DOCSLIB.ORG

Genomic Approaches to Understanding Variable Expressivity in Alagille Syndrome and Genetic Susceptibility to Biliary Atresia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genomic Approaches to Understanding Variable Expressivity in Alagille Syndrome and Genetic Susceptibility to Biliary Atresia University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2013 Genomic Approaches to Understanding Variable Expressivity in Alagille Syndrome and Genetic Susceptibility to Biliary Atresia Ellen Tsai University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, and the Genetics Commons Recommended Citation Tsai, Ellen, "Genomic Approaches to Understanding Variable Expressivity in Alagille Syndrome and Genetic Susceptibility to Biliary Atresia" (2013). Publicly Accessible Penn Dissertations. 932. https://repository.upenn.edu/edissertations/932 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/932 For more information, please contact [email protected]. Genomic Approaches to Understanding Variable Expressivity in Alagille Syndrome and Genetic Susceptibility to Biliary Atresia Abstract The biliary system facilitates transport of bile from the liver, where it is produced, to the gall bladder, where it is stored and later released to aid digestion. Obstruction and defects in the biliary system are a primary indication of liver transplantation in children. Alagille syndrome (ALGS) and biliary atresia (BA) are two cholangiopathies with different etiopathology, but both affect bile flow and can lead ot end-stage liver disease. ALGS is a dominant, multisystemic disease caused by mutations in JAG1 or NOTCH2 characterized by intrahepatic ductopenia and variable expressivity. BA is a multifactorial disease characterized by necroinflammatory obliteration of the extrahepatic biliary tree with unknown etiology. I used genomic tools including genome-wide gene expression analysis, genome-wide association (GWA) studies of single nucleotide polymorphisms (SNPs) and copy number variation (CNVs), and exome sequence analysis to uncover the genetic component to variable expressivity in ALGS and susceptibility to BA. In the first part of this thesis, I searched for genetic modifiers of the ALGS phenotype by investigating the effects of the non-mutated JAG1 allele, characterizing downstream gene expression of Notch signaling, and performing a SNP and CNV GWA studies of liver disease severity. This work revealed that cardiac defects are correlated with liver disease severity and the presence of butterfly erv tebrae. I uncovered an enhancer element upstream of THBS2 that may affect the progression of liver disease in ALGS patients. In the second part of this thesis, I looked for markers of genetic susceptibility to BA, using an association study, exome sequencing of unrelated patients, and exome sequencing and CNV analysis of familial recurrence of BA-associated phenotypes. This work suggested several BA candidate genes, including FOXA2, which we propose as a BA susceptibility gene. Additionally, fine mapping of a previously reported susceptibility locus demonstrated an intronic risk allele in ADD3. Exome sequencing of candidate genes and a pathway-enriched analysis revealed alterations in several other genes that support the hypothesis that BA is a genetically heterogeneous disorder. This work identifies multiple areas for future research to better understand the genetics of these two biliary disorders. Degree Type Dissertation Degree Name Doctor of Philosophy (PhD) Graduate Group Genomics & Computational Biology First Advisor Nancy B. Spinner Second Advisor Marcella Devoto Keywords copy number variation, exome sequencing, genome-wide association study Subject Categories Bioinformatics | Genetics This dissertation is available at ScholarlyCommons: https://repository.upenn.edu/edissertations/932 GENOMIC APPROACHES TO UNDERSTANDING VARIABLE EXPRESSIVITY IN ALAGILLE SYNDROME AND GENETIC SUSCEPTIBILITY TO BILIARY ATRESIA COPYRIGHT 2013 Ellen A. Tsai This work is licensed under the Creative Commons Attribution- NonCommercial-ShareAlike 3.0 License To view a copy of this license, visit http://creativecommons.org/licenses/by-ny-sa/2.0/ To my father, Thank you for the sacrifices you have made for us. iii ACKNOWLEDGMENTS Each and every graduate experience is unique, and mine has been blessed with a wealth of resources and incredible opportunities. Foremost, I would like to thank my advisors, Nancy and Marcella, for their support and supervision. They have given me expert advice over the past five years not only in science