cells Article HIPK2 Phosphorylates the Microtubule-Severing Enzyme Spastin at S268 for Abscission 1, , 1, 1 2 Alessandra Pisciottani y z, Loredana Biancolillo y, Manuela Ferrara , Davide Valente , Francesca Sardina 1, Laura Monteonofrio 2,§, Serena Camerini 3, Marco Crescenzi 3 , Silvia Soddu 2 and Cinzia Rinaldo 1,2,* 1 Institute of Molecular Biology and Pathology (IBPM), National Research Council (CNR), c/o Sapienza University, 00185 Rome, Italy 2 Unit of Cellular Networks and Molecular Therapeutic Targets; IRCCS-Regina Elena National Cancer Institute, 00144 Rome, Italy 3 Core Facilities, Italian National Institute of Health, 00161 Rome, Italy * Correspondence: [email protected] These Authors contributed equally to the work. y Present address: Vita-Salute San Raffaele University, 20132 Milan, Italy. z § Present address: Laboratory of Cardiovascular Science, NIA/NIH Baltimore, MD 21224, USA. Received: 30 May 2019; Accepted: 3 July 2019; Published: 5 July 2019 Abstract: Abscission is the final step of cell division, mediating the physical separation of the two daughter cells. A key player in this process is the microtubule-severing enzyme spastin that localizes at the midbody where its activity is crucial to cut microtubules and culminate the cytokinesis. Recently, we demonstrated that HIPK2, a multifunctional kinase involved in several cellular pathways, contributes to abscission and prevents tetraploidization. Here, we show that HIPK2 binds and phosphorylates spastin at serine 268. During cytokinesis, the midbody-localized spastin is phosphorylated at S268 in HIPK2-proficient cells. In contrast, no spastin is detectable at the midbody in HIPK2-depleted cells. The non-phosphorylatable spastin-S268A mutant does not localize at the midbody and cannot rescue HIPK2-depleted cells from abscission defects. In contrast, the phosphomimetic spastin-S268D mutant localizes at the midbody and restores successful abscission in the HIPK2-depleted cells. These results show that spastin is a novel target of HIPK2 and that HIPK2-mediated phosphorylation of spastin contributes to its midbody localization for successful abscission. Keywords: HIPK2; spastin; abscission; midbody; phosphorylation 1. Introduction Abscission is the final step of cytokinesis and consists of an orderly sequence of dynamic events that allow the final separation of the two nascent daughter cells, safeguarding the correct distribution of genomic and cytoplasmic materials in cell division [1,2]. At the end of cytokinesis, several membrane remodeling factors of the endosomal sorting complex required for transport-I (ESCRT-I) and -III pathways, such as Alix and CHMPs proteins, and the microtubule (MT)-severing enzyme spastin are sequentially recruited at the midbody, the organelle-like platform at the intercellular bridge [3]. In particular, CHMP1B recruits spastin, whose activity results in MT clearance leading to the physical separation of the two daughter cells [4–6]. This process depends on dramatic rearrangement of the cytoskeleton and membrane remodeling occurring at the midbody. These events are finely orchestrated by several kinases, such as Aurora-B, PLK1, and Citron kinase, which act on multiple targets to regulate the local levels, the interactions, and the functions of key players of cytokinesis [3,7,8]. Cells 2019, 8, 684; doi:10.3390/cells8070684 www.mdpi.com/journal/cells Cells 2019, 8, 684 2 of 12 Spastin belongs to the family of the AAA (associated with diverse cellular activities) ATPases. The ATPase domain (342–599 aa) is preceded by the MT binding domain (MTBD, 270–328 aa) and the MT-interacting and endosomal-trafficking domain (MIT, 116–194 aa) that is necessary for midbody recruitment through CHMP1B interaction [4,5]. Four spastin isoforms have been identified, generated by two alternative start codons (full-length M1 and the shorter isoform lacking the first 86 aa, M87) and differential splicing of the exon 4, M1D4, and M87D4, respectively [6,9]. M87 is ubiquitously expressed, whereas M1 expression appears to be restricted to neuronal cells [6,9,10]. Spastin has been reported to localize at regions of active MT remodeling and its depletion results in strongly delayed abscission, associated with aberrant midbody phenotype [5,11,12]. In interphase, spastin shows a diffuse staining in the nucleus and a punctate pattern in the cytoplasm, where it localizes at the centrosome, endoplasmic reticulum, endosomes, and lipid droplets [13–15]. Instead, during cell division, spastin localizes at the spindle poles, at the resealing nuclear envelope, and at the midbody [5,15,16]. HIPK2 is a highly conserved multifunctional tyrosine-regulated serine/threonine kinase [17–19], which phosphorylates a large number of targets, contributing to the fine-tuning of