Open Full Page

Published OnlineFirst July 7, 2014; DOI: 10.1158/1078-0432.CCR-13-3397

Clinical Cancer Cancer Therapy: Preclinical Research

BCMab1, A Monoclonal Antibody against Aberrantly Glycosylated Integrin a3b1, Has Potent Antitumor Activity of Bladder Cancer In Vivo

Chong Li, Zhao Yang, Ying Du, Haidong Tang, Jun Chen, Deqing Hu, and Zusen Fan

Abstract Purpose: To identify a novel biomarker for bladder cancer targeting therapy. Experimental Design: The human bladder cancer cell line T24 cells were used as immunogen to generate mouse monoclonal antibodies. We screened and identified a specific antibody BCMab1 against bladder cancer. We examined BCMab1 antigen expression in the patients with bladder cancer through immunohistochemical staining and investigated the BCMab1 antigen association with clinical severity. We detected the antitumor activity of BCMab1 antibody and investigated its therapeutic efficacy by subcutaneous and orthotopic bladder cancer models. Results: We developed a new monoclonal antibody BCMab1 against bladder cancer that specifically recognized the aberrantly glycosylated Integrin a3b1 epitope on bladder cancer cells. Expression of the BCMab1 antigen was consistent with clinical severity and prognosis of bladder cancer. The glycosyltransferase GALNT1 could contribute to aberrant glycosylation of Integrin a3. The aberrant glycosylation of integrin a3–activated integrin signaling to initiate FAK activation. BCMab1 could block Integrin engage- ment to inhibit its signaling leading to cell-cycle arrest. In addition, BCMab1 enhanced FcgR-dependent antitumor activity in vivo. Conclusions: BCMab1 antigen is a new biomarker for bladder cancer. BCMab1 antibody exhibited potent antitumor activity against bladder cancer in vivo. Clin Cancer Res; 1–13. 2014 AACR.

Introduction Integrins are a large family of cell membrane receptors Bladder cancer is a common malignancy that is more involved in important processes such as cell proliferation, prevalent in developed countries (1, 2). Of note, 70% of migration, and cell extracellular matrix (ECM) adhesion bladder cancers are superficial at initial presentation, lim- (6). They consist of noncovalently bound a and b subunits, ited to the mucosa, submucosa, or lamina propria, and 30% in which various combinations produce polymorphisms of of patients are muscle-invasive (3). Superficial tumors are ligand-binding specificity (7). The Integrin a3b1 serves as a usually treated by surgical resection and intravescical che- high-affinity receptor for laminin, fibronectin, and collagen motherapy. However, approximately 70% of these patients (8). The Integrin a3b1–deficient mice died during the will recur and as many as 10% to 30% will progress to neonatal period that indicates that it has a vital role in the invasive cancers after treatment (4). The difficulty in man- formation of several organ systems (9). The cell adhesion aging bladder cancer is inability to predict which tumors mediated by the interaction between the Integrin a3b1 and will recur or progress (5). New therapeutic approaches are its ligands plays key roles in a variety of physiologically likely to come from an improved understanding of the important processes in organogenesis and in maintenance molecular basis of this cancer. of epithelial tissues. Altered glycosylation on Integrin a3b1 is associated with tissue invasion and metastasis in many types of cancers (10). It was reported that Integrin a3b1 is differently glycosylated in bladder tumor and normal cell lines (11). Cell Authors' Affiliation: CAS Key Laboratory of Infection and Immunity, Institute of Biophysics, Chinese Academy of Sciences, Beijing, China adhesion to ECM proteins is strongly modulated by their glycosylation (11). Recent studies showed that aberrant Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/). glycosylation has been implicated in tumorigenesis of some tumor types (12, 13). Here, we generated a new monoclonal Corresponding Author: Zusen Fan, CAS Key Laboratory of Infection and Immunity, Institute of Biophysics, Chinese Academy of Sciences, 15 Datun antibody (mAb) BCMab1 against bladder cancer that spe- Road, Room 1611, Beijing 100101, China. Phone: 86-10-6488-8457; Fax: cifically recognized the aberrantly glycosylated Integrin 86-10-6487-1293; E-mail: [email protected] a3b1 epitope on bladder cancer cells. And we investigated doi: 10.1158/1078-0432.CCR-13-3397 the therapeutic activity of BCMab1 and its antitumor 2014 American Association for Cancer Research. mechanisms for bladder cancer.

www.aacrjournals.org OF1

Li et al.

