DMAPP: Dimethylallyl diphosphate; DOXP: 1-deoxy-D-xylulose 5-phosphate; geranylgeraniol on B. orientalis indicated the presence of DXR or IspC: 1-deoxy-D-xylulose 5-phosphate reductoisomerase; DXS: 1-deoxy- the substrate of this pathway, further suggesting that the D-xylulose 5-phosphate synthase; IPP: Isopentenyl diphosphate; IspD: 4- MEP pathway is functional and required for the intraery- diphosphocytidyl-2C-methyl-D-erythritol cytidylyltransferase; IspE: 4-diphosphocytidyl- 2C-methyl-D-erythritol kinase; IspF: 2C-methyl-D-erythritol-2, 4-cyclodiphosphate syn- throcytic growth of B. orientalis merozoites, which is thase; IspG: 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase; similar to that of B. bovis and P. falciparum [15, 21]. IspH: 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate reductase; MEP The effectiveness of fosmidomycin may be attributed to pathway: Methylerythritol phosphate pathway; MEP: 2-C-methyl-D-erythritol 4- phosphate (methylerythritol phosphate); MVA: Pathway: mevalonate pathway the presence of a new permeability pathway of erythro- cytes, which allows the transport of fosmidomycin across Funding the cell membrane to effectively inhibit the growth of This work was supported by the National Natural Science Foundation of apicomplexan parasites including Plasmodium and China (31772729), the National Basic Science Research Program (973 program) of China (2015CB150302), the National Key Research and Development program of Babesia which reside within erythrocytes [19, 23]. The China (2017YFD0501201), the Natural Science Foundation of Hubei Province MEP pathway was also reported in Theileria parva, but (2017CFA020). fosmidomycin showed no inhibitory effect even at a high μ Availability of data and materials concentration of 400 M[24]. All data were included as tables and figures within the article. The nucleotide sequences generated during this study were submitted to the GenBank under Conclusions the accession numbers MH429606-MH429611. In the present study, we cloned and sequenced the seven Authors’ contributions enzyme genes of the MEP pathway in B. orientalis.The LH and JZ designed the study and revised the manuscript. LH wrote the native proteins of BoDXS and BoDXR were also identified, draft of the manuscript. LH, PH, XL, ML, LY, JG and XZ performed the which demonstrated that the parasite contains the initial experiments and analyzed the results. All authors read and approved the final manuscript. enzyme and the rate-limited enzyme of the MEP pathway. Additionally, the growth of B. orientalis could be inhibited Ethics approval by fosmidomycin while the effects of fosmidomycin could This study was approved by the Scientific Ethic Committee of Huazhong be reversed by medium supplemented with geranylgera- Agricultural University (permit number HZAUCA-2017-005). All water buffaloes were handled in accordance with the regulations of the Standing Committee of niol. These results indicated the existence of the isopren- Hubei People’s Congress and the Animal Ethics Procedures and Guidelines of P. oid biosynthesis pathway in B. orientalis, which could be a R. China. He et al. Parasites & Vectors (2018) 11:452 Page 8 of 8

Consent for publication encoding enzymes of the methylerythritol phosphate pathway. Biochem Not applicable. Biophys Res Commun. 2003;307:408–15. 18. Kuzuyama T, Shimizu T, Takahashi S, Seto H. Fosmidomycin, a specific Competing interests inhibitor of 1-deoxy-d-xylulose 5-phosphate reductoisomerase in the The authors declare that they have no competing interests. nonmevalonate pathway for terpenoid biosynthesis. Tetrahedron Lett. 1998; 39:7913–6. 19. Baumeister S, Wiesner J, Reichenberg A, Hintz M, Bietz S, Harb OS, et al. Publisher’sNote Fosmidomycin uptake into Plasmodium and Babesia-infected erythrocytes is Springer Nature remains neutral with regard to jurisdictional claims in facilitated by parasite-induced new permeability pathways. PLoS One. 2011; published maps and institutional affiliations. 6:e19334. 20. Odom AR, Van Voorhis WC. Functional genetic analysis of the Plasmodium falciparum Author details deoxyxylulose 5-phosphate reductoisomerase gene. Mol – 1State Key Laboratory of Agricultural Microbiology, College of Veterinary Biochem Parasitol. 2010;170:108 11. ’ Medicine, Huazhong Agricultural University, Wuhan 430070, Hubei, People’s 21. Cassera MB, Gozzo FC, D Alexandri FL, Merino EF, del Portillo HA, Peres VJ, Republic of China. 2Key Laboratory for Development of Veterinary Diagnostic et al. The methylerythritol phosphate pathway is functionally active in all Plasmodium falciparum Products, Ministry of Agriculture, Huazhong Agricultural University, Wuhan intraerythrocytic stages of . J Biol Chem. 2004;279: – 430070, Hubei, People’s Republic of China. 3Key Laboratory of Preventive 51749 59. Veterinary Medicine in Hubei Province, The Cooperative Innovation Center 22. Huang Y, He L, Hu J, He P, He J, Yu L, et al. Characterization and annotation Babesia orientalis for Sustainable Pig Production, Wuhan 430070, Hubei, China. 4Department of of apicoplast genome. Parasit Vectors. 2015;8:543. Veterinary Pathobiology, College of Veterinary Medicine & Biomedical 23. Kirk K. Membrane transport in the malaria-infected erythrocyte. Physiol Rev. – Sciences, Texas A&M University, College Station, Texas, USA. 2001;81:495 537. 24. Lizundia R, Werling D, Langsley G, Ralph SA. Theileria apicoplast as a target – Received: 8 March 2018 Accepted: 24 July 2018 for chemotherapy. Antimicrob Agents Chemother. 2009;53:1213 7.

