DOCSLIB.ORG

Mechanisms, Regulation and Functions of the Unfolded Protein Response

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mechanisms, Regulation and Functions of the Unfolded Protein Response REVIEWS Mechanisms, regulation and functions of the unfolded protein response Claudio Hetz 1,2,3,4 ✉ , Kezhong Zhang 5,6 ✉ and Randal J. Kaufman 7 ✉ Abstract | Cellular stress induced by the abnormal accumulation of unfolded or misfolded proteins at the endoplasmic reticulum (ER) is emerging as a possible driver of human diseases, including cancer, diabetes, obesity and neurodegeneration. ER proteostasis surveillance is mediated by the unfolded protein response (UPR), a signal transduction pathway that senses the fidelity of protein folding in the ER lumen. The UPR transmits information about protein folding status to the nucleus and cytosol to adjust the protein folding capacity of the cell or, in the event of chronic damage, induce apoptotic cell death. Recent advances in the understanding of the regulation of UPR signalling and its implications in the pathophysiology of disease might open new therapeutic avenues. The secretory pathway is responsible for the synthe- small ligands that bind cell- surface receptors; intracellular sis of one third of all eukaryotic cell proteins, their homeostatic changes such as altered nutrient levels, ene- post- translational modification and assembly into rgy status and redox balance; changes in cellular growth complexes, and their delivery to precise destinations and differentiation; and disruption in the ER protein within the cell or their release into the extracellular folding capacity. Activation of the UPR impacts almost 1Biomedical Neuroscience space. Proteins enter the secretory pathway by trans- every aspect of the secretory pathway, modifying the rate Institute, Faculty of Medicine, location from the cytosol into the endoplasmic retic- of protein synthesis and translocation into the ER, protein University of Chile, Santiago, ulum (ER) in an unfolded state, where they undergo folding, maturation and quality control, protein traffick- Chile. chaperone- assisted folding to acquire their appropriate ing and the elimination of misfolded proteins through 2FONDAP Center for Geroscience Brain Health 3D conformation. Unlike DNA replication, transcription the autophagy and ER- associated protein degradation and Metabolism (GERO), and translation, protein folding is a highly error- prone (ERAD) pathways. Santiago, Chile. process1. Thus, maintenance of a healthy proteome Here we review salient and unique features of the 3Program of Cellular and depends on complex quality control mechanisms, UPR uncovered in the past few years. We first describe Molecular Biology, Institute some of which operate at the level of the ER to promote how protein misfolding in the ER is sensed through the of Biomedical Science, efficient protein folding and trafficking. three conserved signal transducers to preserve ER func- University of Chile, Santiago, Chile. ER homeostasis is constantly challenged by physio- tions vital for cell survival. We then give an overview of logical demands and pathological insults, impacting its the consequences of misfolded protein accumulation by 4Buck Institute for Research 2+ on Aging, Novato, CA, USA. multiple functions in the cell as a Ca reservoir, a fac- discussing recently discovered mechanisms that regu- 5Center for Molecular tory for protein folding and assembly, a site for lipid and late apoptosis in cells experiencing prolonged ER stress. Medicine and Genetics, sterol biosynthesis, and as a platform for signalling Recently, it has become evident that the UPR has essen- Wayne State University and interorganelle communication. Increased protein tial cell functions beyond ER proteostasis, and therefore School of Medicine, Detroit, secretion or disrupted ER protein folding can cause accu- we discuss how the UPR controls organelle interactions, MI, USA. mulation of unfolded or misfolded proteins in the ER bioenergetics, cytoskeletal dynamics, the DNA dam- 6 Department of Biochemistry, lumen — a condition referred to as ‘ER stress’. To ensure age response and cell signalling crosstalk at both the Microbiology and Immunology, Wayne State protein folding fidelity and to maintain ER functions, cell- autonomous and nonautonomous level. Finally, we University School of Medicine, the unfolded protein response (UPR) of eukaryotic cells