GCTTTTTA-30 (sense); 50-AGCTTAAAAAGCTACATGATT- Translational Relevance CAGCGCAATCTCTTGAATTGCGCTGAATCATGTAGCGG- BCMab1 antigen, the aberrantly glycosylated Integrin G-30 (antisence). For Integrin b1: 50-GATCCCCGCTGAA- a3b1, is a new biomarker for bladder cancer that has the GACTATCCCATTGTTCAAGAGACAATGGGATAGTCTTC- characteristics of high specificity so far. It is consistent AGCTTTTTA-30 (sense); 50-AGCTTAAAAAGTGAAGA- with clinical severity and prognosis. GALNT1 could CTATCCCATTGTCTCTTGAACAATGGGATAGTCTTCAGC- confer the aberrant glycosylation of Integrin a3b1on GGG-30 (antisence). For GALNT1: 50-GATCCCCC- bladder cancer. BCMab1 or BCMab1-Ra exhibits potent AGTACAAAAGCCTCATGTTCAAGAGACATGAGGCTTTTG- therapeutic efficacy for bladder cancer. TACTGGTTTTTA-30 (sense); 50-AGCTTAAAAACCAGTAC- AAAAGCCTCATGTCTCTTGAACTGAGGCTTTTGTACTGG- GGG-30(antisence). Corresponding scrambled sequences served as controls (shCtrl). T24 cells were transfected by Materials and Methods using Lipofectamin 2000 (Invitrogen) as described by the manufacturer’s instruction. Integrin a3, b1 and GALNT1- Primary antibodies silenced cells were selected with puromycin (Sigma). Scram- The primary antibodies were goat anti-human Integrin bled sequences vectors transfected cells were used as a3 (Santa Cruz Biotechnology; N-19) for immunoblotting, controls. mouse anti-human Integrin a3 (Santa Cruz Biotechnology; P1B5) for fluorescence staining, mouse anti-human Integ- Animal experiments rin b1 (Santa Cruz Biotechnology; 12G10), rabbit anti- Female 6-week-old BALB/c nude mice with a body weight human cyclin D1 (CST; 92G2), rabbit anti-human CDK4 of approximately 15 g were used and kept under specific (CST; D9G3E), rabbit anti-human c-Jun (CST; 60A8), phos- pathogen-free conditions. Xenografts of T24 cells (include pho–c-Jun (Ser63; CST; 54B3), phospho–c-Jun (Ser73; CST; wide-type cells, shInta3- or shGALNT1-silenced cells) were D47G9), rabbit anti-human FAK (CST; D2R2E), phospho- produced by injecting tumor cells (1 106 resuspended in FAK (Tyr397; CST; D20B1), NKp46 (CD335) antibody PBS) subcutaneously into the back of mice. When tumors (R&D Systems; AF2225), PE-NKp46 (CD335) antibody reached a diameter of 3 to 5 mm, the mice transplanted (eBioscience; 29A1.4), and isotype-matched IgG (Sigma). wide-type cells were grouped (10 mice/group) and admin- Mouse mAb BCMab1 was purified through protein A- istered intraperitoneally BCMab1 or mIgG at a dose of 10 Sepharose from ascites. Corresponding species–specific mg/kg, three times per week for 35 days. Tumor size was horseradish peroxidase (HRP)–biotinylated (Pierce), or measured twice per week. For the orthotopic nude mouse fluorescein isothiocyanate (FITC)–conjugated secondary model, T24 cells were labeled with luciferase and trans- antibodies (Sigma) were used. planted into the murine bladder cavity via 24-gauge angio- catheters (15). The mice were grouped (24 mice/group) and Cells, tissues, and animals intravesically applied with BCMab1 or mIgG at a dose of 1 Bladder cancer T24 cells and normal bladder HCV29 mg/kg next day. Images were obtained by the in vivo image cells were from the Peking University Health Science system (IVIS) at 5, 10, 15, 20, 25, and 30 days after Center (Beijing, China). Cell lines EJ, 5637, J82, SW780, transplantation. The photon counts of each mouse are HepG2, LoVo, 293, A375, Jurkat, PC-1, MCF-7, K562, indicated by the pseudo-color scales. HeLa, and other cell lines, were obtained from the American Type Culture Collection. Human bladder can- Generation of BCMab1-Ra cer tissues and normal human tissues were obtained The immunotoxin BCMab1-Ra was constructed by from the Second Affiliated Hospital of Kunming Medical linking ricin A chain (Ra) to BCMab1 via the hetero-bifunc- College (Kunming, China) with informed consent, tional crosslinker N-succinimidyl 3-(2-pyridyldithio) according to the Institutional Review Board (IRB)– propionate (SPDP). Indirect immunofluorescence, FACS approved protocol (Kunming IRB# 14). BALB/c normal analysis, and competition binding assay showed that the miceandnudemicewereobtainedfromtheAnimal binding activity of the antibody in this immunotoxin was Center of the Chinese Academy of Medical Science (Beij- 95% of the original activity. Cell culture experiments had ing, China). shown BCMab1-Ra to be an exceptionally effective biologic agent that was capable of killing bladder carcinoma cell Silencing of Integrin a3b1 and GALNT1 lines (T24). The RNA sequence against Integrin a3, b1, and GALNT1 (N-acetylgalactosaminyltransferase type 1) for RNAi was Antibody-dependent cell phagocytosis designed on the basis of pSUPER system instructions (Oli- Macrophages, generated from normal human peripheral þ goengine) and cloned into pSUPER-puro that expresses 19 blood mononuclear cells (PBMC). Briefly, CD14 cells were nt hairpin-type short hairpin RNA (shRNA) with a 9 nt loop. purified from PBMC by the EasySep Human Monocyte Integrin a3, b1, and GALNT1 shRNA–encoding sequences Enrichment Kit without CD16 depletion (STEMCELL Tech- þ were as follows: For Integrin a3: 50-GATCCCCGCTACAT- nologies). Purified CD14 monocytes were cultured in GATTCAGCGCAATTCAAGAGATTGCG CTGAATCATGTA- macrophage colony-stimulating factor (Peprotech) at 50

OF2 Clin Cancer Res; 2014 Clinical Cancer Research

BCMab1 Has Antitumor Activity to Bladder Cancer

ng/mL for 10 to 14 days in a humidified incubator. Cultured several bladder tumor cell lines and found that BCMab1 macrophages were detached and plated in flat 96-well plates stained positive on the human bladder cancer cells such as (50,000 cells/well) at 37C. Carboxyfluorescein succinimi- T24, EJ, 5637, J82, and SW780, but not on the nonmalig- dyl ester (CFSE)–stained target cells were incubated with nant ureter epithelium cell line HCV29 or on other tumor antibodies for up to 1 hour on ice. After washing, the cells (Fig. 1A and B; Supplementary Table S1). To investigate different cell solutions were added to the culture plates the specificity of BCMab1 for bladder cancer, we screened containing macrophages at a ratio of 5:1 (target cells: 123 human tumor tissues and 56 normal tissues by immu- macrophages). Then, the culture plates were incubated for nohistochemistry. BCMab1 only positively stained the 2 hours at 37C. The phagocytic index was calculated as the bladder cancer tissues, but not normal bladder tissues or number of CFSE-positive cells per 100 macrophages. other normal tissues, including liver, brain, adrenal gland, pancreas, stomach, colon, breast, lung, ovary, cardiac mus- Antibody-dependent cell cytotoxicity cle, thyroid, lymph node, and bone marrow (Fig. 1C; Natural killer (NK) cells were isolated from purified Supplementary Table S1 and data not shown). Therefore, PBMCs using positive or negative NK cell isolation kits the BCMab1-recognized antigen was truly localized to the (Miltenyi Biotec) and activated by 100 U IL2. Target cells membrane and a tumor-specific antigen for bladder cancer. were harvested and incubated in media with or without the indicated antibodies (2 mg/mL) for 60 minutes on ice. Expression of the BCMab1 epitope is consistent with Then NK cells were washed, diluted in ADCC medium, and clinical severity and prognosis of bladder cancer dispensed together with the antibody-coated target cells at To further investigate whether the BCMab1 epitope is varying effector/target cell ratios. Experiments were per- associated with clinical severity, we examined its expression formed in triplicate. After incubation, TO-PRO-3 dye and in the patients with bladder cancer through immunohisto- counting beads (Invitrogen) were added, and cells were chemical staining. The intensity of BCMab1 immunostain- analyzed for membrane permeabilization using flow ing was scored as follows: 1þ, weak; 2þ, moderate; and 3þ, cytometry. intense. Because tumors showed heterogeneous staining, the dominant pattern was used for scoring. The scores Statistical analysis indicating the percentage of positive tumor cells and stain- The relationship between the staining levels of BCMab1 ing intensity were multiplied to produce a weighed score for antigen and various clinicopathologic factors was analyzed each case. Cases with weighed scores <1 were defined as using the c2 or the Kruskal–Wallis test. Kaplan–Meier negative; cases with weighed scores >2 were defined as analysis was used to estimate the cumulative cause–specific strongly positive; and those in between were defined as survival rate, and the log-rank test was used to correlate positive. We detected bladder tumor tissues from biopsies differences in patient survival with staining intensity of with classification of grade (G1–3) and stage (T1–4) among BCMab1 antigen. The influence of BCMab1 on the growth 69 patients with bladder cancer. Low grades G1–G2 and low of bladder cancers was analyzed by the Student t test. In all stages Ta–T1 were weakly stained (Fig. 2A; Supplementary statistical analyses, P value of 0.05 or less was considered to Table S2). Severe patients with high-grade G3 and high indicate statistical significance in the two-sided test. stages T3–T4 showed intense staining of BCMab1. Normal bladder tissues were not stained as a negative control. The Study approval expression levels of BCMab1 epitope correlated with path- All animal studies were permitted by the Institutional ologic grades and tumor stages of bladder cancers. Animal Care and Use Committee of the Institute of Bio- We analyzed the relationship between expression of the physics, Chinese Academy of Sciences and were conducted BCMab1 epitope and clinicopathologic features in patients in compliance with its recommendations. All human stud- with bladder cancer. The histologically high grade, deeply ies were reviewed and approved by the IRB of Institute of invasive, and lymphatic invasive bladder cancers demon- Biophysics, Chinese Academy of Sciences, and written strated significantly higher expression of the BCMab1 epi- informed consent was provided according to the World tope than the low-grade, superficial, and nonlymphatic Medical Association Declaration of Helsinki. invasive cancers (Supplementary Table S2). To further determine the association between the BCMab1 epitope Results expression and prognosis, we completed 80-month follow- Generation and specificity of the mAb BCMab1 up of the above 69 patients with bladder cancer with radical The human bladder cancer cell line T24 cells were used as cystectomy. Intriguingly, the patients with high expression immunogen to generate mouse monoclonal antibodies. of the BCMab1 epitope had significantly worse prognosis Approximately 312 hybridomas were screened for clones than patients with low expression (P ¼ 0.0036; Fig. 2B). producing antibodies that bound to the cell surfaces of T24 cells and bladder tumor tissues, but not normal bladder BCMab1 or BCMab1-Ra inhibits tumor growth in tissues and other non-bladder cancer cell lines. From this subcutaneous and orthotopic bladder cancer models screen, 11 clones were selected for further characterization. BCMab1-Ra was generated by conjugation of BCMab1 The hybridoma clone BCMab1 was detected to produce an with the Ra chain as an immunotoxin. The Ra is a toxic agent IgG1 antibody that satisfied best the criterion. We checked to kill target cells. BCMab1-Ra was able to suppress

