DOCSLIB.ORG

HIPK2 Phosphorylates the Microtubule-Severing Enzyme Spastin at S268 for Abscission

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
HIPK2 Phosphorylates the Microtubule-Severing Enzyme Spastin at S268 for Abscission cells Article HIPK2 Phosphorylates the Microtubule-Severing Enzyme Spastin at S268 for Abscission 1, , 1, 1 2 Alessandra Pisciottani y z, Loredana Biancolillo y, Manuela Ferrara , Davide Valente , Francesca Sardina 1, Laura Monteonofrio 2,§, Serena Camerini 3, Marco Crescenzi 3 , Silvia Soddu 2 and Cinzia Rinaldo 1,2,* 1 Institute of Molecular Biology and Pathology (IBPM), National Research Council (CNR), c/o Sapienza University, 00185 Rome, Italy 2 Unit of Cellular Networks and Molecular Therapeutic Targets; IRCCS-Regina Elena National Cancer Institute, 00144 Rome, Italy 3 Core Facilities, Italian National Institute of Health, 00161 Rome, Italy * Correspondence: [email protected] These Authors contributed equally to the work. y Present address: Vita-Salute San Raffaele University, 20132 Milan, Italy. z § Present address: Laboratory of Cardiovascular Science, NIA/NIH Baltimore, MD 21224, USA. Received: 30 May 2019; Accepted: 3 July 2019; Published: 5 July 2019 Abstract: Abscission is the final step of cell division, mediating the physical separation of the two daughter cells. A key player in this process is the microtubule-severing enzyme spastin that localizes at the midbody where its activity is crucial to cut microtubules and culminate the cytokinesis. Recently, we demonstrated that HIPK2, a multifunctional kinase involved in several cellular pathways, contributes to abscission and prevents tetraploidization. Here, we show that HIPK2 binds and phosphorylates spastin at serine 268. During cytokinesis, the midbody-localized spastin is phosphorylated at S268 in HIPK2-proficient cells. In contrast, no spastin is detectable at the midbody in HIPK2-depleted cells. The non-phosphorylatable spastin-S268A mutant does not localize at the midbody and cannot rescue HIPK2-depleted cells from abscission defects. In contrast, the phosphomimetic spastin-S268D mutant localizes at the midbody and restores successful abscission in the HIPK2-depleted cells. These results show that spastin is a novel target of HIPK2 and that HIPK2-mediated phosphorylation of spastin contributes to its midbody localization for successful abscission. Keywords: HIPK2; spastin; abscission; midbody; phosphorylation 1. Introduction Abscission is the final step of cytokinesis and consists of an orderly sequence of dynamic events that allow the final separation of the two nascent daughter cells, safeguarding the correct distribution of genomic and cytoplasmic materials in cell division [1,2]. At the end of cytokinesis, several membrane remodeling factors of the endosomal sorting complex required for transport-I (ESCRT-I) and -III pathways, such as Alix and CHMPs proteins, and the microtubule (MT)-severing enzyme spastin are sequentially recruited at the midbody, the organelle-like platform at the intercellular bridge [3]. In particular, CHMP1B recruits spastin, whose activity results in MT clearance leading to the physical separation of the two daughter cells [4–6]. This process depends on dramatic rearrangement of the cytoskeleton and membrane remodeling occurring at the midbody. These events are finely orchestrated by several kinases, such as Aurora-B, PLK1, and Citron kinase, which act on multiple targets to regulate the local levels, the interactions, and the functions of key players of cytokinesis [3,7,8]. Cells 2019, 8, 684; doi:10.3390/cells8070684 www.mdpi.com/journal/cells Cells 2019, 8, 684 2 of 12 Spastin belongs to the family of the AAA (associated with diverse cellular activities) ATPases. The ATPase domain (342–599 aa) is preceded by the MT binding domain (MTBD, 