review the emerging roles of the UPR in the pathogen- Detroit, MI, USA. evolved to a network of signal transduction pathways esis of diseases, including metabolic syndromes, can- 7Degenerative Diseases to reprogramme gene transcription, mRNA translation cer, immunological disorders and neurodegenerative Program, Sanford Burnham and protein modifications to relieve the load of unfolded conditions. Prebys Medical Discovery or misfolded proteins and restore protein homeostasis Institute, La Jolla, CA, USA. (proteostasis2) (Fig. 1). ER stress and the three UPR branches ✉e- mail: [email protected]; (BOx 1) [email protected]; The UPR orchestates the enforcement of adaptive Initially discovered in yeast , the basic UPR path- [email protected] mechanisms to maintain an optimal rate of protein pro- ways in mammals consist of three main signalling cas- https://doi.org/10.1038/ duction and rapidly reacts to diverse stimuli, including cades initiated by the ER transmembrane protein sensors: s41580-020-0250- z extracellular responses to hormones, growth factors and IRE1α, PERK and ATF6α3. These signal- transducing NATURE REVIEWS | MOLECULAR CELL BIOLOGY REVIEWS a Adaptive UPR ER PERK IRE1α ATF6 Cytosol Phosphorylation RIDD TRAF eIF2α • mRNAs • Inflammation XBP1 mRNA • miRNAs • Autophagy • Stress pathways Translation Selective Golgi attenuation translation • Reduced protein load S2P S1P Reduced protein ATF4 • Metabolic adaptation folding load • Inflammation XBP1s ATF6p50 Nucleus • Amino acid metabolism • ER protein folding • Protein folding • Antioxidative response • Translocation • Protein secretion • Autophagy • Secretion • ERAD • ER protein folding • ERAD • ER/Golgi • ER/Golgi biogenesis biogenesis • Inflammation • Protein secretion b Proapoptotic UPR ER IP3R BI-1/GRINA IRE1α PERK TRAF2 Ca2+ JNK eIF2α eIF2α ATF4 Inflammasome TXNIP Caspase 2 RIDD PP1 PP1 CReP GADD34 Caspase 1 BID Caspase 8 DR5 GADD34 CHOP IL-1β BAX/BAK NOXA BIM PUMA Sterile Mitochondrion inflammation Apoptosome Apoptosis proteins contain ER luminal domains that sense unfol- Concomitantly, phosphorylated eIF2α initiates the trans- ded protein peptides (see later) and cytosolic regions lation of a growing set of specific mRNAs that harbour that signal through the translational or transcriptional one or more upstream open reading frames in their apparatus or by interacting with signalling molecules as 5′ untranslated regions5–8. One of these encodes ATF4, scafold to protect cells from ER stress under physiolog- a stress- inducible transcription factor that activates ical conditions. Here we discuss fundamental aspects of the expression of genes involved in redox homeostasis, UPR signalling and the consequences that determine cell amino acid metabolism, protein synthesis, apoptosis fate under ER stress. Owing to the length restriction, we and autophagy. ATF4 participates in a feedback loop are unable to acknowledge many contributions, but refer to dephosphorylate eIF2α to restore protein synthe- to reviews for historical or background information3,4. sis through upregulation of the protein phosphatase 1 (PP1) regulatory subunit GADD34 (REFS9–11) (Fig. 1b). UPR signalling through PERK. An immediate adaptive During ER stress, GADD34 forms a complex with PP1 reaction to ER stress is initiated by PERK, a kinase that to dephosphorylate eIF2α12,13. Similarly to GADD34, phosphorylates eukaryotic translation initiation factor 2 expression of constitutive repressor of eIF2α phospho- subunit-α (eIF2α), leading to the transient attenuation of rylation (CReP), which serves as a PP1 cofactor, confers protein synthesis3,4 (Fig. 1a). This reversible covalent mod- PP1 specificity for phosphorylated eIF2α. GADD34 and ification limits the protein misfolding load by prevent- CReP are essential for recovery of protein synthesis as ing the influx of newly synthesized proteins into the ER. ER stress is resolved14. www.nature.com/nrm REVIEWS ◀ Fig. 1 | The major UPR pathways initiated from the ER. a | Adaptive unfolded protein sequence motif within a stem–loop structure is a key response (UPR). Under endoplasmic reticulum (ER) stress, three major UPR branches are feature of the IRE1α cleavage site. IRE1α was recently activated: (1) PERK phosphorylates eukaryotic translation initiation factor 2 subunit-α found to form complexes with the components of the (eIF2 ), reducing the overall frequency of mRNA translation initiation. However, selective α translational