www.aacrjournals.org Clin Cancer Res; 2014 OF3

Li et al.

Figure 1. Speciﬁc recognition of the BCMab1 antibody to cancerous lines and tissues of bladder cancer. A and B, BCMab1 recognized its antigen on the bladder cancer cell line T24 cells, but not on the normal bladder cell line HCV29 by immunoﬂuorescence and immunohistochemistry assays. C, BCMab1 recognized its antigen on the bladder cancer tissue, but not on the normal bladder mucosa tissue (immunohistochemistry).

proliferation and growth of human bladder cancer cell lines 5637, J82, and SW780 (data not shown). We repeated these in vitro (data not shown). To determine the anticancerous experiments by using primary tumor cells from five bladder effect of BCMab1 in vivo, we generated xenografted tumor tumor samples. Expectedly, the BCMab1 and BCMab1-Ra models by subcutaneously injecting T24 cells into the back exhibited potent therapeutic efficacy against primary blad- of BALB/c nude mice. When tumors reached a size of 0.3 to der tumor cells (Supplementary Fig. S1). 0.5 cm in diameter, BCMab1, BCMab1-Ra, or control mIgG To detect the anticancerous action of BCMab1 in situ,we was injected intraperitoneally into mice, three times per established an orthotopic bladder cancer mouse model by week. After treatment, the sizes of tumors were significantly using luciferase-labeled T24 cells. Luciferase-labeled cells (1 reduced in BCMab1-treated groups and -treated mice pro- 106) were implanted into murine bladder cavity. Bladder moted their survival compared with mice treated with cancers were apparent in all of the implanted mice by control mIgG (Fig. 3A). At the end of our experiments detection of high bioluminescence with an IVIS. The mice (40 days), the inhibition rates of both groups were more were grouped (24 mice/group) and intravescically applied than 70%. Notably, BCMab1-Ra treatment almost elimi- with purified BCMab1, BCMab1-Ra, or control mIgG at a nated tumors in mice bearing T24 cells (Fig. 3A), and their dose of 1 mg/kg next day (Fig. 3B). Intravescical adminis- survival was similar to normal mice. Similar results were tration of BCMab1 was able to suppress bladder tumor obtained by using other bladder cancer cell lines such as EJ, growth and prolong the survival rate of T24 tumor-bearing

OF4 Clin Cancer Res; 2014 Clinical Cancer Research

BCMab1 Has Antitumor Activity to Bladder Cancer

Figure 2. Expression of the BCMab1 epitope is consistent with clinical severity and prognosis of patients with bladder cancer. A, the expression level of the BCMab1 epitope is in agreement with clinical severity. Serial sections of bladder cancer biopsies were stained with BCMab1 by immunohistochemistry analysis. Normal bladder biopsy from a healthy person was not stained with BCMab1. B, relationship between the expressions of BCMab1 epitope and clinicopathologic features in radical-cystectomy patients. The patients with high expressions of the BCMab1 epitope had signiﬁcantly worse prognosis than those with low expressions of the BCMab1 epitope (P ¼ 0.0036); n, patient number.

mice compared with mice in the mIgG-treated control no tumor cells were observed by immunohistochemistry group (P < 0.01; Fig. 3B). Interestingly, BCMab1-Ra was (data not shown). However, tumors were apparent in able to prevent cancerous growth in orthotopic bladder mIgG-treated mouse bladders and confirmed by histologic cancer mouse models and these mice lived as long as staining (Fig. 3C, left). The mucosal surfaces of these normal mice (Fig. 3B). Similar treatment efficacy was BCMab1- or BCMab1-Ra–treated murine bladders did not observed by using other bladder cancer cell lines or primary show apparent injury (Fig. 3C, right). There were no differ- tumor cells from bladder cancer samples (data not shown). ences microscopically in the noncancerous bladder mucosa In the course of these experiments, we did not observe any among the BCMab1- or BCMab1-Ra–treated and –untreat- toxic effect associated with administration of BCMab1 or ed normal mice. Taken together, BCMab1 inhibited the BCMab1-Ra. No metastasis was found in the BCMab1- or growth of bladder cancers in vivo, and some of the mice BCMab1-Ra–treated group by histopathologic analysis. showed complete eradication of the cancer cells without any Therefore, BCMab1 or BCMab1-Ra is a potent cytotoxic severe adverse effects. BCMab1-Ra treatment could eradi- agent against bladder cancer. cate bladder cancer cells and showed no side effect in the We surveyed 25 sections from each murine bladder to course of our observations. examine whether bladder cancers existed in the mice. Blad- der cancers were apparent in all of the mice in which we BCMab1 recognizes a new aberrantly glycosylated observed with high bioluminescence by IVIS. At day 25 of Integrin a3 epitope and GALNT1 knockdown reduces treatment, no apparent tumors were observed in BCMab1- glycosylation of Integrin a3 treated murine bladders (Fig. 3C, middle). Only few cancer To identify the BCMab1 antigen, T24 cell extracts were cells were detectable in the T24 cell implanted locations applied to affinity chromatography with BCMab1 and sep- with immunohistochemical staining and hematoxyline and arated by gel filtration. Two peaks (I and II) were obtained eosin (H&E) counterstaining. With BCMab1-Ra treatment, through eluting with 500 mmol/L NaCl (Supplementary

www.aacrjournals.org Clin Cancer Res; 2014 OF5

Li et al.