270–328 aa) and the MT-interacting and endosomal-trafficking domain (MIT, 116–194 aa) that is necessary for midbody recruitment through CHMP1B interaction [4,5]. Four spastin isoforms have been identified, generated by two alternative start codons (full-length M1 and the shorter isoform lacking the first 86 aa, M87) and differential splicing of the exon 4, M1D4, and M87D4, respectively [6,9]. M87 is ubiquitously expressed, whereas M1 expression appears to be restricted to neuronal cells [6,9,10]. Spastin has been reported to localize at regions of active MT remodeling and its depletion results in strongly delayed abscission, associated with aberrant midbody phenotype [5,11,12]. In interphase, spastin shows a diffuse staining in the nucleus and a punctate pattern in the cytoplasm, where it localizes at the centrosome, endoplasmic reticulum, endosomes, and lipid droplets [13–15]. Instead, during cell division, spastin localizes at the spindle poles, at the resealing nuclear envelope, and at the midbody [5,15,16]. HIPK2 is a highly conserved multifunctional tyrosine-regulated serine/threonine kinase [17–19], which phosphorylates a large number of targets, contributing to the fine-tuning of several pathways [20,21]. We previously observed that HIPK2-null or -depleted cells undergo cytokinesis delay and failure, accumulating elongated midbodies and tetraploid cells [22,23]. During cytokinesis, HIPK2 is recruited at the midbody in an Aurora-B-dependent manner [24] and, there, phosphorylates the extrachromosomal histone H2B at S14 [22]. This phosphorylation is not required for the midbody localization of H2B, but it is necessary for successful cytokinesis [22,24], supporting the inclusion of HIPK2 among the kinases that regulate cytokinesis. Since these kinases usually work on multiple targets, we searched for additional cytokinesis substrates of HIPK2. Here, we identify spastin as a novel abscission target of HIPK2 and show that HIPK2-mediated phosphorylation of spastin at S268 is required for the midbody localization of spastin to drive abscission. 2. Materials and Methods 2.1. Cell Culture Conditions and Expression Vectors HeLa, U2OS, and A549 cells were cultured at 37 ◦C and 5% CO2 in DMEM GlutaMAX, supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Life Technologies, Carlsbad, CA, USA); they were enriched in telophase as in [22]. The following plasmids were employed: Flag-myc empty vector (pCMV6-Entry) and flag-myc-tagged spastin-expressing vectors from OriGene Technologies (Rockville, MD, USA). Spastin mutants were obtained by site-directed mutagenesis in the Spastin-flag-myc-tagged vector using a QuikChange Lightening Kit (Agilent, Cernusco sul Naviglio, Italy) and analyzed by sequencing. Vectors were transfected by using Lipofectamine LTX and Plus reagent (Life Technologies). 2.2. RNA Interference (RNAi) and Real-Time (Reverse Transcription)-PCR (Real-Time (RT)-PCR) HIPK2 RNAi was obtained by using human-specific validated stealth siRNAs (a mix of three different siRNAs by Life Technologies, as in [22]). Spastin RNAi was obtained by using a mix of specific validated stealth siRNAs by Life Technologies, targeting sequences common to all spastin isoforms. siRNAs were transfected using Lipofectamine RNAi MAX (Life Technologies). RNA extraction and real-time (RT)-PCR were performed as in [22], and relative fold-change were determined by the 2-DDCt method using GAPDH mRNA as normalizer. Primers for amplification were as in [22]. SiRNA sequences were the following: siHIPK2#1: CCCGAGUCAGUAUCCAGCCCAAUUU; siHIPK2#2: CCACCAACCUGACCAUGACCUUUAA; siHIPK2#3: CAGGGUUUGCCUGCUGAAUAUUUAU; siSpastin#1: CCAGUGAGAUGAGAAAUAUUCGAUU; siSpastin#2: CCAGUGAGAUGAGAAAUAUUCGAUU. Cells 2019, 8, 684 3 of 12 2.3. Western Blot (WB) and Co-Immunoprecipitation (co-IP) For WB, total cell extracts (TCEs) were prepared in RIPA buffer (50mM Tris-HCl (pH 8), 600 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 1% NP40 and 1mM EDTA) supplemented with protease and phosphatase inhibitors (Roche, Basel, Switzerland). For co-IP, TCEs were prepared in non-denaturating lysis buffer (50 mM Tris-HCl (pH 8), 150 mM NaCl, 1% NP40 and 5 mM EDTA), supplemented with protease and phosphatase inhibitors (Roche, Basel, Switzerland). Proteins were resolved by SDS-PAGE using Bolt Novex Bis-Tris Gels 4%–12% (Life Technologies). Immunoreactivity was determined using ECL-Prime (Amersham, Buckinghamshire, UK), image acquisition and densitometric analysis were performed with Image Lab software (BIORAD, Hercules, CA, USA). The following antibodies (Abs) were employed: anti-HIPK2 (rat monoclonal Ab C5C6, kindly provided by Dr. L. Schmitz); anti-GST (1:500), anti-GAPDH (1:1000), anti-His tag (1:200), and anti-spastin (1:100; sp311/1 mouse monoclonal Ab), all provided by Santa Cruz Biotechnology, Dallas, TX, USA; anti-alpha-tubulin (1:1000; Immunological Science, Rome, Italy); anti-Flag (mouse monoclonal Ab, TA50011, OriGene Technologies, and rabbit polyclonal Ab provided by Sigma-Aldrich, St. Louis, MO, USA); anti-GFP (mouse monoclonal Ab provided by Roche and rabbit polyclonal Ab provided by Santa Cruz Biotechnology); and anti-HRP-conjugated goat anti-mouse,-rat, and -rabbit (Cell Signaling Technology, Danvers, MA, USA). 2.4. Kinase Assay and Recombinant Proteins In vitro kinase assays were performed as in [19], by using HIPK2 Kinase domain (kind gift of Dr. Montemiglio) as the enzymatic source and the following recombinant proteins as substrates: His6-tagged spastin 79–310 (ag18866, Proteintech, Rosemont, IL, USA) and spastin M1 (TP320458, OriGene technologies). 2.5. GST Pull-Down and Binding Assay GST pull-down and binding assay were performed as in [24]. In particular, GST and GST-HIPK2 were obtained by H1299 T7-vaccinia virus infection followed by transfection as described in [22] and were incubated with 100 ng of recombinant His6-tagged spastin 79–310 (Proteintech) in 50 mM Tris-HCl, pH 7.5, 150 nM NaCl. Bound Spastin was analyzed by WB. 2.6. Mass
Load more

Recommended publications
  • Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling
    G C A T T A C G G C A T genes Review Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling Aoife A. Nolan 1, Nourhan K. Aboud 1, Walter Kolch 1,2,* and David Matallanas 1,* 1 Systems Biology Ireland, School of Medicine, University College Dublin, Belfield, Dublin 4, Ireland; [email protected] (A.A.N.); [email protected] (N.K.A.) 2 Conway Institute of Biomolecular & Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland * Correspondence: [email protected] (W.K.); [email protected] (D.M.) Abstract: Oncogenic RAS (Rat sarcoma) mutations drive more than half of human cancers, and RAS inhibition is the holy grail of oncology. Thirty years of relentless efforts and harsh disappointments have taught us about the intricacies of oncogenic RAS signalling that allow us to now get a pharma- cological grip on this elusive protein. The inhibition of effector pathways, such as the RAF-MEK-ERK pathway, has largely proven disappointing. Thus far, most of these efforts were aimed at blocking the activation of ERK. Here, we discuss RAF-dependent pathways that are regulated through RAF functions independent of catalytic activity and their potential role as targets to block oncogenic RAS signalling. We focus on the now well documented roles of RAF kinase-independent functions in apoptosis, cell cycle progression and cell migration. Keywords: RAF kinase-independent; RAS; MST2; ASK; PLK; RHO-α; apoptosis; cell cycle; cancer therapy Citation: Nolan, A.A.; Aboud, N.K.; Kolch, W.; Matallanas, D. Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling.