References 1. Lau AO, McElwain TF, Brayton KA, Knowles DP, Roalson EH. Babesia bovis:a comprehensive phylogenetic analysis of plastid-encoded genes supports green algal origin of apicoplasts. Exp Parasitol. 2009;123:236–43. 2. Brayton KA, Lau AO, Herndon DR, Hannick L, Kappmeyer LS, Berens SJ, et al. Genome sequence of Babesia bovis and comparative analysis of apicomplexan hemoprotozoa. PLoS Pathog. 2007;3:1401–13. 3. Cornillot E, Hadj-Kaddour K, Dassouli A, Noel B, Ranwez V, Vacherie B, et al. Sequencing of the smallest apicomplexan genome from the human pathogen Babesia microti. Nucleic Acids Res. 2012;40:9102–14. 4. Gershenzon J, Dudareva N. The function of terpene natural products in the natural world. Nat Chem Biol. 2007;3:408–14. 5. Bloch K. Sterol molecule: structure, biosynthesis, and function. Steroids. 1992;57:378–83. 6. Hunter WN. Isoprenoid precursor biosynthesis offers potential targets for drug discovery against diseases caused by apicomplexan parasites. Curr Top Med Chem. 2011;11:2048–59. 7. Rohmer M, Knani M, Simonin P, Sutter B, Sahm H. Isoprenoid biosynthesis in bacteria: a novel pathway for the early steps leading to isopentenyl diphosphate. Biochem J. 1993;295:517–24. 8. Jomaa H, Wiesner J, Sanderbrand S, Altincicek B, Weidemeyer C, Hintz M, et al. Inhibitors of the nonmevalonate pathway of isoprenoid biosynthesis as antimalarial drugs. Science. 1999;285:1573–6. 9. Olliaro P, Wells TN. The global portfolio of new antimalarial medicines under development. Clin Pharmacol Ther. 2009;85:584–95. 10. Anthony MP, Burrows JN, Duparc S, Moehrle JJ, Wells TN. The global pipeline of new medicines for the control and elimination of malaria. Malar J. 2012;11:316. 11. He L, Liu Q, Yao B, Zhou Y, Hu M, Fang R, et al. A historical overview of research on Babesia orientalis, a protozoan parasite infecting water buffalo. Front Microbiol. 2017;8:1323. 12. He L, Zhou YQ, Oosthuizen MC, Zhao JL. Loop-mediated isothermal amplification (LAMP) detection of Babesia orientalis in water buffalo (Bubalus babalis Linnaeus, 1758) in China. Vet Parasitol. 2009;165:36–40. 13. Katoh K, Standley DM. A simple method to control over-alignment in the MAFFT multiple sequence alignment program. Bioinformatics. 2016;32: 1933–42. 14. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol. 2013;30:2725–9. 15. Caballero MC, Pedroni MJ, Palmer GH, Suarez CE, Davitt C, Lau AO. Characterization of acyl carrier protein and LytB in Babesia bovis apicoplast. Mol Biochem Parasitol. 2012;181:125–33. 16. Imlay L, Odom AR. Isoprenoid metabolism in apicomplexan parasites. Curr Clin Microbiol Rep. 2014;1:37–50. 17. Sauret-Gueto S, Ramos-Valdivia A, Ibanez E, Boronat A, Rodriguez- Concepcion M. Identification of lethal mutations in Escherichia coli genes