Figure 3. BCMab1 or BCMab1-Ra suppresses cancerous growth in xenograft and orthotopic bladder cancer models. A, BCMab1 or BCMab1-Ra inhibits cancerous growth in xenograft bladder cancer mice. T24 cells were subcutaneously injected into nude mice. When tumors reached a diameter of 3 to 5 mm, the mice were grouped (10 mice/group) and administered intraperitoneally BCMab1 or BCMab1-Ra at a dose of 10 mg/kg, three times per week for 5 weeks. mIgG was used as a control. Comparison of the survival curves between treatment with BCMab1 or BCMab1-Ra and mIgG control is shown at right. , p < 0.01. B, cancerous inhibition by BCMab1 or BCMab1-Ra was confirmed in orthotopic bladder cancer mice. Images were obtained by IVIS at 5, 10, 15, 20, and 25 days after luciferase-labeled T24 cell transplantation (left). The photon counts of each mouse are indicated by pseudo-color scales. The mice were grouped (24 mice/group) and intravescically applied with BCMab1, BCMab1-Ra, or mIgG at a dose of 1 mg/kg next day. The growth curves of orthotopic tumors were measured by IVIS (middle). Comparison of the survival curves between treatment with BCMab1 or BCMab1-Ra and mIgG control (right). , p < 0.01. C, intravescical BCMab1 or BCMab1-Ra successfully inhibits tumor growth verified by immunohistochemical staining and H&E counterstaining. At day 25 of treatment, tumors were removed for histology examination. No tumor cells were found in BCMab1-Ra–treated mice (data not shown). Original magnification was 400.

Fig. S2A). Each peak fraction was concentrated and resolved weights of the a3 and b1 subunits of Integrin bound to by SDS–PAGE followed by silver staining. Peaks I and II BCMab1 were bigger than their theoretically predicted showed 4 and 2 bands, respectively (Supplementary molecular weights (118 kDa for a3 subunit and 88 kDa Fig. S2B). All the bands were hydrolyzed and analyzed by for b1 subunit). We proposed that Integrin a3b1 recognized mass spectrometry (Supplementary Table S3). The lower by BCMab1 is glycosylated in bladder cancer. two bands of peaks I and II were identiﬁed as the heavy and To characterize the oligosaccharides of the glycosylated light chains of the BCMab1. The upper two bands of the Integrin a3b1 epitope recognized by BCMab1, we per- peak I (around 130 and 100 kDa) were identiﬁed as the a3 formed a glycan chip assay against BCMab1. The carbo- and b1 subunits of Integrin, respectively. The molecular hydrate composition of oligosaccharides that reacted

OF6 Clin Cancer Res; 2014 Clinical Cancer Research

BCMab1 Has Antitumor Activity to Bladder Cancer

positively with BCMab1 was [3OSO3]Galb1-4(Fuca1-3)[ formation of T24 cells compared with shCtrl cells (Fig. 4B). 6OSO3]GlcNAc (Supplementary Fig. S2C and Supple- We examined other functional properties of Integrin a3– or mentary Table S4). Furthermore, we silenced expression GALNT1-silenced T24 cells. We found that Integrin a3or of the a3orb1 subunit via pSUPER–shIntegrin a3or GALNT1 silencing significantly decreased cell attachment pSUPER–shIntegrin b1 transfection. Integrin a3– or b1 to laminin (Fig. 4C). Wound-healing assay showed sim- subunit–silenced T24 cells were selected by puromycin and ilar results (Fig. 4D). Silenced Integrin a3orGALNT1 stable clones were established. The a3- or b1 subunit– expression significantly inhibited subcutaneous tumor silenced T24 cells were stained with BCMab1 antibody growth compared with the control groups by injection followed by FACS analysis. BCMab1 stained negative in the of shCtrl cells (Supplementary Fig. S3). At the end of a3-silenced T24 cells (Supplementary Fig. S2D), whereas it observation course (35 days), the inhibitory rates of still stained shCtrl cells. However, BCMab1 still stained the cancerous growth for Integrin a3 or GALNT1 knockdown Integrin b1–silenced T24 cells (Supplementary Fig. S2D). were 53% and 42%, respectively. We repeated these The murine IgG (mIgG) was used as a negative staining experiments by using EJ and 5637 cells and got similar control. These results verify that the BCMab1 epitope on observations (data not shown). Integrin a3b1 is localized on the a3 subunit. We screened a prostatic cancer cell line LNCaP, which To identify the glycosyltransferase responsible for gly- lacked Integrin a3b1 expression (Supplementary Fig. S4A). cosylation of the Integrin a3b1, we performed DNA GALNT1-silenced LNCaP cells were established by puro- microarray assay on bladder tumor tissues of patients mycin selection (Supplementary Fig. S4B). We observed and normal bladder tissues. The mRNA samples were that GALNT1 knockdown had no effect on attachment, extracted from 10 patients with early-stage tumor and transmigration, colony formation, and wound healing 10 normal bladder tissues obtained from bladder biopsy. (Supplementary Fig. S4C–S4F). Thus, we conclude that Microarray analysis revealed that GALNT1 mRNA in GALNT1 is involved in the modification of aberrantly bladder tumor tissues was 11.2-fold higher than in nor- glycosylated integrin a3b1 in bladder cancer. mal bladder tissues (Supplementary Table S5). However, other GALNTs (GALNT2–9) and all the fucosyltrans- Aberrant glycosylation of Integrin a3b1 activates ferases (FUT 1–10) had no significant changes in bladder Integrin signaling that is inhibited by BCMab1 tumor tissues compared with normal bladder tissues treatment (Supplementary Tables S5 and S6). The mRNA expression We used a transcription activator–like effector nucleases levels of the a3andb1 subunits were not markedly (TALEN) approach to delete Integrina3 in T24 cells or changeable in bladder tumor tissues and normal bladder HCV29 cells (Supplementary Fig. S5) (Ref. 40). In Integri- þ þ tissues. To further confirm this result, we used several na3 / T24 cells, GALNT1 knockdown extremely decreased bladder cancer cell lines such as T24, EJ, and 5637 cells for BCMab1 staining signal compared with that of shCtrl cells RNAi-silencing verification. Consistently, only GALNT1 (Fig. 5A, left). However, GALNT1 knockdown had no effect knockdown impaired BCMab1 staining on T24 cells on the total Integrin a3 level. In contrast, Integrina3 / T24 (Supplementary Fig. S2E and S2F). Similar results were cells, BCMab1 antibody stained negative, and GALNT1 obtained in EJ or 5637 cells (data not shown). knockdown still remained negative for BCMab1 staining þ þ GALNT1 expression in T24 cells was knocked down (Fig. 5B, left). Importantly, in Integrina3 / HCV29 cells, through transfection by pSUPER–shGALNT1 vector. GALNT1 overexpression dramatically increased BCMab1 GALNT1-silenced stable T24 cells were established by staining signal compared with that of empty vector trans- puromycin selection (Supplementary Fig. S2G). GALNT1 fected HCV29 cells (Fig. 5C, left). However, in Integrina3 / was silenced over 80%. GALNT1 knockdown extremely HCV29 cells, GALNT1 overexpression did not increase decreased the BCMab1 staining signal compared with BCMab1 antibody staining signal (Fig. 5D, left). shCtrl cells (Supplementary Fig. S2H, left). We carried In T24 cells, BCMab1 could precipitate much more Talin1 out a competitive inhibition test by using the GALNT1 and Kindin2 (Fig. 5E), which are two adaptor proteins to substrate benzyl-N-acetyl-D-galactosaminide (BG). BG represent active Integrin signaling. However, GALNT1- treatment remarkably reduced the BCMab1 staining (Sup- silenced T24 cells had dramatically decreased the two pro- plementary Fig. S2H, right). mIgG was used as a negative tein levels. Notably, a glycosylation-insensitive antibody staining control. We silenced GALNT1 in EJ or 5637 cells (Santa Cruz Biotechnology; N-19) precipitated equal levels and obtained similar results (data not shown). These of total Integrin a3 (Fig. 5E). We further wanted to examine results indicate that the GALNT1 might cause the aberrant the BCMab1 antitumor signaling. Surprisingly, BCMab1 glycosylation of Integrin a3b1 in bladder cancer. treatment restrained phosphorylation of FAK and c-Jun in T24 cells (Fig. 5E). Consequently, the cyclin D1 and cyclin- Integrin a3 or GALNT1 knockdown inhibits cancerous dependent kinase-4 (CDK4) were also reduced after proliferation, migration, and tumor growth BCMab1 treatment. We examined the effect of the BCMab1 Integrin a3 or GALNT1 knockdown markedly reduced on cell cycle of bladder cancer cells. BCMab1 treatment 3 incorporation of [ H]-thymidine into DNA of T24 cells at all arrested cell-cycle progression at G1–S phase (Fig. 5G). time points compared with shCtrl cells (Fig. 4A). Integrin Similar results were obtained by using EJ and 5637 cells a3 or GALNT1 knockdown significantly decreased colony (data not shown).