and translocational machineries, includ- mRNAs, such as ATF4 mRNA, are preferentially translated in the presence of phosphorylated signal recognition particle eIF2 . ATF4 activates the transcription of UPR target genes encoding factors involved in ing RNA, ribosomal RNAs and α 25,26 amino acid biosynthesis, the antioxidative response, autophagy and apoptosis. (2) IRE1α transfer RNAs . However, whether the IRE1α–small RNase splices XBP1 mRNA, which encodes a potent transcription factor that activates RNA complexes are of biological significance remains to expression of UPR target genes involved in ER proteostasis and cell pathophysiology. be further investigated. Additionally, IRE1α also associ- IRE1α RNase can also cleave ER- associated mRNAs or non- coding functional RNAs, ates with adapter proteins to undergo crosstalk with other leading to their degradation
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Control of Protein Function
    3 Control of Protein Function In the cell, precise regulation of protein function is essential to avoid chaos. This chapter describes the most important molecular mechanisms by which protein function is regulated in cells. These range from control of a protein’s location and lifetime within the cell to the binding of regulatory molecules and covalent modifications such as phosphorylation that rapidly switch protein activity on or off. Also covered here are the nucleotide-driven switches in conformation that underlie the action of motor proteins and that regulate many signal transduction pathways. 3-0 Overview: Mechanisms of Regulation 3-1 Protein Interaction Domains 3-2 Regulation by Location 3-3 Control by pH and Redox Environment 3-4 Effector Ligands: Competitive Binding and Cooperativity 3-5 Effector Ligands: Conformational Change and Allostery 3-6 Protein Switches Based on Nucleotide Hydrolysis 3-7 GTPase Switches: Small Signaling G Proteins 3-8 GTPase Switches: Signal Relay by Heterotrimeric GTPases 3-9 GTPase Switches: Protein Synthesis 3-10 Motor Protein Switches 3-11 Regulation by Degradation 3-12 Control of Protein Function by Phosphorylation 3-13 Regulation of Signaling Protein Kinases: Activation Mechanism 3-14 Regulation of Signaling Protein Kinases: Cdk Activation 3-15 Two-Component Signaling Systems in Bacteria 3-16 Control by Proteolysis: Activation of Precursors 3-17 Protein Splicing: Autoproteolysis by Inteins 3-18 Glycosylation 3-19 Protein Targeting by Lipid Modifications 3-20 Methylation, N-acetylation, Sumoylation and Nitrosylation 3-0 Overview: Mechanisms of Regulation Protein function in living cells is precisely regulated A typical bacterial cell contains a total of about 250,000 protein molecules (comprising different amounts of each of several thousand different gene products), which are packed into a volume so small that it has been estimated that, on average, they are separated from one another by a distance that would contain only a few molecules of water.
    [Show full text]
  • Ire1β Negatively Regulates Ire1α Signaling in Response to Endoplasmic Reticulum Stress
    bioRxiv preprint doi: https://doi.org/10.1101/586305; this version posted March 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. IRE1 negatively regulates IRE1 signaling in response to endoplasmic reticulum stress Michael J. Grey1,2,3†, Eva Cloots4,5†, Mariska S. Simpson1,6†, Nicole LeDuc1, Yevgeniy V. Serebrenik7, Heidi De Luca1, Delphine De Sutter4, Phi Luong1, Jay R. Thiagarajah1,2,3, Adrienne W. Paton8, James C. Paton8, Markus A. Seeliger9, Sven Eyckerman4, Sophie Janssens5, and Wayne I. Lencer1,2,3* 1Division of Gastroenterology, Hepatology, and Nutrition, Boston Children’s Hospital, Boston, MA 02115 2Harvard Medical School, Boston MA 02115 3Harvard Digestive Disease Center, Boston MA 02115 4VIB-UGent Center for Medical Biotechnology and Department of Biomolecular Medicine, Ghent University, Ghent, Belgium 5Laboratory for ER stress and Inflammation, VIB-UGent Center for Inflammation Research and Department of Internal Medicine and Pediatrics, Ghent University, Ghent, Belgium 6Molecular and Cellular Sciences, Graduate School of Life Sciences, Utrecht University, Utrecht, The Netherlands 7Department of Molecular, Cellular, and Developmental Biology, Yale University, New Haven, CT 06511 8Research Centre for Infectious Diseases, Department of Molecular and Biomedical Science, University of Adelaide, Adelaide, SA, Australia 9Department of Pharmacological Sciences, Stony Brook University Medical School, Stony Brook, NY 17794 †These authors contributed equally to this work. 1 bioRxiv preprint doi: https://doi.org/10.1101/586305; this version posted March 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Nuclear Ubiquitin-Proteasome Pathways in Proteostasis Maintenance
