The Phylogeography and Conservation of the Brassy Minnow, Hybognathus Hankinsoni

Home , Brassy minnow, Cypress minnow, Eastern silvery minnow, Hybognathus, Leopard dace, Redside shiner

THE PHYLOGEOGRAPHY AND CONSERVATION OF THE BRASSY MINNOW, HYBOGNATHUS HANKINSONI

DAMON M. NOWOSAD

B.Sc., University of Victoria, 1998

B.Ed., University of British Columbia, 2002

A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

THE FACULTY OF GRADUATE STUDIES

(Zoology)

THE UNIVERSITY OF BRITISH COLUMBIA

(Vancouver)

March 2011

©Damon M. Nowosad, 2011

Abstract

Brassy minnow, Hybognathus hankinsoni, is a little-studied cyprinid fish with highly disjunct distributions in western Canada. Phylogeographic scenarios on the origins of brassy minnow in British Columbia (BC) were explored using two mitochondrial loci (cyt b and ND4) that were sequenced for up to 32 localities. This revealed an approximate ‘east-west’ geographic split, suggesting that BC populations are likely post-glacial colonists from the Mississippi-Missouri refugium. However, certain ‘eastern’ populations exhibited incongruences between gene and species trees, suggesting complex evolutionary histories in brassy minnow. Sampling brassy minnow within BC revealed highest catch rates in the Interior of the province, and a year-long survey conducted in the Lower Mainland (n = 60 sites), revealed that brassy minnow abundances were highest at Westham Island. A logistic-regression habitat model was performed incorporating seven physical habitat parameters over 37 sites, identifying conductivity as a near significant parameter for predicting brassy minnow presence. Additionally, in the Lower Mainland, eight invasive species constituted 28 % of the relative abundance of species sampled. Compared to historical records from the University of BC Fish Museum, sites exhibited a significant decline in the number of cypriniform species, including brassy minnow, but showed no significant change in the number of invasive species present. A detrended correspondence analysis (DCA) of species abundance across sites suggested brassy minnow overlapped most closely with two invasive species: bullfrogs, Lithobates catesbieanus, and brown bullhead, Ameiurus nebulosus. To explore the impact of brown bullhead on brassy minnow, pools with and without adult brown bullhead were compared at Tamboline Slough, Westham Island, and showed significant differences in the native fish species abundances across pools, including brassy minnow. Additionally, growth experiments were conducted over 90 days with brassy minnow, young-of-year brown bullhead, and redside shiner, Richardsonius balteatus, kept in all possible combinations for a total of four treatments per species. Treatments showed that brassy minnow were the only species to exhibit weight loss and mortality when with other species. In addition to providing insights into the biogeography, ecology, and conservation implications of brassy minnow, my thesis provides a quantitative baseline for invasive species found within the Lower Mainland.

TABLE OF CONTENTS

ABSTRACT...... ii TABLE OF CONTENTS...... iii LIST OF TABLES...... vii LIST OF FIGURES...... viii ACKNOWLEDGEMENTS...... xi

CHAPTER 1: GENERAL INTRODUCTION AND BACKGROUND ...... 1

1.1 Postglacial dispersal and (re)colonization of Canadian freshwater fishes ...... 1

1.2 Conservation of freshwater fishes in Canada ...... 2

1.3 Brassy minnow (Hybognathus hankinsoni) ...... 4

1.4 General thesis objectives and overview ...... 6

CHAPTER 2: THE PHYLOGEOGRAPHY AND ORIGINS OF H. HANKINSONI IN BC ...... 7

2.1 Introduction ...... 7

2.1.1 The unusual and disjunct distribution of brassy minnow in BC ...... 7 2.1.2 Possible origins of brassy minnow in BC, and using molecular markers to test hypotheses on population movements ...... 9

2.1.3 Mitochondrial (mtDNA) loci as molecular markers ...... 11

2.1.4 General phylogeny of Hybognathus ...... 12

2.1.5 Objectives ...... 13

2.2 Materials and methods ...... 15

2.2.1 The Lower Mainland and lower Fraser River ...... 15

2.2.2 Obtaining and collecting samples outside the Lower Mainland ...... 15

2.2.3 Genetic analyses - sequencing mitochondrial regions...... 16

2.2.4 Phylogenetic analyses - gene tree re-constructions ...... 17

2.3 Results ...... 18

2.3.1 Cyt b and ND4 mitochondrial gene trees ...... 18

2.4 Discussion ...... 21

iii

2.4.1 An approximate ‘east-west’ split in brassy minnow mtDNA gene trees ...... 21

2.4.2 The origins of brassy minnow in BC and the Lower Mainland ...... 23

2.4.3 Confounded cyprinids - genetic polymorphisms and gene tree issues ...... 24

2.5 Conclusions ...... 26

CHAPTER 3: TOWARDS A PREDICTIVE HABITAT MODEL FOR H. HANKINSONI ...... 34

3.1 Introduction ...... 34

3.1.1 General Hybognathus conservation - vulnerable life histories? ...... 34 3.1.2 The overall distribution of brassy minnow in Canada, and the highly disjunct BC populations ...... 35 3.1.3 Patchy local abundances of brassy minnow, and the value of a predictive habitat model ...... 36

3.1.4 Objectives ...... 37

3.2 Materials and methods ...... 38

3.2.1 Sampling in the Lower Mainland ...... 38

3.2.2 One year minnow trap survey ...... 38

3.2.3 Catch-per-unit effort ...... 39

3.2.4 Relative abundance and sampling autocorrelations...... 39

3.2.5 Measuring site habitat attributes ...... 40

3.2.6 Use of logistic regression for predictive habitat models ...... 41

3.3 Results ...... 42

3.3.1 Catch-per-unit-effort in BC for brassy minnow ...... 42

3.3.2 Seasonal and regional brassy minnow relative abundances in the Lower Mainland ...... 42

3.3.3 Sites with positive temporal autocorrelations for brassy minnow sampling ...... 43

3.3.4 A predictive habitat model for brassy minnow ...... 44

3.4 Discussion ...... 44

3.4.1 Distribution and catch-per-unit-effort for brassy minnow in BC ...... 44

3.4.2 Relative abundance, persistence, and regional habitat use of brassy minnow in the Lower Mainland...... 48

3.4.3 Predicting brassy minnow presence ...... 52

3.5 Conclusions ...... 56

CHAPTER 4: INVASIVE SPECIES IN THE LOWER MAINLAND AND INTERACTIONS WITH H. HANKINSONI ...... 64

4.1 Introduction ...... 64

4.1.1 The spread of exotics and the establishment of invasive species ...... 64

4.1.2 Direct effects of invasive predators on brassy minnow and other cyprinids ...... 65

4.1.3 Competition and other effects of invasives on brassy minnow and other cyprinids ...... 66

4.1.4 Objectives ...... 67

4.2 Materials and methods ...... 69

4.2.1 Historical records and re-sampling in the Lower Mainland ...... 69

4.2.2 One year minnow trap survey ...... 69

4.2.3 Relative species abundances for freshwater vertebrates in the Lower Mainland ...... 70

4.2.4 Historical site species comparisons – Wilcoxon paired rank tests ...... 70

4.2.5 Detrended correspondence analysis ...... 71

4.2.6 Tamboline Slough, Westham Island ...... 71

4.2.7 Chi-square analysis of fish size classes between pools at Tamboline Slough ...... 72

4.2.8 Cage transplants of brassy minnow across pools ...... 73

4.2.9 Growth experiment with two indigenous cyprinid species and an invasive catfish ...... 73 4.2.9.1 Experimental apparatus and treatments ...... 73 4.2.9.2 Measuring growth rates ...... 74 4.2.9.3 Kruskal-Wallis one-way ANOVAs and Mann-Whitney pairwise comparison of treatments ...... 74

4.3 Results ...... 75

4.3.1 Freshwater vertebrate community in the Lower Mainland ...... 75

4.3.2 Historical site comparisons ...... 76

4.3.3 The fish community at Tamboline Slough, Westham Island ...... 77

4.3.4 Growth experiment ...... 78

4.4 Discussion ...... 80

4.4.1 Distribution of invasive species in the lower Fraser River relative to brassy minnow .... 80

4.4.2 Trends in species presence at re-sampled historical sites ...... 87

4.4.3 Pool community structure at Tamboline Slough, Westham Island ...... 90

4.4.4 Growth experiment and species competition ...... 92

4.5 Conclusions ...... 95

CHAPTER 5: GENERAL CONCLUSIONS ...... 106

5.1 General thesis overview of results...... 106

5.2 Applications ...... 109

5.3 Future directions ...... 110

Literature cited ...... 114

Appendix 1. Sites where brassy minnow were sampled for genetic analysis...... 129 Appendix 2. Full sequences for cyt b and ND4 loci for all brassy minnow sampled...... 130 Appendix 3. Qualitative habitat features and position of sites sampled across the Lower Mainland...... 163 Appendix 4. Sites and tributaries in BC where brassy minnow were sampled...... 165 Appendix 5. Brassy minnow monthly presence at sites...... 167 Appendix 6. Durbin-Watson test for autocorrelation for repeated temporal sampling for brassy minnow across 25 sites for one year...... 169 Appendix 7. Habitat measures for 37 sites in the Lower Mainland that were used as parameter inputs for brassy minnow predictive habitat model...... 171 Appendix 8. Inter-correlations between parameters of site habitat measures across the Lower Mainland...... 173 Appendix 9. Variance inflation factors (VIFs) for exploring the inter-correlation between parameters of site habitat measures across the Lower Mainland...... 175 Appendix 10. Overall relative abundance of all species sampled using both minnow trap and seining methods for one year of sampling in the Lower Mainland...... 179 Appendix 11. Mean growth for each species (in grams) per treatment...... 181 Appendix 12. JMP 4 outputs for assumption tests for one-way ANOVA...... 184

LIST OF TABLES

Table 1. Whole and reduced models of logistic regression and their significance relative to the null hypothesis that removal of habitat parameters (x) does not affect the likelihood of predicted brassy minnow presence (y). The stated p value is the probability that rejecting the null hypothesis that removal of habitat parameters will not affect the likelihood of predicting brassy minnow presence is incorrect...... 58

Table 2. Logistic regression parameter estimates and their significance relative to the Ho: the habitat parameter (x) had a slope, X = 0, and HA: the habitat parameter (x) has a slope, x 0. The stated p value is the probability that rejecting the null hypothesis of slope 0 is incorrect...... 59

Table 3. Historical comparison of number of sites with species presence-absence across nine Lower Mainland locations sampled in 1956/1959 and re-sampled in 2008-2009...... 97

vii

LIST OF FIGURES

Figure 1. The range distribution of brassy minnow across Canada and the United States modified from Moyer et al. 2009. Brassy minnow have a more continuous range in the east and across the plains relative to some western populations which are isolated and disjunct...... 28

Figure 2. Sites where brassy minnow samples were obtained for genetic analyses. The site numbers correspond to the numbers on the branches of gene trees...... 29

Figure 3. Cyt b Neighbour Joining tree with 1,000 Bootstrap replicates for brassy minnow. The numbers in parentheses correspond to the sampling sites shown in Figure 2...... 30

Figure 4. Cyt b majority rule Bayesian tree for brassy minnow. The numbers in parentheses correspond to the sampling sites shown in Figure 2...... 31

Figure 5. ND4 Neighbour Joining tree with 1,000 Bootstrap replicates for brassy minnow. The numbers in parentheses correspond to the sampling sites shown in Figure 2...... 32

Figure 6. ND4 majority rule Bayesian tree for brassy minnow. The numbers in parentheses correspond to the sampling sites shown in Figure 2...... 33

Figure 7. Localities of monthly sampled sites surveyed for fish species presence over one year in the Lower Mainland (n = 60 sites). In addition, historical sites (n = 8 sites) were re-seined during the 2008-2009 re-sampling in the months when the original sampling occurred in 1956/1959. The sites where habitat parameters (n = 37 sites) were measured over two days in Aug 2009. Both historical and habitat parameter sites were measured were part of the year-long monthly survey...... 60

Figure 8. Catch-per-unit-effort (CPUE) for brassy minnow (number of fish/hour trap time), for the four sampled regions of BC (Peace = Williston Reservoir area (0.083), Upper Fraser = Summit Lake area (0.071), Mid-Fraser = Horsefly and Quesnel rivers’ tributaries (0.016), and Lower Fraser = Lower Mainland area (0.060)). As the Lower Fraser River CPUE was for an entire year of sampling, Lower Fraser, May only (0.018) was included because all the other sampling in BC was conducted in May and it better matched sampling effort...... 61

Figure 9. Total number of brassy minnow caught per region of the Lower Mainland over one year of sampling. The regions are as follows, with total number of fish caught in parenthesis: 1 = Coquitlam River (0), 2 = Pitt-Alouette Rivers (0), 3 = Stave River (0), 4 = Hatzic Lake and sloughs (0), 5 = Nicomen Slough (0), 6 = Sumas River (8), 7 = Vedder River (0), 8 = Richmond Sloughs (26), 9 = Ladner Sloughs (0), 10 = Westham Island Sloughs (1588), 11 = Delta Sloughs (169), 12 = Deer Lake (225), 13 = Burnaby Lake-Brunette River (137)...... 62

viii

Figure 10. Number of brassy minnow caught per water body type across the Lower Mainland over one year of sampling. Total numbers include all brassy minnow caught trapping and seining, and are as follows: Slough = 1,626, Creek = 306, Lake = 136, Ditch = 77, and River = 8.

...... 63

Figure 11. Overall relative abundance of individual species sampled across the Lower Mainland over one year of sampling, methods used included: minnow trapping, beach and pole seining. Species caught (from left to right) with total individuals caught in parentheses, are as follows: SB = Three spine stickleback, Gasterosteus aculeatus (6,946), BM = brassy minnow, Hybognathus hankinsoni (2,163), BF = bullfrog tadpoles, Lithobates catesbieanus (1,700), BB = brown bullhead, Ameiurus nebulosus (1,680), SC = prickly sculpin, Cottus asper (1,118), CC = common carp, Cyprinus carpio (480), PS = pumpkinseed sunfish, Lepomis gibbosus (446), UT = unidentified tadpoles (263), RS = redside shiner, Richardsonius balteatus (215), SM = smallmouth bass, Micropterus dolomieui (74), BC = black crappie, Pomoxis nigromaculatus (70), PM = northern pikeminnow, Ptychocheilus oregonensis (54), CO = coho salmon, Oncorhynchus kisutch (47), LM = largemouth bass, Micropterus salmoides (36), LS = long-toed salamander, Ambystoma macrodactylum (23), CT = coastal cutthroat trout, Oncorhynchus clarkii clarkii (19).

...... 99

Figure 12. Comparison of fish species and size classes between two pool habitats at Tamboline Slough. Total number of fishes were as follows: (starting with the top figure going left to right) Brassy (brassy minnow) = (0, 0, 1, 0); Bullhead (brown bullhead) = (42, 30, 21, 12); Redside (redside shiner) = (11, 6, 3, 0); Carp (common carp) = (0, 0, 6, 6); Stickles (three spine stickleback) = (0, 0, 8, 0), and bottom figure: Brassy = (23, 12, 6, 0); Bullhead = (0,0,0,0); Redside = (18, 3, 1, 0); Carp = (0, 0, 2, 0); Stickles = (16, 6, 3, 0)...... 100

Figure 13. Detrended correspondence analysis (DCA) for sixty sites minnow trapped in the Lower Mainland over one year. Axis 1 represents relative species abundances, and axis 2 represents site location. Symbols represent the species found, and are as follows: M.d = Micropterus dolomieu, M.s = Micropterus salmoides, P.n = Pomoxis nigromaculatus, R.c = Lithobates catesbieanus, C.a = Cottus asper, C.c = Cyprinus carpio, H.h = Hybognathus hankinsoni, A.n = Ameiurus nebulosus, G.a = Gasterosteus aculeatus, O.c = Oncorhynchus clarkii clarkii, R.b = Richardsonius balteatus, O.k = Oncorhynchus kisutch, L.g = Lepomis gibbosus, P.o = Ptychocheilus oregonensis, M.c = Myolcheilus caurinus...... 101

Figure 14. Mean growth rates (measured in grams) plus or minus one standard error for all species (brassy minnow, redside shiner, and brown bullhead) growth over 90 days across four treatments. Each treatment data point consists of the mean tank growth of three of each of the

ix species per tank (n = 5 tanks), and the boxes represent the upper (75%) and lower (25%) quartiles of the data...... 102

Figure 15. Mean growth rates (measured in grams) plus or minus one standard error for H. hankinsoni growth over 90 days across four treatments: Alone = brassy minnow alone, All = all three species, Redsides = brassy minnow plus redside shiner, Bullhead = brassy minnow plus brown bullhead. Each treatment data point consists of the mean tank growth of three brassy minnow per tank (n = 5 tanks), and the boxes represent the upper (75%) and lower (25%) quartiles of the data...... 103

Figure 16. Mean growth rates (measured in grams) plus or minus one standard error for R. balteatus growth over 90 days across four treatments: Alone = redside shiner alone, All = all three species, Brassy = redside shiner plus brassy minnow, Bullhead = redside shiner plus brown bullhead. Each treatment data point consists of the mean tank growth of three redside shiner per tank (n = 5 tanks), and the boxes represent the upper (75%) and lower (25%) quartiles of the data...... 104

Figure 17. Mean growth rates (measured in grams) plus or minus one standard error for A. nebulosus growth over 90 days across four treatments: Alone = brown bullhead alone, All = all three species, Brassy = brown bullhead plus brassy minnow, Redsides = brown bullhead plus redside shiner. Each treatment data point consists of the mean tank growth of three brown bullhead per tank (n = 5 tanks), and the boxes represent the upper (75%) and lower (25%) quartiles of the data...... 105

Acknowledgments

First, I’d like to thank my supervisor Rick Taylor for the opportunity to pursue graduate studies, and for your constant and multi-faceted support, encouragement, and flexibility. The Bamfield trips and the fish classes (both as a student and as a TA) will always be memorable. Thank you Jordan Rosenfeld for your insights and enthusiastic suggestions at all stages of this thesis. Thank you to Christopher Harley and John Richardson for your editing suggestions.

Also, I thank Randy Zemlak and the Peace Williston Fish and Wildlife Compensation Program for providing genetic samples, loaning gear, encouraging and funding collaborative fieldwork in the Interior. Randy, thanks for all of the field preparation – everything went smoothly, we even avoided most bears!

Thanks to my fellow lab mates: Chad Ormond, Les Harris, Jon Mee, J.S. Moore, Patricia Woodruff, Gerrit Velema, Monica Yau, Matt Siegle, Stefan Dick, Patrick Tamkee, Jen Gow, Katriina Ilves, Carla Crossman, Sara Northrup, Carita Chan, and Carling Gerlinsky. You were supportive, encouraging, and best of all fun.

Thanks to all who helped sample in the Lower Mainland: Chad Ormond (Coussin Gonflable), Les Harris, Patricia Woodruff, Alezza Gerstein. Also thanks to the main ‘trapping’ crew, Dylan Nowosad (Guild House), Bryce Cherry (Rusty Gussels), and the rare Sarah Arruda-Nowosad (Bunwich).

Thanks to my parents, David and Gisele Nowosad for their constant support. Also, thanks for the help in the field – we got pretty good at bending trees.

Thanks to Kerry Baird and the British Columbia Conservation Foundation and Sue Pollard of the Ministry of the Environment for financial support allowing for me to sample the areas of Williston Lake and Horsefly River.

Thanks to Patrick Tamkee for helping obtain plants and other materials and equipment for the experimental aspects of this study. Also, thanks to Eric Leinberger and the UBC Geography Department Map Services for help with the maps.

Thanks to the following for sending samples for the genetic aspects of this study: Randy Zemlak of the Peace Williston Fish and Wildlife Compensation Program, Noel Alfonso of the Canadian Museum of Nature, Douglas Watkinson and Barton Franzin of the Department of Fisheries and Oceans, Karin Linburg of the SUNY College of Environmental Science and Forestry, and Richard Winterbottom of the Royal Ontario Museum.

CHAPTER 1: GENERAL INTRODUCTION AND BACKGROUND

1.1 Postglacial dispersal and (re)colonization of Canadian freshwater fishes

The biodiversity and distribution of freshwater fishes in Canada has been heavily influenced by

Pleistocene glaciation events that occurred over the last two million years, and especially by the most recent Wisconsinan glaciations that receded 10,000 to 15,000 years ago (Bernatchez and

Wilson, 1998; McPhail, 2007). During the last glacial maximum it is hypothesized that several freshwater refugia existed as the only areas where freshwater fishes could have survived during this time (McPhail and Lindsey, 1970; Rempel and Smith, 1998). Within these refugia, ancestral populations of contemporary freshwater fish species persisted until they could disperse and

(re)colonize new freshwater habitats via the dynamic water bodies associated with the receding ice sheets (Bernatchez and Wilson, 1998; Rempel and Smith, 1998; McPhail, 2007). Therefore, current indigenous freshwater fishes of Canada are descendants of these ancestral freshwater

(re)colonists or derivatives of marine species that invaded freshwaters post-glacially (e.g., freshwater three spine sticklebacks, Gasterosteus aculeatus (Taylor and McPhail, 2000)). One of the objectives of phylogeographic studies is to explore hypotheses about historical processes that influenced post-glacial dispersal by examining patterns of current species geographic distributions, often through the use of molecular markers (Avise et al., 1987). Such studies are important because, given the occurrence of these glaciation events, any study examining contemporary Canadian freshwater fish distributions or relationships between and among fish populations needs to incorporate the history of such lineages. By examining the historical biogeography of a taxon, important components of biodiversity can be revealed such as: the

1 identification of distinct or unique evolutionary groups, the assessment and prioritization of populations of conservation concern, based in part on evolutionary distinctiveness, and insights into the processes that have lead to current patterns of the distribution and biodiversity within and between species (Moritz, 1994; Green, 2005).

1.2 Conservation of freshwater fishes in Canada

Anthropogenic change via habitat alteration and degradation, and deliberate or accidental introduction of exotic species can have profound impacts on the distribution and persistence of indigenous freshwater fishes (Riccardi and Rasmussen, 1999; Dextrase and Mandrak, 2006).

Many aspects of island biogeography are applicable to freshwater systems as these habitats are frequently limited in size and relatively isolated because terrestrial habitats pose a barrier, and for primary freshwater fish species (i.e., fishes with limited salinity tolerance), the marine environment limits these fishes to particular watersheds. With such restrictions to specific catchments, freshwater fishes are vulnerable to disturbances and are amongst the most threatened of all faunas in Canada (Riccardi and Rasmussen, 1999). Introductions of exotic predators and competitors to temperate freshwater systems, which are typically taxonomically depauperate relative to faunas of lower latitudes and perhaps not yet at equilibrium due to the most recent glacial disturbances (Simberloff and Von Holle, 1999), can lead to the establishment of invasive species (i.e., established non-native species that have spread beyond introduced site(s), as defined in Rejmánek et al., 2002). The persistence and spread of invasive species can be facilitated by competitor or predator release (Simberloff, 1989) their tolerance to degraded habitats (Clavero and García-Berthon, 2005), and their ability to outcompete

2 indigenous species (Mills et al., 2004). In fact, invasive species introductions and anthropogenic induced habitat changes are the most cited causes of indigenous fish population reductions and extirpations in Canada (Dextrase and Mandrak, 2006). Therefore, in order to help conserve indigenous freshwater fish lineages it is important to describe current species distributions, understand the evolutionary relationships among and between lineages, identify critical habitat for all life history stages, and ascertain threats to such populations such as invasive species.

The brassy minnow (Cyprinidae: Hybognathus hankinsoni, Hubbs, 1929) is one such fish species that is currently listed as a candidate for status review by the Committee on the Status of

Endangered Wildlife in Canada (COSEWIC), and based on limited data, is yellow-listed (i.e., apparently secure) in British Columbia (BC). To better clarify and update the conservation status of brassy minnow, I examined the phylogeography of this species as a way of identifying possible designatable units (DUs) within brassy minnow throughout Canada. Designatable units are defined by COSEWIC, in part, according to the degree of geographic isolation between populations, and the genetic distinctiveness at neutral loci among these groups (Green, 2005) and are considered as ‘species’ for the purposes of conservation under Canada’s Species-at-Risk

Act (SARA). In addition, identifying specific threats to individual species or DUs are important components of conservation assessment and recovery under SARA and I addressed the general habitat use of the brassy minnow and the possible threats of invasive species which are wide spread in parts of the range of brassy minnow in BC (Taylor, 2004; Taylor 2010). This thesis will explore both of these conservation related issues for brassy minnow as expanded on below.