    [Show full text]
  • 1 Tumor Suppressor PLK2 May Serve As a Biomarker in Triple-Negative Breast Cancer for Improved Response to PLK1 Therapeutics
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Tumor suppressor PLK2 may serve as a biomarker in triple-negative breast cancer for improved response to PLK1 therapeutics Yang Gao1, 2, 3, Elena B. Kabotyanski1, 2, Elizabeth Villegas7, Jonathan H. Shepherd8, Deanna Acosta1, 2, Clark Hamor1, 2, Tingting Sun2,4,5, Celina Montmeyor-Garcia9, Xiaping He8, Lacey E. Dobrolecki1, 2, 3, Thomas F. Westbrook2, 4, 5, Michael T. Lewis1, 2, 3, Susan G. Hilsenbeck2, 3, Xiang H.-F. Zhang1, 2, 3, 6, Charles M. Perou8 and Jeffrey M. Rosen1, 2 1Department of Molecular and Cellular Biology 2Dan L. Duncan Cancer Center 3Lester and Sue Smith Breast Center 4Department of Molecular and Human Genetics 5Verna & Marrs McLean Department of Biochemistry and Molecular Biology 6McNair Medical Institute Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA 7University of Houston-Downtown, Houston, TX 77002, USA 8The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 9 Canadian Blood Services, Toronto, ON M5G 2M1, Canada Correspondence to Jeffrey M. Rosen (Mail Stop: BCM130, Room: BCM-M638a, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030. Office: 713-798-6210. Fax: 713-898-8012. Email: [email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021.
    [Show full text]
  • Genome-Wide Association Study to Identify Genomic Regions And
    www.nature.com/scientificreports OPEN Genome‑wide association study to identify genomic regions and positional candidate genes associated with male fertility in beef cattle H. Sweett1, P. A. S. Fonseca1, A. Suárez‑Vega1, A. Livernois1,2, F. Miglior1 & A. Cánovas1* Fertility plays a key role in the success of calf production, but there is evidence that reproductive efciency in beef cattle has decreased during the past half‑century worldwide. Therefore, identifying animals with superior fertility could signifcantly impact cow‑calf production efciency. The objective of this research was to identify candidate regions afecting bull fertility in beef cattle and positional candidate genes annotated within these regions. A GWAS using a weighted single‑step genomic BLUP approach was performed on 265 crossbred beef bulls to identify markers associated with scrotal circumference (SC) and sperm motility (SM). Eight windows containing 32 positional candidate genes and fve windows containing 28 positional candidate genes explained more than 1% of the genetic variance for SC and SM, respectively. These windows were selected to perform gene annotation, QTL enrichment, and functional analyses. Functional candidate gene prioritization analysis revealed 14 prioritized candidate genes for SC of which MAP3K1 and VIP were previously found to play roles in male fertility. A diferent set of 14 prioritized genes were identifed for SM and fve were previously identifed as regulators of male fertility (SOD2, TCP1, PACRG, SPEF2, PRLR). Signifcant enrichment results were identifed for fertility and body conformation QTLs within the candidate windows. Gene ontology enrichment analysis including biological processes, molecular functions, and cellular components revealed signifcant GO terms associated with male fertility.
    [Show full text]
  • Identification of PIM1 Substrates Reveals a Role for NDRG1
    ARTICLE https://doi.org/10.1038/s42003-020-01528-6 OPEN Identification of PIM1 substrates reveals a role for NDRG1 phosphorylation in prostate cancer cellular migration and invasion Russell J. Ledet1,2,3,5, Sophie E. Ruff1,2,3,5, Yu Wang1,2, Shruti Nayak4, Jeffrey A. Schneider1,2,3, ✉ ✉ 1234567890():,; Beatrix Ueberheide1,4, Susan K. Logan1,2 & Michael J. Garabedian 2,3 PIM1 is a serine/threonine kinase that promotes and maintains prostate tumorigenesis. While PIM1 protein levels are elevated in prostate cancer relative to local disease, the mechanisms by which PIM1 contributes to oncogenesis have not been fully elucidated. Here, we performed a direct, unbiased chemical genetic screen to identify PIM1 substrates in prostate cancer cells. The PIM1 substrates we identified were involved in a variety of oncogenic processes, and included N-Myc Downstream-Regulated Gene 1 (NDRG1), which has reported roles in sup- pressing cancer cell invasion and metastasis. NDRG1 is phosphorylated by PIM1 at serine 330 (pS330), and the level of NDRG1 pS330 is associated higher grade prostate tumors. We have shown that PIM1 phosphorylation of NDRG1 at S330 reduced its stability, nuclear localization, and interaction with AR, resulting in enhanced cell migration and invasion. 1 Departments of Biochemistry and Molecular Pharmacology, New York University School of Medicine, New York, NY 10016, USA. 2 Department of Urology, New York University School of Medicine, New York, NY 10016, USA. 3 Department of Microbiology, New York University School of Medicine, New York, NY 10016, USA. 4 Proteomics Laboratory, New York University School of Medicine, New York, NY 10016, USA.