but also in life. Their boundless positive energy helped carry me through the ups and downs of graduate research. I am truly grateful for the opportunity to conduct research in such nourishing environment. I would also like to thank members of the laboratory. Their kindness and friendship have created such a pleasant atmosphere. I am indebted to many colleagues for their help throughout the years: Laura C, Joanne, Rob, Jen, Melissa, Anne, Laura L, Grace, Henry, Chris, Debbie, Ramki, Ying, and Alex. I have also been fortunate to mentor some incredibly talented students, Carly, Matt, and Andrew: I have learned much from you as well. Because of the interdisciplinary nature of genomics research, I have been fortunate to work with many clinicians and scientists. I would like to thank Barbara Haber, Kathy Loomes, Randy Matthews, Pierre Russo, Ian Krantz, and Li-San Wang for their scientific discussions and collaboration. In addition, I would like to also thank the members of my committee, Shane Jensen, Paul Gadue, and Mingyao Li, for their advice throughout the progress of my dissertation work. At Penn, I have made so many amazing friends who challenged me to grow as a person. Last but not least, I am grateful for the support from my wonderful family. They believed in me even during the times when I doubted myself. This dissertation would have impossible without all of these wonderful people who supported and motivated me throughout this entire process. They have my unyielding gratitude. This research was supported by NIH grants, R01-DK081702 and R01-DK090045, the Fred and Suzanne Biesecker Foundation, and a NHGRI training grant, T32-HG000046. iv ABSTRACT GENOMIC APPROACHES TO UNDERSTANDING VARIABLE EXPRESSIVITY IN ALAGILLE SYNDROME AND GENETIC SUSCEPTIBILITY TO BILIARY ATRESIA Ellen A. Tsai Nancy B. Spinner, PhD Marcella Devoto, PhD The biliary system facilitates transport of bile from the liver, where it is produced, to the gall bladder, where it is stored and later released to aid digestion. Obstruction and defects in the biliary system are a primary indication of liver transplantation in children. Alagille syndrome (ALGS) and biliary atresia (BA) are two cholangiopathies with different etiopathology, but both affect bile flow and can lead to end-stage liver disease. ALGS is a dominant, multisystemic disease caused by mutations in JAG1 or NOTCH2 characterized by intrahepatic ductopenia and variable expressivity. BA is a multifactorial disease characterized by necroinflammatory obliteration of the extrahepatic biliary tree with unknown etiology. I used genomic tools including genome-wide gene expression analysis, genome-wide association (GWA) studies of single nucleotide polymorphisms (SNPs) and copy number variation (CNVs), and exome sequence analysis to uncover the genetic component to variable expressivity in ALGS and susceptibility to BA. In the first part of this thesis, I searched for genetic modifiers of the ALGS phenotype by investigating the effects of the non-mutated JAG1 allele, characterizing downstream gene expression of Notch signaling, and performing a SNP and CNV GWA studies of liver disease severity. This work revealed that cardiac defects are correlated with liver disease severity and the presence of butterfly vertebrae. I uncovered an enhancer element upstream of THBS2 that may affect the progression of liver disease in ALGS patients. In the second part of this thesis, I looked for markers of genetic susceptibility to BA, using an association study, exome sequencing of unrelated patients, and exome sequencing and CNV analysis of familial recurrence of BA- v associated phenotypes. This work suggested several BA candidate genes, including FOXA2, which we propose as a BA susceptibility gene. Additionally, fine mapping of a previously reported susceptibility locus demonstrated an intronic risk allele in ADD3. Exome sequencing of candidate genes and a pathway-enriched analysis revealed alterations in several other genes that support the hypothesis that BA is a genetically heterogeneous disorder. This work identifies multiple areas for future research to better understand the genetics of these two biliary disorders. vi TABLE OF CONTENTS ACKNOWLEDGMENTS ....................................................................................... iv! ABSTRACT ........................................................................................................... v! LIST OF TABLES ................................................................................................. xi! LIST OF ILLUSTRATIONS ................................................................................ xiii! CHAPTER 1: Introduction ................................................................................... 1! 1.1! Approaches to Understanding the Complexity of Genetic Disorders .................................... 1! 1.1.1! Genetic Models for Modifier and Susceptibility Genes ................................................... 1! 1.1.2! Methods to Detect Genes for Complex Disorders .......................................................... 4! 1.2 The Hepatobiliary System