1.3 Brassy minnow (Hybognathus hankinsoni)

Brassy minnow belongs to the Family Cyprinidae which is widely regarded as the most diverse and specious group of freshwater fishes in North America, containing an estimated 300 species on this continent (Burr and Mayden, 1992). The genus Hybognathus consists of seven species: the Rio Grande minnow (H. amarus), western silvery minnow (H.argyritis), cypress minnow (H. hayi), Mississippi silvery minnow (H. nuchalis), plains minnow (H. placitus), eastern silvery minnow (H. regius), and brassy minnow (H. hankinsoni). These minnows are considered

‘generalised herbivores’ (Copes, 1975) due to the presence of fine pharyngeal papillae and enlarged epibranchials which are believed to filter and collect small food items (Hlohowskj et al., 1989; Schmidt, 1994), and long intestines (relative to body length) suggesting a herbivorous diet (Page and Burr, 1991). Analyses of stomach contents have confirmed high percentages of plant matter, algae, and detritus in the diet of Hybognathus but also zooplankton and insect larvae (Scott and Crossman, 1973; McPhail, 2007). Fishes of the genus Hybognathus are small

(maximum 150 mm total length but typically under 70 mm) schooling minnows that are forage for piscivorous fish species such as brook trout, Salvelinus fontinalis (Scott and Crossman, 1973;

Copes, 1975). Hybognathus species are generally short-lived, with the majority of individuals being annual, although some females may live up to three years (Moyer et al., 2005; McPhail,

2007). It is suggested these minnows originated in the Great Plains, and are subsequently adapted to highly seasonal, abiotically variable water bodies (Matthews, 1988; Quist et al.,

2003; Quist et al., 2004). As such, these minnows are tolerant to wide ranges in temperatures and dissolved oxygen levels (Quist et al., 2004). All Hybognathus species are fecund (often

1,000 eggs, exceptionally to 5,000 (Alò and Turner, 2005)) and use water level, flow change,

4 and temperatures above 14:C as spawning cues (Dudley et al., 2003). Early life stages of these minnows are capable of considerable downstream dispersal depending on water flow (Dudley et al., 2003; Alò and Turner, 2004; Alò and Turner, 2005) due to semi-buoyant eggs which can remain suspended in the water column (Fausch and Bestgen, 1997)). Additionally, larval and juvenile minnows can disperse quickly as they have been found in recently inundated, seasonally flooded areas far from adult fishes (Scheurer et al., 2003).

Brassy minnow, Hybognathus hankinsoni, is endemic to Canada and the United States of

America (USA) (Figure 1). It is hypothesized that brassy minnow survived in the Mississippi-

Missouri refugium during the Pleistocene glaciations and still persist in the upper portions of the Missouri and Mississippi drainages, as well as the Illinois, Platte, Yellowstone River tributaries and lakes Superior and Michigan (McPhail and Lindsey, 1970; Scott and Crossman,

1973; Rempel and Smith, 1998). Brassy minnow range as far east as New York, south to the northern portions of Kansas and Missouri, and west into parts of Colorado, Wyoming, and

Montana (McPhail, 2007). It has been suggested that brassy minnow have been introduced to the Susquehanna River in New York (Smith, 1985), areas of Tennessee (Etnier and Starnes,

1993), and the Colorado and Green Rivers in Colorado and Utah (Walker, 1993). The northernmost distribution of brassy minnow populations extend into the southern portions of several Canadian provinces, including: Québec, Ontario, Manitoba, Saskatchewan, Alberta, and

BC (Scott and Crossman, 1973; McPhail, 2007). The populations in Alberta and BC are highly disjunct and scattered in the southernmost portions of the provinces; however, there are additional populations isolated around the centres of both of these provinces (McPhail, 2007).

Owing to the isolated and disjunct nature of these populations, questions have arisen as to

5 their origins; are these population remnants of at one time more widespread populations which reflect natural post-glacial dispersal patterns, or a series of ‘bait bucket’ introductions? (Carl et al., 1948; Rempel and Smith, 1998)

1.4 General thesis objectives and overview

This thesis will explore several issues related to the evolution, ecology and conservation of brassy minnow in BC and their relevance to the status of the species across Canada. The remainder of this thesis is divided into three parts: (1) Chapter 2: the phylogeography and hypotheses concerning the origin of the species across its Canadian range with an emphasis on

BC. (2) Chapter 3: a survey of the distribution of brassy minnow in BC, with an emphasis on the

Lower Mainland (i.e., the lower Fraser River Valley) including an assessment of habitat parameters associated with brassy minnow presence-absence, and (3) Chapter 4: an assessment of the Lower Mainland populations of brassy minnow and their relative threat from invasive species, with an emphasis on Westham Island (Tamboline Slough).

CHAPTER 2: THE PHYLOGEOGRAPHY AND ORIGINS OF H. HANKINSONI IN BC

2.1 Introduction

2.1.1 The unusual and disjunct distribution of brassy minnow in BC

Brassy minnow, H. hankinsoni were first identified in Canada in the provinces of Québec and

Ontario (Bailey, 1954). The recorded distribution of brassy minnow was later expanded when it was found in scattered distributions throughout southern Manitoba and Saskatchewan, and in disjunct southern and central localities in Alberta and BC (Keenleyside, 1954; Scott and

Crossman, 1973). This small (typically under 70 mm fork length) fish, therefore, exists across

Canada in a series of highly disjunct populations. Within BC, brassy minnow also have a disjunct distribution: they are found in the headwaters of the Peace and Fraser rivers and in lower

Fraser River tributaries downstream of Chilliwack (with a distance of about 800 km separating these and the upper Fraser River populations (McPhail and Lindsey, 1970)).

The origin of brassy minnow in BC has puzzled ichthyologists for decades (McPhail and Lindsey,

1970; McPhail, 2007). For instance, it is suggested that brassy minnow originally dispersed to the Peace River system following the retreat of the Pleistocene ice sheets around 10,000 to

15,000 years ago and subsequently invaded the upper Fraser River via a temporary post-glacial connection between these large watersheds (McPhail and Lindsey, 1970; Rempel and Smith,

1998; McPhail, 2007). The hypothesized post-glacial (re)colonization route that brassy minnow

(along with lake whitefish, Coregonus clupeaformis, and white sucker, Catostomus commersoni) used while migrating into central BC was via Glacial Lake Peace (Rempel and Smith, 1998;

McPhail, 2007). At one time Glacial Lake Peace was connected by a series of drainages to the

Mississippi-Missouri refugium before this route was blocked and altered (McPhail and Lindsey,

1970; Rempel and Smith, 1998). Once brassy minnow was in the Peace River system, access to the upper Fraser River was possible through the Crooked River which historically connected these two tributaries (Rempel and Smith, 1998). The seemingly isolated lower Fraser River populations may be from colonists that dispersed downstream from the upper Fraser River, although Carl et al. (1948) suggested that they became established after being introduced as bait fish. These uncertainties suggest that a broad-scale geographic study on the molecular phylogeography of brassy minnow would better define their distribution patterns, inter- relationships, and be able to test different scenarios for the biogeographic origins of the disjunctions. Establishing the native or introduced status of the lower Fraser River population(s) of brassy minnow has clear implications for conservation. For instance, so-called ‘extra-limital’ populations of species (i.e., those species that have been introduced outside their natural range) are not included in calculations of species range sizes or population abundances under the status assessment guidelines of the Committee on the Status of Endangered Wildlife in

Canada (COSEWIC 2008). In addition, given the large-scale disjunction of brassy minnow in

Canada, it is possible that one or more major phylogeographic lineages exist across this range that could form the basis of two or more separate designatable units (DUs) for species assessments under COSEWIC (COSEWIC, 2008).

2.1.2 Possible origins of brassy minnow in BC, and using molecular markers to test hypotheses on population movements

Based on the current distribution of brassy minnow including their presence within the upper

Mississippi and Missouri drainages, it is likely that brassy minnow survived the Pleistocene glaciations within the Mississippi-Missouri refugium (Rempel and Smith, 1998; McPhail, 2007).

Additional support for this hypothesis includes: fossilized brassy minnow found in the historical extent of the Mississippi-Missouri drainages (Rempel and Smith, 1998), and similar ‘east-west’ distribution patterns of several freshwater fish species that colonized from the Mississippi-

Missouri refugium such as northern pike, Esox lucius (Senanan and Kapuscinski, 2000), lake whitefish (Bernatchez and Dodson, 1991; Lu et al., 2001), longnose sucker, Catostomus catostomus (McPhail and Taylor, 1999) and white sucker (LaFontaine and Dodson, 1997).

However, many of these fish species, such as lake whitefish and white sucker, have divergences at neutral molecular markers suggesting population isolation times pre-dating the Pleistocene glaciations, implying that some of these fish species could have originated from different refugia (LaFontaine and Dodson, 1997; Lu et al., 2001). Therefore, it is possible that brassy minnow persisted in other refugia in addition to the Mississippi-Missouri refugium. Since brassy minnow do not currently inhabit the water bodies associated with the Atlantic refugium

(McPhail, 2007), it is unlikely that brassy minnow persisted there. However, because brassy minnow are currently present in the Fraser River and Peace River systems, it is possible that in addition to the Mississippi-Missouri refugium, brassy minnow persisted in the Pacific refugium and (re)colonized northwards into the Fraser River and migrated upstream into the Peace River.

Another explanation for the origin of brassy minnow in BC and the Lower Mainland is that this species was introduced to the area by humans from eastern brassy minnow populations (Carl et al., 1948; Bailey, 1954). An alternative hypothesis is that either the Lower Mainland populations resulted from introductions of fish from natural populations in the Peace River and/or upper

Fraser River area, or vice versa. However, due to the widespread and disjunct nature of the

Peace River and upper Fraser River brassy minnow populations, and the fact that brassy minnow are associated with areas of the Peace River in Alberta on the other side of the Rocky

Mountains and the Continental Divide, it seems unlikely that brassy minnow were anthropogenically introduced to the Peace River and upper Fraser River (McPhail, 2007).

Therefore, the most likely scenario of brassy minnow introduction, if in fact, they were introduced, would be that brassy minnow were introduced to the Lower Mainland from the upper Fraser/Peace river or from populations originating from east of the Continental Divide.

Molecular markers can be used to explore hypotheses regarding the refugial origins and subsequent movements of populations (e.g., LaFontaine and Dodson, 1997; Wilson and

Herbert, 1998). For instance, Senanan and Kapuscinski (2000) examined differences at molecular markers between northern pike across North America and Europe, and found a lack of divergence among the North American populations relative to the European ones, and attributed these differences to the North American populations originating from a single putative refugium, whereas the European populations probably originated in multiple refugia.

Furthermore, the examination of molecular markers can allow for formulation of hypotheses about the historical movements of populations (e.g., Bernatchez and Wilson, 1998). For example, genetic diversity tends to decrease relative to the distance from putative refugia

(Bernatchez and Wilson, 1998), which is usually due to the smaller emigrating populations undergoing bottlenecks and founder effects (Nei et al., 1975), thereby making inferences on historical movements possible. However, additional processes such as reticulate evolution, population admixture, natural selection, and incomplete lineage sorting can confound these molecular signals (Maddison, 1997; Wilson and Bernatchez, 1998; Turgeon and Bernatchez,

2001). Patterns at molecular markers can also be used to examine hypotheses on the origins of anthropogenically introduced species (e.g., Moyer et al., 2005; Kolbe et al., 2007). Introduced populations often are identical to or very similar in terms of molecular variation to the source population, albeit with less variability, making the geographic locality of the source population traceable (Allendorf and Lundquist, 2003). However, traceability to the source population may be confounded should population admixture occur via introductions from multiple different sources, or if the introduction of the alien population is into areas where the same species already occurs (Kolbe et al., 2007).

2.1.3 Mitochondrial (mtDNA) loci as molecular markers

Mitochondrial (mtDNA) loci are suitable and frequently used molecular markers for phylogeographic and population studies (Neigel and Avise, 1986; Avise et al., 1987; Avise and

Ball, 1990), due to several properties of the mitochondrion including a haploid condition and maternal inheritance (Moore, 1995; Brown, 2008). As such, the entire mitochondrion is inherited as a single haplotype with little to no recombination among loci (Mortiz et al., 1987;

Moore, 1995), meaning that ‘genetic signals’ are relatively conserved and genealogical relationships can be more easily reconstructed among haplotypes. Additionally, being

11 maternally inherited, mtDNA has a low effective population size (Ne) (around ¼ Ne of nuclear

DNA), and therefore differences driven by genetic drift accrue relatively quickly; at approximately four times the rate of nuclear sequences (Brown et al., 1982; Birky et al., 1989).

Finally, the mutation rate across the genome is often higher than for many single copy nuclear loci (Birky et al., 1989). However, changes within loci in the mitochondrial haplotype can exhibit some variability according to the region, codon position, and taxon examined, and it has been suggested that an organism’s metabolic rate influences the rate of mutation (Rand, 2001; Miya et al., 2005; Brown, 2008). These mutational changes, coupled with the apparent neutrality of mtDNA under certain conditions (Charlesworth et al., 1993; Oosterhaut, 2004; Bos et al., 2008), may produce ‘clock-like’ sequence changes over time (Kimura, 1968; Avise et al., 1987; Brown,

2008). As such, mtDNA can be a useful tool in researching a species post-glacial population structure and phylogeography, and by utilizing coalescence methods one can produce retrospective gene trees, which, if monophyletic, may yield the co-ancestor of gene copies

(Neigel and Avise, 1986; Mortiz et al., 1987; Avise and Ball, 1990; Hudson, 1990; Hudson, 1992).

Additionally, if the monophyly of mtDNA is corroborated with other characters such as nuclear loci (Hare, 2001) geographic relationships and hypotheses on how species population lineages evolved may be ascertained, and conservation units (e.g., DUs) better defined (Brown, 2005).

2.1.4 General phylogeny of Hybognathus

Within the phylogeny of cyprinids, brassy minnow fall within the ‘chub’ clade (Simons and

Mayden, 1998; Dowling et al., 2002) with six morphologically similar congeners: the Rio Grande minnow (H. amarus), western silvery minnow (H.argyritis), plains minnow (H. placitus), cypress

12 minnow (H. hayi), Mississippi silvery minnow (H. nuchalis), and the eastern silvery minnow (H. regius) (Schmidt, 1994). Although Hybognathus forms a monophyletic group, the inter- relationship of the seven species within the Hybognathus clade is less clear. Schmidt (1994) found that morphological characters resulted in polytomies within Hybognathus, and Moyer et al. (2009) found incongruences between multiple mitochondrial and nuclear gene trees for this group. Across their range, finer scale Hybognathus population structure and evolutionary relationships, as well as the nature of conservation units (DUs in Canada and the similar evolutionarily significant units (ESUs) in the USA (Waples, 1991; Mortiz, 1994, Waples, 1995)), are not well known. As such, I sought to utilize mitochondrial loci as molecular markers to explore phylogeographic hypotheses and define potential DUs across Canada and BC.

2.1.5 Objectives

I tested the following phylogeographic hypotheses concerning the origins of brassy minnow in

BC: (1) brassy minnow colonized from the Mississippi-Missouri refugium only, whereby

‘western’ populations are the result of ‘spill-over’ from ‘eastern’ population(s), versus (2) brassy minnow used the Mississippi-Missouri refugium and this lineage constitutes the ‘eastern’ brassy minnow populations, whereas the ‘western’ populations are (re)colonists from the Pacific refugium that migrated northwards and underwent subsequent biased extinctions in BC.

Molecular evidence for the ‘spill-over’ hypothesis would consist of ‘eastern’ brassy minnow populations being ancestral in gene trees and having more variable haplotypes from being the source population to the presumably less variable ‘western’ haplotypes (as suggested in Nei et al., 1975; and Bernatchez and Wilson, 1998). In contrast, molecular evidence for the

Mississippi-Missouri plus Pacific colonization scenarios should have ‘eastern’ populations of brassy minnow as distinct haplotype lineages that form monophyletic clades in gene trees that are distinct from the ‘western’ populations, except for possible admixture zones in geographic areas where these lineages potentially met (such as in Bernatchez and Dodson, 1991;

LaFontaine and Dodson, 1997; Lu et al., 2001).

In addition, I tested the hypotheses that brassy minnow origins in the Lower Mainland could be a result of: (1) anthropogenic introduction from ‘eastern’ brassy minnow populations as suggested by Carl et al. (1948) and Bailey (1954), or (2) anthropogenic introduction from the upper Fraser River brassy minnow populations, or (3) brassy minnow are natural post-glacial colonists. Molecular evidence of ‘eastern’ brassy minnow introduction into the Lower Mainland would consist of all Lower Mainland brassy minnow as most closely related to their most recent common ancestor from an ‘eastern’ source population. In contrast, for the scenario of the introduction of Lower Mainland populations of brassy minnow from the upper Fraser River populations, molecular evidence should show the Lower Mainland population of brassy minnow as being most closely related to their common ancestor from an upper Fraser River source population. Molecular evidence for a natural colonization scenario should show brassy minnow from the upper Fraser River as common ancestors to the Lower Mainland population.

In addition, the Lower Mainland populations of brassy minnow, if colonized naturally, should show more divergence at loci due to the longer separation time from their source population than if introduced more recently, which should be virtually identical to the source population.

2.2 Materials and methods

2.2.1 The Lower Mainland and lower Fraser River

The Lower Mainland is BC’s most populated and developed region including areas of industry and extensive agriculture (Richardson et al., 2000). It encompasses the lower Fraser River Valley floodplain downstream of Agassiz and Chilliwack, to the mouths of the two arms of the Fraser

River in Vancouver, Richmond, and Delta. Several tributaries that originate in the mountains, such as the Harrison, Pitt, Alouette, and Stave rivers, join the Fraser River in this region, the latter two have dams located where they leave their lake sources. In many tidal areas of the

Fraser River, such as Delta and Richmond, there are man-made sloughs and ditches regulated by pump houses for flood prevention and irrigation purposes. Additionally, there are a series of urban lakes (e.g., Deer, Burnaby, and Trout Lake) and bog areas (e.g., Burns Bog) in the lower areas of the Fraser River delta. Many of the water bodies sampled for this study across the

Lower Mainland were eutrophic, warm water, subject to siltation and often anthropogenically- disturbed in terms of water quality and physical habitat manipulations. Tissue samples were obtained by sampling fish using minnow traps and seines between June 2008 to June 2009 from a variety of locations (Figure 2, Appendix 1). Minnow traps were baited with sardines and soaked for 24 hr. Up to five individuals of brassy minnow per site were euthanized and preserved in 95% ethanol for genetic analysis.

2.2.2 Obtaining and collecting samples outside the Lower Mainland

Additional samples for genetic analysis of brassy minnow was collected from three major regions of BC (Figure 2): (1) the Summit Lake area located between the Peace and upper Fraser

River tributaries around the headwaters of the Crooked River, approximately 33 km north of

Prince George in the interior of BC; (2) The southern areas of Williston Reservoir around Parsnip

Reach, which is associated with the Peace River drainage; and (3) the Horsefly and Quesnel rivers’ drainages in the Cariboo Region that empty into the mid-Fraser River, approximately 65 km northeast of Williams Lake. Sampling was conducted around the Summit Lake area for four days in May of 2008, and in addition to minnow trapping, a surface gill net (20 mm mesh size) was set in the north end of Summit Lake for 24 hr. Sampling around Williston Reservoir was conducted in May of 2009 for a total of six days. Both the Summit Lake and Williston Reservoir sampling was worked in collaboration with Randy Zemlak of the Peace Williston Fish and

Wildlife Compensation Program. Additionally, in May 2009, sampling was conducted in the

Quesnel and Horsefly rivers’ drainages for a total of eight days. Samples of brassy minnow from localities outside of BC for genetic analysis were obtained with the assistance of colleagues at various universities, government agencies, and private companies (Figure 2).

2.2.3 Genetic analyses - sequencing mitochondrial regions

For genetic analysis, cytochrome b (cyt b) was sequenced as it is a frequently used mtDNA molecular marker for resolving cyprinid phylogenies (e.g., Dowling et al., 2002). Although not independent, for a ‘finer resolution’ molecular marker to potentially resolve within BC DUs,

NADH dehydrogenase subunit 4 (ND4) was sequenced, as it has also been used for resolving cyprinid phylogenies (e.g., Moyer et al., 2009) and is considered to evolve at a rate faster than cyt b in the cyprininds (Miya et al., 2005). Additionally, two individuals of H. argyritis were sequenced both at cyt b and ND4 regions to serve as outgroups. The DNA was extracted from

16 fin clips of ethanol preserved tissue using a Qiagen DNeasy Tissue Kit and the spin-column protocol was followed. Primers used for amplification of cyt b were HD (5’-GGG TTG TTT GAT

CCT GTT TCG T-3’) and GluDG (5’-GTG ACT TGA AGA ACC ACC GTT-3’) as described in Dowling et al. (2002), and for ND4: ND4f (5’-GAC CGT CTG CAA AAC CTT AA-3’) and ND4r (5’-GGG GAT GAG

AGT GGC TTC AA-3’) were used as described in Moyer et al. (2009). PCR reactions for cyt b were as follows: 5.0 µL 10X buffer (New England Biolabs), 4.0 µL dNTPs at 5mM, 1.0 µL each of 10 µM primers HD and GluDG, 0.3 µL 5U/mL Taq (New England Biolabs), 1.5 µL DNA, and 37.2 µL ddH2O. PCR reactions for ND4 were as follows: 5.0 µL 10X buffer (New England Biolabs), 2.0 µL

MgCl2, 5.0 µL dNTPs at 5mM, 2.5 µL each of 10 µM primers ND4f and ND4r, 0.5 µL 5U/mL Taq

(New England Biolabs), 1.5 µL DNA, and 31.0 µL ddH2O. The thermocycler program for cyt b was: 20 cycles of 94:C for 1 min, 48:C for 1 min, and 72:C for 2 min, and for ND4 it was 25 cycles

94:C for 1 min, 50:C for 1 min, and 72:C for 30 s, but with the initial denaturing cycle for 2 min, and the final annealing cycle for 7 min. PCR products were purified using Qiagen QIAquick PCR

Purification Kit and sequenced by Macrogen, Korea using a 3730XL automated DNA sequencer.

2.2.4 Phylogenetic analyses - gene tree re-constructions

All sequences were searched for probable sequence similarities using the National Centre for

Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/) BLAST search utility and

GenBank was used to add the additional outgroups of common carp, Cyprinus carpio, and lake chub, Couesius plumbeus, for the cyt-b trees, and a concatenated goldfish, Caurassus auratus sequence for the ND4 trees. Additional brassy minnow sequences from Colorado (South Platte

River) and Michigan (Wolf River) were added to the analysis by searching GenBank. Sequences

17 were edited using BioEdit v7.0.9 (Hall, 1999) and aligned with Clustal X v2.0.12 (Larkin et al.,

2007) (see Appendix 2). Pairwise alignments were run with gap opening penalties of 10.0 and gap extension penalties of 0.10 (Hall, 2004). Neighbour joining (NJ) trees were constructed in

PAUP v4.0.10 (Swofford, 2003) with 1,000 bootstrap support pseudo-replicates performed

(Felsenstein, 1985). MrModeltest v2.3 (Nylander, 2004) was used to determine a model of sequence evolution using the Akaike Information Criterion (AIC) (Posada and Buckley, 2004).

The substitution model chosen for both the cyt b and ND4 regions was the HKY + I + G

(Hasegawa et al., 1985). Trees were constructed using Bayesian inference methods using

MrBayes v3.1.2. (Huelsenbeck and Ronquist, 2001; Ronquist and Huelsenbeck, 2003). Bayesian analyses were run for 1 X 107 generations with 4 Markov Chain Monte Carlo (MCMC) chains, with a tree sampling frequency of 100, and a ‘burnin’ time of 100,000 trees. Majority rule consensus trees (i.e., over 50% clade support) were chosen using the sumt command in PAUP v4.0.10, and topologies were examined and edited in Tree Explorer (Tamura, 2005) or Tree

Graph 2 (Stöver and Müller, 2010). Sequence divergence values were calculated in MEGA 4.2

(Tamura et al., 2007; Kumar et al., 2008).

2.3 Results

2.3.1 Cyt b and ND4 mitochondrial gene trees

For cyt b, 556-557 bp was sequenced for 75 individual brassy minnow from a total of 29 localities. Neighbour joining (NJ) trees with 1,000 bootstrap replicates suggested a well supported clade for seven Québec and Ontario brassy minnow cyt b gene copies that were ancestral to that of an outgroup congener - the western silvery minnow, Hybognathus agyritis

(Figure 3). These sequences were subsequently searched in BLAST revealing that the seven basal sequences of Ontario and Québec brassy minnow cyt b genes matched cyt b sequences of common shiner, Luxilus cornutus. With the exception of the incongruence of gene versus species trees for the seven Ontario and Québec brassy minnow/common shiner clade, there was good support for the monophyly of the other brassy minnow cyt b gene groups, but weak clade support and little geographic substructure within the brassy minnow cyt b clade other than an approximate ‘east-west’ grouping. Similar results were found in majority rule Bayesian inference (BI) trees for cyt b suggesting good posterior probability support for outgroups and for the incongruent basal clade of common shiner cyt b copies within the seven eastern brassy minnow individuals (Figure 4). The remainder of brassy minnow cyt b genes formed a weakly supported clade with ‘eastern’ brassy minnow gene copies from New York, Ontario, Wyoming,

Michigan, Wisconsin, and Colorado as ancestral to the copies from Saskatchewan, Alberta and

BC suggesting an approximate ‘east-west’ split. Additionally, there was no geographic structuring amongst the upstream Peace and upper Fraser River populations of brassy minnow cyt b relative to the downstream mid and lower Fraser River populations. Kimura 2 parameter

(K2P) sequence distances revealed that the basal incongruent ‘eastern’ brassy minnow clade to be ~ 11 % divergent to some of the ‘western’ sequences. Additionally, there was up to a 2.1 % sequence divergence between the more derived of the ‘eastern’ brassy minnow and the

‘western’ sequences, and up to 1.9 % sequence divergence between some ‘western’ brassy minnow.