www.aacrjournals.org Clin Cancer Res; 2014 OF7

Li et al.

Figure 4. Integrin a3 or GALNT1 knockdown inhibits cancerous proliferation, migration, and tumor growth. A, integrin a3 or GALNT1 silencing inhibited T24 cell proliferation. Integrin a3– or GALNT1-silenced T24 cells or BCMab1 (10 mg/ml)-treated T24 cells were cultured from 24 to 72 hours followed by incubation with [3H]-thymidine for 4 hours. Data are representative of at least three separate experiments. B, integrin a3 or GALNT1 silencing or BCMab1 treatment suppressed anchorage-independent growth through soft agar colony formation assay. C, integrin a3 or GALNT1 knockdown or BCMab1 treatment decreased tumor ECM adhesion compared with those of controls; , P < 0.01. D, integrin a3 or GALNT1 knockdown or BCMab1 treatment reduced migration was veriﬁed through wound-healing experiments; , P < 0.01.

BCMab1 confers Fc-FcgR–dependent antitumor dent cell cytotoxicity, ADCC) of bladder cancer cells in vitro. activity by macrophages and NK cells Expectedly, BCMab1 conferred ADCP of both T24 cells and Antibody-mediated antitumor activity in vivo can be primary human bladder cancer cells in the presence of augmented by crosslinking with FcgR-expressing effector mouse or human macrophages (Fig. 6D and data not cells (16, 17). We next assessed the roles of NK cells and shown). In addition, BCMab1 also exhibited ADCC of both macrophages, two major cell types capable of conferring T24 cells and primary human bladder cancer cells (Fig. 6E). FcgR-dependent antitumor effects, for BCMab1 therapeutic Blockade of FcgR almost abolished such activities. Actually, activity. First, we determined the relative abundance of these BCMab1 antibody per se had no effect on macrophage cell types in tumor tissues harvested from BCMab1- or phagocytosis or NK cell cytotoxicity (Fig. 6D and data not control mIgG–treated mice. We found that macrophages shown). þ þ (F4/80 cells) and NK cells (NKp46 cells) constituted the To further confirm the role of ADCC in BCMab1-medi- vast majority of FcgR-expressing cells in BCMab1-treated ated cytoreductive activity, we detected NK cell activity tumors (Fig. 6A and B). These data indicate that treatment inside tumors with BCMab1 treatment. Expectedly, with BCMab1 significantly increased tumor macrophage tumor-inside NK cells with BCMab1 treatment exhibited and NK cell infiltration. To confirm these observations, we better killing activity against T24 cells than those of mIgG depleted macrophages or NK cells in nude mice bearing treatment (Supplementary Fig. S6A). Similar results were established T24 cells by using clodronate liposomes or anti- obtained by using patient with bladder cancer samples asialo GM1 antibody, respectively. We observed that mac- (Supplementary Fig. S6B). Moreover, tumor-inside NK cells rophage or NK cell depletion dramatically attenuated with BCMab1 treatment significantly increased perforin BCMab1 antitumor activities in mice bearing T24 cells or expression and IFNg production compared with those of primary bladder tumor cells from patient samples (Fig. 6C). mIgG treatment (Supplementary Fig. S6C and S6D). Col- We next investigated BCMab1 ability to mediate Fc-FcgR– lectively, macrophage-mediated ADCP and NK cell–medi- dependent macrophage phagocytosis (antibody-dependent ated ADCC are involved in BCMab1 therapeutic activity cell phagocytosis, ADCP) or NK cell lysis (antibody-depen- against bladder cancer.

OF8 Clin Cancer Res; 2014 Clinical Cancer Research

BCMab1 Has Antitumor Activity to Bladder Cancer

Figure 5. Aberrant glycosylation of integrin a3 can activate integrin signaling and BCMab1 can counteract this activity. A, GALNT1 þ þ knockdown of Integrin a3 / T24 cells was stained with BCMab1 and P1B5 antibodies. P1B5 is a glycosylation-insensitive antibody against integrin a3. B, integrin a3 was deleted in T24 cells by TALEN approach. GALNT1 knockdown of integrin a3 / T24 cells was stained by BCMab1 and P1B5 antibody. C, GALNT1 þ þ overexpression of integrin a3 / HCV29 cells was stained by BCMab1 and P1B5 antibodies. D, integrin a3 was deleted in HCV29 cells by TALEN approach. GALNT1 overexpression of Integrin a3 / HCV29 cells was stained by BCMab1 and P1B5 antibody. E, coimmunoprecipitation of total integrin a3, Talin1, and Kindlin2 in shCtrl- or GALNT1-silenced cells. T24 cell lysates were precipitated by total integrin a3 antibody (N-19). The immunoprecipitates were probed with Talin1, Kindlin2, or BCMab1 antibodies. N-19 is a glycosylation-insensitive antibody of integrin a3 for immunoblotting. F, BCMab1 treatment represses phosphorylation of FAK and c-Jun and reduces cyclin D1 and CDK4 expression. T24 cells were preincubated with BCMab1 or control mIgG before adhesion to laminin for 30 minutes. Cell lysates were immunoblotted with antibodies against phospho-FAK (Tyr397) or phospho–c-Jun (Ser63 and Ser73). Blots were stripped and reprobed for total FAK and c- Jun. b-Actin was used as a loading control. G, BCMab1 treatment arrests cell-cycle progression. T24 cells were incubated with BCMab1 (10 mg/mL) and analyzed by ﬂow cytometry using propidium iodide (PI) staining. mIgG was used as a negative control.