Load more

Recommended publications
  • Tumor Initiating but Differentiated Luminal-Like Breast Cancer Cells Are Highly Invasive in the Absence of Basal-Like Activity
    Tumor initiating but differentiated luminal-like breast cancer cells are highly invasive in the absence of basal-like activity Jiyoung Kima, René Villadsena, Therese Sørlieb,c, Louise Fogha, Signe Z. Grønlunda,d, Agla J. Fridriksdottira, Irene Kuhne, Fritz Rankf,1, Vera Timmermans Wielengaf, Hiroko Solvangb,g, Paul A. W. Edwardsh, Anne-Lise Børresen-Daleb,i, Lone Rønnov-Jessend, Mina J. Bisselle,2, and Ole William Petersena,2 aDepartment of Cellular and Molecular Medicine, Centre for Biological Disease Analysis and Danish Stem Cell Centre, Faculty of Health Sciences, University of Copenhagen, DK-2200 Copenhagen N, Denmark; bDepartment of Genetics, Institute for Cancer Research, Oslo University Hospital Radiumhospitalet, Montebello 0310, Oslo, Norway; cCancer Stem Cell Innovation Center, Oslo University Hospital, Norwegian Radium Hospital, 0310 Oslo, Norway; dCell and Developmental Biology, Department of Biology, University of Copenhagen, DK-2100 Copenhagen Ø, Denmark; eLife Sciences Division, Berkeley National Laboratory, Berkeley, CA 94720; fDepartment of Pathology, Rigshospitalet, DK-2100 Copenhagen Ø, Denmark; gDepartment of Biostatistics, Institute of Basic Medical Science, University of Oslo, 0317 Oslo, Norway; hDepartment of Pathology and Hutchison/MRC Research Centre, University of Cambridge, Cambridge CB2 0X2, United Kingdom; and iK. G. Jebsen Center for Breast Cancer Research, Institute for Clinical Medicine, Faculty of Clinical Medicine, University of Oslo, 0318 Oslo, Norway Contributed by Mina J. Bissell, February 28, 2012 (sent for review January 10, 2012) The majority of human breast cancers exhibit luminal epithelial these contradictions is the concept of tumor cell plasticity, i.e., the differentiation. However, most aggressive behavior, including possibility that differentiated luminal cells must acquire basal-like invasion and purported cancer stem cell activity, are considered traits to become malignant (10–14).
    [Show full text]
  • Analysis and Identification of Bite Marks in Forensic Casework
    ORIGINAL | http://dx.doi.org/10.4172/1994-8220.1000102 J Psychiatry 2014;17:475-482 Handedness in schizophrenia and schizoaffective disorder in an afrikaner founder population RH Mataboge¹*, M Joubert¹, JC Jordaan², F Reyneke2, JL Roos1 ¹University of Pretoria, Department of Psychiatry, Pretoria, South Africa ²University of Pretoria, Department of Statistics, Pretoria, South Africa Abstract Objective: An association between the Leucine-rich repeat trans membrane neuronal 1 gene (LRRTM1), schizophrenia/ schizoaffective disorder and handedness was recently claimed to be established. This study aimed to test the hypothesis that Afrikaner patients with schizophrenia/schizoaffective disorder are more non-right handed than their non-affected first- degree relatives and that of two separate control groups. The association between handedness, gender and age at onset of illness in the patients group was also determined. Method: Two cross-sectional studies were carried out, which compared the handedness of a group of 100 (30 females and 70 males) Afrikaner patients with schizophrenia/schizoaffective disorder, their non-affected first-degree relatives, and two separate control groups. Handedness was determined by the Edinburg Handedness Inventory (EHI). Results: Patients were found to be more right-handed than expected with only 17 out of 100 being non-right-handed compared to 11 out of 100 non-affected relatives; 36 out of 100 students and 75 out of 500 non- affected Afrikaner participants. The students were significantly more non-right handed than the patient and family groups but no difference in handedness was found when comparing the patients, family members and 500 participant control group. There was no significant difference between age at onset of illness and handedness.