For ND4, 284-332 bp was sequenced for 61 brassy minnow individuals from a total of 32 localities. NJ trees with 1,000 bootstrap replicates suggested two ND4 sequences in Québec

19 brassy minnow were ancestral to that of ND4 gene copies in western silvery minnow outgroups.

In addition, the ND4 gene tree suggested that brassy minnow ND4 sequences from the Laramie

River, and North and South Platte River formed a sister group to the clade containing all other brassy minnow ND4 genes sampled (Figure 5). However, when GenBank was searched using

BLAST the ND4 gene copies of the two basal Québec brassy minnow, western silvery minnow outgroup, and the Laramie, North and South Platte brassy minnow sequences all matched ND4 sequences from Mississippi silvery minnow (H. nuchalis). Within the brassy minnow ND4 gene groups that corresponded to brassy minnow species in BLAST, there was weak clade support for an approximate ‘east-west’ group. For example, the ‘eastern’ brassy minnow ND4 copies from

New York, Québec, Ontario, and Wisconsin formed a group that also included seven individuals from BC from the Peace River, upper, mid, and lower Fraser River. The sister clade to this

‘eastern’ group, however, formed a clade that consisted of the majority of the ‘western’ sampled brassy minnow from Saskatchewan, Alberta, and BC. Similarly to the cyt b gene tree majority rule Bayesian trees for brassy minnow, ND4 genes suggested good clade support for basal gene copies of brassy minnow sampled from Québec and Delta, BC, and the western silvery minnow outgroup that matched BLAST searched sequences of ND4 from Mississippi silvery minnow (Figure 6). There was also good support for the ancestral brassy minnow ND4 gene copies that consisted of ‘eastern’ sampled brassy minnow from Wyoming, Michigan,

Colorado, Wisconsin, Québec, and Ontario. However, there were also brassy minnow ND4 copies originating from Ontario and New York in the more derived but weakly supported

‘western’ sections of the tree that consisted of brassy minnow sampled from Saskatchewan,

Alberta and BC. Kimura 2 parameter model sequence distances revealed divergences between

20 the basal incongruent ‘eastern’ brassy minnow populations and some of the ‘western’ brassy minnow populations to be ~ 5.6 %. Furthermore, sequence divergences between the more derived ‘eastern’ brassy minnow populations and some of the ‘western’ ones were as high as

3.4 %, and between some individuals of the ‘western’ clade they were as high as 1.6 %.

2.4 Discussion

2.4.1 An approximate ‘east-west’ split in brassy minnow mtDNA gene trees

Contrary to expectation cyt b and ND4 gene trees of brassy minnow did not form distinct monophyletic ‘east-west’ clades as seen in other species of Canadian freshwater fishes (e.g.,

Bernatchez and Dodson, 1991; LaFontaine and Dodson, 1997; Wilson and Herbert, 1998;

McPhail and Taylor, 1999; Lu et al., 2001; Turgeon and Bernatchez, 2001); nevertheless there was an approximate ‘east-west’ geographic split. For example, ‘western’ geographic copies of cyt b and ND4 in brassy minnow from Saskatchewan, Alberta, and BC were derived in trees and grouped together for BI cyt b trees. However, in the ND4 and NJ cyt b trees, the ‘western’ clades were paraphyletic with a few ‘eastern’ copies within the ‘western’ group. Additionally,

‘eastern’ populations of ND4 and cyt b gene copies were paraphyletic with an ancestral

‘eastern’ brassy minnow group clustering more closely to other species such as common shiner for cyt b genes and Mississippi silvery minnow for ND4 genes than with other brassy minnow.

These incongruences are similar to other studies on the phylogeny of Hybognathus species, where it has been suggested that complicated evolutionary processes have confounded the examination of species inter-relationships (Moyer et al., 2009) (also see 2.4.3). These tree topologies suggest that, along with the ‘eastern’ polymorphic genes matching more closely to

21 other species than to other brassy minnow, that ‘eastern’ brassy minnow cyt b and ND4 genes are ancestral relative to ‘western’ ones. This ‘east-west’ split in gene trees along with fossil evidence of brassy minnow from Glacial Lake Agassiz (Rempel and Smith, 1998), and the fragmentary distribution of brassy minnow in BC (McPhail, 2007) support the hypothesis that brassy minnow utilized the Mississippi-Missouri refugium during the last glaciation (Rempel and

Smith, 1998; McPhail, 2007) because the ancestral clades are ‘eastern’ in origin and are still associated with these drainages. Additionally, with the ‘western’ group clustering together and generally separate from ‘eastern’ groups, this suggests that ‘western’ brassy minnow are not introductions from ‘eastern’ brassy minnow bait introductions as once suggested in Carl et al.

(1948). Also, contrary to expectation gene copies originating from brassy minnow in the Peace and upper Fraser River tributaries were undifferentiated from lower Fraser River copies. In fact, there was little differentiation and poor clade support for gene copies originating from

Saskatchewan, Alberta, and BC, possibly suggesting a more recent separation in these ‘western’ groups and insufficient time for mutations to accrue. Despite the lack of monophyly across cyt b and ND4 mitochondrial gene trees there is an approximate ‘east-west’ grouping of brassy minnow and with the isolated and disjunct nature of brassy minnow populations in western

Canada relative to eastern populations, ‘eastern’ and ‘western’ cannot be treated as separate

DUs for conservation purposes. Although ‘eastern’ and ‘western’ population(s) of brassy minnow fit DU criteria for distinctness by being approximately monophyletic for these regions at two mitochondrial loci, possessing disjunct and isolated ‘western’ population(s) relative to

‘eastern’ ones, and are within different freshwater eco-regions in the ‘west’ (Pacific and Arctic) versus ‘east’ (Saskatchewan, Missouri, and Great Lakes/Upper St. Lawrence), there is

22 insufficient evidence that brassy minnow meet the evolutionary - significance criterion, e.g., being genetically discrete or having evidence of potential local adaptations (COSEWIC, 2008).

Given, however, the large pronounced disjunction in the distribution of brassy minnow between the bulk of the range in Ontario and Québec and those in Saskatchewan, Alberta, and

BC, the loss of the assemblage of ‘western’ or ‘eastern’ populations would produce a large gap in the range of the species across Canada. Consequently, the discrete ‘western’ and ‘eastern’ populations of brassy minnow are likely significant in a biogeographic sense and it is probably justifiable to erect at least two major assemblages of populations, or DUs, for status assessments: ‘eastern’ and ‘western’ populations, respectively.

2.4.2 The origins of brassy minnow in BC and the Lower Mainland

Gene trees for brassy minnow cyt b and ND4 loci suggest that the most likely phylogeographic scenario for the origin of ‘western’ brassy minnow was post-glacial colonization from ‘eastern’ populations, and that Lower Mainland populations are downstream colonists from the upper

Fraser River (as hypothesized both by Rempel and Smith, 1998 and; McPhail, 2007) as opposed to being introductions to the Lower Mainland from eastern Canada (Carl et al., 1948). For instance, both NJ and BI methods used to construct gene trees had ‘eastern’ brassy minnow as ancestral to the ‘western’ groups and little by way of sequence divergence within the ‘western’ clade of brassy minnow from Saskatchewan, Alberta, and for all regions in BC. The ‘relatedness’ of all of the ‘western’ brassy minnow populations at these molecular markers suggest that these were not recent introductions from ‘eastern’ populations because there were few

‘western’ individuals inter-mixed in the ‘eastern’ clade. Additionally, the minimal sequence

23 divergence between ‘eastern’ and BC brassy minnow populations suggest that brassy minnow were unlikely to have been in the Pacific refugium because fish lineages originating from different refugia tend to have greater differentiation at molecular markers than fish lineages originating from single refugia (Bernatchez and Wilson, 1998; Senanan and Kapuscinski, 2000).

Furthermore, there are no brassy minnow currently found in areas associated with the putative

Pacific refugium within the USA. Similarly, the ‘relatedness’ at these loci between the brassy minnow within BC, including the Peace River, and upper and lower Fraser River, suggest that these were not single introductions from any one central BC locality. Such a single introduction scenario pattern was noted for plains minnow, Hybognathus placitus in Colorado where all of the individuals in the introduced population formed an unambiguous clade within the Red River source population (Moyer et al., 2005). Furthermore, many of the individual brassy minnow in the lower Fraser River had upper Fraser River individuals as their most recent common ancestors or as sister groups although, in general, there was poor support for distinct clades.

This affinity suggests that upper Fraser River populations likely seeded the lower Fraser River populations multiple times. In addition, the lower Fraser River brassy minnow populations are unlikely to have been anthropogenic introductions from upper Fraser River sources as a few individuals in the lower Fraser River are highly divergent at these loci, suggesting these populations have been in the lower Fraser River for some time.

2.4.3 Confounded cyprinids - genetic polymorphisms and gene tree issues

Gene trees of brassy minnow mtDNA cyt b and ND4 exhibited considerable discordance between gene and species trees. Presuming these mtDNA loci are acting neutrally, coalescent

24 theory suggests these gene copies are sorted randomly through time and will eventually reach fixation depending on the amount of time passed relative to the mitochondrial effective population size (Brown et al., 1982; Birky et al., 1989). Gene trees are small sub-sets of species trees and therefore discordance between gene and species trees can happen via several processes including: possible selective pressures on loci, gene duplications and subsequent loss, reticulate evolution via hybridization and introgression, and incomplete lineage sorting or deep coalescence (Maddison, 1997). Gene duplication and loss are unlikely to have influenced

Hybognathus gene evolution in the post-glacial timeframes focussed on in this study

(Maddison, 1997; Maddison and Knowles, 2006); however, reticulate evolution and incomplete lineage sorting have been suggested to have influenced Hybognathus evolution and confounded species trees with incongruences between nuclear versus mitochondrial genes for this group (Moyer et al., 2009). For instance, cyprinids are known to undergo hybridization and introgression (Gerber et al., 2001), and in Hybognathus low levels of hybridization have been found in co-occuring species (Moyer et al., 2005). Furthermore, both common shiner and

Mississippi silvery minnow overlap with current brassy minnow ranges in the east; common shiner co-occur with brassy minnow from the Great Lakes through the Great Plains to

Saskatchewan (Scott and Crossman, 1973), and Mississippi silvery minnow co-occur with brassy minnow near the Great Lakes in Illinois and Wisconsin (Moyer et al., 2009) suggesting that contact for hybridization is possible. While it is possible that the incongruent brassy minnow sampled from sites in Ontario and Québec were misidentified, and were in fact common shiner, it is unlikely that the other incongruent brassy minnow samples could have been misidentified as Mississippi silvery minnow because these two specie’s ranges do not overlap in the areas

25 that where sampled for this study. Incomplete lineage sorting of these genes is another possible explanation for the observed discordances because, in general, cyprinids should have species trees that possess wide branches if possessing generalised life histories associated with high reproductive output (Maddison, 1997). These wide species tree branches coupled with short time since divergence, perhaps as little as post-glacial time-frames, can increase the probability of deep coalescence (Maddison, 1997). Furthermore, the fact that brassy minnow had ND4 copies from a congener and cyt b from common shiner that is a sister group to

Hybognathus (Dowling et al., 2002) further suggests that introgression and/or incomplete lineage sorting are strong possibilities for the incongruences that I observed.

2.5 Conclusions

This chapter has demonstrated that brassy minnow populations form an approximate ‘east- west’ split at cyt b and ND4 mitochondrial loci. While ‘eastern’ and ‘western’ populations of brassy minnow are distinct due to isolation and inhabit different freshwater eco regions, there is little evidence for the evolutionary significance of this discreteness, i.e., the groups were not strictly monophyletic and we have no data on possible adaptive differences between ‘eastern’ and ‘western’ assemblages. Still, the large disjunction between the assemblage centres in

Ontario/Québec and Saskatchewan/Alberta/BC indicates that if populations in one of these areas become extirpated, there would be a large gap introduced into the range of brassy minnow in Canada. Consequently, maintenance of ‘eastern’ and ‘western’ populations has some geographic significance in terms of maintaining the extent of the range of the species in

Canada. Thus, it seems not unreasonable that ‘eastern’ and ‘western’ assemblages of brassy minnow might constitute two DUs for status assessment in Canada.

In addition, certain ‘eastern’ brassy minnow sequences of cyt b and ND4 exhibited incongruences between species and gene trees, matching sequences for common shiner and

Mississippi silvery minnow respectively in BLAST searches in GenBank suggesting evolutionary processes such as deep coalescence and reticulate evolution have occurred in brassy minnow.

Additionally, ‘eastern’ brassy minnow populations were mostly basal in these gene trees, with

‘western’ populations as derived, suggesting (re) colonization of the ‘west’ from the Mississippi-

Missouri refugium and ‘spill-over’ into BC. In BC, the lower Fraser River populations of brassy minnow were intermixed in the upper Fraser River and Peace River populations, suggesting multiple natural downstream dispersals occurred rather than single anthropogenic introductions.

In the next chapter I explored issues in the conservation biology of brassy minnow. I surveyed the distribution of brassy minnow within BC, with an emphasis in the Lower Mainland. I sampled within the various regions of BC where brassy minnow occur to explore differences in catch rates between areas. I also examined the relative abundance and, seasonal trends in habitat use of brassy minnow, and explored a predictive habitat model for physical parameters associated with brassy minnow presence in the Lower Mainland.

Figure 1. The approximate area of extent for brassy minnow across Canada and the United States modified from Moyer et al. (2009) and McPhail (2007). Brassy minnow have a more continuous range in the east and across the plains relative to some western populations in Alberta and BC which are isolated and disjunct.

Figure 2. Sites where brassy minnow samples were obtained for genetic analyses. Site numbers correspond to the numbers on the branches of gene trees.

FR(11) FR(11) FR(11) WH(33) Rich(31) Delta(33) Delta(33) FR(11) FR(11) WH(33) BrL(20) WH(32) ‘east’ FR(11) 66 FR(11) BC(21) ‘west’ HL(18) HL(18) BC(21) ML(12) Rich(31) BC(21) BC(21) BC(21) Delta(33) HuL(22) Delta(33) Rich(31) WH(32) ML(12) WH(32) TC(17) NY(1) 84 Win(7) NY(1) Mich(6) Que(3) Que(3) NY(1) 81 SP(10) LR(8) LR(8) 87 LR(8) 63 NP(9) NP(9) NP(9) 62 NP(9) NP(9) Delta(33) SR(28) WL(26) WL(26) 71 Bell(27) Bell(27) DL(30) DL(30) Delta(33) NL(24) Delta(33) SH(23) 89 NL(24) 100 Delta(33) BL(25) Delta(33) 89 59 81 BL(29) 50 BL(29) H.argyritis 100 H.argyritis 96 Que(3) 89 Ont(5) Que(2) Que(2) 100 Que(2) Que(2) 100 Ont(5) Que(2) Que(2) C.plumbeus 100 C.plumbeus C.carpio 0.02

Figure 3. Cyt b Neighbour Joining tree with 1,000 Bootstrap replicates for brassy minnow. Numbers in parentheses correspond to the sampling sites shown in Figure 2.

‘east’

‘west’

Figure 4. Cyt b majority rule Bayesian tree for brassy minnow. Numbers in parentheses correspond to the sampling sites shown in Figure 2.

58 MM(13) WR(14) 84 FR(11) ‘east’ Bell(27) WL(26) BtL(25) ‘west’ BrL(20) BH(19) 51 FR(11) BtL(25) FR(11) HL(18) SR(28) 50 51 SR(28) WH(32) DL(30) Delta(33) TC(17) FR(11) BrL(20) HL(18) TC(17) BH(19) TC(17) BL(29) 50 DL(30) 96 ML(12) 94 ML(12) WL(26) 60 HuL(22) SH(23) WH(32) FR(11) NL(24) Ont(5) Que(4) NY(1) Win(7) NY(1) 63 NP(9) NP(9) 100 98 61 NP(9) NP(9) 67 Bell(27) RM(16) 76 50 Rich(31) 62 Rich(31) BC(21) 60 Delta(33) 69 BC(21) NY(1) 51 Que(4) 100 100 Que(4) 95 LR(8) LR(8) SP(10) 58 NP(9) H.argyritis 100 H.argyritis Que(2) 100 Que(3) C.auratus 0.05

Figure 5. ND4 Neighbour Joining tree with 1,000 Bootstrap replicates for brassy minnow. Numbers in parentheses correspond to the sampling sites shown in Figure 2.

‘east’

‘west’

Figure 6. ND4 majority rule Bayesian tree for brassy minnow. Numbers in parentheses correspond to the sampling sites shown in Figure 2.

CHAPTER 3: TOWARDS A PREDICTIVE HABITAT MODEL FOR H. HANKINSONI

3.1 Introduction

3.1.1 General Hybognathus conservation - vulnerable life histories?

It is suggested that up to 25% of all freshwater fishes are threatened with extinction (Vié et al.,

2009), and in North America many species within the family Cyprinidae are in decline (Tonn and

Magnuson, 1982; Williams, 1989; Patton et al., 1988; Jackson et al., 1992; Fausch and Bestgen,

1997; Vander Zanden et al., 1999; MacRae and Jackson, 2001). Of the cyprinid guilds, it is suggested that there are decreasing abundances in ‘herbivorous pelagic spawners’ (Scheurer et al., 2003; Dodds et al., 2004), and that small, short-lived, opportunistic species with high reproductive efforts, and therefore, highly variable yearly survivorship, are the most vulnerable species to stochastic events (Caughley et al., 1994; reviewed in Winemiller, 2005). Hybognathus spp. possess these generalized life history traits and are members of this feeding guild, and in many instances these minnows are undergoing local reductions and extinctions in Colorado

(Scheurer et al., 2003), New Mexico (Alò and Turner, 2005), Tennessee (Etnier et al., 1979),

Alberta (Ripley, 2001), and BC (McPhail, 2007). Despite this, there have been few studies done on the conservation of Hybognathus specifically, except for the endangered species Rio Grande minnow, Hybognathus amarus (Dudley et al, 2003; Alò and Turner, 2004; Alò and Turner, 2005), the locally endangered plains minnow, H. placitus in Colorado (Scheurer et al., 2003), threatened populations of brassy minnow, H. hankinsoni in Colorado (Scheurer et al., 2003), and local assessment reports on H. hankinsoni (Ripley, 2001), and western silvery minnow, H. argyritis in Alberta (Pollard, 2003). Many of the population declines in the Hybognathus have

34 been attributed to river fragmentation due to anthropogenic impoundments, mainly dams, but the introduction of invasive species into areas is also a factor (Alò and Turner, 2004; Quist et al.,

2004; Alò and Turner, 2005). Frequently, threats from invasive species are in areas where other anthropogenic disturbances have occurred, and several studies suggest that habitat disturbances may increase the probability of invasive species becoming established (Whittier et al., 1997; Gido and Brown, 1999; Bunnell and Zampella, 2008). Clearly, pre-impact research into the distribution, ecology, and conservation of the Hybognathus, in this case brassy minnow in

BC, would aid in population monitoring, and in designing strategies for the long-term persistence of this species.

3.1.2 The overall distribution of brassy minnow in Canada, and the highly disjunct BC populations

In Canada, brassy minnow can be found as far east as Québec in the St. Lawrence, Gatineau, and Ottawa rivers’ tributaries, through southern Ontario water bodies historically associated with the Mississippi and Missouri systems, and in lakes Superior and Michigan (Scott and

Crossman, 1973; McPhail, 2007). In Manitoba their range extends further into the Red,

Assiniboine, and Winnipeg rivers’ drainages, and in Saskatchewan brassy minnow have been found in the Souris River and Frenchman River systems (Scott and Crossman, 1973; McPhail,

2007). Further west in Alberta and BC the distributions of brassy minnow are disjunct, patchy, and isolated. For instance, in Alberta brassy minnow are recorded in the Oldman River and Milk

River systems in the southern portion of the province, and in the Athabasca River system near

Fort McMurray and the Peace River system, both of which are in the centre of this province

(Scott and Crossman, 1973; McPhail, 2007). In BC, the distribution of brassy minnow follows

35 this same central-southern range; they are found in the Peace River and upper Fraser River systems north of Prince George, in the Horsefly River system near Williams Lake, and then 800 km downstream in the lower Fraser River from Chilliwack to Westham Island at the mouth of the south arm of the Fraser River (McPhail, 2007).

3.1.3 Patchy local abundances of brassy minnow, and the value of a predictive habitat model

There have been few studies specifically on the ecology and life history of brassy minnow.

Brassy minnow are small (to a maximum of 88 mm fork length), schooling fish that are considered to be herbivorous; much of their diet consists of algae, detritus, and organic matter.

Stomach content analyses, however, have also included zooplankton and insects (Copes, 1975;

McPhail, 2007). Adult brassy minnow are typically found in lakes, rivers, creeks, sloughs, and ditches where flow rates do not exceed 50 cm per second (McPhail, 2007). Habitat models show that the presence of brassy minnow is correlated with the presence of submerged vegetation which is used for food and cover (Quist et al., 2005). Depth and isolation of water bodies are important for the persistence of brassy minnow in areas where freezing or drying of pools occurs. These pools must be of sufficient depth such that brassy minnows can survive during periods of freezing, and if the pools are not isolated they can move to deeper habitats

(Scheurer et al., 2003). Brassy minnow are tolerant of many abiotic extremes; they have been found in water temperatures up to 35:C with dissolved oxygen concentrations as low as 0.03 mg per L (Scheurer et al., 2003; Quist et al., 2004), as well as in brackish waters (McPhail, 2007).

Adult brassy minnow seem highly transitory, only remaining in areas and reaching high abundances if conditions are favourable, and if predation and/or competitive pressures are low

(McPhail, 2007). In BC, upper Fraser and Peace River populations of brassy minnow spawn from

June to August, while the lower Fraser River populations spawn in vegetated backwaters in May to June with the possibility of a second spawning in the early fall (McPhail, 2007). Additionally, seasonal habitats seem important for spawning sites and larval development in some populations (Scheurer et al., 2003). It has been suggested that eggs, larvae and juvenile brassy minnow can disperse and may colonize areas depending on flow regime (Scheurer et al., 2003).

Understanding and identifying essential habitat for brassy minnow is important for sampling potential areas within their range for additional populations, and monitoring the demographics of the known populations. A predictive habitat model would help to achieve these goals, and possibly help explain the local variability in brassy minnow abundance throughout their range, and permit possible longer term conservation studies and monitoring.

3.1.4 Objectives

Given that brassy minnow seem to be tolerant of a wide range of abiotic conditions in other areas (Scheurer et al., 2003; Quist et al., 2004), I expected that in BC, brassy minnow would be found in a wide range of water bodies with variable abiotic habitat parameters at sites and that habitat model associations may involve a range of variables (Porter et al., 2000). Also, given that Hybognathus spp. are considered part of the ‘turbid water cyprinid community’ assemblage of the Great Plains (Quist et al., 2003), and that highly turbid waters can afford cyprinids some shelter from visually based predators (Abrahams and Kattenfeld, 1996; Reid et al., 1999), I expected that the habitat parameter that would contribute most to predicting brassy minnow presence would be high turbidity. The overall objective of this chapter was,

37 therefore, to develop an understanding of the physical habitat parameters that are associated with, and perhaps promote, persistence of brassy minnow in aquatic habitats.

3.2 Materials and methods

3.2.1 Sampling in the Lower Mainland

The UBC Fish Collection (http://www.zoology.ubc.ca/~etaylor/nfrg/fishmuseum.html) was searched electronically for all historical records of brassy minnow in the Lower Mainland region of BC (Figure 7). The original sampling method conducted in 1956 and 1959 was by beach seine with up to five passes per locality, so these methods were replicated for the 2008-2009 re- sampling in order to minimize differences in sampling method and effort, which can confound historical comparisons (Patton et al., 1998). Also the re-sampling was replicated in the same months as the historical sampling at sites because local fresh water community compositions can be seasonal (Patton et al., 1998; Porter et al., 2000).

3.2.2 One year minnow trap survey

Additionally, a monthly minnow trap survey (total n = 60 sites) was conducted for one year from June 2008 to June 2009 for the Lower Mainland, and included the historical brassy minnow sites (n = 8) along with several preliminary sampling locations (Taylor and Aspinall, unpub.)(Figure 7). This trapping schedule was to further identify brassy minnow local distributions, to examine possible seasonal movements (as suggested in McPhail, 2007) including seasonal habitat use, and to explore the distribution and composition of invasive species in the lower Fraser River watershed. Although no sampling method is without bias,

38 minnow trapping has proven to be an efficient sampling method for small fishes in shallow waters, and amongst the best gear for sampling lake community species compositions (Jackson and Harvey, 1997). As such, minnow traps were baited with sardines and soaked for 48 hours, traps were re-set each month within 2 m of the previous months trap location, all fishes and other vertebrates were identified and their abundance recorded and then released unharmed.