    [Show full text]
  • Inhibition of Polo-Like Kinase 1 During the DNA Damage Response Is Mediated Through Loss of Aurora a Recruitment by Bora
    OPEN Oncogene (2017) 36, 1840–1848 www.nature.com/onc ORIGINAL ARTICLE Inhibition of Polo-like kinase 1 during the DNA damage response is mediated through loss of Aurora A recruitment by Bora W Bruinsma1,2,4,5, M Aprelia1,2,5, I García-Santisteban1,3, J Kool2,YJXu2 and RH Medema1,2 When cells in G2 phase are challenged with DNA damage, several key mitotic regulators such as Cdk1/Cyclin B, Aurora A and Plk1 are inhibited to prevent entry into mitosis. Here we have studied how inhibition of Plk1 is established after DNA damage. Using a Förster resonance energy transfer (FRET)-based biosensor for Plk1 activity, we show that inhibition of Plk1 after DNA damage occurs with relatively slow kinetics and is entirely dependent on loss of Plk1-T210 phosphorylation. As T210 is phosphorylated by the kinase Aurora A in conjunction with its co-factor Bora, we investigated how they are affected by DNA damage. Interestingly, we find that the interaction between Bora and Plk1 remains intact during the early phases of the DNA damage response (DDR), whereas Plk1 activity is already inhibited at this stage. Expression of an Aurora A mutant that is refractory to inhibition by the DDR failed to prevent inhibition of Plk1 and loss of T210 phosphorylation, suggesting that inhibition of Plk1 may be established by perturbing recruitment of Aurora A by Bora. Indeed, expression of a fusion in which Aurora A was directly coupled to Bora prevented DNA damage-induced inhibition of Plk1 activity, as well as inhibition of T210 phosphorylation. Taken together, these data demonstrate that DNA damage affects the function of Aurora A at multiple levels: both by direct inhibition of Aurora A activity, as well as by perturbing the interaction with its co-activator Bora.
    [Show full text]
  • PDF Hosted at the Radboud Repository of the Radboud University Nijmegen
    PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/48948 Please be advised that this information was generated on 2021-09-28 and may be subject to change. MOLECULAR AND CELLULAR BIOLOGY, Feb. 2005, p. 1402–1414 Vol. 25, No. 4 0270-7306/05/$08.00ϩ0 doi:10.1128/MCB.25.4.1402–1414.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved. Divergent Mitochondrial and Endoplasmic Reticulum Association of DMPK Splice Isoforms Depends on Unique Sequence Arrangements in Tail Anchors† Rene´ E. M. A. van Herpen,1 Ralph J. A. Oude Ophuis,1 Mietske Wijers,1 Miranda B. Bennink,2 Fons A. J. van de Loo,2 Jack Fransen,1 Be´ Wieringa,1* and Derick G. Wansink1 Department of Cell Biology1 and Rheumatology Research and Advanced Therapeutics,2 Nijmegen Center for Molecular Life Sciences, University Medical Center, Nijmegen, The Netherlands Received 3 September 2004/Returned for modification 23 September 2004/Accepted 10 November 2004 Myotonic dystrophy protein kinase (DMPK) is a Ser/Thr-type protein kinase with unknown function, originally identified as the product of the gene that is mutated by triplet repeat expansion in patients with myotonic dystrophy type 1 (DM1). Alternative splicing of DMPK transcripts results in multiple protein isoforms carrying distinct C termini. Here, we demonstrate by expressing individual DMPKs in various cell ؊/؊ types, including C2C12 and DMPK myoblast cells, that unique sequence arrangements in these tails control the specificity of anchoring into intracellular membranes.