    biomolecules Review Nuclear Ubiquitin-Proteasome Pathways in Proteostasis Maintenance Dina Frani´c †, Klara Zubˇci´c † and Mirta Boban * Croatian Institute for Brain Research, School of Medicine, University of Zagreb, 10000 Zagreb, Croatia; [email protected] (D.F.); [email protected] (K.Z.) * Correspondence: [email protected] † Equal contribution. Abstract: Protein homeostasis, or proteostasis, is crucial for the functioning of a cell, as proteins that are mislocalized, present in excessive amounts, or aberrant due to misfolding or other type of damage can be harmful. Proteostasis includes attaining the correct protein structure, localization, and the for- mation of higher order complexes, and well as the appropriate protein concentrations. Consequences of proteostasis imbalance are evident in a range of neurodegenerative diseases characterized by protein misfolding and aggregation, such as Alzheimer’s, Parkinson’s, and amyotrophic lateral sclerosis. To protect the cell from the accumulation of aberrant proteins, a network of protein quality control (PQC) pathways identifies the substrates and direct them towards refolding or elimination via regulated protein degradation. The main pathway for degradation of misfolded proteins is the ubiquitin-proteasome system. PQC pathways have been first described in the cytoplasm and the endoplasmic reticulum, however, accumulating evidence indicates that the nucleus is an important PQC compartment for ubiquitination and proteasomal degradation of not only nuclear, but also cyto- plasmic proteins. In this review, we summarize the nuclear ubiquitin-proteasome pathways involved in proteostasis maintenance in yeast, focusing on inner nuclear membrane-associated degradation (INMAD) and San1-mediated protein quality control. Keywords: proteasome; ubiquitin; nucleus; inner nuclear membrane; yeast; proteostasis; protein quality control; protein misfolding Citation: Frani´c,D.; Zubˇci´c,K.; Boban, M.
    [Show full text]
  • Prokaryotic Ubiquitin-Like Protein Remains Intrinsically Disordered When Covalently Attached to Proteasomal Target Proteins Jonas Barandun1,2, Fred F
    Barandun et al. BMC Structural Biology (2017) 17:1 DOI 10.1186/s12900-017-0072-1 RESEARCH ARTICLE Open Access Prokaryotic ubiquitin-like protein remains intrinsically disordered when covalently attached to proteasomal target proteins Jonas Barandun1,2, Fred F. Damberger1, Cyrille L. Delley1, Juerg Laederach1, Frédéric H. T. Allain1 and Eilika Weber-Ban1* Abstract Background: The post-translational modification pathway referred to as pupylation marks proteins for proteasomal degradation in Mycobacterium tuberculosis and other actinobacteria by covalently attaching the small protein Pup (prokaryotic ubiquitin-like protein) to target lysine residues. In contrast to the functionally analogous eukaryotic ubiquitin, Pup is intrinsically disordered in its free form. Its unfolded state allows Pup to adopt different structures upon interaction with different binding partners like the Pup ligase PafA and the proteasomal ATPase Mpa. While the disordered behavior of free Pup has been well characterized, it remained unknown whether Pup adopts a distinct structure when attached to a substrate. Results: Using a combination of NMR experiments and biochemical analysis we demonstrate that Pup remains unstructured when ligated to two well-established pupylation substrates targeted for proteasomal degradation in Mycobacterium tuberculosis, malonyl transacylase (FabD) and ketopantoyl hydroxylmethyltransferase (PanB). Isotopically labeled Pup was linked to FabD and PanB by in vitro pupylation to generate homogeneously pupylated substrates suitable for NMR analysis. The single target lysine of PanB was identified by a combination of mass spectroscopy and mutational analysis. Chemical shift comparison between Pup in its free form and ligated to substrate reveals intrinsic disorder of Pup in the conjugate. Conclusion: When linked to the proteasomal substrates FabD and PanB, Pup is unstructured and retains the ability to interact with its different binding partners.