Anurans were identified as bullfrogs (Lithobates catesbeianus) (over 75 mm total length (TL)), or unidentified tadpoles (under 75 mm TL). I also recorded the depth of water as well as the water temperature (for eight of 12 months) at each trap location. Habitat features (i.e., cover, macrophyte presence-absence, and substrate) was also recorded for all 60 sites (Appendix 3).

3.2.3 Catch-per-unit effort

Catch-per-unit effort (CPUE) was calculated in terms of the number of brassy minnow caught per trap hour in four different regions of BC (i.e., Peace-Williston Reservoir, Peace-upper Fraser

Summit Lake, mid-Fraser Horsefly, and lower Fraser; for site locations see Appendix 4). This was to compare standardized measures of approximate catch abundances for brassy minnow in each of the regions of BC.

3.2.4 Relative abundance and sampling autocorrelations

Relative abundance of brassy minnow was calculated both per site (n = 60) and per region (n =

12) of the Lower Mainland. The regions of the Lower Mainland consisted of tributaries of the

Fraser River as follows: 1 = Coquitlam River, 2 = Pitt-Alouette River, 3 = Stave River, 4 = Hatzic

Lake and sloughs, 5 = Nicomen Slough, 6 = Sumas-Vedder rivers, 8 = Richmond sloughs, 9 =

Ladner sloughs, 10 = Westham Island sloughs, Delta sloughs, 11 = Deer Lake and 12 = Burnaby

Lake and Brunette River. The number of brassy minnow was recorded in each month at sites to note seasonal trends in habitat use and potential brassy minnow movements (Appendix 5). Due to the nature of such temporal re-sampling potential statistical non-independence can arise due to autocorrelation. Autocorrelation occurs when data points or data errors are interdependent spatially or temporally, thus violating assumptions of independence required for many statistical tests (Carroll and Pearson, 2000; Lichstein et al., 2002; Diniz-Filho et al.,

2003). As autocorrelation at sites could potentially lead to errors, one month lagged regressions of brassy minnow abundance per site (n = 22) and per month (n = 12) were performed using

JMP 4.0 to calculate Durban-Watson test statistics (d) from the residuals (Appendix 6) for testing for potential autocorrelation (Carroll and Pearson, 2000).

3.2.5 Measuring site habitat attributes

Habitat attributes were measured for 37 Lower Mainland sites over two days in August of 2009.

Water velocity, pH, conductivity, turbidity, temperature, and average depth were measured within 2 m of trap sites (Appendix 7). Water velocity was measured in the fastest moving water within 2 m of the trap site with a Marsh-McBirney Flo-Mate Model 2000. Conductivity and pH were measured at each trap site using a Hoskin Scientific 340i probe that was calibrated approximately once every third site. Turbidity was measured using a LaMotte 2020e meter.

Temperature was measured at each site and was compared to monthly trapping temperature measures (n = 8 per site), and the maximum temperature was chosen. Maximum temperature was used as it can be a limiting factor for species presence in freshwater communities (Jackson et al, 2001). Depth was measured at sites with a meter stick within 2 m of the trap location.

3.2.6 Use of logistic regression for predictive habitat models

Logistic regression-based habitat models have been used to predict the presence-absence of fishes (Porter et al., 2000; Dauwalter and Rahel, 2008). Logistic regression is useful for creating a habitat model because it requires no assumptions of normality or equality of variances of the sample data; it can accommodate any class of parameter input variable, and yields a binary outcome (e.g., presence-absence; Tabachnick and Fidell, 1996). A logistic regression was performed in JMP 4.0 with the following parameter input variables for 37 Lower Mainland sites: water velocity, pH, conductivity, turbidity, maximum temperature, and trap depth. Previous studies have suggested that the presence of macrophytes positively correlate with brassy minnow presence (Quist et al., 2005). However, for the scale of my study macrophyte presence- absence counts were excluded as all sites had macrophytes present. To check for multicolinearity issues that can confound logistic regressions if input variables are too highly intercorrelated (i.e., r > 0.70), (Tabachnick and Fidell, 1996), pairwise correlations (Appendix 8) and variance inflation factors (VIFs) were calculated in JMP 4.0 for each input parameter

(Appendix 9). ‘Whole model’ and ‘reduced models’ of logistic regression was compared. A whole model contains all of the measured parameters, whereas a reduced model contains a reduced number of the parameters. When testing whole vs. reduced models, the null hypothesis (Ho) being tested is that removal of habitat parameters (x) does not affect the likelihood of brassy minnow presence (y), and the alternate hypothesis (HA) is that removal of habitat parameters (x) does affect the likelihood of brassy minnow presence (y). Input parameters were each examined with Ho: the habitat parameter (x) had a slope, X = 0, and HA: the habitat parameter (x) has a slope, x 0. Lastly, Wald effect tests were performed in JMP

4.0 for each input parameter, Ho: the input parameter (x) has no effect on the probability of brassy minnow presence (y), and HA: the input parameter (x) has no effect on the probability of brassy minnow presence (y).

3.3 Results

3.3.1 Catch-per-unit-effort in BC for brassy minnow

Catch-per-unit-effort (CPUE) of brassy minnow in BC was highest in the Peace River system around the Parsnip Reach area of Williston Lake with 0.083 fish per trap hour, and lowest in the mid-Fraser River region around the Horsefly River drainage with 0.016 fish per trap hour. In general, the central interior BC populations (i.e., Peace and upper Fraser tributaries) had higher proportions of brassy minnow caught per hour than the downstream populations in the

Horsefly drainage and Lower Mainland tributaries (i.e., in the mid and lower Fraser) (Figure 9).

The CPUE did not differ greatly for the overall (i.e., year-long) Lower Mainland sampling, and the upper Fraser and Peace River sampling. However, when only May CPUE was used for the lower Fraser to match the May only sampling in the other regions, the generally lower Fraser

CPUE were more similar to the Horsefly River drainage CPUE.

3.3.2 Seasonal and regional brassy minnow relative abundances in the Lower Mainland

In the Lower Mainland (lower Fraser River Valley), after a total of 35,712 minnow trap hours, brassy minnow were caught at 22 out of 60 sites (37% of sites sampled). Of all brassy minnow trapped, Westham Island recorded the most catches; 74% of all brassy minnow were trapped in the Lower Mainland from this location (Figure 10). In contrast, the Sumas River near Abbotsford

42 was the region where fewest brassy minnow were caught, but they were still present at 0.4% of all catches. No brassy minnow were caught for the duration of the study in the Coquitlam, Pitt,

Alouette, Stave, and Hatzic, Nicomen, or Vedder drainages despite UBC historical records of brassy minnow presence in these areas. Of the water bodies surveyed, brassy minnow were most frequently sampled in sloughs at 78%, followed by creeks at 15% (Figure 11). Seasonally, brassy minnow was most frequently encountered in the summer (June-August), as 74% of all brassy minnow encountered in the Lower Mainland were sampled in these months.

Additionally, in June, gravid brassy minnow were found in very large numbers in Tamboline

Slough, where general abundance was very high (n = 1,126 brassy minnow in two minnow traps). In July and August, the Deer Lake population of brassy minnow moved from the littoral zone of the lake to spend more time in the pelagic zone (D. Nowosad pers. obs). Both Deer Lake and Burnaby Lake populations of brassy minnow moved into the surrounding four creeks in the winter months, and at Pavilion Creek brassy minnow were caught for several months (Sept -

Jan) over the winter. Generally, in the winter months (Dec-Feb), brassy minnow were most frequently encountered in small creeks under 2 m in width; 77% of brassy minnow were caught in such water bodies during this time.

3.3.3 Sites with positive temporal autocorrelations for brassy minnow sampling

Of the regions of the Lower Mainland where brassy minnow were sampled over the 12 month study, they were found in Delta for all 12 months, Burnaby Lake for nine months, Westham

Island for eight months, Deer Lake for six months, Richmond for four months, and Sumas River for three months. Four sites exhibited positive autocorrelations for brassy minnow presence.

This included all three sites on Westham Island (site 37, Tamboline Slough NE, d = 1.101, n = 12, p = 0.044; site 38, Tamboline Slough SW, d = 1.102, n = 12, p = 0.045; site 39, London Slough, d

= 0.711, n = 12, p = 0.004), and one site in Delta (site 44, 128th Rd, d = 0.710, n = 12, p = 0.004).

3.3.4 A predictive habitat model for brassy minnow

Brassy minnow were found at sites with wide ranges of habitat measures, such as pH 5.42-8.88 and temperatures ranging from 1-25:C. Brassy minnow were also present across a wide range of turbidity, from 1.11-24.3 NTUs (nephelometric turbidity units), and conductivities ranging from 101-2060 µS/cm. Additionally, brassy minnow were found at sites with dissolved oxygen levels as low as 3.1% saturation. For the logistic regression model, comparisons of the full model to the reduced model rejected the null hypothesis that the habitat parameters (x) did not affect the likelihood of brassy minnow presence (y) (Table 1). The coefficient of determination for model fit was r2 = 0.46. The fitting of the parameter input variables and Wald effect tests of the parameter input variables yielded similar results. Conductivity was the only parameter that approached a significant effect on brassy minnow presence (χ2 = 3.625, df = 1, p

= 0.056) (Table 2).

3.4 Discussion

3.4.1 Distribution and catch-per-unit-effort for brassy minnow in BC

Brassy minnow were found in all regions of BC where UBC Fish Museum records had historical entries of brassy minnow presence with the exception of five local areas in the Lower Mainland and generally supported the range of the species proposed by McPhail (2007) (Appendix 5). In

44 the areas between Williston Reservoir and Summit Lake, additional populations of brassy minnow were found by biologists of the Peace Williston Fish and Wildlife Compensation

Program (R. Zemlak, Peace Williston Fish and Wildlife Compensation Program, pers. comm.,

2009). No brassy minnow were found in the Quesnel River near the Horsefly River drainage, but there is suitable habitat and the potential that brassy minnow are present in drainages associated with the Fraser River between Quesnel Lake and Prince George. In the lower Fraser

River, brassy minnow were found in tributaries of the Sumas River in Yarrow near Abbotsford, in Deer and Burnaby lakes, and in sloughs associated with Richmond, Delta and Westham

Island. No brassy minnow were found in the Coquitlam, Pitt, Alouette, Stave rivers, Hatzic Lake, or Nicomen Slough tributaries for the duration of the sampling, despite historical UBC Fish

Museum records of brassy minnow presence in these areas.

Richardson et al. (2000) examined changes in fish community structure in the main-stem of the lower Fraser River, comparing sites in 1973 to 1995, and found small numbers of brassy minnow in areas between Pitt Meadows and Agassiz in the Fraser River proper. This could mean that brassy minnow are utilizing the main-stem of the Fraser in these areas rather than backwaters, or may be a main-stem resident population that could act like a meta-population for backwater re-colonizations (Fraser et al., 1999). Another possibility is that brassy minnow may be attempting to re-colonize these backwaters, but with the combination of fragmentation by dams in these areas (e.g., areas of the Alouette and Stave rivers), and high numbers of invasive predators present at sites (e.g., Silvermere-Stave Slough and Hatzic Lake and sloughs, see Chapter 4) adult brassy minnows may fail to colonize or persist and may become additionally fragmented by the presence of predators (Fraser et al., 1995; Gilliam and Fraser,

2001). Additionally, brassy minnow eggs and larvae maybe washed out of these areas into the

Fraser River due to the proximity of these sites to the dams that control these tributaries discharge. Presumably, controlled discharge minimizes flooding in these local areas rather than allowing the riverbanks to overflow creating more seasonal side-channels and new flood plain habitat that may be used as brassy minnow nurseries (Scheurer et al., 2003). The effects of such hydrological processes caused by dam construction and discharge on Hybognathus life history have been examined in the conservation efforts of Rio Grande minnow demonstrating downstream washing of eggs and larvae and habitat fragmentation due to the blocking of upstream movement of adults (Alò and Turner, 2004). Furthermore, studies on the swimming performance of Rio Grande minnows showed they quickly fatigued in waters flowing over 60 cm/sec (Bestgen et al., 2010). Therefore, even if brassy minnow are capable of entering these tributaries when discharge is minimal, the high number of invasive predators (in some areas up to four species per water body) in such areas could reduce or extirpate the colonizers (Whittier et al., 1997; Findlay et al., 2000; Quist et al., 2004).

Causes of discrepancies between upstream (i.e., Peace and upper Fraser River) and downstream (i.e., mid and lower Fraser River) CPUE of brassy minnow are speculative and could benefit from finer-scale population genetic studies (e.g., microsatellite analyses) to infer population structure and interactions, especially migration events. From limited sampling, the upstream populations have higher CPUE, and presumably, higher abundances than downstream populations which might be a reflection of the step-wise post-glacial (re) colonization of BC by brassy minnow with the upstream as the source population for downstream populations. Certainly, the distribution of brassy minnow align with the post-

46 glacial (re) colonization routes suggested in Rempel and Smith (1998) and McPhail (2007), i.e., colonization from the east across the Rocky Mountains through ephemeral watershed connections. This scenario is supported by the distribution of brassy minnow on both sides of the Continental Divide (McPhail, 2007) fossil brassy minnows collected from the site of former

Glacial Lake Agassiz (Rempel and Smith, 1998), my molecular data (Chapter 2), and other plains fish species utilizing this (re)colonization route (Rempel and Smith, 1998). While this may explain the distribution of brassy minnow in central BC, the presence of brassy minnow some

600-800 km downstream in the Lower Mainland is puzzling. Perhaps the presence of brassy minnow in the Horsefly River area hints at a stepwise dispersal pattern. Just before the Lower

Fraser Valley, however, lies the Fraser Canyon which is a major barrier for small fish species for both upstream (e.g,. three spine stickleback, Gasterosteus aculeatus) and downstream (e.g., lake chub, Couesius plumbeus) (McPhail, 2007) migration/colonization. Brassy minnow, however, apparently show exceptional downstream dispersal in early life stages (i.e., eggs and larva) as described in Scheurer et al. (2003). Studies on the distances travelled by early life stages of brassy minnow have not been conducted, but for a congener, the Rio Grande minnow, dispersal has been examined with eggs travelling distances greater than 100 km and remaining buoyant for five days (Alò and Turner, 2005). Therefore, depending on the distance to backwater spawning areas, actual distance downstream, and the level of discharge possibly enhanced by snow melt and flooding, brassy minnow could potentially pass through the Fraser

Canyon. Other explanations for the differential CPUE for brassy minnow upstream versus downstream could include: differences in suitable habitat depending on region, as well as

47 different levels of stressors such as, effluents, habitat loss, number of and types of predators, and invasive species presence between regions.

3.4.2 Relative abundance, persistence, and regional habitat use of brassy minnow in the Lower Mainland

Westham Island was the region of the Lower Mainland with the highest relative abundances of brassy minnow with 74% of all individuals caught for the duration of this study in the two sloughs in this area. Large densities of brassy minnow were encountered in Tamboline Slough on Westham Island in June of 2008, which skewed the relative abundance for the species in this region. This large aggregation corresponds with spawning times suggested in McPhail (2007), and although actual spawning was not observed, ripe females were among the individuals sampled at this time, and fry were observed at this site in the summer months. Brassy minnow persisted in Westham Island sloughs for eight of the 12 months of sampling. Local habitat shifts by brassy minnow occurred in the late summer to early fall corresponding to the appearance of adults of the invasive species brown bullhead, Ameiurus nebulosus (see Chapter 4).

Deer Lake was the region with the next highest relative abundance of brassy minnow with large shoals observed throughout the spring in the littoral zone of the lake, frequently in shallow water (i.e., under 30 cm) feeding on filamentous algae. During the summer months, brassy minnow moved into the pelagic zone of the lake, and only fry could be found in the shallow areas of the littoral zone. Such habitat shifts by minnows have been observed in the presence of predators (Power et al., 1985; Schlosser, 1988; He and Kitchell, 1990; MacRae and Jackson,

2001); however, no predators were sampled in the littoral zone during this time except for

48 potentially large specimens of prickly sculpin, Cottus asper, that are present in the littoral zone of Deer Lake year-round. Therefore, the pelagic habitat use by brassy minnow may be a result of increased plankton resources in open water during this time. Similar littoral to pelagic habitat shifts were observed in bluegill sunfish, Lepomis macrochirus, to utilize the more abundant zooplankton resources in open waters for the summer months (Mittelbach, 1981).

Nevertheless, it is likely that brassy minnow movements into open water influenced the relative abundance measures by decreasing catch numbers of minnows in Deer Lake during the summer months, as trapping was focussed on the littoral zone. Brassy minnow were found for six months of the year in Deer Lake, predominantly in the spring and summer months. During the late fall, Deer Lake populations of brassy minnow migrated into creeks surrounding the lake, presumably to overwinter. Migration of brassy minnow into creeks may be due to decreased swimming performance as a result of lower winter temperatures. For instance, a congener Rio

Grande minnow, H. armarus, displayed positive correlations between swim performance and warm temperatures (Bestgen et al., 2010). Also, as temperatures dropped in Deer Lake influxes of coho salmon, Oncorhynchus kisutch, were observed and perhaps brassy minnow seek refuge in the surrounding creeks as a response to coho salmon predation. After this migration, brassy minnow were not found in Deer Lake until the following spring.

The sloughs and ditches of Delta were the areas with the third highest abundance of brassy minnow, and the area of highest persistence with brassy minnow found in the region for all 12 months of the study. Several of the sites in Delta were shallow (i.e., under 60 cm deep), but they fluctuated little in depth, suggesting that drying and freezing of water and associated mortality of brassy minnows in these habitats likely did not influence sampling (Scheurer et al.,

2003). Variations in water body connectivity that can affect brassy minnow presence (Scheurer et al., 2003) were present in Delta, but proved to be a short-term issue at two sites where ditches were choked by soil erosion and plant growth. However, these ditches were re- connected after being dredged with heavy equipment. Few predators were caught in Delta, apart from larger (i.e., over 120 mm FL) brown bullhead in the deeper sloughs and this limited presence of aquatic predators may be a factor favouring the persistence of brassy minnow here.

Burnaby Lake had the fourth highest abundance, and second highest persistence of brassy minnow, with minnows present in nine of 12 months. The majority of brassy minnow sampled in Burnaby Lake were caught in creeks surrounding the lake, particularly in creeks near Deer

Lake Brook which connects Deer Lake and Burnaby Lake. It is possible that some of these brassy minnow were migrants from Deer Lake that passed over a weir present at the Burnaby Lake side of Deer Lake Brook and could not return to Deer Lake as such structures can block adult

Hybognathus movements (Alò and Turner, 2004). The Burnaby Lake populations of brassy minnow followed the same fall movements into creeks as the Deer Lake brassy minnows, and in

Pavilion Creek brassy minnow could be found throughout the winter. This suggests that brassy minnow overwinter in small (i.e., under 2 m wide) creeks with organic matter for cover rather than in deeper waters as suggested by McPhail (2007). Northern pikeminnow, Ptychocheilus oregonensis were the only predators trapped in such creeks in Burnaby Lake.

Areas with the lowest abundances of brassy minnow were Abbotsford-Yarrow tributaries of the

Sumas River, followed by the sloughs and ditches of Richmond. In Richmond, all brassy minnow

50 were sampled within 1 km of the confluence of the Fraser River, and as the sloughs neared the

Fraser River proper, the water levels were highly influenced by tides and pump-houses occasionally drying out sections of ditches and sloughs in this area. Therefore, the connectivity and drying of Richmond sloughs may constrain brassy minnow persistence in these areas as these factors are known to affect brassy minnow populations in Colorado (Scheurer et al.,

2003). Large brown bullhead and northern pikeminnow were the only predators sampled in these sloughs. In the tributaries of the Sumas River, brassy minnow were found in low numbers

(i.e., under six individuals per trap, and most often one), and were never found at the same site twice. Coho salmon, coastal cutthroat trout, Oncorhynchus clarkii clarkii, and northern pikeminnow predators were all sampled in the Sumas River tributaries, although the salmonids were only trapped in these areas in the late summer and early fall. Although subpopulation interactions of brassy minnow, such as interlocality dispersal in the Lower Mainland remain speculative, based on sampling alone, the limited numbers of brassy minnow caught in the tributaries of the Sumas River and the potentially isolated nature of this subpopulation suggest that fish in this area may be at risk and require further monitoring.

Caution should be used when interpreting relative abundance data due to potential lack of independence of repeated sampling. For instance, with temporal sampling such as the monthly re-trapping at sites, temporal autocorrelation could potentially lead to inflated abundance measures (Diniz-Filho et al., 2003). This may be the case for the three Westham Island sites and the one site in Delta, because these sites exhibited positive autocorrelations for monthly brassy minnow abundance. However, in the case of the Westham Island and Delta sites, lack of independence likely reflect brassy minnow remaining at these sites for prolonged periods of

51 time (i.e., all sites had brassy minnow present for over five months of the 12 month study), thus reflecting brassy minnow persistence in the area and the importance of these localities for brassy minnow conservation.

3.4.3 Predicting brassy minnow presence

As I expected, brassy minnow in the Lower Mainland exhibited similar physiological tolerances to abiotic factors as suggested by Quist et al. (2004), and Scheurer et al., (2003). For instance, brassy minnow were found in water bodies ranging from ditches to small lakes with DO levels as low as 3.1% of saturation, temperatures to 25:C, turbidities up to 24.3 NTUs, conductivities as high as 2060 µS/cm, and a range in pH from 5.42-8.88. Despite the variability in water bodies where brassy minnow were sampled, the model was able to explain 46 % of the variation in brassy minnow presence at sites in the Lower Mainland.

Contrary to expectation, turbidity was not the best parameter for the predictive habitat model of brassy minnow presence, but conductivity was, being marginally statistically significant.

Conductivity is the ability of a substance, in this case water, to pass electrical current and is a function of the abundance of inorganic dissolved solids present in a water body (Bunnell and

Zampella, 2008). Therefore, conductivity can be influenced by the mineral geomorphology of water bodies, marine influences, and run-off associated with development and agriculture

(Morgan and Good, 1988; Zampella et al., 2007). My predictive habitat model suggests that the presence of brassy minnow approached statistical significance for being associated with areas of high conductivity, and two of the areas associated with the highest abundance and persistence of brassy minnow, Westham Island and Delta, were also the areas of highest

52 conductance (744 – 2060 µS/cm). Richmond was the area of the next highest conductance (230

– 980 µS/cm), but had few brassy minnow present; however, brassy minnow were only found here in areas with higher conductivities (i.e., over 675 µS/cm). Presumably, these areas in the lowest reaches of the Fraser River have high conductance due to marine influences, but these are also highly developed areas with considerable agricultural run-off. This trend continued upstream in the Sumas River, where tidal influences are minimal, but agriculture abounds; the few brassy minnow found were in the highest water conductivities in the area (109-239 µS/cm), and these conductivity measures were similar to the urban lakes with heavy development nearby (i.e., Deer and Burnaby Lake, 101-246 µS/cm), that had some of the highest brassy minnow abundances.

Conductivity itself, however, might not be the best predictor for brassy minnow presence, because primary productivity correlates positively and strongly with high conductivity (Morgan,

1985). Measures of total dissolved phosphorous or chlorophyll would be useful as more direct correlates of primary production levels at these sites (Dillon and Rigler, 1974; Carlson, 1977;

Marshall and Peters, 1989) to test if productivity was a better predictor of brassy minnow presence. For example, high measures of chlorophyll a can indicate high local biomass of bacteria and phytoplankton (Nürnberg and Shaw, 1999), as well as certain zooplankton assemblages (Mills and Schiavone, 1982). Brassy minnow could aggregate in these kinds of areas to exploit such resources. In fact, brassy minnow have specialized feeding morphology

(e.g., mucous covered pharyngeal papillae and enlarged epibranchials) to harvest phytoplankton, bacteria, and diatoms (Hlohowskyj et al., 1989), but they also utilize zooplankton and zoobenthic invertebrates if present (Scott and Crossman, 1973; McPhail,

2007). The relationship of conductivity to productivity may also explain previous habitat model findings by Quist et al. (2005) who found that brassy minnow presence was positively correlated with submerged vegetation suggesting these areas had high productivity. This may also explain the common occurrence of brassy minnow in stained lakes (McPhail, 2007), because lakes rich in humic acid generally have higher: dissolved organics (especially nitrogen and phosphorous), phytoplankton, bacteria and chlorophyll a levels than unstained lakes

(Nürnberg and Shaw, 1999). Lastly, this may also explain the observation that brassy minnow are frequently found in high abundances throughout BC in lakes associated with the presence of waterfowl or waterfowl restoration programs (e.g., Burnaby and Deer Lake in the Lower

Mainland, Rocky and Mugaha Marsh near Williston Lake, and Neilson Lake near Summit Lake) as nutrients added to lakes by waterfowl can lead to increased conductivity and productivity

(Manny et al., 1994).