Discussion and progression also depend on two extrinsic processes Bladdercancerisstillamajor epidemiologic problem that interact with stromal elements and adjoining cells, in which incidence continues toriseeachyear.Increasing harboring angiogenesis and tumor cell invasion. Here, we evidence showed tumorigenesis of bladder cancer con- generated a new mAb BCMab1, which speciﬁcally reacted tributes to alterations in molecular pathways that mod- to the aberrantly glycosylated Integrin a3b1onbladder ulate cellular homeostasis (18, 19). Major cellular pro- cancer cells. The BCMab1 epitope was localized to the cesses are comprised of ﬁve intrinsic processes that aberrantly glycosylated subunit a3ofIntegrina3b1. respond to external carcinogenic signals or become inter- Glycosyltransferase GALNT1 was highly expressed in nally deregulated owing to genetic changes, including bladder cancer that may contribute to the aberrant gly- cell-cycle regulation, cell death, cell growth, signal trans- cosylation of Integrin a3. Silenced Integrin a3or duction, and gene regulation (19). Tumor maintenance GALNT1 expression suppressed cancerous proliferation, migration and tumor growth in vitro and in vivo.The

www.aacrjournals.org Clin Cancer Res; 2014 OF9

Li et al.

Figure 6. BCMab1 confers Fc-FcgR–dependent antitumor activity through both macrophages and NK cells. A and B, immunohistochemical quantitation of F4/ þ 80 macrophages (A) or NKp46 NK cells (B) in tumor tissues of mice bearing established T24 tumors treated with control mIgG or BCMab1. Graphs, mean F4/ þ þ 80 and NKp46 cells in tumor areas, respectively; , P < 0.01. C, depletion of macrophages or NK cells attenuates antitumor activity in vivo. Tumor growth in macrophage or NK cell depleted nude mice bearing established tumors from T24 cells (left) or primary human bladder cancer cells (right) treated with BCMab1 or control mIgG; , P < 0.01. D, BCMab1 enhances macrophage-mediated ADCP of T24 cells (left) and primary human bladder cancer cells (right) in the presence of human macrophages; ND, not detectable; , P < 0.01. E, BCMab1 promotes NK cell–mediated ADCC of T24 cells (left) and primary human bladder cancer cells (right) in the presence of IL2-activated human NK cells. Graphs, speciﬁc lysis against target cells following treatment with BCMab1, control mIgG, or FcgR blockade; , P < 0.01. Patient primary tumor cells represent at least four bladder cancer samples.

aberrantly glycosylated Integrin a3b1 expression was able treatment inhibited cancerous growth in vivo.Moreover, to activate Integrin signaling, which might contribute to the BCMab1 epitope was consistent with clinical severity tumorigenesis of bladder cancer. BCMab1 or BCMab1-Ra and prognosis of bladder cancers.

OF10 Clin Cancer Res; 2014 Clinical Cancer Research

BCMab1 Has Antitumor Activity to Bladder Cancer

Integrins play central roles in controlling cell adhesion to We found that the aberrantly glycosylated Integrin a3b1 the ECM, cell migration, growth, survival, differentiation could activate Integrin signaling. In T24 cells, the aberrantly and apoptosis (20). Integrins are heterodimers of trans- glycosylated Integrin a 3b1 precipitated much more active membrane a and b subunits, which bind to their cognate adaptor proteins such as Talin1 and Kindlin2. However, in extracellular ligands, such as fibronectin, fibrinogen and normal HCV29 cells, the active adaptor proteins were not collagen (21, 22). Integrin signaling regulates adhesion- detectable. GALNT1 silencing impaired the aberrant glyco- dependent growth, survival migration and invasion of sylation of Integrin a3b1, leading to disassociation of the tumor cells (23). Integrin a3b1 was firstly identified as a active adaptor proteins. Furthermore, Integrin a3or receptor for collagen, laminin-1, fibronectin and entactin GALNT1 depletion significantly inhibited FAK signaling. (8). Mice deficient in Integrin a3b1 died during the neo- We propose that the aberrant glycosylation of Integrin natal period (9). It indicates Integrin a3b1 plays a critical a3b1 might change the conformation of Integrin hetero- role in the formation of vital organs. Ghosh and colleagues dimers that initiates Integrin activation. Therefore, the showed that decreased Integrin a3b1 expression was con- aberrantly glycosylated Integrin a3b1 might aberrantly sistent with low invasive behavior of tumors (24). Several activate Integrin signaling to integrate a malignant signal reports showed that Integrin a3b1 is involved in progres- for cell transformation. sion, cell migration, adhesion, metastasis and invasiveness Orthotopic xenografts of human bladder cancer are con- in bladder cancer (25, 26, 27). sidered as the best model for the evaluation of new thera- DNA microarray showed that the expression level of peutic approaches. Noninvasive bioluminescence imaging Integrin a3orb1 subunit was not significantly changed in has turned out to be an excellent technique for the longi- bladder cancer tissues compared with the normal bladder tudinal surveillance of tumor development and detection of tissues. However, the glycosyltransferase GALNT1 in the extravesical tumor spread or metastasis at an early stage bladder tissues was expressed 11-fold higher than the (39). Using luciferase-labeled T24 cells, we established an normal bladder tissues. Here, we revealed that GALNT1 animal model of human orthotopic bladder cancer for the might be responsible for the aberrantly glycosylated noninvasive monitoring of tumor development and ther- Integrin a3b1ofbladdercancer.Protein–sugar linkage apeutic efficacy. The orthotopic bladder tumor models between N-acetylgalactosamine (GalNAc) and Thr or Ser more closely mimic the behavior of human bladder cancer. residues is catalyzed by members of the UDP-GalNAc Here, we showed that the intravesical application of polypeptide: N-acetylgalactosaminyltransferase (GALNT) BCMab1 or BCMab1-Ra at different time points after instil- family (28, 29). Most of the GALNT isoforms show both lation of bladder tumor cells was highly efficient in pre- unique and overlapping substrate specificities (30). Car- venting tumor growth in the bladder. We labeled other bohydrate chip analysis showed a putative oligosaccha- bladder cancer cell lines and primary tumor cells from ride for the glycosylated Integrin a3 recognized by patients with bladder cancer for these therapeutic experi- BCMab1. A report demonstrated that the 237 mAb rec- ments and obtained similar antitumor activity. Local deliv- ognized aberrantly glycosylated OTS8 of the Ag104A ery of BCMab1 or BCMab1-Ra can avoid many problems fibrosarcoma cell with an altered monosaccharide as a compared with systemic therapy, such as: (i) absorption by neoepitope, which was transformed into a tumor-specific the mononuclear phagocyte system (mainly in the liver and antigen (31). This glycopeptidic epitope raised a high- spleen) during antibody catabolism; (ii) only a small affinity, highly specific, syngeneic mAb with antitumor amount of antibodies reaching the inside tumor; (iii) local- activity. Qualitative and quantitative alterations in O- and ization of antibodies in normal organs and formation of N-glycosylation in Integrins are consistent features of malig- human anti-mouse antibodies for clinical applications. nancies (32). Integrins promote various adhesion-depen- BCMab1 suppressed the aberrantly glycosylated integrin dent effects in tumor cells, including proliferation, survival, a3b1–mediated integrin signaling. Blockade of integrin migration, and invasion through focal adhesion kinase signaling inactivated FAK signaling leading to cell-cycle (FAK) signaling cascades (33–34, 35). FAK phosphorylation arrest. Besides inhibition of cell-cycle progression, BCMab1 is considered to be one of the initial steps that allows could enhance FcgR-dependent in vivo antitumor activity. binding of Src and Fyn for further phosphorylation leading Both macrophages and NK cells participated in eradication to signaling cascade (14, 36–38). The Integrin a3b1is of tumor cells of bladder cancer. These data imply that differently glycosylated in bladder cancer and control cell BCMab1 will be a potent drug for clinical therapy. Notably, lines (11). Cell adhesion to ECM proteins is strongly mod- BCMab1-Ra was a conjugate of BCMab1 with the Ra chain ulated by their glycosylation. We found that silenced Integ- as an immunotoxin. The Ra is a toxic agent to efficiently kill rin a3 or GALNT1 expression suppressed cancerous prolif- target cells. BCMab1-Ra could prevent cancerous growth eration, migration, and tumor growth in vitro and in vivo. more effectively than that of BCMab1. In the course of our Blockade of Integrin a3b1 signaling by BCMab1 also inhib- experiments, we did not observe any toxic effects associated ited cancerous proliferation and tumor growth. BCMab1 with administration of BCMab1-Ra. No metastasis was treatment mostly blocked FAK phosphorylation, conse- found in the BCMab1-Ra–treated group by histopathologic quently reduced c-Jun phosphorylation, which decreases analysis. BCMab1-Ra treatment showed to be safe and cyclin D1 and CDK4 expression resulting in inhibition of tolerable in vivo. Taken together, BCMab1 or BCMab1-Ra proliferation and cell cycle. may become a potent antitumor drug for treatment of