    [Show full text]
  • OR5K2 (NM 001004737) Human Tagged ORF Clone – RG214545
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG214545 OR5K2 (NM_001004737) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: OR5K2 (NM_001004737) Human Tagged ORF Clone Tag: TurboGFP Symbol: OR5K2 Synonyms: OR3-9 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG214545 representing NM_001004737 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTTGAAGAAAATCATACCATGAAAAATGAGTTTATCCTCACAGGATTTACAGATCACCCTGAGCTGA AGACTCTGCTGTTTGTGGTGTTCTTTGCCATCTATCTGATCACCGTGGTGGGGAATATTAGTTTGGTGGC ACTGATATTTACACACTGTCGGCTTCACACACCAATGTACATCTTTCTGGGAAATCTGGCTCTTGTGGAT TCTTGCTGTGCCTGTGCTATTACCCCCAAAATGTTAGAGAACTTCTTTTCTGAGGGCAAAAGGATTTCCC TCTATGAATGTGCAGTACAGTTTTATTTTCTTTGCACTGTGGAAACTGCAGACTGCTTTCTTCTGGCAGC AGTGGCCTATGACCGCTATGTGGCCATCTGCAACCCACTGCAGTACCACATCATGATGTCCAAGAAACTC TGCATTCAGATGACCACAGGCGCCTTCATAGCTGGAAATCTGCATTCCATGATTCATGTAGGGCTTGTAT TTAGGTTAGTTTTCTGTGGATTGAATCACATCAACCACTTTTACTGTGATACTCTTCCCTTGTATAGACT CTCCTGTGTTGACCCTTTCATCAATGAACTGGTTCTATTCATCTTCTCAGGTTCAGTTCAAGTCTTTACC ATAGGTAGTGTCTTAATATCTTATCTCTATATTCTTCTTACTATTTTCAGAATGAAATCCAAGGAGGGAA GGGCCAAAGCCTTTTCTACTTGTGCATCCCACTTTTCATCAGTTTCATTATTCTATGGATCTATTTTTTT CCTATACATTAGACCAAATTTGCTTGAAGAAGGAGGTAATGATATACCAGCTGCTATTTTATTTACAATA GTAGTTCCCTTACTAAATCCTTTCATTTATAGTCTGAGAAACAAGGAAGTAATAAGTGTCTTAAGAAAAA
    [Show full text]
  • Journal of Medical Genetics April 1992 Vol 29 No4 Contents Original Articles
    Journal of Medical Genetics April 1992 Vol 29 No4 Contents Original articles Beckwith-Wiedemann syndrome: a demonstration of the mechanisms responsible for the excess J Med Genet: first published as on 1 April 1992. Downloaded from of transmitting females C Moutou, C Junien, / Henry, C Bonai-Pellig 217 Evidence for paternal imprinting in familial Beckwith-Wiedemann syndrome D Viljoen, R Ramesar 221 Sex reversal in a child with a 46,X,Yp+ karyotype: support for the existence of a gene(s), located in distal Xp, involved in testis formation T Ogata, J R Hawkins, A Taylor, N Matsuo, J-1 Hata, P N Goodfellow 226 Highly polymorphic Xbol RFLPs of the human 21 -hydroxylase genes among Chinese L Chen, X Pan, Y Shen, Z Chen, Y Zhang, R Chen 231 Screening of microdeletions of chromosome 20 in patients with Alagille syndrome C Desmaze, J F Deleuze, A M Dutrillaux, G Thomas, M Hadchouel, A Aurias 233 Confirmation of genetic linkage between atopic IgE responses and chromosome 1 1 ql 3 R P Young, P A Sharp, J R Lynch, J A Faux, G M Lathrop, W 0 C M Cookson, J M Hopkini 236 Age at onset and life table risks in genetic counselling for Huntington's disease P S Harper, R G Newcombe 239 Genetic and clinical studies in autosomal dominant polycystic kidney disease type 1 (ADPKD1) E Coto, S Aguado, J Alvarez, M J Menendez-DIas, C Lopez-Larrea 243 Short communication Evidence for linkage disequilibrium between D16S94 and the adult onset polycystic kidney disease (PKD1) gene S E Pound, A D Carothers, P M Pignatelli, A M Macnicol, M L Watson, A F Wright 247 Technical note A strategy for the rapid isolation of new PCR based DNA polymorphisms P R Hoban, M F Santibanez-Koref, J Heighway 249 http://jmg.bmj.com/ Case reports Campomelic dysplasia associated with a de novo 2q;1 7q reciprocal translocation I D Young, J M Zuccollo, E L Maltby, N J Broderick 251 A complex chromosome rearrangement with 10 breakpoints: tentative assignment of the locus for Williams syndrome to 4q33-q35.1 R Tupler, P Maraschio, A Gerardo, R Mainieri G Lanzi L Tiepolo 253 on September 26, 2021 by guest.
    [Show full text]