Water bodies with high conductivity and potentially high productivity may promote the presence of brassy minnow, but persistence in the area may also depend on the nature of the water body and the fish assemblage present. For instance, it has been suggested that cyprinid persistence in water bodies can be heavily influenced by aquatic predators; especially the number (Findlay et al., 2000), efficiency (Schlosser, 1988), habitat preference (Vander Zanden et al., 1999), and origin (i.e., invasive versus indigenous; Whittier et al., 1997) of predatory fishes in the local community. In addition, physical characteristics of the water body in relation to types of predators present can affect the persistence and abundance of cyprinids. For example, studies have shown that cyprinid species can persist in areas with aquatic predators depending on: the degree of heterogeneity and amount of cover present (MacRae and Jackson,

2001), the number of outlets, size, and depth of the water body (Whittier et al., 1997), and the degree of winterkill effects (Tonn and Magnuson, 1982) in the area. Furthermore, brassy minnow may be a ruderal species (i.e., a species to capable of exploiting disturbed areas) able to persist either in the absence of strong competitors and predators, or in areas where disturbances permit ‘harsh’ habitats for brassy minnow to persist until re-colonization is possible (Meffe, 1984; Wootton et al., 1996).

Such interactions may have influenced brassy minnow presence as several trends were observed when sampling brassy minnow throughout BC. For instance, in the central interior, brassy minnow were sampled in (1) small lakes with abundant submerged vegetation that were isolated or with seasonal outlets in which no predators sampled in the lakes (e.g., Mugaha and

Rocky Marsh, Boot, Neilson, and Wawn lakes), or (2) seasonal creeks or backwaters with varying states of submerged vegetation and no predators sampled at the same time. In both of these classes of water bodies, brassy minnow were consistently trapped with lake chub (all central interior sampling, save Wawn Lake), and less frequently with redside shiners,

Richardsonius balteatus (in seasonal creeks surrounding Williston Lake, and Wawn Lake). Such associations of brassy minnow with other cyprinids may reflect the high productivity of the areas (Mills and Schiavone, 1982), and may afford additional protection from predators depending on shoal size and the size similarity of both species and individuals (Morgan, 1988;

Theodarakis, 1989; Abrahams and Kattenfeld, 1996). In the Lower Mainland, brassy minnow were found in: (1) backwater ditches and sloughs with submerged vegetation present in areas of agriculture with occasional northern pikeminnow and, frequently brown bullhead present in these areas, (2) small urban lakes in highly developed areas with abundant submerged

55 vegetation and cover, with more than four outlets including several small, deep and creeks that were rich in organic matter, with occasional northern pikeminnow and prickly sculpin, Cottus asper, caught in these areas, and seasonal influxes of salmonids (coho salmon, rainbow trout,

Oncorhynchus mykiss, and coastal cutthroat trout), and (3) rivers and creeks with submerged vegetation in areas of agriculture associated with Sumas Prairie, with northern pikeminnow trapped at sites, and seasonally, coastal cutthroat trout and coho salmon. The incorporation of such predator and water body associations might improve habitat model fit for predicting brassy minnow presence. Further details on invasive predator interactions with brassy minnow are discussed in Chapter 4.

3.5 Conclusions

In this chapter I examined the distribution and relative abundance of brassy minnow in BC.

Catch-per-unit-effort data suggest that catches of brassy minnow in BC are highest in the Peace and upper Fraser rivers’, and within the Lower Mainland, the greatest number of brassy minnow as measured by relative abundance and persistence was at Westham Island and in

Delta. I also noted seasonal trends in habitat use for brassy minnow including spawning in

Westham Island sloughs, and movements into creeks by brassy minnow in lake habitats adding to the life history knowledge of this species. Additionally, I developed a logistic-based predictive habitat model for brassy minnow using physical habitat variables that suggested that conductivity was a near significant parameter for predicting brassy minnow presence, which could potentially allow for increased sampling efficiency for brassy minnow.

In the next chapter I explored the relative abundances of freshwater vertebrate species in the lower Fraser River, and the potential effects that several invasive freshwater vertebrates found in this area had on the persistence of brassy minnow. In addition, I compared contemporary invasive and native cypriniform species compositions, including brassy minnow, to historical sampling from approximately 50 years ago. I also explored the distribution of fish species between pool habitats at Westham Island, Tamboline Slough, after the influx of invasive adult brown bullhead. In addition, to further explore the effects of young-of-year brown bullhead on brassy minnow, I conducted a growth experiment with both of these species, and redside shiner a potential native competitor.

Table 1. Whole model and reduced model of logistic regression and their significance relative to the null hypothesis that removal of habitat parameters (x) does not affect the likelihood of predicted brassy minnow presence (y). The stated p value is the probability that rejecting the null hypothesis that removal of habitat parameters will not affect the likelihood of predicting brassy minnow presence is incorrect.

Whole Model vs. Reduced Model Test

Model Log likelihood Df Chi-square p

Difference - 11.629184 7 23.25837 0.0015

Full - 13.678388

Reduced - 25.307572 r2 (U) = 0.4595

Observations (sum weights) = 37

Parameter Estimates

Term Estimate Std Error Chi-square p

Intercept -12.412468 9.70309 1.64 0.2008

Depth 0.01565473 0.020588 0.58 0.4470

Max Temp -0.0013755 0.3642754 0.00 0.9970 pH 1.77663553 1.2561744 2.00 0.1573

Conductivity 0.00917774 0.0048206 3.62 0.0569

DO -0.0275944 0.0209665 1.73 0.1881

Water velocity -6.5835241 6.6778827 0.97 0.3242

Turbidity -0.1382536 0.1490181 0.86 0.3535

Figure 7. Localities of monthly sampled sites surveyed for fish species presence over one year in the Lower Mainland (n = 60 sites). In addition, historical sites (n = 8 sites) were re-seined during the 2008-2009 re-sampling in the months when the original sampling occurred in 1956/1959. The sites where habitat parameters were measured (n = 37 sites) were measured over two days in Aug 2009. Both historical and sites where habitat parameters were measured were part of the year-long monthly survey.

CPUE for brassy minnow in BC

0.08

0.06

0.04

CPUE(number of fish per hour) per fish CPUE(numberof

0.02 0.00

Peace Upper Fraser Mid-Fraser Lower Fraser(May only) Lower Fraser

Region of BC

Total number of brassy minnow caught in the Lower Mainland

1500

1000

Number of brassy minnow brassy of Number

500 0

1 2 3 4 5 6 7 8 9 10 11 12 13

Region of Lower Mainland

Number of brassy minnow caught per water body type across the Lower Mainland 1500 Sloughs = 11,904 trap hr.

Creeks = 5,357 trap hr.

Lakes = 6,547 trap hr.

Ditches = 5,357 trap hr. 1000

Rivers = 6,547 trap hr.

Number of fish caught fish of Number

500 0

Slough Creek Lake Ditch River

Water body type

CHAPTER 4: INVASIVE SPECIES IN THE LOWER MAINLAND AND INTERACTIONS WITH H. HANKINSONI

4.1 Introduction

4.1.1 The spread of exotics and the establishment of invasive species

Invasive freshwater fish species occur with what appears to be increasing frequency in Canada and in BC in particular (see Taylor, 2004). In BC, the regions appearing to be most affected by invasive species are those areas experiencing the fastest growth in human population and development, i.e., southern Vancouver Island, the Okanagan Valley, and the Lower Mainland

(Taylor, 2004). This is alarming, as habitat loss and invasive species (exotics that become established and negatively impact native species) are the most serious threats to indigenous freshwater fish species (Riccardi and Rasmussen, 1998; Dextrase and Mandrak, 2006). Despite conservation efforts, North American freshwater faunas have the highest rates of extinction of all North American taxa (Haas, 1999; Riccardi and Rasmussen, 1999). In one of the population centers for brassy minnow, H. hankinsoni, in BC, the lower Fraser River Valley, many invasive species are established including: common carp, Cyprinus carpio, smallmouth bass, Micropterus dolomieui, brown bullhead, Ameiurus nebulosus, and pumpkinseed sunfish, Lepomis gibbosus

(Cambray, 2003; Taylor, 2004; Dextrase and Mandrak, 2006; McPhail, 2007). Several of these invasive species could be impacting the distribution and persistence of brassy minnow in the lower Fraser Valley where at least some invasives have been present for more than 50 years.

4.1.2 Direct effects of invasive predators on brassy minnow and other cyprinids

Despite the apparent environmental ‘hardiness’ of brassy minnow, these fish require structurally complex habitats (defined as shallow and deep pools containing cover) to persist with predators (Scheurer et al., 2003), or as shown in other cyprinids good connectivity of water bodies to move into areas with fewer predators (He and Kitchell, 1990; He and Wright,

1992; Jackson et al., 2001). Top predators have been found to have profound direct (i.e., predation) and indirect (i.e., forcing habitat shifts) effects on brassy minnow persistence

(Findlay et al., 2000). Cyprinid abundance and diversity in general, decreases with the number of predators in the area (Findlay et al., 2000). Of these predators, introduced invasive littoral predators such as basses (genus Micropterus), have the strongest effects on cyprinid species persistence (Quist et al., 2004; Whittier et al., 1997). In several areas with such invasive predators, there have been large reductions in the native cyprinid communities (Robinson and

Tomm, 1989; Chapleau et al., 1997; Whittier et al., 1997). Many areas in North America have suggested that elements of faunal homogenization (sensu Taylor, 2004) include the replacement of cyprinid species with invasives, especially with non-native centrarchids

(Kamerath et al., 2008). Such changes and losses of biodiversity, and in particular for H. hankinsoni, may be happening in regions of the Lower Mainland area of south-western BC where various invasive fish and amphibian predators now exist. Such a pattern was proposed for the reduction of brassy minnow due to the introduction of exotic rainbow trout, near Grand

Prairie, Alberta (Ripley, 2001), and the extirpation of brassy minnow due to the introduction of exotic brook trout, Salvelinus fontinalis, in the Esker Lakes in BC (McPhail, 2007). Additionally, predation pressures on cyprinids can occur at different life stages. For instance, it has been

65 suggested that adult brown bullhead feed heavily on juvenile fishes and fish eggs (DeClerck et al., 2002). Invasive predators of brassy minnow can have very pronounced effects on their persistence, suggesting that reductions in numbers and extirpations could be due to, in whole or in part, to the presence of invasive species.

4.1.3 Competition and other effects of invasives on brassy minnow and other cyprinids

Competition and indirect effects of invasive species on brassy minnow are more difficult to observe than predation events, and frequently require controlled experiments to illustrate effects. Competition can be in the form of exploitation competition (i.e., when the invasive species is better at exploiting a resource than indigenous species (e.g., Hazelton and Grossman,

2009), or interference competition (i.e., when the invasive species excludes indigenous species from a resource (Power et al., 1985)). One approach for experimentally examining competition between species is to compare growth rates of individuals with and without a potential competitor. It has been suggested that high growth rate can positively correlate with fitness in fishes as higher growth rates may allow for individuals to access certain resources sooner

(Arendt and Wilson, 1997), reduce size-specific periods of predation (Sogard, 1997), and permit earlier reproduction (Roff, 1992), although there also may be trade-offs to rapid growth

(Sundström et al., 2005). Additionally, reproduction at a larger body size has been correlated with higher fecundity and egg size (Shine, 1988; Mcgurk, 2000; Bünger et al., 2005).

Invasive species can affect indigenous brassy minnows in other indirect ways. For instance, it has been suggested that certain populations of brassy minnow migrate into deeper channels during the summer months (McPhail, 2007), and these movements may be a response to

66 predation because cyprinids school more frequently and enter open (deeper) waters when faced with predators such as bass (Savino and Stein, 1989), but do not respond in this way to large non-predatory fishes such as suckers, Catostomidae (Fraser and Mottolese, 1984). Such habitat shifts have been experimentally demonstrated in brassy minnow that faced predation pressures; they entered riffle and raceway habitats (Schlosser, 1988), despite not normally being found in such fast-moving waters (McPhail, 2007) when faced with predators. Schlosser

(1988) found that brassy minnow preferred the most structurally complex pools when no predators were present, and the degree of displacement into potentially marginal habitats was most pronounced when faced with more efficient predators (i.e., smallmouth bass, M. dolomieui) than less efficient ones (i.e., creek chub, Semotilus atromaculatus). In addition, fishes that exhibit parental care in the form of egg and young guarding behaviours, such as brown bullhead will chase cyprinids in areas when spawning or rearing young (Blumer, 1986) potentially causing habitat shifts. Examining habitat shifts could clarify the extent of brassy minnow reduction and extirpation versus migration in these populations, and if movements are associated with the presence of invasive species.

4.1.4 Objectives

In this chapter, I compared the abundance and growth of brassy minnow in the presence and absence of suspected invasive predator species of fish. I predicted that brassy minnow will not be found in areas with invasive predators present, such as basses and bullhead catfishes (genus

Ameiurus) (Robinson and Tomm, 1989; Chapleau et al., 1997; Whittier et al., 1997). Also, I re- sampled historical sites and recorded the number of brassy minnow and invasive species, and

67 predicted that the mean number of cyprinid species per site had declined in areas where invasive species per site has increased over the last 50 years, as such trends have been suggested in other studies in other North American water bodies (Williams et al., 1989; Reinthal and Stiassny, 1991; Kamerath et al., 2008).

In one area, Tamboline Slough, Westham Island, I found large numbers of brown bullhead and cyprinid fishes, including brassy minnow. Here, I predicted that the mean size and numbers of brassy minnow and other cyprinid fishes across pools at Tamboline Slough, would shift in the late summer/early fall coincident with an influx of invasive adult brown bullhead (i.e., over 100 mm FL) which are known fish predators (McDowell et al., 1990; DeClerck et al., 2002) and also appear to displace other fishes through competition for habitat (Blumer, 1986).

Due to the co-occurrence of invasive brown bullhead at this important site for brassy minnow

(i.e., the dominant area for brassy minnow abundance in this study, and a potential spawning area for the species), I conducted a growth experiment to test the effects of brown bullhead on the growth of brassy minnow. I predicted that brassy minnow mean growth would be depressed in the presence of brown bullhead juveniles compared to ‘brassy minnow alone’ treatments. I also examined growth rates in the presence of a potential cyprinid competitor, the redside shiner to try and isolate the effects of the invasive brown bullhead on brassy minnow. For these experiments each species (brassy minnow, redside shiner, and brown bullhead) was housed in all possible combinations with the other species, (which included an alone treatment as a control), for a total of four treatments for each of the three species. The

68 objective of this experiment was to examine potential growth differences among treatments of each species housed with combinations of the other species.

4.2 Materials and methods

4.2.1 Historical records and re-sampling in the Lower Mainland

The UBC Fish Collection was searched electronically for all historical records of brassy minnow in the Lower Mainland region of BC as described in section 3.2.1. The original historical sampling method was by beach seine with up to five passes per locality, so these methods were replicated for the 2008-2009 re-sampling in order to minimize differences in sampling method and effort, which can confound historical comparisons (Patton et al., 1998). Also the re- sampling was replicated in the same months as the historical sampling at sites because local freshwater community compositions can be seasonal (Patton et al., 1998; Porter et al., 2000).

Such historical data has been used to examine fish community changes (e.g., Anderson et al.,

1995) and has been used to identify species reductions (Williams et al., 1989; Reinthal and

Stiassny, 1991) and extirpations (Kattan et al., 1994; Drayton and Primack, 1996). The purpose of the historical re-sampling was to compare possible brassy minnow distribution changes, reductions, and extirpations, as well as potential trends in freshwater community changes especially with regard to invasive species and cyprinids.

4.2.2 One year minnow trap survey

Additionally, a monthly minnow trap survey (total n = 60 sites) was conducted for one year from June 2008 to June 2009 for the Lower Mainland, and included the historical brassy

69 minnow sites (n = 8) along with several preliminary sampling locations (Taylor and Aspinall, unpub) (Figure 6) as described in section 3.2.2. All of the freshwater vertebrates were identified to species in the field, except for tadpoles which were identified according to size as bullfrogs,

Lithobates catesbeianus (over 75 mm total length (TL)), or unidentified tadpoles (under 75 mm

TL). Habitat features (i.e., cover, macrophyte presence-absence, and substrate) was also noted for all 60 sites as described in section 3.2.1 (Appendix 2).

4.2.3 Relative species abundances for freshwater vertebrates in the Lower Mainland

Relative abundance was calculated for the frequency of all vertebrate species encountered across sites (n = 60), and per region of Lower Mainland (n = 12), to examine the freshwater vertebrate community structure in tributaries of the lower Fraser River. Additionally, to examine the contribution of invasive species to this community, the overall frequency of invasive to indigenous species was calculated for the entire Lower Mainland for all sampling methods.

4.2.4 Historical site species comparisons – Wilcoxon paired rank tests

Historical comparisons were made for eight sites, and focused primarily on changes to the presence-absence of: brassy minnow at sites and within regions, the number of cypriniform species, and the overall number of invasive species at sites. Wilcoxon paired rank sum tests were performed in PAST 2.00 (Hammer et al., 2001) for historical to contemporary comparisons of the change in the number of cypriniform (Cyprinidae and Catostomidae) species at sites, invasive species at sites, and the number of centrarchid species at sites. Amphibian species

70 sampled were excluded from this analysis as the historical sampling did not include amphibians caught at sites.

4.2.5 Detrended correspondence analysis

Detrended correspondence analysis (DCA) was performed in PAST 2.00 (Hammer et al., 2001) using relative species abundances per region. Detrended correspondence analysis is a descriptive analysis traditionally used to examine patterns and clustering of species across environmental gradients and space (Hill and Gauch, 1980), and has been used to examine relationships of species presences and absences within freshwater communities (Bunnell and

Zampella, 2008). The objective of the DCA was to determine which species clustered closely with brassy minnow in terms of presence or absence. The species that clustered closely with brassy minnow should co-occur and interact with brassy minnow more so than those which cluster furthest away. However, there is the potential that the species that cluster away from brassy minnow may still interact with them, but are superior predators or competitors that can exclude or eliminate brassy minnow from the local area, thus reflecting a negative association in DCA space.

4.2.6 Tamboline Slough, Westham Island

Westham Island is the last landmass that the south arm of the Fraser River passes before reaching the Strait of Georgia (Pacific Ocean). Most of the island’s development consists of agriculture, and the two main water bodies (London Slough and Tamboline Slough) that transect the island water levels are controlled by pump houses at the confluence of the sloughs and the Fraser River. Water levels are highest in the summer months, approximately 1 m higher

71 that other times of the year (D. Nowosad pers. obs), and despite being in a tidal zone, the water levels do not change frequently. Westham Island Road transects Tamboline Slough with two culverts connecting the southwest pool portion to the northeast pool portion. Of the two pools, the northeast pool is larger, deeper, and contained more macrophytes and cover in the form of small woody debris, while the southwest pool contains two boulders and floating small woody debris.

4.2.7 Chi-square analysis of fish size classes between pools at Tamboline Slough

Both pools of Tamboline Slough, Westham Island, were sampled by pole seining in late August to early September on four occasions for approximately two hours at a time, or until no fishes were caught in the seining pass. Seining was conducted in transects and all fish species were identified, counted, and categorized according to four size classes: >25 mm, 25-50 mm, 50-75 mm, <75 mm FL (fork length). A χ2 analysis of fish size classes per pool at Tamboline Slough was performed in JMP 4.0, however, due to the high number (i.e., greater than 25% of the data) of values below five individuals in the data categories (data not shown), the sampling data was pooled into fishes under 50 mm FL and fishes above 50 mm FL. This was done to compare the fish community and size class structure of fishes in both pools to see if there was a difference in size structure associated with differences in community structure between pools. Seventy of each of brassy minnow, red-side shiners, and young-of-year brown bullhead were kept for the laboratory growth experiment (see section 4.2.6).

4.2.8 Cage transplants of brassy minnow across pools

To observe whether brassy minnow could persist in the northeast pool of Tamboline Slough when adult brown bullhead were present, two 60 cm by 45 cm by 45 cm cages were constructed from 6.35 mm hardware cloth fastened together with tie-wire and bar lock ties

(zap straps). Twenty brassy minnow were caught in the southwest side of Tamboline Slough and ten were added per cage and transplanted into the northeast side of the slough. One cage was placed at a depth of 76 cm, and the other at 88 cm. Cages were monitored twice per month for two months (August and September, 2009), for brassy minnow survival.

4.2.9 Growth experiment with two indigenous cyprinid species and an invasive catfish

4.2.9.1 Experimental apparatus and treatments

Seventy individuals of each of brassy minnow, red-side shiners, Richardsonius balteatus, and young-of-year brown bullhead were obtained from Tamboline Slough, Westham Island. All fishes were acclimated for a minimum of 21 days to an environmental chamber at a temperature of 14:C, and a photoperiod of 10 hr light. Thirty-five 102 L aquaria were cycled and set-up during this time with sand substrate, 50 mm diameter X 76 mm (+/- 20 mm) long PVC pipe sections for shelter, and live plants (Lemna sp., Ceratophyllum sp., Vesicularia dubyana) for cover and food. To reduce confounding variables, aquaria sections were blocked and treatments were randomly assigned using a random number generator in JMP 4.0. As cyprinids are schooling fishes, all treatments consisted of three individuals of the same species per aquarium. To identify effects of other species on brassy minnow, I used all seven potential test

73 combinations: brassy minnow alone, redside shiner alone, brown bullhead alone, brassy minnow with redside shiner, brassy minnow with brown bullhead, redside shiner with brown bullhead, and all – brassy minnow with redside shiner and brown bullhead with five replicates per treatment. Fishes were fed a variety of foods and food sizes (i.e., Artemia sp., Mysis sp.,

Daphnia sp., chironomid larvae, and vegetable-based flake) according to aquaria biomass

(approx 30% of the tank’s biomass in food) six times per week. The biomass of each tank was measured and feeding weights were adjusted monthly after all fishes were weighed. Green algae was grown and added to all aquaria twice per month to add further variety to the diet, and because these species are known to consume algae and plant matter (Scott and Crossman,

1973; Copes, 1975).

4.2.9.2 Measuring growth rates

Growth rate was measured over a 90 day period, and consisted of monthly measures of all fishes’ weights using an Ohaus digital scale, as well as measures of standard length (SL), total length (TL) and body depth (BD) with Mitutoyo digital callipers. Individuals were marked for identification with fin clips in different portions of the caudal fin so that individual growth could be tracked. Fish that died during the experiment were replaced to keep group numbers and tank densities consistent, but were not fin clipped or subsequently included in the growth analysis.

4.2.9.3 Kruskal-Wallis one-way ANOVAs and Mann-Whitney pairwise comparison of treatments

One-way ANOVAs were calculated for species treatments using JMP 4.0. To test whether or not these data met the assumptions for ANOVAs, Shapiro-Wilk normality tests, and Bartlett’s (if

74 data was normal) or Levene’s (if data departed from normal) tests for equal variances (Whitlock and Schluter, 2008) were also conducted using JMP 4.0. Due to some violations of the assumptions for these data (Appendix 12), non-parametric Kruskal-Wallis one-way ANOVA tests were performed for all species differences in the median tank growth rate for each treatment using JMP 4.0. A power analysis was also performed for each species treatment to calculate the least significant number for the sample size that would result in a significant effect at α = 0.05.

Also, the distributions of median species growth rates were compared for the treatments of brassy minnow alone versus brassy minnow with brown bullhead using Mann-Whitney pairwise tests in PAST 2.00 (Hammer et al., 2001). To prevent pseudoreplication (Whitlock and Schluter,

2008), the mean growth weight of each species per aquarium was used as the replicate for each treatment (i.e., n = 5 tanks per treatment, as opposed to n = 15 fish per treatment).

Additionally, for the Mann-Whitney statistical test, fishes that died during the experiment were treated as having zero growth for the purposes of calculating mean tank growth.

4.3 Results

4.3.1 Freshwater vertebrate community in the Lower Mainland

The most frequent species trapped after 12 months and 35,712 trap hours of Lower Mainland sampling, was the three spine stickleback, Gasterosteus aculeatus, (both anadromous and freshwater forms) that consisted of 45% of all fishes sampled (Figure 12). The second most frequently sampled species was brassy minnow at 14%, however the majority of these individuals were from Tamboline Slough on Westham Island and if these two sites were excluded, the frequency dropped to 5%. The most frequent invasive species sampled were

75 bullfrog tadpoles and brown bullhead at 11% each, followed by common carp, Cyprinis carpio and pumpkinseed sunfish, Lepomis gibbosus, at 3%. Prickly sculpin, Cottus asper, was the third most abundant indigenous species at 7%. Overall, invasive species consisted of 28% of the relative abundance of all species caught (Appendix 10).

A detrended correspondence analysis plot of relative abundances across sites for the Lower

Mainland region revealed that brassy minnow clustered closely to both bullfrog tadpoles and brown bullhead (Figure 13), suggesting that brassy minnow would co-occur and interact with these invasives more than other species. The majority of the centrarchids including largemouth bass, Micropterus salmoides, smallmouth bass, M. dolomieui, and black crappie, Pomoxis nigromaculatus, clustered closely together away from indigenous fish species. Other invasive species included pumpkinseed sunfish which clustered alone, and common carp, which clustered near prickly sculpin.