www.aacrjournals.org Clin Cancer Res; 2014 OF11

Li et al.

bladder cancer. The BCMab1 epitope might serve as a novel- Acknowledgments speciﬁc biomarker for diagnosis and prediction of progno- The authors thank R. Yan and J. Hao for their help for human bladder tumor sections. The authors thank Drs. Yangxin Fu and Andre Veillette for sis as well as a new potential molecular target for treatment critical reading of this article. of bladder cancer.

Disclosure of Potential Conﬂicts of Interest No potential conﬂicts of interest were disclosed. Grant Support This work was supported by the State Projects of Essential Drug Research Authors' Contributions and Development (2012ZX09103301-041), the National Natural Science Conception and design: C. Li, Z. Fan Foundation of China (81330047, 81071704, 30830030, and 30972676), Development of methodology: C. Li, Z. Fan 973 program (2010CB911902), and the Innovative programs of Chinese Acquisition of data (provided animals, acquired and managed patients, Academy of Sciences (KSCX1-YW-22 and XDA01010407). provided facilities, etc.): C. Li, Z. Yang, Y. Du, H. Tang, D. Hu, Z. Fan The costs of publication of this article were defrayed in part by the Analysis and interpretation of data (e.g., statistical analysis, biosta- payment of page charges. This article must therefore be hereby marked tistics, computational analysis): C. Li, Z. Yang, Z. Fan advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate Writing, review, and/or revision of the manuscript: C. Li, H. Tang, Z. Fan this fact. Administrative, technical, or material support (i.e., reporting or orga- nizing data, constructing databases): C. Li, Y. Du, J. Chen, Z. Fan Received December 21, 2013; revised April 14, 2014; accepted May 11, Study supervision: C. Li, Z. Fan 2014; published OnlineFirst July 7, 2014.