    [Show full text]
  • Molecular Chaperones and Proteolytic Machineries Regulate Protein Homeostasis in Aging Cells
    cells Review Molecular Chaperones and Proteolytic Machineries Regulate Protein Homeostasis in Aging Cells Boris Margulis, Anna Tsimokha, Svetlana Zubova and Irina Guzhova * Institute of Cytology of the Russian Academy of Sciences, St. Petersburg 194064, Russia; [email protected] (B.M.); [email protected] (A.T.); [email protected] (S.Z.) * Correspondence: [email protected]; Tel.: +7-812-2973794 Received: 14 April 2020; Accepted: 19 May 2020; Published: 24 May 2020 Abstract: Throughout their life cycles, cells are subject to a variety of stresses that lead to a compromise between cell death and survival. Survival is partially provided by the cell proteostasis network, which consists of molecular chaperones, a ubiquitin-proteasome system of degradation and autophagy. The cooperation of these systems impacts the correct function of protein synthesis/modification/transport machinery starting from the adaption of nascent polypeptides to cellular overcrowding until the utilization of damaged or needless proteins. Eventually, aging cells, in parallel to the accumulation of flawed proteins, gradually lose their proteostasis mechanisms, and this loss leads to the degeneration of large cellular masses and to number of age-associated pathologies and ultimately death. In this review, we describe the function of proteostasis mechanisms with an emphasis on the possible associations between them. Keywords: molecular chaperones; autophagy; ubiquitin-proteasomal system; aging 1. Introduction Aging is a process that, according to Maurice Chevalier, “isn’t so bad when you consider the alternative.” In numerous essays, aging or senescence is presented as a gradual dying process that involves a loss of cell integrity, leading to the dysfunction of cells or organs and eventually to their deaths.
    [Show full text]
  • The Signal Recognition Particle
    P1: GDL May 22, 2001 22:53 Annual Reviews AR131-22 Annu. Rev. Biochem. 2001. 70:755–75 Copyright c 2001 by Annual Reviews. All rights reserved THE SIGNAL RECOGNITION PARTICLE Robert J. Keenan1, Douglas M. Freymann2, Robert M. Stroud3, and Peter Walter3,4 1Maxygen, 515 Galveston Drive, Redwood City, California 94063; e-mail: [email protected] 2Department of Molecular Pharmacology and Biological Chemistry, Northwestern University Medical School, Chicago, Illinois 60611; e-mail: [email protected] 3Department of Biochemistry and Biophysics, University of California, San Francisco, California 94143; e-mail: [email protected] 4The Howard Hughes Medical Institute, University of California, San Francisco, California 94143; e-mail: [email protected] Key Words Alu domain, SRP, SRP54, Ffh, SRP receptor, FtsY, signal sequence, GTPase, SRP9/14, SRP RNA ■ Abstract The signal recognition particle (SRP) and its membrane-associated re- ceptor (SR) catalyze targeting of nascent secretory and membrane proteins to the protein translocation apparatus of the cell. Components of the SRP pathway and salient fea- tures of the molecular mechanism of SRP-dependent protein targeting are conserved in all three kingdoms of life. Recent advances in the structure determination of a number of key components in the eukaryotic and prokaryotic SRP pathway provide new insight into the molecular basis of SRP function, and they set the stage for future work toward an integrated picture that takes into account the dynamic and contextual properties of this remarkable cellular machine. CONTENTS INTRODUCTION ................................................ 756 by UNIVERSITY OF CHICAGO LIBRARIES on 11/05/07. For personal use only. COTRANSLATIONAL PROTEIN TARGETING ..........................756 Annu.