    [Show full text]
  • Kinase Profiling Book
    Custom and Pre-Selected Kinase Prof iling to f it your Budget and Needs! As of July 1, 2021 19.8653 mm 128 196 12 Tyrosine Serine/Threonine Lipid Kinases Kinases Kinases Carna Biosciences, Inc. 2007 Carna Biosciences, Inc. Profiling Assays available from Carna Biosciences, Inc. As of July 1, 2021 Page Kinase Name Assay Platform Page Kinase Name Assay Platform 4 ABL(ABL1) MSA 21 EGFR[T790M/C797S/L858R] MSA 4 ABL(ABL1)[E255K] MSA 21 EGFR[T790M/L858R] MSA 4 ABL(ABL1)[T315I] MSA 21 EPHA1 MSA 4 ACK(TNK2) MSA 21 EPHA2 MSA 4 AKT1 MSA 21 EPHA3 MSA 5 AKT2 MSA 22 EPHA4 MSA 5 AKT3 MSA 22 EPHA5 MSA 5 ALK MSA 22 EPHA6 MSA 5 ALK[C1156Y] MSA 22 EPHA7 MSA 5 ALK[F1174L] MSA 22 EPHA8 MSA 6 ALK[G1202R] MSA 23 EPHB1 MSA 6 ALK[G1269A] MSA 23 EPHB2 MSA 6 ALK[L1196M] MSA 23 EPHB3 MSA 6 ALK[R1275Q] MSA 23 EPHB4 MSA 6 ALK[T1151_L1152insT] MSA 23 Erk1(MAPK3) MSA 7 EML4-ALK MSA 24 Erk2(MAPK1) MSA 7 NPM1-ALK MSA 24 Erk5(MAPK7) MSA 7 AMPKα1/β1/γ1(PRKAA1/B1/G1) MSA 24 FAK(PTK2) MSA 7 AMPKα2/β1/γ1(PRKAA2/B1/G1) MSA 24 FER MSA 7 ARG(ABL2) MSA 24 FES MSA 8 AurA(AURKA) MSA 25 FGFR1 MSA 8 AurA(AURKA)/TPX2 MSA 25 FGFR1[V561M] MSA 8 AurB(AURKB)/INCENP MSA 25 FGFR2 MSA 8 AurC(AURKC) MSA 25 FGFR2[V564I] MSA 8 AXL MSA 25 FGFR3 MSA 9 BLK MSA 26 FGFR3[K650E] MSA 9 BMX MSA 26 FGFR3[K650M] MSA 9 BRK(PTK6) MSA 26 FGFR3[V555L] MSA 9 BRSK1 MSA 26 FGFR3[V555M] MSA 9 BRSK2 MSA 26 FGFR4 MSA 10 BTK MSA 27 FGFR4[N535K] MSA 10 BTK[C481S] MSA 27 FGFR4[V550E] MSA 10 BUB1/BUB3 MSA 27 FGFR4[V550L] MSA 10 CaMK1α(CAMK1) MSA 27 FGR MSA 10 CaMK1δ(CAMK1D) MSA 27 FLT1 MSA 11 CaMK2α(CAMK2A) MSA 28
    [Show full text]
  • Combined Inhibition of MEK and Plk1 Has Synergistic Anti-Tumor Activity in NRAS Mutant Melanoma
    Combined inhibition of MEK and Plk1 has synergistic anti-tumor activity in NRAS mutant melanoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Posch, C., B. Cholewa, I. Vujic, M. Sanlorenzo, J. Ma, S. Kim, S. Kleffel, et al. 2015. “Combined inhibition of MEK and Plk1 has synergistic anti-tumor activity in NRAS mutant melanoma.” The Journal of investigative dermatology 135 (10): 2475-2483. doi:10.1038/jid.2015.198. http://dx.doi.org/10.1038/jid.2015.198. Published Version doi:10.1038/jid.2015.198 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:26860102 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA HHS Public Access Author manuscript Author Manuscript Author ManuscriptJ Invest Author ManuscriptDermatol. Author Author Manuscript manuscript; available in PMC 2016 April 01. Published in final edited form as: J Invest Dermatol. 2015 October ; 135(10): 2475–2483. doi:10.1038/jid.2015.198. Combined inhibition of MEK and Plk1 has synergistic anti-tumor activity in NRAS mutant melanoma C Posch#1,2,3,*, BD Cholewa#4, I Vujic1,3, M Sanlorenzo1,5, J Ma1, ST Kim1, S Kleffel2, T Schatton2, K Rappersberger3, R Gutteridge4, N Ahmad4, and S Ortiz/Urda1 1 University of California San Francisco, Department of Dermatology, Mt. Zion Cancer Research
    [Show full text]
  • Lenalidomide Induces Cell Death in an MDS-Derived Cell Line with Deletion of Chromosome 5Q by Inhibition of Cytokinesis