  • Alagille Watson Syndrome (JAG1) Sequencing & Deletion/Duplication
    Lab Dept: Anatomic Pathology Test Name: ALAGILLE WATSON SYNDROME (JAG1) SEQUENCING General Information Lab Order Codes: JAG1 Synonyms: Alagille Watson Syndrome; Cholestasis with Peripheral Pulmonary Stenosis; Arteriohepatic Dysplasia; Syndromatic Hepatic Ductular Hypoplasia; ALGS1 CPT Codes: Sequencing: 81407 – Molecular pathology Level 8 Deletion/Duplication- High Density Targeted Array 81406 – Molecular pathology Level 7 Test Includes: Analysis of bi-directional sequencing. Also includes a targeted array CGH analysis with exon-level resolution to evaluate for a deletion or duplication of one exon of this gene. Logistics Test Indications: Alagille Syndrome is one of the major forms of chronic liver disease in children and is an autosomal dominant disorder with high penetrance but variable expressivity. The main clinical findings include cholestatis due to bile duct paucity, a characteristic facial appearance, and cardiovascular, eye and skeletal abnormalities. Cardiovascular findings include tetralogy of Fallot or singular manifestations thereof, peripheral pulmonary artery stenosis, atrial and/or ventricular septal defects, and coarction of the aorta. Butterfly vertebra is the most common skeletal finding. Other findings include narrowing of interpeduncular spaces in the lumbar spine, spina bifida occulta, and short fingers and ulnae. Facial features consist of broad forehead, triangular face, prominent zygomatic arch and moderate hypertelorism. Posterior embryotoxon and retinal pigmentary changes are common opthalmological findings. ALGS1 is caused by mutations in the JAG1 gene. It encodes jagged-1, a ligand for the Notch receptors. Notch proteins are transmembrane receptors and are components of signaling pathways important for cell fate. JAG1 is expressed in the developing heart and other structures affected in Alagille syndrome. Over 90% of patients with Alagille syndrome have a mutation in the JAG1 gene.
    [Show full text]
  • The Hands to Say It
    Issue 91, February 2008 www.proteinspotlight.org The hands to say it Vivienne Baillie Gerritsen When I was a little girl, I thought that my left-handed classmates were special. I envied their difference. And I used to marvel at the way they crouched over their desk, embracing something invisible as they did their best to avoid smudging ink all over their sheet of paper. Left-handedness is special. But so is right-handedness. Humans are not the only animals to make use of their hands – or claws, or paws, or hooves - but they are the only ones who show a marked preference for either the left one, or the right one. If this is so, there must be a reason for it. And not only must there be a reason but it must translate a certain structure of our brain: an asymmetry somewhere. Indeed, our brain is divided into two hemispheres which are dedicated to processing different activities. One side looks after our dreams, while the other is far more down to earth. LRRTM1 is the first protein to have been discovered which seems to be directly involved in this brain asymmetry. Consequently, it influences the handedness of a human-being and, more astonishingly, may also predispose individuals to psychotic troubles such as schizophrenia. don’t have a distinct preference for one hand over the other. The passing of roles from hand to mind expresses a particular brain structure. In turn, the progressive use of speech has continued to mould our brain into a shape peculiar to the human species.