    [Show full text]
  • Yichen – Structure and Allostery of the Chaperonin Groel. Allosteric
    Literature Lunch 5-1-13 Yichen – J Mol Biol. 2013 May 13;425(9):1476-87. doi: 10.1016/j.jmb.2012.11.028. Epub 2012 Nov 24. Structure and Allostery of the Chaperonin GroEL. Saibil HR, Fenton WA, Clare DK, Horwich AL. Source Crystallography and Institute of Structural and Molecular Biology, Birkbeck College London, Malet Street, London WC1E 7HX, UK. Abstract Chaperonins are intricate allosteric machines formed of two back-to-back, stacked rings of subunits presenting end cavities lined with hydrophobic binding sites for nonnative polypeptides. Once bound, substrates are subjected to forceful, concerted movements that result in their ejection from the binding surface and simultaneous encapsulation inside a hydrophilic chamber that favors their folding. Here, we review the allosteric machine movements that are choreographed by ATP binding, which triggers concerted tilting and twisting of subunit domains. These movements distort the ring of hydrophobic binding sites and split it apart, potentially unfolding the multiply bound substrate. Then, GroES binding is accompanied by a 100° twist of the binding domains that removes the hydrophobic sites from the cavity lining and forms the folding chamber. ATP hydrolysis is not needed for a single round of binding and encapsulation but is necessary to allow the next round of ATP binding in the opposite ring. It is this remote ATP binding that triggers dismantling of the folding chamber and release of the encapsulated substrate, whether folded or not. The basis for these ordered actions is an elegant system of nested cooperativity of the ATPase machinery. ATP binds to a ring with positive cooperativity, and movements of the interlinked subunit domains are concerted.
    [Show full text]
  • (Ubl-Ptms): Small Peptides with Huge Impact in Liver Fibrosis
    cells Review Ubiquitin-Like Post-Translational Modifications (Ubl-PTMs): Small Peptides with Huge Impact in Liver Fibrosis 1 1, 1, Sofia Lachiondo-Ortega , Maria Mercado-Gómez y, Marina Serrano-Maciá y , Fernando Lopitz-Otsoa 2, Tanya B Salas-Villalobos 3, Marta Varela-Rey 1, Teresa C. Delgado 1,* and María Luz Martínez-Chantar 1 1 Liver Disease Lab, CIC bioGUNE, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), 48160 Derio, Spain; [email protected] (S.L.-O.); [email protected] (M.M.-G.); [email protected] (M.S.-M.); [email protected] (M.V.-R.); [email protected] (M.L.M.-C.) 2 Liver Metabolism Lab, CIC bioGUNE, 48160 Derio, Spain; fl[email protected] 3 Department of Biochemistry and Molecular Medicine, School of Medicine, Autonomous University of Nuevo León, Monterrey, Nuevo León 66450, Mexico; [email protected] * Correspondence: [email protected]; Tel.: +34-944-061318; Fax: +34-944-061301 These authors contributed equally to this work. y Received: 6 November 2019; Accepted: 1 December 2019; Published: 4 December 2019 Abstract: Liver fibrosis is characterized by the excessive deposition of extracellular matrix proteins including collagen that occurs in most types of chronic liver disease. Even though our knowledge of the cellular and molecular mechanisms of liver fibrosis has deeply improved in the last years, therapeutic approaches for liver fibrosis remain limited. Profiling and characterization of the post-translational modifications (PTMs) of proteins, and more specifically NEDDylation and SUMOylation ubiquitin-like (Ubls) modifications, can provide a better understanding of the liver fibrosis pathology as well as novel and more effective therapeutic approaches.
    [Show full text]
  • 1519038862M28translationand
    Paper No. : 15 Molecular Cell Biology Module : 28 Translation and Post-translation Modifications in Eukaryotes Development Team Principal Investigator : Prof. Neeta Sehgal Department of Zoology, University of Delhi Co-Principal Investigator : Prof. D.K. Singh Department of Zoology, University of Delhi Paper Coordinator : Prof. Kuldeep K. Sharma Department of Zoology, University of Jammu Content Writer : Dr. Renu Solanki, Deen Dayal Upadhyaya College Dr. Sudhida Gautam, Hansraj College, University of Delhi Mr. Kiran K. Salam, Hindu College, University of Delhi Content Reviewer : Prof. Rup Lal Department of Zoology, University of Delhi 1 Molecular Genetics ZOOLOGY Translation and Post-translation Modifications in Eukaryotes Description of Module Subject Name ZOOLOGY Paper Name Molecular Cell Biology; Zool 015 Module Name/Title Cell regulatory mechanisms Module Id M28: Translation and Post-translation Modifications in Eukaryotes Keywords Genome, Proteome diversity, post-translational modifications, glycosylation, phosphorylation, methylation Contents 1. Learning Objectives 2. Introduction 3. Purpose of post translational modifications 4. Post translational modifications 4.1. Phosphorylation, the addition of a phosphate group 4.2. Methylation, the addition of a methyl group 4.3. Glycosylation, the addition of sugar groups 4.4. Disulfide bonds, the formation of covalent bonds between 2 cysteine amino acids 4.5. Proteolysis/ Proteolytic Cleavage 4.6. Subunit binding to form a multisubunit protein 4.7. S-nitrosylation 4.8. Lipidation 4.9. Acetylation 4.10. Ubiquitylation 4.11. SUMOlytion 4.12. Vitamin C-Dependent Modifications 4.13. Vitamin K-Dependent Modifications 4.14. Selenoproteins 4.15. Myristoylation 5. Chaperones: Role in PTM and mechanism 6. Role of PTMs in diseases 7. Detecting and Quantifying Post-Translational Modifications 8.