    Leukemia (2010) 24, 748–755 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Lenalidomide induces cell death in an MDS-derived cell line with deletion of chromosome 5q by inhibition of cytokinesis A Matsuoka1, A Tochigi1, M Kishimoto1, T Nakahara1, T Kondo1, T Tsujioka1, T Tasaka1, Y Tohyama2 and K Tohyama1 1Department of Laboratory Medicine, Kawasaki Medical School, Okayama, Japan; and 2Division of Biochemistry, Faculty of Pharmaceutical Sciences, Himeji Dokkyo University, Hyogo, Japan Myelodysplastic syndromes (MDS) are a group of hematopoietic higher-risk groups with del(5q) that are susceptible to leukemic stem cell disorders characterized by refractory cytopenias transformation.6 Several hematopoiesis-related genes and tumor and susceptibility to leukemic transformation. On a subset of suppressor genes are located at 5q locus, and SPARC,7 MDS patients with deletion of the long arm of chromosome5 8 9 10 11 (del(5q)), lenalidomide exerts hematological and cytogenetic CTNNA1, EGR1, RPS14 and CDC25C are reported as effects, but the underlying pharmacological mechanisms are the candidate genes of MDS with del(5q) or 5q- syndrome. not fully understood. In this study, we have investigated the Lenalidomide, a derivative of thalidomide, is shown to in vitro effects of lenalidomide on an MDS-derived cell line, exert plenty of biological actions including inhibition of MDS-L, which carries del(5q) and complex chromosome angiogenesis,12 suppression of proinflammatory cytokine abnormalities. We found that the growth of MDS-L cells was production such as TNF-a,13 enhancement of T- and NK-cell specifically suppressed mainly by apoptosis, and in addition, 14–16 multinucleated cells were frequently formed and finally died activation.
    [Show full text]
  • PDF Hosted at the Radboud Repository of the Radboud University Nijmegen
    PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/85871 Please be advised that this information was generated on 2021-09-29 and may be subject to change. ISOFORMS IN MUSCLE AND BRAIN CELLS localization and function • ralph j.a. oude ophuis • 2011 9 789088 912344 > ISBN 978-90-8891234,-4 DMPK ISOFORMS IN MUSCLE AND BRAIN CELLS LOCALIZATION AND FUNCTION Voor het bijwonen van de openbare verdediging van het proefschrift van RALPH J.A. OUDE OPHUIS DMPK ISOFORMS IN MUSCLE AND BRAIN CELLS LOCALIZATION AND FUNCTION op vrijdag 1 april 2011 om 13:00u precies in de Aula van de Radboud Universiteit Nijmegen aan de Comeniuslaan 2 te Nijmegen Na afloop van de verdediging is er een receptie ter plaatse PARANIMFEN Susan Mulders [email protected] Rinske van de Vorstenbosch r.vandevorstenbosch(§) ncmls.ru.nl DMPK ISOFORMS IN MUSCLE AND BRAIN CELLS LOCALIZATION AND FUNCTION ISBN-13 978-90-8891234-4 ISBN-10 90-8891-234-3 Printed by Proefsohriftmaken.nl || Printyourthesis.com Published by Uitgeverij BOXPress, Oisterwijk DMPK ISOFORMS IN MUSCLE AND BRAIN CELLS LOCALIZATION AND FUNCTION Een wetenschappelijke proeve op het gebied van de Medische Wetenschappen Proefschrift ter verkrijging van de graad van doctor aan de Radboud Universiteit Nijmegen op gezag van de rector magnificus prof. mr. S.C.J.J. Kortmann, volgens besluit van het college van decanen in het openbaar te verdedigen op vrijdag 1 april 2011 om 13:00 uur precies door Raphaël Johannes Antonius Oude Ophuis geboren op 24 oktober 1978 te Sint-Oedenrode Promotor Prof.