4.3.2 Historical site comparisons

Historical site comparisons suggest an overall increase in invasive species present in the Lower

Mainland. A total of six invasive species were seined at the eight historical sites in the 2008-

2009 sampling, whereas four were sampled across these sites in 1956/1959. Three additional invasive species were encountered in the 2008-2009 sampling: bullfrogs, yellow bullhead,

Ameiurus natalis, and largemouth bass, however these were excluded from the comparison as larval amphibians were not recorded in the original survey, and the largemouth bass and yellow bullhead were not seined at the sites in the months that the original sampling occurred. One historically sampled invasive species, black bullhead, Ameiurus melas, was not encountered

76 during the re-sampling. However, three new invasive species were sampled in the 2008-2009 survey that was not present in the historical records: pumpkinseed sunfish, yellow bullhead, and smallmouth bass. Despite this increase in overall invasive species present in the Lower

Mainland, the median change in the number of invasive species and centrarchid species at sites for the re-sampling versus the historical sampling was statistically insignificant (invasives W =

11, n = 8, p = 0.916; centrarchid W = 9.5, n = 8, p = 0.589).

For indigenous cyprinids, there was a decline in the overall number of species encountered across all sites, dropping from six species in 1956/1959 to three species encountered for the

2008-2009 sampling (Table 3). Cypriniforms showed a reduction in the number of sites where present, with brassy minnow at 25% of the original sites, northern pikeminnow at 25%, redside shiners at 20%, largescale sucker at 17%, and peamouth chub at 14%. Historically, two species of dace (Leopard dace, Rhinichthys falcatus, and longnose dace, R. cataractae) were encountered in Nicomen Slough whereas none were sampled in the current study. Overall, the median number of cypriniform species found at sites displayed a statistically significant decline in the re-sampling compared to the historical sampling (W = 28, n = 8, p = 0.018).

4.3.3 The fish community at Tamboline Slough, Westham Island

Westham Island, Tamboline Slough sites displayed differences in the species composition and fish size class structure across the two pools at this site (Figure 12). Before the influx of adult brown bullhead, pole seining both pools in July revealed a similar distribution in the relative abundance of fish species across pools with: 100% of juvenile brown bullhead, 44% brassy minnow, 60% three spine stickleback, and 57% redside shiners found in the northeast pool, and

0% brown bullhead, 56% brassy minnow, 40% three spine stickleback, and 43% redside shiners found in the southwest pool; however, size classes were not measured at this time. After the adult brown bullhead entered Tamboline Slough a shift in the relative abundance of species composition between the two pools was apparent; the northwest pool had 100% of the brown bullhead found, and 81% of fish species less than 25 mm FL present were young-of-year brown bullhead. The southeast pool, however, now had 98% of brassy minnow caught, and 70% of three spine stickleback found. Also, 84% of all indigenous fish species less than 25 mm FL were in the south eastern pool. All fishes sampled showed a statistically significant difference in size class (i.e., under 50 mm FL and over 50 mm FL) across the pools of Tamboline Slough ( 2 =

11.89, df = 1, p = 0.001), with the northwest pool comprised of more large fishes. Of the two transplanted cages containing ten brassy minnow per cage introduced to the northeast pool, six of ten brassy minnows survived in the deeper set cage and eight of ten brassy minnows survived in the shallow set cage over the duration of two months in the pool.

4.3.4 Growth experiment

For the growth experiment, fish mass was the metric that showed the greatest change compared to the measures of length (standard and fork length) and width (body depth; data not shown). Therefore, the change in mass (measured in grams) was the parameter used for the measure of growth for the experiment (Appendix 11). Of the fish species, brassy minnow gained the least mean weight ( = 0.062 g, SE = 0.024 g, n = 51), of all the species over all treatments (Figure 14). In contrast, redside shiner gained the most mean weight ( = 0.768 g,

SE = 0.034 g, n = 60) among all treatments, and brown bullhead was intermediate ( = 0.166 g,

SE = 0.020 g, n = 60). For each species, non-parametric Kruskal-Wallis tests were performed to test for differences in growth weight of species per tank per treatment (n = 5), owing to, non- normal distributions and unequal variances (Appendix 12). Here, differences in median species growth among treatments for brassy minnow (Figure 15) and brown bullhead (Figure 16) were statistically insignificant among treatments for both species (brassy minnow, H = 5.28, df = 3, p

= 0.152; brown bullhead, H = 3.24, df = 3, p = 0.357). However, for redside shiner the median tank growth among treatments was significantly different (H = 11.59, df = 3, p = 0.009) (Figure

17). Power analyses indicated that I had power of 0.32, 0.99, and 0.25 to reject a false null hypothesis of brassy minnow, redside shiner, and brown bullhead, respectively. Also, the least significant sample size numbers were calculated for α = 0.05, and were as follows: brassy minnow n = 39, redside shiner = 9, and brown bullhead = 48.

Additionally, brassy minnow were the only fish that died during the 90 day experiment with one fatality in the brassy minnow with redside shiner treatments, and four fatalities each for the brassy minnow with brown bullhead treatments and brassy minnow with redside shiner with brown bullhead treatments respectively. By contrast, none of the brassy minnow in the brassy minnow alone treatments died. Furthermore, brassy minnow were the only species to exhibit negative growth rates over the duration of the experiment, with a total of eight individuals losing weight. The treatment of brassy minnow with redside shiner had two individual brassy minnow that lost weight, while the treatments of brassy minnow with brown bullhead and brassy minnow with redside shiner with brown bullhead had three individuals of brassy minnow that lost weight. When brassy minnow fatalities were treated as zero growth for calculating mean tank growth, the Mann-Whitney U test demonstrated that median tank growth of brassy

79 minnow for the brassy minnow alone treatments was significantly greater (0.19 grams vs. 0.03 grams) than in the brassy minnow with brown bullhead treatments (U = 4.811, n = 10, p =

0.037).

4.4 Discussion

4.4.1 Distribution of invasive species in the lower Fraser River relative to brassy minnow

Brown bullhead and bullfrogs were the most abundant invasive species sampled in the Lower

Mainland, with brown bullhead being found in all water bodies sampled except for Deer Lake and faster-moving waters of the Alouette and Vedder Rivers. These habitat observations support previous literature suggesting that brown bullhead prefer sluggish backwaters with abundant vegetation and soft substrates (Scott and Crossman, 1973). These soft substrates are required for brown bullhead to construct overwintering burrows when subjected to low temperatures (Scott and Crossman, 1973), and therefore winter sampling may have underestimated the abundance of brown bullhead in areas. Brown bullhead were most abundant at Westham Island in late summer to early fall when they congregated in sloughs to build nests, spawn, and care for young (Blumer, 1986). Young-of-year brown bullhead compromised the majority of the catch counts throughout sampling, being found in most backwaters in both shallow and deeper water bodies (i.e., as shallow as 30 cm) whereas adult brown bullhead (i.e., individuals over 100 mm FL) were only caught in deeper sloughs (over 91 cm deep). Contrary to expectation, DCA ordinations suggest that brown bullhead and brassy minnow overlap closely in abundance across sites, and both species were caught at highest

80 abundances in tributaries associated with lowest reaches of the Fraser River. This suggests that of all invasives, one of the species that brassy minnow encounter most is brown bullhead.

However, types of interactions between these species at sites may depend on the size/age of the brown bullhead encountered by brassy minnow. For instance, juvenile brown bullhead (i.e.,

30-60 mm FL) feed predominantly on zooplankton and zoobenthic invertebrates (Scott and

Crossman, 1973; DeClerk et al., 2002) and may compete with brassy minnow for such items

(McPhail, 2007). However, large brown bullhead additionally feed on algae and plant matter

(Scott and Crossman, 1973) potentially competing for these resources with brassy minnow as well (Scott and Crossman, 1973). Furthermore the large (i.e., over 250 mm SL) adult brown bullhead are predators of fishes, larval fishes, and fish eggs (Barnes and Hicks, 1990; DeClerk et al., 2002). As brown bullhead are nocturnal predators that use olfaction to find prey, (studies have shown blocking brown bullhead olfaction affects foraging success (Pitcher, 1993)), and presumably would be little affected by the poor water clarity in the areas where this species co- occurs with brassy minnow, brown bullhead may be important predators of all life stages of brassy minnow. A second species of bullhead, the yellow bullhead, A. natalis, was caught in low numbers (i.e., seven individuals only) at Westham Island sites in the summer of 2008. No further yellow bullhead were caught in subsequent sampling, but it probably has similar negative effects on brassy minnow.

Bullfrogs were the species that tied with brown bullhead for the most abundant invasive species sampled across the Lower Mainland for the duration of the study. Bullfrog tadpoles were most abundant in the areas of Richmond, Westham Island, Deer Lake, Burnaby Lake and

Delta. Upstream bullfrog were less abundant in general (e.g., in the Pitt-Alouette rivers and

Hatzic Lake areas), and in the Sumas River system no bullfrogs were sampled. Due to the aquatic focus of my sampling, bullfrog may be more abundant than reported because sampling would miss adult bullfrogs present in terrestrial areas. Bullfrogs overlapped with brassy minnow and brown bullhead catfish for the DCA analysis, and were most abundant in tributaries associated with the lower reaches of the Fraser River and the Deer and Burnaby Lake much like the other two species. This suggests that larval bullfrogs and brassy minnow overlap at sites and may compete for algal resources as bullfrog tadpoles have been found to alter the levels of available algae in areas (Kupferberg, 1997). Additionally, juvenile and adult bullfrogs are highly aquatic and have been found to incorporate fishes into their diets (Wang et al, 2008), and may potentially feed on brassy minnow.

Common carp were present in all water bodies sampled, save for the Pitt-Alouette, Stave, and

Vedder rivers. Common carp were abundant in Deer and Burnaby Lake, larger Richmond sloughs, Westham Island sloughs, and the main stem of the Sumas River, with sampling consisting predominantly of young-of-year individuals caught in the summer months. This is consistent with published preferences of common carp for large vegetated water bodies with soft substrates with little water flow (Scott and Crossman, 1973). Common carp were only caught with brassy minnow at Westham Island, Deer Lake, and in the Sumas River. Effects of common carp on brassy minnow may be indirect as carp feed heavily on benthic macro- invertebrates by sifting substrate and frequently dislodge and feed on submerged vegetation in the process (Scott and Crossman, 1973; Parkos III et al., 2003). This removal of macrophytes would decrease the food and cover present for brassy minnow to use (Quist et al., 2004).

However, common carp feeding in this manner might not just have negative effects on brassy

82 minnow, as experiments have shown that common carp presence is positively correlated with zooplankton biomass, increased phosphorous levels, and increased turbidity (Parkos III et al.,

2003). Therefore, brassy minnow could utilize the increased zooplankton resources (McPhail,

2007), and increased turbidity could afford them some protection from visually oriented predators (Abrahams and Kattenfeld, 1996; Reid et al., 1999). The DCA association of common carp and prickly sculpin is likely due to the fact that these were species that dominated catches in Deer Lake.

Pumpkinseed sunfish were ubiquitous in all sampled areas of the Lower Mainland except for

Deer and Burnaby Lake, and were especially abundant in vegetated shallow water bodies of the

Sumas River, Delta, Pitt-Alouette sloughs, Stave Slough and Hatzic Lake. Pumpkinseed sunfish were caught with brassy minnow in the Sumas River and in Delta sloughs and ditches.

Additionally, nesting pairs of pumpkinseed sunfish and young-of-year juveniles were found in large numbers in Katzie Slough associated with the Pitt River, Delta ditches and in the Sumas

River indicating this species is well established in the Lower Mainland. Finding pumpkinseed sunfish in slow-moving backwaters with abundant submerged vegetation corresponds to habitats occupied by this species described in the literature (Scott and Crossman, 1973; Page and Burr, 1991). Juvenile pumpkinseed sunfish are zooplanktivores, while adults possess specialized pharyngeal jaws and teeth and are considered predominantly molluscivorous

(Mittlebach et al., 1992), although research has shown plasticity in the strength of jaw muscles that corresponds to the degree of hard-bodied prey items available (Mittlebach et al., 1999).

Additionally, without sufficient hard-bodied prey, adult pumpkinseed sunfish have been found to feed on zooplankton, insect larvae, fish eggs, and small fishes (Scott and Crossman, 1973).

Therefore, pumpkinseed juveniles could compete with brassy minnow for zooplankton, and adults may not, or may be both competitors for zooplankton, and potential predators. Although not confirmed by morphological examinations, observations of abundant gastropod molluscs at sites in Delta, Katzie Slough, Stave Slough, and the Sumas River suggest that adult pumpkinseed sunfish may not compete or prey heavily on brassy minnow. Detrended correspondence ordinations of pumpkinseed sunfish abundance across sites grouped this species alone, perhaps because it was found at nearly all sites.

Black crappie was found in Hatzic Lake and all associated sloughs, and in nearby Nicomen

Slough. Sampled sites with black crappie presence in the Lower Mainland were associated with soft substrates and areas of submerged vegetation similar to habitats suggested for this species by Scott and Crossman (1973), but also rocky areas in Nicomen Slough. Juvenile black crappie feed on zooplankton and insect larvae, before becoming predominantly piscivorous as adults at approximately 250 mm (Scott and Crossman, 1973). Schools of young-of-year black crappie were caught in lower Hatzic Slough, and near the shallow outlet of Hatzic Lake. No brassy minnow were sampled from areas with black crappie, and DCA ordinations grouped this species with the other invasive centrarchid species introduced into the Lower Mainland.

Two invasive centrarchids of the genus Micropterus were sampled in two isolated areas of the

Lower Mainland, Hatzic Lake and Stave Slough. Smallmouth bass were only sampled in Hatzic

Lake, near rocky structures and pilings. Smallmouth bass prey on large invertebrates and fishes and have been shown to significantly alter cyprinid biodiversity in areas where they are present

(Chapleau et al., 1997; Whittier et al., 1997). Scott and Crossman (1973) suggest that

84 smallmouth bass prefer clear, deeper areas of littoral zones in lakes or deep pools in streams, and this may be a factor for this specie’s isolation to Hatzic Lake as the outlet sloughs from the lake are shallow, muddy, and have little cover. Largemouth bass were found in Hatzic Lake and

Stave Slough near Silvermere Lake, in areas with macrophytes similar to habitats suggested occupied by this species in Scott and Crossman (1973). Additionally, young of year largemouth bass were found in the shallow muddy waters of lower Hatzic Slough near Hatzic Lake outlet, suggesting that this species may be capable of dispersing into the Fraser River. It is possible that the Stave Slough largemouth bass originated in Silvermere Lake- a private lake known to stock such species. Largemouth bass feed on crayfish, frogs, and fishes (Scott and Crossman,

1973).

Detrended correspondence analysis plot grouped black crappie, smallmouth and largemouth basses together as they were sympatric and isolated in the Hatzic Lake area, save a few largemouth bass in Stave Slough. Having these invasive predators concentrated in this area likely excludes brassy minnow from these sites, as no brassy minnow were sampled here for the length of the study. Additionally, in Hatzic Lake the only non-invasive species sampled was prickly sculpin, suggesting that the freshwater community assemblage of the lake is comprised almost exclusively of invasive species.

Although two sampling methods (i.e., minnow trapping and beach seining) were used in this study it should be noted that sampling methods are not without bias. Different sampling gear was chosen because with seining large-sized fishes would be sampled that minnow traps would miss, and by leaving minnow traps in overnight, one would sample nocturnal species that might

85 be missed by seining. Although Jackson and Harvey (1997), found that minnow traps were amongst the best sampling gear in littoral zones of lakes and similar shallow waters such as those sampled in this study, population estimates and relative abundance estimates may be skewed due to the biology of the fish species involved (Jackson and Harvey, 1997). For instance,

He and Lodge (1990) have shown that two gregarious species of dace (genus Phoxinus) may potentially bias sampling by being attracted to fish already in minnow traps, while other species, such as mudminnow (genus Umbra) might avoid traps until dace are rare - effectively avoiding traps with fish already in them. Additionally, certain species such as the mummichog,

(Fundulus heteroclitus) have been recorded leaving traps (Kneib and Craig, 2001) which would alter the accuracy of abundance counts. Furthermore, properties of habitats within water bodies can affect trap success as minnow traps in habitats devoid of cover may preferentially catch species attracted to cover (Layman and Smith, 2001). Additionally bait used may preferentially attract certain species such as prickly sculpin that readily consumed the bait used in this study. Temporal autocorrelation is another potential source of error due to the repeated sampling of sites, and may influence abundance values (Carroll and Pearson, 2000). Due to time constraints, autocorrelations were not performed for invasive species caught at sites.

Therefore, sampling for presence of species may be reasonably accurate for sites in the Lower

Mainland, but relative abundances should be interpreted with caution. Despite this potential bias, this study presents a seasonal baseline record of the species presence in backwaters of the

Lower Mainland including invasive species encountered that may be useful for future studies in this area. Additionally, with sampling, utilizing similar gear and bait should yield repeatable

86 results, however it is important to acknowledge that for some species catch correlations may exist depending on sampling methods used.

4.4.2 Trends in species presence at re-sampled historical sites

Comparison of historical and contemporary fish communities after 50 years indicates that the number of cypriniform species at these locations is significantly reduced. For example, across the Lower Mainland brassy minnow were found in this study at two of the eight historic sites

(Deer Lake and Sumas River) when seined in the same months as the original sampling, and the number of occupied sites only marginally increased to three when the more extensive monthly minnow trapping was included (adding Burnaby Lake). Similar declines were noted for other cyprinids, for example: peamouth chub, Mylocheilus caurinus, were found at one site whereas historically peamouth were present at seven. In fact, peamouth chub were rarely encountered during sampling with only 12 individuals caught in tributaries of the Pitt-Alouette when combining both seining and minnow trap sampling over the 12 month study. However,

Richardson et al. (2000) found peamouth chub constituted the highest biomass of fishes in the

Fraser River proper in 1995 sampling, suggesting that if populations are reduced, it has occurred since that time or that backwaters that I sampled are less frequently used by this species than in historical times. Similarly, redside shiners were found at one site, the Sumas

River and tributaries, where historically they were found at five. However, additional sampling of sites throughout the 12 month sampling revealed the presence of redside shiners in areas of

Delta, Westham Island, and Deer and Burnaby Lake. Northern pikeminnow followed the same pattern as redside shiners, with presence at one site, the Pitt-Alouette rivers’ areas, matching

87 historical records, but further sampling revealed northern pikeminnow to be present in

Nicomen Slough, Sumas River, Burnaby Lake, and in areas of Richmond and Delta, and

Richardson et al. (2000) found that this species constituted the fourth highest biomass of fishes in the Fraser River. The lone species of catostomid sampled during my study was the largescale sucker, Catostomus macrocheilus, that were historically sampled from six sites, but I found them only at one. Furthermore, only three largescale suckers were caught across all sites from only the Pitt-Alouette tributaries for the duration of the 12 month study. This trend was also noted in Richardson et al. (2000), who suggested that largescale sucker had decreased in numbers by 37% in the Fraser River from 1974 to 1995. This suggests that largescale sucker reductions are widespread throughout the lower Fraser River.

While the number of invasive species encountered in the Lower Mainland increased overall, contrary to expectation, the number of invasive species at sites did not significantly change.

Two invasive species, common carp and brown bullhead were found at four sites historically and four sites for the re-sampling. However, a second species of bullhead, the black bullhead that was sampled in the Pitt drainage historically was not encountered in the re-sampling. I did, however, record a new species of bullhead, the yellow bullhead on Westham Island. The number of centrarchid species present in the Lower Mainland increased from one in 1956/1959

(black crappie), to three in 2008-2009 (black crappie, smallmouth and largemouth basses).

There were no records of pumpkinseed sunfish in the historical sampling for any locations, whereas I found this species at five sites when these sites were re-sampled, suggesting that pumpkinseed sunfish are a relatively recent introduction. Additionally, smallmouth bass were not present in the original sampling, and in my re-sampling this species was only encountered

88 in Hatzic Lake. With newly recorded invasive species at sites, it might be expected that more invasive species would be present at sites overall, but this was not the case. Perhaps the largest factor in the lack of change of invasive species at sites was due to the range reduction of black crappie that was found at two sites during my sampling but at four sites historically. Black crappie was more widespread historically, being sampled in the Pitt River, Hatzic Lake, Nicomen

Slough, and Burnaby Lake, whereas in the 2008-2009 re-sampling this species was restricted to

Hatzic Lake tributaries. The decline in sites with black crappie presence suggests that this species has undergone range contraction or was unable to establish and maintain populations at many historical sites where it was originally found.

Since habitat and water chemistry variables were unavailable for the historical sampling, possible explanations for the change in species assemblage at sites are speculative. For instance, the decline of certain cypriniform species at sites may be due to increases in development and agriculture in these areas resulting in more eutrophic backwaters (Bunnell and Zampella, 2008). Richardson et al. (2000) suggested a temperature increase of 0.5:C had occurred in the Fraser River between 1973 and 1995, so it is possible that shallow backwaters could have had similar increases in temperature. Since higher water temperatures would suggest an associated decrease in availability of dissolved oxygen in these backwaters, certain species could be excluded from the fish community as low DO levels can shape species assemblages in water bodies (Tonn and Magnuson, 1982; Jackson et al., 2001). Additionally, anthropogenic activities have been correlated with decreased pH levels in water bodies

(Bunnell and Zampella, 2008), and such acidification has been attributed to declines in certain smaller bodied species in fish assemblages such as certain cyprinid species (Jackson et al.,

2001). Additionally, these data suggest that the number of invasive species present has not increased, however the kinds of invasive species present at these sites has. For instance, certain species of cypriniforms that could potentially persist in these eutrophic areas such as brassy minnow may now encounter more efficient piscivorous invasive species (e.g., smallmouth bass) that were not encountered in historical times. Similarly, some invasive species introduced in historical times may not have established themselves at all sites introduced across the Lower

Mainland, and subsequently the ranges have receded or they remain rare or have been extirpated. Despite the limited inferences that can be suggested without quantitative habitat measures to compare, and the small sample of sites to make historical comparisons such studies are often the only means available to compare species assemblage changes over time.

4.4.3 Pool community structure at Tamboline Slough, Westham Island

The seasonal influx of adult brown bullhead in the late summer and early fall into Tamboline

Slough at Westham Island caused a significant shift in the size class distribution of fishes across pools. No brown bullhead were caught in the southwest pool of Tamboline Slough for the duration of the study, suggesting that the shallow water (i.e., approx 15 cm deep) or other properties of the culvert that connected the two pools was a barrier to brown bullhead movement. Adult brown bullhead dug nests, spawned, and cared for young (Blumer, 1986) from Aug-Oct in the northeast pool, while the young-of-year brown bullhead could be sampled in this pool virtually year round. Once the adult brown bullhead appeared several species present in the Tamboline Slough community that temporally overlapped with this spawning event were affected; most notably was the partitioning of many indigenous species and the

90 significant difference in size of these fishes caught across pools. For instance, 98% of the brassy minnow and 70% of the three spine stickleback were subsequently found in the southwest pool separate from the large brown bullhead, suggesting a habitat shift or exclusion from the brown bullhead dominated pool by other means.

Size-class of fishes was significantly partitioned across pools, with 84% of the indigenous fish species present under 50 mm FL in the pool without large (i.e., over 100 mm FL) brown bullhead. For instance, the adult brown bullhead could be preying on the small fishes remaining in the pool, as gut analyses have shown that large brown bullhead prey on fishes (Barnes and

Hicks, 1990), and pond experiments have shown that brown bullhead presence has limited population growth of other fish species by preying on fishes, particularly juveniles (DeClerk et al., 2002). Other effects might be indirect as habitat shifts via emigration from the area and more local habitat shifts to other habitats (i.e., the opposite pool) in the same water body have been shown by fish species when confronted with predators (Power et al., 1985; He and

Wright, 1992).

Also, the exclusion of most indigenous species from the brown bullhead pool may be a result of nest defence and protection by parental brown bullhead as these fish exhibit parental care that includes chasing cyprinids out of the local area (Blumer, 1986). However, redside shiners remained approximately equally distributed across pools with 56% in the southwest pool

(without brown bullhead), and 44% in the northeast pool (with brown bullhead), suggesting differential brown bullhead effects on certain indigenous species. The apparent habitat shift by brassy minnow may be a result of all of these factors, because when brassy minnow were

91 introduced to the adult brown bullhead pool but protected in two enclosures, 60% and 80% of the brassy minnow survived over two months. This suggests that the pool was habitable to brassy minnow if protected from larger brown bullhead.