    [Show full text]
  • Copy Number Variation in Fetal Alcohol Spectrum Disorder
    Biochemistry and Cell Biology Copy number variation in fetal alcohol spectrum disorder Journal: Biochemistry and Cell Biology Manuscript ID bcb-2017-0241.R1 Manuscript Type: Article Date Submitted by the Author: 09-Nov-2017 Complete List of Authors: Zarrei, Mehdi; The Centre for Applied Genomics Hicks, Geoffrey G.; University of Manitoba College of Medicine, Regenerative Medicine Reynolds, James N.; Queen's University School of Medicine, Biomedical and Molecular SciencesDraft Thiruvahindrapuram, Bhooma; The Centre for Applied Genomics Engchuan, Worrawat; Hospital for Sick Children SickKids Learning Institute Pind, Molly; University of Manitoba College of Medicine, Regenerative Medicine Lamoureux, Sylvia; The Centre for Applied Genomics Wei, John; The Centre for Applied Genomics Wang, Zhouzhi; The Centre for Applied Genomics Marshall, Christian R.; The Centre for Applied Genomics Wintle, Richard; The Centre for Applied Genomics Chudley, Albert; University of Manitoba Scherer, Stephen W.; The Centre for Applied Genomics Is the invited manuscript for consideration in a Special Fetal Alcohol Spectrum Disorder Issue? : Keyword: Fetal alcohol spectrum disorder, FASD, copy number variations, CNV https://mc06.manuscriptcentral.com/bcb-pubs Page 1 of 354 Biochemistry and Cell Biology 1 Copy number variation in fetal alcohol spectrum disorder 2 Mehdi Zarrei,a Geoffrey G. Hicks,b James N. Reynolds,c,d Bhooma Thiruvahindrapuram,a 3 Worrawat Engchuan,a Molly Pind,b Sylvia Lamoureux,a John Wei,a Zhouzhi Wang,a Christian R. 4 Marshall,a Richard F. Wintle,a Albert E. Chudleye,f and Stephen W. Scherer,a,g 5 aThe Centre for Applied Genomics and Program in Genetics and Genome Biology, The Hospital 6 for Sick Children, Toronto, Ontario, Canada 7 bRegenerative Medicine Program, University of Manitoba, Winnipeg, Canada 8 cCentre for Neuroscience Studies, Queen's University, Kingston, Ontario, Canada.
    [Show full text]
  • Gene Expression Effects of Lithium and Valproic Acid in a Serotonergic Cell Line
    bioRxiv preprint doi: https://doi.org/10.1101/227652; this version posted December 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Gene expression effects of lithium and valproic acid in a serotonergic cell line. Diana Balasubramanian1, John F. Pearson2, Martin A. Kennedy1 1Gene Structure and Function Laboratory and Carney Centre for Pharmacogenomics, Department of Pathology, University of Otago, Christchurch, New Zealand2 2Biostatistics and Computational Biology unit, University of Otago, Christchurch. Correspondence to: Prof. M. A. Kennedy Department of Pathology University of Otago, Christchurch Christchurch, New Zealand Email: [email protected] Keywords: RNA-Seq, valproic acid, gene expression, mood stabilizer, pharmacogenomics bioRxiv preprint doi: https://doi.org/10.1101/227652; this version posted December 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Valproic acid (VPA) and lithium are widely used in the treatment of bipolar disorder. However, the underlying mechanism of action of these drugs is not clearly understood. We used RNA-Seq analysis to examine the global profile of gene expression in a rat serotonergic cell line (RN46A) after exposure to these two mood stabilizer drugs. Numerous genes were differentially regulated in response to VPA (log2 fold change ≥ 1.0; i.e.