    [Show full text]
  • Regulation of P27kip1 and P57kip2 Functions by Natural Polyphenols
    biomolecules Review Regulation of p27Kip1 and p57Kip2 Functions by Natural Polyphenols Gian Luigi Russo 1,* , Emanuela Stampone 2 , Carmen Cervellera 1 and Adriana Borriello 2,* 1 National Research Council, Institute of Food Sciences, 83100 Avellino, Italy; [email protected] 2 Department of Precision Medicine, University of Campania “Luigi Vanvitelli”, 81031 Napoli, Italy; [email protected] * Correspondence: [email protected] (G.L.R.); [email protected] (A.B.); Tel.: +39-0825-299-331 (G.L.R.) Received: 31 July 2020; Accepted: 9 September 2020; Published: 13 September 2020 Abstract: In numerous instances, the fate of a single cell not only represents its peculiar outcome but also contributes to the overall status of an organism. In turn, the cell division cycle and its control strongly influence cell destiny, playing a critical role in targeting it towards a specific phenotype. Several factors participate in the control of growth, and among them, p27Kip1 and p57Kip2, two proteins modulating various transitions of the cell cycle, appear to play key functions. In this review, the major features of p27 and p57 will be described, focusing, in particular, on their recently identified roles not directly correlated with cell cycle modulation. Then, their possible roles as molecular effectors of polyphenols’ activities will be discussed. Polyphenols represent a large family of natural bioactive molecules that have been demonstrated to exhibit promising protective activities against several human diseases. Their use has also been proposed in association with classical therapies for improving their clinical effects and for diminishing their negative side activities. The importance of p27Kip1 and p57Kip2 in polyphenols’ cellular effects will be discussed with the aim of identifying novel therapeutic strategies for the treatment of important human diseases, such as cancers, characterized by an altered control of growth.
    [Show full text]
  • Rnai Screen Identifies a Synthetic Lethal Interaction Between PIM1 Overexpression and PLK1 Inhibition
    Published OnlineFirst April 25, 2014; DOI: 10.1158/1078-0432.CCR-13-3116 Clinical Cancer Cancer Therapy: Preclinical Research RNAi Screen Identifies a Synthetic Lethal Interaction between PIM1 Overexpression and PLK1 Inhibition Riet van der Meer1, Ha Yong Song2, Seong-Hoon Park2, Sarki A. Abdulkadir1, and Meejeon Roh2 Abstract Purpose: To identify genes whose depletion is detrimental to Pim1-overexpressing prostate cancer cells and to validate this finding in vitro and in vivo. Experimental Design: RNAi screening was used to identify genes whose depletion is detrimental to Pim1-overexpressing cells. Our finding was validated using shRNA or PLK1-specific inhibitor BI 2536. Xenograft studies were performed using both PLK1-knockdown cells and BI 2536 to investigate the effects of PLK1 inhibition on tumorigenesis in Pim1-overexpressing cells. Finally, PLK1 and PIM1 expression patterns in human prostate tumors were examined by immunohistochemistry using tissue microarrays. Results: We identified the mitotic regulator polo-like kinase (PLK1) as a gene whose depletion is particularly detrimental to the viability of Pim1-overexpressing prostate cancer. Inhibition of PLK1 by shRNA or BI 2536 in Pim1-overexpressing prostate cancer xenograft models resulted in a dramatic inhibition of tumor progression. Notably, Pim1-overexpressing cells were more prone to mitotic arrest followed by apoptosis due to PLK1 inhibition than control cells. Furthermore, inhibition of PLK1 led to the reduction of MYC protein levels both in vitro and in vivo. Our data also suggest that PIM1 and PLK1 physically interact and PIM1 might phosphorylate PLK1. Finally, PLK1 and PIM1 are frequently co- expressed in human prostate tumors, and co-expression of PLK1 and PIM1 was significantly correlated to higher Gleason grades.
    [Show full text]