4.4.4 Growth experiment and species competition

Despite the lack of statistical significance of different median weight changes among brassy minnow treatments, brassy minnow alone treatments was the only one group not to exhibit weight loss or mortality. Individuals of brassy minnow lost weight in treatments with redside shiner and brown bullhead; however, mortality dominantly occurred in treatments with brown bullhead. However, if brassy minnow that died during the experiment were scored as having zero growth for the purposes of calculating mean tank growth, the non-parametric rank sum test examining brassy minnow growth alone to those kept with brown bullhead revealed that there was a significant difference in the median change in weight between these two treatments. Despite offering plant based foods, algae, and a wide range in the size of invertebrates offered as food, my study suggests that brassy minnow were outcompeted for these food resources both by brown bullhead and redside shiner. It should be noted that certain foods such as phytoplankton and diatoms that brassy minnow can collect with specialized pharyngeal structures (Hlohowskyj et al., 1989) were not added to the treatments, but are probably present at Tamboline Slough. Providing phytoplankton to treatments may have given brassy minnow an exclusive resource base to exploit and therefore increased growth rates and allowed for less direct competition in treatments with other species. Brassy minnow are able to utilize a wide range of food resources (Scott and Crossman, 1973; McPhail,

2007) despite having specialized morphological structures to collect and concentrate phytoplankton, diatoms, and bacteria (Hlohowskyj et al., 1989; Schmidt, 1994). This phenomenon is referred to as Liem’s Paradox, and is a situation observed in African cichlids whereby fish have specialized feeding phenotypes yet appear to act like a generalist feeder

(Robinson and Wilson, 1998; Binning et al., 2009). Because brassy minnow have one growing season due to a one year life span (Moyer et al., 2005), they may need to exploit the most abundant food resources available, but retain the ability to switch to phytoplankton resources when faced with superior competitors or unpredictable food resource bases. This could explain how brassy minnow can overlap and persist in Tamboline Slough for the majority of the year with both redside shiner and young-of-year brown bullhead as competitors.

There was a statistically significant difference in redside shiner median growth among treatments, and overall, redside shiners grew more than both brassy minnow and brown bullhead. In redside shiner treatments with all species present, redside shiners increased in weight the most and when redside shiners were alone they increased in weight the least. This suggests that redside shiners are good competitors and could potentially detect and consume the extra food provided in the treatments with all species as these had the highest biomass and therefore highest amounts of food added. This inference is supported by studies from the BC

Interior where redside shiners in warm waters out-competed juvenile rainbow trout in lakes for zooplankton resources (Johannes and Larkin, 1961). Additionally, the fact that the alone treatments of redside shiners grew the least in weight across treatments suggests that redside shiners in treatments with other species were able to consume portions of food that were allocated to the other tank occupants. Redside shiners were aggressive feeders and learned

93 cues associated with feeding times, perhaps giving them an advantage in detecting food presence relative to the other species. In treatments of redside shiner that included brassy minnow, mixed species shoaling occurred but with slight segregations with redside shiner grouping more in the upper half of the tanks and brassy minnow in the lower regions. Such associations were noted in mixed species schools of cyprinids with sub-structuring of schools believed to reduce competition without losing the benefits of protection in numbers (Allan,

1986). Furthermore, by inhabiting the upper regions of aquaria in the treatments that included other species, redside shiners were the first species to encounter food when added, and could potentially select preferred items (e.g., chironomid larvae).

There was a lack of statistical significance for the median growth among brown bullhead treatments. Brown bullhead generally grew more than brassy minnow overall, but not as much as redside shiners. As brown bullhead use olfaction to locate food resources (Pitcher, 1993), and feedings occurred during the day food search times were longer for the brown bullhead than for the more visually oriented brassy minnows and this may have affected the capture success of the brown bullhead as well as the amount of food obtainable overall in the treatments that included the other species. However, plants were available as food for the duration of the study and could be fed on by brown bullhead at night, although it is suggested that larger brown bullhead incorporate higher percentages of plant matter into their diet than juveniles (Barnes and Hicks, 1990). Once food was detected brown bullhead were aggressive feeders, and might attack brassy minnows that were near to them. None of the brown bullhead approached the size suggested to become predatory on the brassy minnows (max end length was 70 mm FL); however, all but one of the brassy minnow fatalities occurred in tanks with

94 brown bullhead present. Additionally, some of the brassy minnow that died in the brown bullhead treatments were partially consumed by brown bullhead, and this may be a factor as to the best growth by brown bullhead in treatments with brassy minnow.

4.5 Conclusions

In this chapter I examined the community assemblage of freshwater vertebrate species in the

Lower Mainland, finding high numbers and abundances of invasive species in this highly developed area. I also compared species presence-absence at historical sites by re-sampling these areas up to 50 years later to examine how the community assemblage has changed, and found significant declines in the numbers of cypriniform species, including brassy minnow, but only slight changes in the number of invasive species present. In addition, I explored trends of brassy minnow relative abundances in relation to invasive species, and found that brassy minnow mostly co-occurred with two invasive species: bullfrogs and brown bullhead. To further examine brown bullhead and brassy minnow interactions, I focussed on the site where the majority of brassy minnow were sampled in the Lower Mainland; Tamboline Slough on

Westham Island. At this site, I observed a significant habitat shift in small fish species, including brassy minnow, to pool habitats away from adult brown bullhead. Furthermore, I transplanted cages containing brassy minnow into the adult brown bullhead pool where most brassy minnow survived, suggesting that brassy minnow could persist in this pool if protected from the large brown bullhead. In addition, I conducted an experiment measuring the growth of brassy minnow with invasive young-of-year brown bullhead, and redside shiners another potential competitor, and found the only treatments where no brassy minnow lost weight was when they

95 were alone. Additionally, brassy minnow fatalities occurred mostly in the treatments containing brown bullhead. These data suggest that brown bullhead are potential predators and competitors and may cause habitat displacement in brassy minnow.

Table 3. Historical comparison of number of sites with species presence-absence across nine Lower Mainland locations sampled in 1956/1959 and re-sampled in 2008-2009.

Taxon Number of sites with species present

1956/1959 2008-2009

Indigenous Species

Cyprinidae

Peamouth chub (Mylocheilus caurinus) 7 1

Redside shiner (Richardsonius balteatus) 5 1

Northern Pikeminnow (Ptychocheilus oregonensis) 4 1

Brassy minnow (Hybognathus hankinsoni) 8 2

Longnose dace (Rhinichthys cataractae) 1 0

Leopard dace (Rhinichthys falcatus) 1 0

Catostomidae

Largescale sucker (Catostomus macrocheilus) 6 1

Cottidae

Prickly sculpin (Cottus asper) 5 5

Gasterosteidae

Three spine stickleback (Gasterosteus aculeatus) 5 7

Salmonidae

Rainbow trout (Oncorhynchus mykiss) 1 0

Coastal cutthroat trout (Oncorhynchus clarkii clarkii) 1 0

Coho salmon (Oncorhynchus kisutch) 1 0

Chum salmon (Oncorhynchus keta) 1 0

Pink salmon (Oncorynchus gorbuscha) 1 0

Taxon Number of sites with species present

1956/1959 2008-2009

Invasive Species

Cyprinidae

Common carp (Cyprinis carpio) 2 2

Ictaluridae

Black bullhead (Ameiurus melas) 1 0

Brown bullhead (Ameiurus nebulosus) 4 2

Centrarchidae

Black crappie (Pomoxis nigromaculatus) 4 2

Smallmouth bass (Micropterus dolomieui) 0 1

Pumpkinseed sunfish (Lepomis gibbosus) 0 4

Relative Abundance of Freshwater Species in the Lower Mainland

Native Brassy Minnow

Exotic

0.4

0.3

0.2

ProportionalRelative Abundance

0.1 0.0

SB BM BF BB SC CC PS RS UT SM BC PM CO LM LS CT

Species

Size classes of fish species sampled from the northwest pool at Tamboline Slough

40 0-25mm 25-50mm 50-100mm

100mm+

Number of fishes of Number

10 0

Brassy Bullhead Redside Carp Stickles

Size classes of fish species sampled from the southeast pool at Tamboline Slough

Number of fishes of Number

5 0

Brassy Bullhead Redside Carp Stickles

100

DCA of Relative Species Abundances across Lower Mainland Sites

P.n M.d 4.2 M.s

3.6

A.n C.c 2.4 C.a L.g H.h R.c Axis2 1.8 G.a R.b 1.2

0.6

0 O.c P.o M.c -0.6 O.k

-1 -0.5 0 0.5 1 1.5 2 2.5 3 3.5 Axis 1

Figure 13. De trended correspondence analysis (DCA) for sixty sites minnow trapped in the Lower Mainland over one year. Axis 1 represents relative species abundances, and axis 2 represents site location. Symbols represent the species found, and are as follows: M.d = smallmouth bass (Micropterus dolomieu), M.s = largemouth bass (Micropterus salmoides), P.n = black crappie (Pomoxis nigromaculatus), R.c = American bullfrog (Lithobates catesbieanus), C.a = prickly scuplin (Cottus asper), C.c = common carp (Cyprinus carpio), H.h = brassy minnow (Hybognathus hankinsoni), A.n = brown bullhead (Ameiurus nebulosus), G.a = threespine stickleback (Gasterosteus aculeatus), O.c = coastal cutthroat trout (Oncorhynchus clarkii clarkia), R.b = redside shiner (Richardsonius balteatus), O.k = coho salmon (Oncorhynchus kisutch), L.g = pumpkinseed sunfish (Lepomis gibbosus), P.o = northern pikeminnow (Ptychocheilus oregonensis), M.c = peamouth chub (Myolcheilus caurinus).

101

Mean growth rate per tank per species over all treatments

1.0

0.8

0.6

0.4

Mean growth rate (grams) rate growth Mean

0.2 0.0

H.hankinsoni R.balteatus A.nebulosus

Species

Figure 14. Mean growth rates (measured in grams) plus or minus one standard error for all species (brassy minnow, redside shiner, and brown bullhead) growth over 90 days (n = 20 for each species). Each data point consists of the mean tank growth of three of each of the species per tank (n = 5 tanks), and the boxes represent the upper (75%) and lower (25%) quartiles of the data.

102

Brassy minnow growth rates

0.4

0.2

Growth rates (g) rates Growth

0.0 -0.2

Alone All Redsides Bullhead

Treatments

103

Redside shiner growth rates

1.5

1.0

Growth rates (g) rates Growth

0.5 0.0

Alone All Brassy Bullhead

Treatment

104

Brown bullhead growth rates

0.8

0.6

0.4

Growth rates (g) rates Growth

0.2 0.0

Alone All Brassy Redsides

Treatments

105

CHAPTER 5: GENERAL CONCLUSIONS

5.1 General thesis overview of results

Brassy minnow mitochondrial gene trees displayed discordance for some individuals within ancestral ‘eastern’ sequences that best matched other species sequences (common shiner for cyt b and Mississippi silvery minnow for ND4), suggesting that these loci may have been influenced by natural selection, reticulate evolution, and incomplete lineage sorting processes.

Despite this, brassy minnow cyt b and ND4 loci within these gene trees formed an approximate

‘east-west’ split with the ‘eastern’ populations ancestral to the ‘western’ ones. This approximate ‘east-west’ split of the mtDNA loci along with fossil evidence and the widespread distribution of brassy minnow in BC suggest that these populations are not bait fish introductions, but rather re-colonized western Canada post-glacially from the Mississippi-

Missouri refugium. These ‘eastern’ versus ‘western’ brassy minnow populations are distinct due to geographic isolation and inhabit multiple freshwater eco regions, and may qualify for designatable unit status under COSEWIC guidelines, more study, particularly in terms of possible adaptive differences between populations are desirable. Within the derived ‘western’ clade of brassy minnow there was little geographic structuring or evidence for distinct clades in the Peace and upper Fraser River compared to those in the mid and lower Fraser River.

Brassy minnow were found in areas associated with Parsnip Reach of Williston Reservoir, around Summit Lake, in the Horsefly River drainage, and in various locations in the Lower

Mainland associated with the lower Fraser River downstream of Chilliwack. Catch-per-unit-

106 effort for brassy minnow was highest in the upstream populations associated with the Peace and upper Fraser rivers and lower in the mid and lower Fraser River. In the Lower Mainland sampling of 60 sites for one year revealed that highest abundances of brassy minnow were found in the lowest reaches of the Fraser River. In particular, Westham Island and Delta sloughs and ditches had the highest abundance and most persistent brassy minnow populations encountered. In addition, Tamboline Slough, Westham Island proved to be a spawning site for brassy minnow further indicating the importance of this site for brassy minnow conservation. In addition to brassy minnow spring spawning events, other seasonal trends were observed including lake populations overwintering in creeks, and littoral to pelagic habitat shifts in lakes in the summer. A logistic regression-based habitat model was explored for brassy minnow using seven variables recorded at 30 sites and revealed conductivity as a near significant parameter to predict brassy minnow presence. However, conductivity is typically positively correlated with productivity (Morgan, 1985), and productivity may be a better predictor for presence of brassy minnow because they feed on phytoplankton (Hlohowskyj et al., 1989) and have been found to be associated with macrophytes (Quist et al., 2004). Within BC, brassy minnow were most typically found in small water bodies without predators present.

Eight invasive species were sampled in lower Fraser River tributaries, five of which are piscivorous as adults (Scott and Crossman, 1973). Historical comparisons over eight sites suggested that brassy minnow are extirpated in some areas, and overall presence of cypriniform species was significantly reduced at many sites. By contrast, the number of invasive species at sites did not show a significant change across the time interval between the historical and contemporary survey. The causes of these historical changes in native species prevalence

107 remain speculative; however, habitat changes, eutrophication, and shifts in the number of invasive predatory species found may be factors. For seasonal sampling, a DCA of relative abundance across 60 sampling sites revealed that brassy minnow grouped most closely with two invasive species: bullfrogs, and brown bullhead. Interactions of brassy minnow and brown bullhead were further explored at Tamboline Slough on Westham Island, a site where both species were most abundant and both species spawn. With the appearance of large (i.e., over

140 mm FL) predatory adult brown bullhead in Tamboline Slough from Aug-Oct, there were more small fishes, including brassy minnow, in the pool without brown bullhead. When 20 brassy minnow were transplanted into the brown bullhead pool in two cages, 14 survived over two months, suggesting if protected from brown bullhead, brassy minnow could persist in this pool. This suggests that brassy minnow shifted into the pool habitat without brown bullhead, as a result of predation pressure and nest guarding behaviours of invasive brown bullhead

(Blumer, 1986; DeClerck et al, 2002; Scheurer et al., 2003). While adult brown bullhead appeared to use Tamboline Slough temporarily, young-of-year brown bullhead persisted at this site for most of the year. To examine interactions of invasive young-of-year brown bullhead with two indigenous cyprinids, brassy minnow and redside shiner growth experiments were performed in the laboratory. Over 90 days, median growth differences between treatments for brassy minnow and brown bullhead was not significant, but redside shiner exhibited increased growth in the presence of one or both of the other species. However, brassy minnow were the only species to exhibit weight loss and mortality over the duration of the study. Also, all but one of the brassy minnow fatalities occurred in treatments with brown bullhead present.

108

5.2 Applications

My thesis provides evidence for an approximate ‘east-west’ geographic split in cyt b and ND4 loci for populations of brassy minnow. Additionally, this thesis provides baseline data for the distribution and relative abundance of brassy minnow in BC, and especially in the Lower

Mainland. Catch-per-unit-effort data suggest that brassy minnow in the Horsefly drainage and the in Lower Mainland are least abundant and may require conservation attention and further monitoring. Within the Lower Mainland relative abundance from seasonal sampling suggested that brassy minnow are rare in the Sumas River, but are both abundant and persist for many months within Deer and Burnaby lakes, Delta, and Westham Island. Important habitats for brassy minnow include: Westham Island sloughs for spawning, creeks as apparently high quality habitat because brassy minnow persist there at certain times of the year. High conductivity proved to be a near significant predictor of brassy minnow presence of the abiotic habitat parameters measured. Using conductivity as a correlate for brassy minnow presence could aid in the assessment of suitable habitat for brassy minnow, aid in searches for new populations, and allow the monitoring of existing populations. My findings also emphasise the importance of seasonal sampling for assessing freshwater community assemblages and stresses the need for sampling smaller water bodies such as creeks associated with lakes to obtain a comprehensive understanding of fish habitat use across life history stages.

My thesis also provides baseline distribution and abundance data for aquatic vertebrates, including invasive species, encountered in backwaters of lower Fraser River tributaries. With

109 records of the distribution and abundance of invasive species present in the Lower Mainland, future comparisons can be made and control programmes could be explored for areas of high invasive species occurrences such as Hatzic Lake. For instance, adult brown bullhead could be removed from Tamboline Slough in August, as studies have shown larval bullhead survivorship is poor without parental care and defence (Blumer, 1986). My results, therefore, illustrates the potential effects of invasive species on indigenous ones, such as the habitat shift and competition as well as potential predation of brown bullhead on brassy minnow. Educating the public about such interactions will hopefully dissuade further invasive introductions.

Furthermore, my study suggests that the number of cypriniform species have declined in some areas of the Lower Mainland, a trend observed in many areas of North America (e.g., Robinson and Tomm, 1989; Chapleau et al., 1997; Whittier et al., 1997). This illustrates a need for further studies on this group of fishes (i.e., cyprinids and catostomids), which have been relatively understudied compared to salmonids in BC.

5.3 Future directions

Brassy minnow conservation would benefit from finer-scale genetic studies examining within region population substructure, and in particular, the extent of gene flow within regions and the extent of long distance migrations between regions. Such a study could determine the degree of isolation between brassy minnow populations in the Peace River drainage and the various reaches of the Fraser River. Additionally, further finer-scale population genetic studies of brassy minnow in the Lower Mainland could determine subpopulation structuring and the extent of downstream gene flow by early life stage brassy minnow versus upstream adult

110 migrations. For instance, if brassy minnow migration is strongly biased in the downstream direction, this could explain why brassy minnow abundance is so high in the most downstream areas of the Fraser River. Furthermore, flow chamber experiments similar to the ones recently performed on Rio Grande minnows (Bestgen et al., 2010) could reveal the limits of upstream migration and backwater re-colonization with the variable discharges associated with the dammed areas of the Lower Mainland. Additionally, explorations into the limits of brassy minnow downstream egg movements under different flow regimes in artificial streams could help determine the possible distances travelled by early life stages of brassy minnow.

To further define brassy minnow distribution in BC, sampling of additional regions would help determine how isolated the seemingly disjunct populations of brassy minnow are in BC. Little sampling has occurred for brassy minnow between Prince George and Quesnel and between

Williams Lake and Chilliwack, therefore it is unknown whether these seemingly isolated populations of brassy minnow are disjunct or more continuous than previously thought. Also further monitoring of the Lower Mainland freshwater vertebrate community, especially brassy minnow and other cypriniforms, especially largescale suckers is required to establish long-term abundance and presence-absence data that would help determine the extent of community change and potential biodiversity loss in this area.

Examining the relationship between conductivity and productivity further could refine a brassy minnow habitat model. For instance measures of total dissolved phosphorous and chlorophyll a across sites may yield a better brassy minnow habitat model fit. In addition, the number and efficiency of predatory species present along with properties of water body size, connectivity,

111 number of outlets, and habitat heterogeneity have been found to be important factors for many minnow species presence and persistence in some areas (Chapleau et al., 1997; Whittier et al., 1997) and would be useful to incorporate into future brassy minnow habitat models.

Further pond or field based experiments on the interactions of the Tamboline Slough vertebrate community with increased replication could improve on the initial lab experiment from this study. A more large-scale study incorporating the interactions of bullfrog tadpoles along with brown bullhead, redside shiner, and brassy minnow would better replicate the natural conditions of Tamboline Slough. Experiments with larger brown bullhead could assess this species’ efficiency and extent of predatory interactions with local indigenous species.

Finally, manipulations of turbidity could explore how water clarity can affect competitive outcomes, elicit changes in search behaviours, and influence prey capture efficiency in brassy minnow versus brown bullhead and the predator-prey interactions between brassy minnow and vertebrate predators.

In conclusion, my thesis has contributed to a much better understanding of the biogeography, ecology, and conservation implications of these subjects for a previously little studied freshwater fish in Canada. In addition, I have made a contribution to providing a quantitative baseline for studying the distribution and implications of invasive species in the Lower Fraser

Valley. Establishing such a baseline is important as invasive species are a major threat to the persistence of native fishes in Canada (Dextrase and Mandrak, 2006) and given that the Lower

Mainland region of BC, is the fastest growing region in BC the introduction, spread, and

112 negative consequences of invasive species is bound to increase without some consistent monitoring and action on invasive species in this area.

113

Literature cited

Abrahams M.V., and M.G. Kattenfeld 1996. The role of turbidity as a constraint on predator- prey interactions in aquatic environments. Behavioural Ecology and Sociobiology 40(3) pp. 169- 174

Allen J.R., 1986. The influence of species composition on behaviour in mixed-species cyprinid shoals. Journal of Fish Biology 29(1) pp. 97-106

Allendorf F.W., and L.L. Lundquist 2003. Introduction: population biology, evolution, and control of invasive species. Conservation Biology 17(1) pp. 24-30

Alò D., and T.F.Turner 2005. Effects of habitat fragmentation on effective population size in the endangered Rio Grande silvery minnow. Conservation Biology 19(4) pp. 1138-1148

Anderson A.A., C. Hubbs, K.O. Winemiller, and R.J. Edwards 1995. Texas freshwater fish assemblages following three decades of environmental change. The Southwestern Naturalist 40 (3) pp. 314-321

Ardent J. and D.S. Wilson 1997. Optimistic growth: competition and an ontogenetic niche-shift select for rapid growth in pumpkinseed sunfish (Lepomis gibbosus). Evolution 51(7) pp. 1946- 1954

Avise J.C., Arnold J., Ball R.M., Bermingham E., Lamb T., Neigel J.E., Reeb C.E., and N.C. Saunders 1987. Intraspecific phylogeography: the mitochondrial DNA bridge between population genetics and systematics. Annual Review of Ecological Systematics 18(4) pp. 489-522

Avise J.C., and Ball R.M. 1990. Principles of genealogical concordance in species concepts and biological taxonomy. Oxford Survey of Evolutionary Biology 7(1) pp. 45-67

Bailey R.M. 1954. Distribution of the American cyprinid fish Hybognathus hankinsoni with comments on its original description. Copeia 4(1) pp. 289-291

Barnes G.E., and B.J. Hicks 1990. Brown bullhead catfish (Ameiurus nebulosus) in Lake Taupo. Managing invasive freshwater fish in New Zealand pp. 27-35

Bernatchez L., and J.J. Dodson 1991. Phylogeographic structure in mitochondrial DNA of the lake whitefish (Coregonus clupeaformis) and its relation to Pleistocene Glaciations. Evolution 45(4) pp. 1016-1035

Bernatchez L., and C.C. Wilson 1998. Comparative phylogeography of Nearctic and Palearctic fishes. Molecular Ecology 7(4) pp. 431-452

114

Bestgen K.R., Mefford B., Bundy J.M., Walford C.D., and R.I. Compton 2010. Swimming performance and fishway model passage success of Rio Grande silvery minnow. Transactions of the American Fisheries Society 139(3) pp. 433-448

Binning S.A., Chapman L.J., and A. Cosandey-Godin 2009. Specialized morphology for a generalised diet: evidence of Liem’s Paradox in a cichlid fish. Journal of Fish Biology 75(7) pp. 1683-1699

Birky C.W., Fuerst P. Jr., and T. Maruyama 1989. Organelle gene diversity under migration, mutation, and drift: equilibrium expectations, approach to equilibrium, effects of heteoplasmic cells, and comparison to nuclear genes. Genetics 12(4) pp. 613-627

Blumer L.S. 1986. The function of parental care in the brown bullhead Ictalurus nebulosus. American Midland Naturalist 115(2) pp. 234-238

Bos D.H., Gopurenko D., Williams R.N., and J.A. DeWoody 2008. Inferring population history and demography using microsatellites, mitochondrial DNA, and major histocompatibility complex (MHC) genes. Evolution 62(6) pp. 1458-1468

Brown K.H. 2008. Fish mitochondrial genomics: sequences, inheritance and functional variation. Journal of Fish Biology 72(4) pp. 355-374

Bünger L., Lewis R.M., Rothschild M.F., Blasco A., Renne U., and G. Simm 2005. Relationships between quantitative and reproductive fitness traits in animals. Philosophical Transactions: Biological Sciences 360(1459) pp. 1489-1502

Bunnell J.F., and R.A. Zampella 2008. Native fish and anuran assemblages differ between impoundments with and without non-native centrarchids and bullfrogs. Copeia 4(6) pp. 931- 939

Burr B.M. and R.L. Mayden 1992. Phylogenetics and North American freshwater fishes. pp. 18- 75 In: Systematics, historical ecology, and North American fishes. R.L. Mayden Ed. Stanford University Press, CA.

Cambray J.A. 2003. Impact on indigenous species biodiversity caused by the globalization of alien recreational freshwater fishes. Hydrobiologica 500(2) pp. 217-230

Carl G.C., Clemens W.A., and C.C. Lindsey 1948. The freshwater fishes of British Columbia. Provincial Museum Handbook No.5 Victoria B.C.