several pathways [20,21]. We previously observed that HIPK2-null or -depleted cells undergo cytokinesis delay and failure, accumulating elongated midbodies and tetraploid cells [22,23]. During cytokinesis, HIPK2 is recruited at the midbody in an Aurora-B-dependent manner [24] and, there, phosphorylates the extrachromosomal histone H2B at S14 [22]. This phosphorylation is not required for the midbody localization of H2B, but it is necessary for successful cytokinesis [22,24], supporting the inclusion of HIPK2 among the kinases that regulate cytokinesis. Since these kinases usually work on multiple targets, we searched for additional cytokinesis substrates of HIPK2. Here, we identify spastin as a novel abscission target of HIPK2 and show that HIPK2-mediated phosphorylation of spastin at S268 is required for the midbody localization of spastin to drive abscission. 2. Materials and Methods 2.1. Cell Culture Conditions and Expression Vectors HeLa, U2OS, and A549 cells were cultured at 37 ◦C and 5% CO2 in DMEM GlutaMAX, supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Life Technologies, Carlsbad, CA, USA); they were enriched in telophase as in [22]. The following plasmids were employed: Flag-myc empty vector (pCMV6-Entry) and flag-myc-tagged spastin-expressing vectors from OriGene Technologies (Rockville, MD, USA). Spastin mutants were obtained by site-directed mutagenesis in the Spastin-flag-myc-tagged vector using a QuikChange Lightening Kit (Agilent, Cernusco sul Naviglio, Italy) and analyzed by sequencing. Vectors were transfected by using Lipofectamine LTX and Plus reagent (Life Technologies). 2.2. RNA Interference (RNAi) and Real-Time (Reverse Transcription)-PCR (Real-Time (RT)-PCR) HIPK2 RNAi was obtained by using human-specific validated stealth siRNAs (a mix of three different siRNAs by Life Technologies, as in [22]). Spastin RNAi was obtained by using a mix of specific validated stealth siRNAs by Life Technologies, targeting sequences common to all spastin isoforms. siRNAs were transfected using Lipofectamine RNAi MAX (Life Technologies). RNA extraction and real-time (RT)-PCR were performed as in [22], and relative fold-change were determined by the 2-DDCt method using GAPDH mRNA as normalizer. Primers for amplification were as in [22]. SiRNA sequences were the following: siHIPK2#1: CCCGAGUCAGUAUCCAGCCCAAUUU; siHIPK2#2: CCACCAACCUGACCAUGACCUUUAA; siHIPK2#3: CAGGGUUUGCCUGCUGAAUAUUUAU; siSpastin#1: CCAGUGAGAUGAGAAAUAUUCGAUU; siSpastin#2: CCAGUGAGAUGAGAAAUAUUCGAUU. Cells 2019, 8, 684 3 of 12 2.3. Western Blot (WB) and Co-Immunoprecipitation (co-IP) For WB, total cell extracts (TCEs) were prepared in RIPA buffer (50mM Tris-HCl (pH 8), 600 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 1% NP40 and 1mM EDTA) supplemented with protease and phosphatase inhibitors (Roche, Basel, Switzerland). For co-IP, TCEs were prepared in non-denaturating lysis buffer (50 mM Tris-HCl (pH 8), 150 mM NaCl, 1% NP40 and 5 mM EDTA), supplemented with protease and phosphatase inhibitors (Roche, Basel, Switzerland). Proteins were resolved by SDS-PAGE using Bolt Novex Bis-Tris Gels 4%–12% (Life Technologies). Immunoreactivity was determined using ECL-Prime (Amersham, Buckinghamshire, UK), image acquisition and densitometric analysis were performed with Image Lab software (BIORAD, Hercules, CA, USA). The following antibodies (Abs) were employed: anti-HIPK2 (rat monoclonal Ab C5C6, kindly provided by Dr. L. Schmitz); anti-GST (1:500), anti-GAPDH (1:1000), anti-His tag (1:200), and anti-spastin (1:100; sp311/1 mouse monoclonal Ab), all provided by Santa Cruz Biotechnology, Dallas, TX, USA; anti-alpha-tubulin (1:1000; Immunological Science, Rome, Italy); anti-Flag (mouse monoclonal Ab, TA50011, OriGene Technologies, and rabbit polyclonal Ab provided by Sigma-Aldrich, St. Louis, MO, USA); anti-GFP (mouse monoclonal Ab provided by Roche and rabbit polyclonal Ab provided by Santa Cruz Biotechnology); and anti-HRP-conjugated goat anti-mouse,-rat, and -rabbit (Cell Signaling Technology, Danvers, MA, USA). 2.4. Kinase Assay and Recombinant Proteins In vitro kinase assays were performed as in [19], by using HIPK2 Kinase domain (kind gift of Dr. Montemiglio) as the enzymatic source and the following recombinant proteins as substrates: His6-tagged spastin 79–310 (ag18866, Proteintech, Rosemont, IL, USA) and spastin M1 (TP320458, OriGene technologies). 2.5. GST Pull-Down and Binding Assay GST pull-down and binding assay were performed as in [24]. In particular, GST and GST-HIPK2 were obtained by H1299 T7-vaccinia virus infection followed by transfection as described in [22] and were incubated with 100 ng of recombinant His6-tagged spastin 79–310 (Proteintech) in 50 mM Tris-HCl, pH 7.5, 150 nM NaCl. Bound Spastin was analyzed by WB. 2.6. Mass