    [Show full text]
  • 9, 2015 Glasgow, Scotland, United Kingdom Abstracts
    Volume 23 Supplement 1 June 2015 www.nature.com/ejhg European Human Genetics Conference 2015 June 6 - 9, 2015 Glasgow, Scotland, United Kingdom Abstracts EJHG_OFC.indd 1 4/1/2006 10:58:05 AM ABSTRACTS European Human Genetics Conference joint with the British Society of Genetics Medicine June 6 - 9, 2015 Glasgow, Scotland, United Kingdom Abstracts ESHG 2015 | GLASGOW, SCOTLAND, UK | WWW.ESHG.ORG 1 ABSTRACTS Committees – Board - Organisation European Society of Human Genetics ESHG Office Executive Board 2014-2015 Scientific Programme Committee European Society President Chair of Human Genetics Helena Kääriäinen, FI Brunhilde Wirth, DE Andrea Robinson Vice-President Members Karin Knob Han Brunner, NL Tara Clancy, UK c/o Vienna Medical Academy Martina Cornel, NL Alser Strasse 4 President-Elect Yanick Crow, FR 1090 Vienna Feliciano Ramos, ES Paul de Bakker, NL Austria Secretary-General Helene Dollfus, FR T: 0043 1 405 13 83 20 or 35 Gunnar Houge, NO David FitzPatrick, UK F: 0043 1 407 82 74 Maurizio Genuardi, IT E: [email protected] Deputy-Secretary-General Daniel Grinberg, ES www.eshg.org Karin Writzl, SI Gunnar Houge, NO Treasurer Erik Iwarsson, SE Andrew Read, UK Xavier Jeunemaitre, FR Mark Longmuir, UK Executive Officer Jose C. Machado, PT Jerome del Picchia, AT Dominic McMullan, UK Giovanni Neri, IT William Newman, UK Minna Nyström, FI Pia Ostergaard, UK Francesc Palau, ES Anita Rauch, CH Samuli Ripatti, FI Peter N. Robinson, DE Kristel van Steen, BE Joris Veltman, NL Joris Vermeesch, BE Emma Woodward, UK Karin Writzl, SI Board Members Liaison Members Yasemin Alanay, TR Stan Lyonnet, FR Martina Cornel, NL Martijn Breuning, NL Julie McGaughran, AU Ulf Kristoffersson, SE Pascal Borry, BE Bela Melegh, HU Thomas Liehr, DE Nina Canki-Klain, HR Will Newman, UK Milan Macek Jr., CZ Ana Carrió, ES Markus Nöthen, DE Tayfun Ozcelik, TR Isabella Ceccherini, IT Markus Perola, FI Milena Paneque, PT Angus John Clarke, UK Dijana Plaseska-Karanfilska, MK Hans Scheffer, NL Koen Devriendt, BE Trine E.
    [Show full text]
  • Pan-Cancer Molecular Classes Transcending Tumor Lineage Across 32 Cancer Types, Multiple Data Platforms, and Over 10,000 Cases Fengju Chen1, Yiqun Zhang1, Don L
    Published OnlineFirst February 9, 2018; DOI: 10.1158/1078-0432.CCR-17-3378 Biology of Human Tumors Clinical Cancer Research Pan-Cancer Molecular Classes Transcending Tumor Lineage Across 32 Cancer Types, Multiple Data Platforms, and over 10,000 Cases Fengju Chen1, Yiqun Zhang1, Don L. Gibbons2,3, Benjamin Deneen4,5,6,7, David J. Kwiatkowski8,9, Michael Ittmann10, and Chad J. Creighton1,11,12,13 Abstract Purpose: The Cancer Genome Atlas data resources represent of immune infiltrates were most strongly manifested within a an opportunity to explore commonalities across cancer types class representing 13% of cancers. Pathway-level differences involving multiple molecular levels, but tumor lineage and involving hypoxia, NRF2-ARE, Wnt, and Notch were manifested histology can represent a barrier in moving beyond differences in two additional classes enriched for mesenchymal markers and relatedtocancertype. miR200 silencing. Experimental Design: On the basis of gene expression data, we Conclusions: All pan-cancer molecular classes uncovered classified 10,224 cancers, representing 32 major types, into 10 here, with the important exception of the basal-like breast molecular-based "classes." Molecular patterns representing tissue cancer class, involve a wide range of cancer types and would or histologic dominant effects were first removed computation- facilitate understanding the molecular underpinnings of ally, with the resulting classes representing emergent themes cancers beyond tissue-oriented domains. Numerous biolog- across tumor lineages. ical processes associated with cancer in the laboratory Results: Key differences involving mRNAs, miRNAs, proteins, setting were found here to be coordinately manifested and DNA methylation underscored the pan-cancer classes. One across large subsets of human cancers.