References 1. Gingrich JR. Bladder cancer: chemohyperthermia for bladder can- 18. Platt FM, Hurst CD, Taylor CF, Gregory WM, Harnden P, Knowles MA. cer—clinically effective? Nat Rev Urol 2011;8:414–6. Spectrum of phosphatidylinositol 3-kinase pathway gene alterations in 2. Soloway MS. Bladder cancer: lack of progress in bladder cancer— bladder cancer. Clin Cancer Res 2009;15:6008–17. what are the obstacles? Nat Rev Urol 2013;10:5–6. 19. Mitra AP, Cote RJ. Molecular pathogenesis and diagnostics of bladder 3. Gallagher DJ, Milowsky MI. Bladder cancer. Curr Treat Options Oncol cancer. Annu Rev Pathol 2009;4:251–85. 2009;10:205–15. 20. Wolfenson H, Lavelin I, Geiger B. Dynamic regulation of the structure 4. de Braud F, Maffezzini M, Vitale V, Bruzzi P, Gatta G, Hendry WF, et al. and functions of integrin adhesions. Dev Cell 2013;24:447–58. Bladder cancer. Crit Rev Oncol Hematol 2002;41:89–106. 21. Kim C, Schmidt T, Cho EG, Ye F, Ulmer TS, Ginsberg MH. Basic amino- 5. Kaufman DS, Shipley WU, Feldman AS. Bladder cancer. Lancet acid side chains regulate transmembrane integrin signalling. Nature 2009;374:239–49. 2012;481:209–13. 6. Jung I, Messing E. Molecular mechanisms and pathways in bladder 22. Jean C, Gravelle P, Fournie JJ, Laurent G. Influence of stress on cancer development and progression. Cancer Control 2000;7:325–34. extracellular matrix and integrin biology. Oncogene 2011;30: 7. Hood JD, Cheresh DA. Role of integrins in cell invasion and migration. 2697–706. Nat Rev Cancer 2002;2:91–100. 23. Morello V, Cabodi S, Sigismund S, Camacho-Leal MP, Repetto D, 8. Kreidberg JA. Functions of alpha3beta1 integrin. Curr Opin Cell Biol Volante M, et al. beta1 integrin controls EGFR signaling and tumor- 2000;12:548–53. igenic properties of lung cancer cells. Oncogene 2011;30:4087–96. 9. Kreidberg JA, Donovan MJ, Goldstein SL, Rennke H, Shepherd K, 24. Ghosh S, Johnson JJ, Sen R, Mukhopadhyay S, Liu Y, Zhang F, et al. Jones RC, et al. Alpha 3 beta 1 integrin has a crucial role in kidney and Functional relevance of urinary-type plasminogen activator receptor- lung organogenesis. Development 1996;122:3537–47. alpha3beta1 integrin association in proteinase regulatory pathways. 10. Kremser ME, Przybylo M, Hoja-Lukowicz D, Pochec E, Amoresano A, J Biol Chem 2006;281:13021–9. Carpentieri A, et al. Characterisation of alpha3beta1 and alpha(v)beta3 25. Pochec E, Litynska A, Bubka M, Amoresano A, Casbarra A. Charac- integrin N-oligosaccharides in metastatic melanoma WM9 and terization of the oligosaccharide component of alpha3beta1 integrin WM239 cell lines. Biochim Biophys Acta 2008;1780:1421–31. from human bladder carcinoma cell line T24 and its role in adhesion 11. Litynska A, Przybylo M, Ksiazek D, Laidler P. Differences of alpha3- and migration. Eur J Cell Biol 2006;85:47–57. beta1 integrin glycans from different human bladder cell lines. Acta 26. Mitsuzuka K, Handa K, Satoh M, Arai Y, Hakomori S. A specific Biochim Pol 2000;47:427–34. microdomain ("glycosynapse 3") controls phenotypic conversion and 12. Brooks CL, Schietinger A, Borisova SN, Kufer P, Okon M, Hirama T, reversion of bladder cancer cells through GM3-mediated interaction of et al. Antibody recognition of a unique tumor-specific glycopeptide alpha3beta1 integrin with CD9. J Biol Chem 2005;280:35545–53. antigen. Proc Natl Acad Sci U S A 2010;107:10056–61. 27. Laidler P, Gil D, Pituch-Noworolska A, Ciolczyk D, Ksiazek D, Przybylo 13. Park JH, Nishidate T, Kijima K, Ohashi T, Takegawa K, Fujikane T, et al. M, et al. Expression of beta1-integrins and N-cadherin in bladder Critical roles of mucin 1 glycosylation by transactivated polypeptide N- cancer and melanoma cell lines. Acta Biochim Pol 2000;47:1159–70. acetylgalactosaminyltransferase 6 in mammary carcinogenesis. Can- 28. Guda K, Moinova H, He J, Jamison O, Ravi L, Natale L, et al. Inactivat- cer Res 2010;70:2759–69. ing germ-line and somatic mutations in polypeptide N-acetylgalacto- 14. Huang J, Zheng DL, Qin FS, Cheng N, Chen H, Wan BB, et al. Genetic saminyltransferase 12 in human colon cancers. Proc Natl Acad Sci U S and epigenetic silencing of SCARA5 may contribute to human hepa- A 2009;106:12921–5. tocellular carcinoma by activating FAK signaling. J Clin Invest 29. Kahai S, Lee SC, Lee DY, Yang J, Li M, Wang CH, et al. MicroRNA miR- 2010;120:223–41. 378 regulates nephronectin expression modulating osteoblast differ- 15. Li C, Yan R, Bao J, Yuan G, Feng Y, Wang J, et al. Characterization of a entiation by targeting GalNT-7. PLoS ONE 2009;4:e7535. novel transplantable orthotopic murine xenograft model of a human 30. Miwa HE, Gerken TA, Jamison O, Tabak LA. Isoform-specificO- bladder transitional cell tumor (BIU-87). Cancer Biol Ther 2006;5: glycosylation of osteopontin and bone sialoprotein by polypeptide 394–8. N-acetylgalactosaminyltransferase-1. J Biol Chem 2010;285: 16. Wilson NS, Yang B, Yang A, Loeser S, Marsters S, Lawrence D, et al. An 1208–19. Fcgamma receptor-dependent mechanism drives antibody-mediated 31. Schietinger A, Philip M, Yoshida BA, Azadi P, Liu H, Meredith SC, et al. target-receptor signaling in cancer cells. Cancer Cell 2011;19:101–13. A mutant chaperone converts a wild-type protein into a tumor-specific 17. Clynes RA, Towers TL, Presta LG, Ravetch JV. Inhibitory Fc receptors antigen. Science 2006;314:304–8. modulate in vivo cytotoxicity against tumor targets. Nat Med 32. Paszkiewicz-Gadek A, Porowska H, Lemancewicz D, Wolczynski S, 2000;6:443–6. Gindzienski A. The influence of N- and O-glycosylation inhibitors on the

OF12 Clin Cancer Res; 2014 Clinical Cancer Research

BCMab1 Has Antitumor Activity to Bladder Cancer

glycosylation profile of cellular membrane proteins and adhesive functions and their consequences for tumor cell behavior. Cancer Res properties of carcinoma cell lines. Int J Mol Med 2006;17:669–74. 2005;65:1335–42. 33. Pylayeva Y, Gillen KM, Gerald W, Beggs HE, Reichardt LF, Giancotti 37. Desgrosellier JS, Barnes LA, Shields DJ, Huang M, Lau SK, Prevost N, FG. Ras- and PI3K-dependent breast tumorigenesis in mice and Tarin D, et al. An integrin alpha(v)beta(3)-c-Src oncogenic unit pro- humans requires focal adhesion kinase signaling. J Clin Invest motes anchorage-independence and tumor progression. Nat Med 2009;119:252–66. 2009;15:1163–9. 34. Lahlou H, Sanguin-Gendreau V, Zuo D, Cardiff RD, McLean GW, Frame 38. Kostic A, Sheetz MP. Fibronectin rigidity response through Fyn and MC, et al. Mammary epithelial-specific disruption of the focal adhesion p130Cas recruitment to the leading edge. Mol Biol Cell 2006;17:2684– kinase blocks mammary tumor progression. Proc Natl Acad Sci U S A 95. 2007;104:20302–7. 39. Nogawa M, Yuasa T, Kimura S, Tanaka M, Kuroda J, Sato K, et al. 35. Bianchi-Smiraglia A, Paesante S, Bakin AV. Integrin beta5 contributes Intravesical administration of small interfering RNA targeting PLK-1 to the tumorigenic potential of breast cancer cells through the Src-FAK successfully prevents the growth of bladder cancer. J Clin Invest and MEK-ERK signaling pathways. Oncogene 2013;32:3049–58. 2005;115:978–85. 36. Brunton VG, Avizienyte E, Fincham VJ, Serrels B, Metcalf CA, Sawyer 40. Zhang F1, Cong L, Lodato S, Kosuri S, Church GM, Arlotta P. Efficient TK, et al. Identification of Src-specific phosphorylation site on focal construction of sequence-specific TAL effectors for modulating mam- adhesion kinase: dissection of the role of Src SH2 and catalytic malian transcription. Nat Biotechnol 2011;29:149–53.

www.aacrjournals.org Clin Cancer Res; 2014 OF13

BCMab1, A Monoclonal Antibody against Aberrantly Glycosylated Integrin α3β1, Has Potent Antitumor Activity of Bladder Cancer In Vivo

Chong Li, Zhao Yang, Ying Du, et al.

Clin Cancer Res Published OnlineFirst July 7, 2014.

Updated version Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-13-3397

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2015/07/17/1078-0432.CCR-13-3397.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/early/2014/07/03/1078-0432.CCR-13-3397. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.