    [Show full text]
  • ERN1 Knockdown Modifies the Impact of Glucose and Glutamine Deprivations on the Expression of EDN1 and Its Receptors in Glioma Cells
    This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/ licenses/ by-nc-nd/4.0), which permits copy and redistribute the material in any medium or format, provided the original work is properly cited. 72 ENDOCRINE REGULATIONS, Vol. 55, No. 2, 72–82, 2021 doi:10.2478/enr-2021-0009 ERN1 knockdown modifies the impact of glucose and glutamine deprivations on the expression of EDN1 and its receptors in glioma cells Dmytro O. Minchenko1,2, Olena O. Khita1, Dariia O. Tsymbal1, Yuliia M. Viletska1, Myroslava Y. Sliusar1, Yuliia V. Yefimova1, Liudmyla O. Levadna2, Dariia A. Krasnytska1, Oleksandr H. Minchenko1 1Palladin Institute of Biochemistry, National Academy of Sciences of Ukraine, Kyiv, Ukraine; 2National Bogomolets Medical University, Kyiv, Ukraine E-mail: [email protected] Objective. The aim of the present investigation was to study the impact of glucose and gluta- mine deprivations on the expression of genes encoding EDN1 (endothelin-1), its cognate receptors (EDNRA and EDNRB), and ECE1 (endothelin converting enzyme 1) in U87 glioma cells in re- sponse to knockdown of ERN1 (endoplasmic reticulum to nucleus signaling 1), a major signaling pathway of endoplasmic reticulum stress, for evaluation of their possible implication in the control of glioma growth through ERN1 and nutrient limitations. Methods. The expression level of EDN1, its receptors and converting enzyme 1 in control U87 glioma cells and cells with knockdown of ERN1 treated by glucose or glutamine deprivation by quantitative polymerase chain reaction was studied. Results. We showed that the expression level of EDN1 and ECE1 genes was significantly up- regulated in control U87 glioma cells exposure under glucose deprivation condition in compari- son with the glioma cells, growing in regular glucose containing medium.
    [Show full text]
  • A Clearer Picture of the ER Translocon Complex Max Gemmer and Friedrich Förster*
    © 2020. Published by The Company of Biologists Ltd | Journal of Cell Science (2020) 133, jcs231340. doi:10.1242/jcs.231340 REVIEW A clearer picture of the ER translocon complex Max Gemmer and Friedrich Förster* ABSTRACT et al., 1986). SP-equivalent N-terminal transmembrane helices that The endoplasmic reticulum (ER) translocon complex is the main gate are not cleaved off can also target proteins to the ER through the into the secretory pathway, facilitating the translocation of nascent same mechanism. In this SRP-dependent co-translational ER- peptides into the ER lumen or their integration into the lipid membrane. targeting mode, ribosomes associate with the ER membrane via ER Protein biogenesis in the ER involves additional processes, many of translocon complexes. These membrane protein complexes them occurring co-translationally while the nascent protein resides at translocate nascent soluble proteins into the ER, integrate nascent the translocon complex, including recruitment of ER-targeted membrane proteins into the ER membrane, mediate protein folding ribosome–nascent-chain complexes, glycosylation, signal peptide and membrane protein topogenesis, and modify them chemically. In cleavage, membrane protein topogenesis and folding. To perform addition to co-translational protein import and translocation, distinct such varied functions on a broad range of substrates, the ER ER translocon complexes enable post-translational translocation and translocon complex has different accessory components that membrane integration. This post-translational pathway is widespread associate with it either stably or transiently. Here, we review recent in yeast (Panzner et al., 1995), whereas higher eukaryotes primarily structural and functional insights into this dynamically constituted use it for relatively short peptides (Schlenstedt and Zimmermann, central hub in the ER and its components.
    [Show full text]