    [Show full text]
  • Chromosome 20
    Chromosome 20 ©Chromosome Disorder Outreach Inc. (CDO) Technical genetic content provided by Dr. Iosif Lurie, M.D. Ph.D Medical Geneticist and CDO Medical Consultant/Advisor. Ideogram courtesy of the University of Washington Department of Pathology: ©1994 David Adler.hum_20.gif Introduction Chromosome 20 contains about 2% of the whole genetic material. Its genetic length is ~63 Mb. The long arm (~36 Mb) is a little bit larger than the short arm (~27 Mb). Chromosome 20 contains ~700–800 genes. Less than 10% of these genes are known to be related to human diseases. Deletions or duplications of these genes, which may be found in patients with chromosomal abnormalities, cause mostly functional defects, including a delay of psycho–motor development and seizures. Only a few genes may lead (when deleted) to structural defects of the heart, liver, extremities and other organs. Deletions of Chromosome 20 There is a relatively small number of known conditions caused by deletions and duplications of various segments of chromosome 20. Almost all of these deletions and duplications became recognized after usage of molecular cytogenetics. Only a handful of reports on patients with these abnormalities were available only 10 years ago. Because these methods open wide an opportunity to examine abnormalities of this previously not–well studied chromosome, there are no doubts that some new syndromes caused by deletions (or duplications) of chromosome 20 will be delineated in the near future. Currently, the most frequent forms of chromosome 20 deletions are deletions 20p12, involving the JAG1 gene and Alagille syndrome, and deletions 20q13.13q13.2, involving the SALL4 gene.
    [Show full text]
  • Its Place Among Other Genetic Causes of Renal Disease
    J Am Soc Nephrol 13: S126–S129, 2002 Anderson-Fabry Disease: Its Place among Other Genetic Causes of Renal Disease JEAN-PIERRE GRU¨ NFELD,* DOMINIQUE CHAUVEAU,* and MICHELINE LE´ VY† *Service of Nephrology, Hoˆpital Necker, Paris, France; †INSERM U 535, Baˆtiment Gregory Pincus, Kremlin- Biceˆtre, France. In the last two decades, decisive advances have been made in Nephropathic cystinosis, first described in 1903, is an auto- the field of human genetics, including renal genetics. The somal recessive disorder characterized by the intra-lysosomal responsible genes have been mapped and then identified in accumulation of cystine. It is caused by a defect in the transport most monogenic renal disorders by using positional cloning of cystine out of the lysosome, a process mediated by a carrier and/or candidate gene approaches. These approaches have that remained unidentified for several decades. However, an been extremely efficient since the number of identified genetic important management step was devised in 1976, before the diseases has increased exponentially over the last 5 years. The biochemical defect was characterized in 1982. Indeed cysteam- data derived from the Human Genome Project will enable a ine, an aminothiol, reacts with cystine to form cysteine-cys- more rapid identification of the genes involved in the remain- teamine mixed disulfide that can readily exit the cystinotic ing “orphan” inherited renal diseases, provided their pheno- lysosome. This drug, if used early and in high doses, retards the types are well characterized. We have entered the post-gene progression of cystinosis in affected subjects by reducing intra- era. What is/are the function(s) of these genes? What are the lysosomal cystine concentrations.
    [Show full text]