Carlson R.E. 1977. A trophic state index for lakes. Limnology and Oceanography 22(2) pp. 361- 369

115

Carroll S.S. and D.L. Pearson 2000. Detecting and modeling spatial and temporal dependence in conservation biology. Conservation Biology 14(6) pp. 1893-1897

Caughley G. 1994. Directions in conservation biology. Journal of Animal Ecology 63(2) pp. 215- 235

Chapleau F., Findlay C.S., and E. Szenasy 1997. Impact of piscivorous fish introductions on fish species richness of small lakes in Gatineau Park, Quebec. Ecoscience 4(2) pp. 259-268

Charlesworth B., Morgan M.T., and D. Charlesworth 1993. The effect of deleterious mutations on neutral molecular variation. Genetics 134(4) pp. 1289-1303

Clavero M., and E. Garcia-Berthou 2005. Invasive species are a leading cause of animal extinctions. Trends in Evolution and Ecology 20(1) pp. 110-116

Copes F.A. 1975. Ecology of the brassy minnow, Hybognathus hankinsoni (Cyprinidae). Reports on the Fauna and Flora of Wisconsin No.10, Museum of Natural History. Stephens Point, WI: University of Wisconsin

COSEWIC 2008. Operations and procedure manual. Committee on the Status of Endangered Wildlife in Canada Ottawa

Dauwalter D.C., and F.J. Rahel 2008. Distribution modelling to guide stream fish conservation: an example using the mountain sucker in the Black Hills National Forest, USA. Aquatic Conservation: Marine and Freshwater Ecosystems 18(7) pp. 1263-1276

DeClerck S., Louette G., De Bie T., and De Meester L. 2002. Patterns of diet overlap between populations of non-indigenous and native fishes in shallow ponds. Journal of Fish Biology 61(5) pp. 1182-1197

Dextrase A.J., and N.E. Mandrak 2006. Impacts of alien invasive species on freshwater fauna at risk in Canada. Biological Invasions 8(1) pp. 13-24

Dillon P.J., and F.H. Rigler 1974. The phosphorous-chlorophyll relationship in lakes. Limnology and Oceanography 19(5) pp. 767-773

Diniz-Filho J.A.F., Bini L.M., and Hawkins B.A. 2003. Spatial autocorrelation and red herrings in geographical ecology. Global Ecology & Biogeography 12(1) pp. 53-64

Dodds W.K., Gido K., M.R. Whiles 2004. Life on the edge: the ecology of Great Plains prairie streams. Bioscience 54(3) pp. 205-216

116

Dowling T.E., Tibbets C.A., Minckley W.L., and G.R. Smith 2002. Evolutionary relationships of the Plagopterins (Teleostei: Cyprinidae) from cytochrome b sequences. Copeia 3(5) pp. 665-678

Drayton B., and R.B. Primack 1996. Plant species lost in an isolated conservation area in metropolitan Boston 1894 to 1993. Conservation Biology 10(1) pp. 30-39

Dudley R.K., Gottlieb S.J., and S.P. Platania 2002. 2002 population monitoring of Rio Grande silvery minnow, Hybognathus amarus. American Southwest Ichthyological Research Foundation pp. 1-79

Etnier D.A., Starnes W.C., and B.H. Bauer 1979. Whatever happened to the silvery minnow (Hybognathus nuchalis) in the Tennessee River? Proceedings of the Southeastern Fishes Council 2(3) pp. 1-3.

Etnier D.A., and W.C. Starnes 1993. The fishes of Tennessee. University of Tennessee Press, Knoxville, TN.

Fausch K.D. and K.R. Bestgen 1997. Ecology of fishes indigenous to the central and southwestern Great Plains. pp. 131-166 F.L. Knopf and B. Samson Eds. In: Ecology and conservation of Great Plains vertebrates. Springer-Verlag, NY.

Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39(5) pp. 783-791

Findlay C.S., Bert D.G., and L. Zheng 2000. Effect of introduced piscivores on native minnow communities in Adirondack lakes. Canadian Journal of Fisheries and Aquatic Sciences 57(4) pp. 570-580

Fraser D.F., and T.N. Mottolese 1984. Discrimination and avoidance reactions towards predatory and non-predatory fish by blacknose dace, Rhinichthys atratulus (Pisces: Cyprinidae) Zoological Tierpsychologie 66(2) pp. 89-100

Fraser D.F., Gilliam J.F., and T. Yip-Hoi 1995. Predation as an agent of population fragmentation in a tropical watershed. Ecology 75(5) pp. 1461-1472.

Fraser D.F., Gilliam J.F., MacGowan M.P., Arcaro C.M., and P.H. Guillozet 1999. Habitat quality in a hostile river corridor. Ecology 80(2) pp. 597-607.

García-Berthou E. 2007.The characteristics of invasive fishes: what have we learned so far? Journal of Fish Biology 71(1) pp. 33-55

Gerber A.S., C.A. Tibbets, and T.E. Dowling 2001. The role of introgressive hybridization in the evolution of the Gila robusta complex (Teleostei: Cyprinidae). Evolution 55(10): pp. 2028-2039.

117

Gido K.B., and J.H. Brown 1999. Invasion of North American drainages by alien fish species. Freshwater Biology 42(1) pp. 387-399

Gilliam J.S., and D.F. Fraser 2001. Movement in corridors: enhancement by predation threat, disturbance, and habitat structure. Ecology 80(1) pp. 258-273

Green D.M.2005. Designatible units for status assessment of endangered species. Conservation Biology 19(6) pp. 1523-1739

Haas G.R. 1999. British Columbia’s freshwater fish, species, ecosystems are more at risk and less protected. Proceedings of the Biology and Management of Species and Habitats at Risk Kamloops, B.C. pp. 15-19

Hall B.G. 2004. Phylogenetic trees made easy. A how to manual. 2 ed. Sinauer Associates Inc. Sunderland, Massachusetts, USA 221 pp.

Hall T.A. 1999. BioEdit: a user friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41(1) pp. 95-98

Hammer, Ø., Harper, D.A.T., and P. D. Ryan, 2001. PAST: Paleontological Statistics Software Package for Education and Data Analysis. Palaeontologia Electronica 4(1): 9pp http://folk.uio.no/ohammer/past/

Hare M. 2001. Prospects for nuclear gene phylogeography. Trends in Evolution and Ecology 16(12) pp. 700-706

Hasegawa M., Kishino H., and T. Yano 1985. Dating the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22(2) pp. 160-174

Hazelton P.D. and G.D. Grossman 2009. The effects of turbidity and an invasive species on foraging success of rosyside dace (Clinostomus funduloides). Freshwater Biology 54(9) pp. 1977- 1989

He X., and J.F. Kitchell 1990. Direct and indirect effects of predation on a fish community: a whole lake experiment. Transactions of the American Fisheries Society 119(5) pp. 825-835

He X., and D.M. Lodge 1990. Using minnow traps to estimate fish population size: the importance of spatial distribution and relative species abundance. Hydrobiologia 190(1) pp. 9- 14

Hewitt G. 2000. The genetic legacy of Quaternary Ice Ages. Nature 405(7335) pp. 516-518

118

Hill M.O. and H.G. Gauch 1980. De trended correspondence analysis: an improved ordination technique. Vegetatio 42(1) pp. 47-58

Hlohowskyj C.P., Coburn M.M., and T.M. Cavender 1989. Comparison of a phyaryngeal filtering apparatus in seven species of the herbivorous cyprinid genus, Hybognathus (Pisces: Cyprinidae). Copeia 1(1)pp. 172-183

Huelsenbeck, J. P., F. Ronquist, R. Nielsen and J. P. Bollback. 2001. Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294(5550) pp. 2310-2314

Hudson R. 1990. Gene genealogies and the coalescent process. Oxford Surveys of Evolutionary Biology 7(1) pp. 1-44

Hudson R. 1992. Gene trees, species trees, and the segregation of ancestral alleles. Genetics 131(3) pp. 509-512

Jackson D.A., Somers K.M., and Harvey H.H. 1992. Null models and fish communities: evidence of non-random patterns. American Naturalist 139(4) pp. 930-943

Jackson D.A., and H.H. Harvey 1997. Qualitative and quantitative sampling of lake fish communities. Canadian Journal of Fisheries and Aquatic Sciences 54(6) pp. 2807-2813

Jackson D.A., Peres-Neto P.R., and Olden J.D. 2001. What controls who is where in freshwater fish communities – the role of biotic, abiotic, and spatial factors. Canadian Journal of Fisheries and Aquatic Sciences 58(1) pp. 157-170

Jackson D.A., and N.E. Mandrak 2002. Changing fish biodiversity: predicting the loss of cyprinid biodiversity due to climate change. Fisheries in a Changing Environment 32(1) pp. 89-98

Johannes R.E., and P.A. Larkin 1961. Competition for food between red-side shiners (Richardsonius balteatus) and rainbow trout (Salmo gairdneri) in two BC lakes. Journal of Fisheries Resource Board of Canada 18(1) pp. 203-220

Johnston C.E., and M.J. Maceina 2009. Fish assemblage shifts and species declines in Alabama, USA streams. Ecology of Freshwater Fish 18(1) pp. 33-40

Kamerath M., Chandra S., and B.C. Allen 2008. Distribution and impacts of warm water invasive fish in Lake Tahoe, USA. Aquatic Invasions 3(1) pp. 35-41

Kattan G.H., Alverez-Lopez H., and M. Giraldo 1994. Forest fragmentation and bird extinctions: San Antonio eighty years later. Conservation Biology 8(1) pp. 138-146

119

Keenleyside M.H.A. 1954. First record of brassy minnow, Hybognathus hankinsoni from British Columbia. Canadian Field-Naturalist 68(1) pp.43

Kennard M.J., Arthington A.H., Pusey B.J., and B.D. Harch 2005. Are alien fish a reliable indicator of river health? Freshwater Biology 50(1) pp. 174-193

Kimura M. 1968. Evolutionary rate at the molecular level. Nature 217(5154) pp. 624-626

Kneib R.T., and A.H. Craig 2001. Efficacy of minnow traps for sampling mummichogs in tidal marshes. Estuaries and Coasts 24(6) pp. 884-893

Kolbe J.J., Glor R.E., Schettino L.R., Lara A.C., Larson A., and J.B. Losos 2007. Multiple sources, admixture, and genetic variation in introduced Anolis lizard populations. Conservation Biology 21(6) pp. 1612-1625

Kumar S., Dudley J., Nei M. and Tamura K. 2008. MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences. Briefings in Bioinformatics 9(4) pp. 299- 306.

Kupferberg S.J. 1997. Bullfrog (Rana catesbeiana) invasion of a Californian river: the role of larval competition. Ecology 78(6) pp. 1736-1751

LaFontaine P. and J.J. Dodson 1997. Intraspecific genetic structure of white sucker (Catostomus commersoni) in northeastern North America as revealed by mitochondrial DNA polymorphism. Canadian Journal of Fisheries and Aquatic Sciences 54(3) pp. 555-565

Layman C.A., and D.E. Smith 2001. Sampling bias of minnow traps in shallow aquatic habitats on the eastern shore of Virginia. Wetlands 21(1) pp. 145-154

Lichstein J.W., Simons T.R., Shriner S.A., and Franzreb K.E. 2002. Spatial autocorrelation and autoregressive models in ecology. Ecological Monographs 72(3) pp. 445-463

Lu G., Basley D.J., and L. Bernatchez 2001. Contrasting patterns of mitochondrial DNA and microsatellite introgressive hybridization between lineages of lake whitefish (Coregonus clupeaformis); relevance for speciation. Molecular Ecology 10(4) pp. 965-985.

MacRae P.S.D., and D.A. Jackson 2001. The influence of smallmouth bass (Micropterus dolomeiu) predation and habitat complexity on the structure of littoral zone fish assemblages. Canadian Journal of Fisheries and Aquatic Sciences 58(2) pp. 342-351

Maddison W.P. 1997. Gene trees in species trees. Systematic Biology 46(3) pp. 523-536

120

Maddison W.P., and Knowles L.L. 2006. Inferring phylogeny despite incomplete lineage sorting. Systematic Biology 55(1) pp. 21-30

Manny B.A., Johnston W.C., and R.G. Wetzel 1994. Nutrient additions by waterfowl to lakes and reservoirs: predicting their effects on productivity and water quality. Hydrobiologia 279(1) pp. 121-132

Marshall C.T., and R.H. Peters 1989. General patterns in the seasonal development of chlorophyll a for temperate lakes. Limnology and Oceanography 34(5) pp. 856-867

Matthews W.J. 1998. Patterns in freshwater fish ecology. Chapman and Hall, Norwell, Mass

Meffe G.K. 1984. Effects of abiotic disturbance on coexistence of predator-prey fish species. Ecology 65(5) pp. 1525-1534.

McGurk M.D. 2000. Comparison of fecundity-length-latitude relationships between nonanadromous (kokanee) and anadromous sockeye salmon (Oncorhynchus nerka). Canadian Journal of Zoology 78(10) pp. 1791-1805

McPhail J.D. and C.C. Lindsey 1970. Freshwater fishes of northwestern Canada and Alaska. Bulletin 173 – Fisheries and Resources Board of Canada, Ottawa, ON. 381 pp.

McPhail J.D., and E.B. Taylor 1999. Morphological and genetic variation in northwestern longnose suckers, Catostomus catostomus: the Salish sucker problem. Copeia 4(3) pp. 884-893

McPhail J.D. 2006. Feature fishes the brassy minnow. Unpublished manuscript.

McPhail J.D. illustrated by D.L. McPhail 2007. The freshwater fishes of British Columbia. University of Alberta Press, Edmonton, AB. 620 pp.

Mills M.D., Rader R.B., and M.C. Belk 2004. Complex interactions between native and invasive fish: the simultaneous effects of multiple negative interactions. Oecologica 141(4) pp. 713-721

Mills E.L., and A.J. Schiavone 1982. Evaluation of fish communities through assessment of zooplankton populations and measures of lake productivity. North American Journal of Fisheries Management 2(1) pp. 14-27

Mittlebach G.G. 1981. Foraging efficiency and body size: a study of optimal diet and habitat use by bluegills. Ecology 62(5) pp. 1370-1386

Mittlebach G.G., Osenberg C.W., and P.C. Wainwright 1992. Variation of resource affects diet and feeding morphology in the pumpkinseed sunfish (Lepomis gibbosus). Oecologia 90(1) pp. 8- 13

121

Mittlebach G.G., Osenberg C.W., and P.C. Wainwright 1999. Variation in feeding morphology between pumpkinseed populations: phenotypic plasticity or evolution? Evolutionary Ecology Research 1(1) pp. 111-128

Miya M., Saitoh K., Wood R., Nishida M., and Mayden R.L. 2005. New primers for amplifying and sequencing the mitochondrial ND4/ND5 gene region of the Cypriniformes (Actinopterygii: Ostariophysi). Ichthyological Research 53(1) pp. 75-81

Moore W.S. 1995. Inferring phylogenies from mtDNA variation: mitochondrial-gene trees versus nuclear-gene trees. Evolution 49(4) pp. 718-726

Morgan M.J. 1988. Influence of hunger, shoal size and predator presence on foraging in bluntnose minnows. Animal Behaviour 36(5) pp. 1317-1322

Morgan M.D. and R.E. Good 1988. Stream chemistry in the New Jersey Pinelands: the influence of precipitation and watershed disturbance. Water Resources Research 24(7) pp. 1091-1100

Moritz C., Dowling T.E., and W.M. Brown 1987. Evolution of animal mitochondrial DNA: relevance for population biology and systematic. Annual Review of Ecology and Systematics 18(1) pp. 269-292

Moritz C. 1994. Applications of mitochondrial DNA analysis in conservation: a critical review. Molecular Ecology 3(5) pp. 401-411

Moritz C. 1994. Defining ‘evolutionary significant units’ for conservation. Trends in Evolution and Ecology 9(10) pp. 373-375

Moyer G.R., Osborne M., and T.F. Turner 2005. Genetic and ecological dynamics of species replacement in an arid-land river system. Molecular Ecology 14(4) pp. 1263-1273

Moyer G.R., Remington R.K., and T.F. Turner 2009. Incongruent gene trees, complex evolutionary processes, and the phylogeny of a group of North American minnows (Hybognathus Agassiz 1855). Molecular Phylogenetics and Evolution 50(3) pp. 514-525

Nei M., T. Maruyama, and R. Chakraborty 1975. The bottleneck effect and genetic variability in populations. Evolution 29(1) pp. 1-10

Neigel J., and J.C. Avise 1986. Phylogenetic relationships of mitochondrial DNA under various demographic models of speciation. pp. 515-534 In: Evolutionary Processes and Theory. Ed: S. Karlin and E. Nevo, Academic Press, New York.

Nürnberg G.K., and M. Shaw 1999. Productivity of clear and humic lakes: nutrients, phytoplankton, bacteria. Hydrobiologia 382(1) pp. 97-112

122

Nylander J.A.A. 2004. MrModeltest v2. Program distributed by author. Evolutionary Biology Centre, Uppsala University, Sweden http://www.abc.se/~nylander/mrmodeltest2/mrmodeltest2.html

Oosterhaut C.V., Van Heuven M.K., and P.M. Brakefield 2004. On the neutrality of molecular genetic markers: pedigree analysis of genetic variation in fragmented populations. Molecular Ecology 13(5) pp. 1025-1034

Page L.M., and B.M. Burr 1991. A field guide to freshwater fishes: North America north of Mexico. Houghton Mifflin, Boston

Palumbi S.R., Cipriano F., and M.P. Hare 2001. Predicting nuclear gene coalescence from mitochondrial data: the three-times rule. Evolution 55(5) pp. 859-868

Parkos III J.J., Santucci Jr. V.J., and D.H. Wahl 2003. Effects of common carp (Cyprinus carpio) on multiple trophic levels in shallow mesocosms. Canadian Journal of Fisheries and Aquatic Sciences 60(2) pp. 182-192

Patton T.M., Rahel F.T., and W.A. Hubert 1997. Using historical data to assess changes in Wyoming’s fish fauna. Conservation Biology 12(5) pp. 1120-1128

Pitcher T.J. 1993. Behaviour of teleost fishes. 2ed. Chapman and Hall 715 pp.

Platania S.P., and C.S. Altenbach 1998. Reproductive strategies and egg types of seven Rio Grande basin cyprininds. Copeia 4(4) pp. 559-569

Pollard S.M. 2003. Status of the western silvery minnow (Hybognathus argyritis) in Alberta. Alberta Wildlife Status Report No. 47 pp 1-35

Porter M.S., Rosenfeld J., and E.A. Parkinson 2000. Predictive models of fish species distribution in the Blackwater drainage, British Columbia. Proceedings of a Conference on the Biology and Management of Species and Habitats at Risk, Kamloops, B.C. pp. 15-19

Posada D. and T.R. Buckley 2004. Model selection and model averaging in phylogenetics: advantages of Akaike information criterion and Bayesian approaches over likelihood ratio tests. Systematic Biology 53(5) pp. 793-808

Power M.E., Matthews W.J., and A.J. Stewart 1985. Grazing minnows, piscivorous bass and stream algae: dynamics of a strong interaction. Ecology 66(5) pp. 1448-1456

Quist M.C., Hubert W.A., and F.J. Rahel 2004. Relations among habitat characteristics, exotic species, and turbid-river cyprinids in the Missouri River drainage of Wyoming. Transactions of the American Fisheries Society 133(3) pp. 727-742

123

Quist M.C., Rahel F.J., and W.A. Hubert. 2005. Heirarchical faunal filters: an approach to assessing effects of habitat and non-native species on native fishes. Ecology of Freshwater Fishes 14(1) pp. 24-39

Rand D.M. 2001. The units of selection of mitochondrial DNA. Annual Review of Ecology and Systematics 32(3) pp. 415-448

Reinthal P.N., and M.L.J. Stiassny 1991. The freshwater fishes of Madagascar: a study of an endangered fauna with recommendations for a conservation strategy. Conservation Biology 5(2) pp. 231-243

Rejmánek M., Richardson D.M., Barbour M.G., Crawley M.J., Hrusa G.F., Moyle P.B., Randall J.M., Simberloff D., and M. Williamson 2002. Biological invasions: politics and the discontinuity of ecological terminology. Bulletin of the Ecological Society of America 83(2) pp. 131-133

Rempel L.L., and D.G. Smith 1998. Postglacial fish dispersal from the Mississippi refuge to the MaKenzie River basin. Canadian Journal of Fisheries and Aquatic Sciences 55(4) pp. 893-899

Ricciardi A., and J.B. Rasmussen 1999. Extinction rates of North American freshwater fauna. Conservation Biology 13(5) pp. 1220-1222

Ricciardi A., and J.B. Rasmussen 1998. Predicting the identity and impact of future biological invaders: a priority for aquatic resource management. Canadian Journal of Fisheries and Aquatic Sciences 55(7) pp. 1759-1765

Richardson J.S., Lissimore T.J., Healey M.C., and T.G. Northcote 2000. Fish communities of the lower Fraser River (Canada) and a 21-year contrast. Environmental Biology of Fishes 59(2) pp. 125-140

Ripley T. 2001. Brassy minnow (Hybognathus hankinsoni) inventory at Musreau Lake and outlet. Alberta Sustainable Resource Development, Fish and Wildlife Division. Alberta Species at Risk Report No.6 Edmonton, AB

Robinson B.W. and D.S. Wilson 1998. Optimal foraging, specialization, and a solution to Liem’s Paradox. American Naturalist 151(3) pp. 223-235

Robinson C.L.K., and W.M. Tonn 1989. Influence of environmental factors and piscivory in structuring fish assemblages in small Alberta lakes. Canadian Journal of Fisheries and Aquatic Sciences 43(1) pp. 81-89

Roff D.A. 1992. The evolution of life histories. Chapman and Hall, New York

124

Ronquist, F. and J. P. Huelsenbeck. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19(12) pp. 1572-1574 http://mrbayes.csit.fsu.edu/

Savino J.F., and R.A. Stein 1989. Behaviour of fish predators and their prey: habitat choice between open water and dense vegetation. Environmental Biology of Fishes 24(4) pp. 287-293

Senanan W., and A.R. Kapuscinski 2000. Genetic relationships among populations of northern pike (Esox lucius). Canadian Journal of Fisheries and Aquatic Sciences 57(4) pp. 391-404

Scheurer J.A., Bestgen K.R., and K.D. Fausch 2003. Resolving taxonomy and historic distribution for conservation of rare Great Plains fishes: Hybognathus (Teleostei: Cyprinidae) in eastern Colorado basins. Copeia 1(1) pp. 1-12

Scheurer J.A., Fausch K.D., and K.R. Bestgen 2003. Multiscale processes regulate brassy minnow persistence in a Great Plains river. Transactions of the American Fisheries Society 132(5) pp. 840-855

Schlosser I.J. 1988. Predation rates and behavioural response of adult brassy minnows (Hybognathus hankinsoni) to creek chub and smallmouth bass predators. Copeia 3(5) pp. 691- 698

Schmidt T.R. 1994. Phylogenetic relationships of the Genus Hybognathus (Teleostei: Cyprinidae). Copeia 3(5) pp. 622-630

Scott W.B., and E.J. Crossman 1973. Freshwater fishes of Canada. Bulletin of Fisheries and Resource Board of Canada No. 184, 966 pp

Sheldon A.L. 1988. Conservation of stream fishes: patterns of diversity, rarity, and risk. Conservation Biology 2(2) pp. 149-156

Shine R. 1988. The evolution of large body size in females: a critique of Darwin’s ‘fecundity advantage’ model. The American Naturalist 131(1) pp. 124-131

Simberloff D. 1989. Which insect introduction succeed, and which fail? Biological Invasions: A Global Perspective, ed. J.A. Drake pp. 61-75 New York: Wiley

Simberloff D., and B. Von Holle 1999. Positive interactions of non-indigenous species: invasional meltdown? Biological Invasions 1(1) pp. 21-32

Smith C.L. 1985. The inland fishes of New York State. New York State Department of Environmental Conservation Albany, NY 522 pp.

125

Sogard S.M. 1997. Size-selective mortality in the juvenile stage of teleost fishes: a review. Bulletin of Marine Sciences 60(3) pp. 1129-1157

Sundström L.F., Lõhmus, M., and R.H. Devlin 2005. Selection on increased intrinsic growth rates in coho salmon, Oncorhynchus kisutch. Evolution 59(7) pp. 1560-1569

Stöver B.C. and K.F. Müller 2010. Tree Graph 2: combining and visualizing evidence from different phylogenetic analyses. BMC Bioinformatics 11(7) pp. 1471-2105 http://treegraph.bioinfweb.info/

Swofford D.L. 2003. PAUP*: Phylogenetics and analysis using parsimony (and other methods). 4.0 Beta. http://paup.csit.fsu.edu/

Tabachnick B.G., and S. Fidell 1996. Using multivariate statistics. 3rd ed. Haper Collins College Publishers, New York, NY, 880 pp.

Tamura K. 2005. Tree Explorer. http://evolgen.biol.metro-u.ac.jp/TE/TE_man.html

Tamura K., Dudley J., Nei M. and Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24(8) pp. 1596-1599 http://www.megasoftware.net/

Taylor E.B., and J.D. McPhail 2000. Historical contingency and ecological determinism interact to prime speciation in sticklebacks, Gasterosteus. Proceedings of the Royal Society of London 267(1460) pp. 2375-2384

Taylor E.B. 2004. An analysis of the homogenization and differentiation of Canadian freshwater fish faunas with an emphasis on British Columbia. Canadian Journal of Fisheries and Aquatic Sciences 61(1) pp. 68-79

Taylor E.B., and A. Aspinall 2006. Brassy minnow update. Unpublished manuscript

Taylor, E.B. 2010. Changes in taxonomy and species distributions and their influence on estimates of homogenization and differentiation in freshwater fish faunas. Diversity and Distributions 16(4) pp. 676-689

Theodorakis, C.W. 1989. Size segregation and the effects of oddity on predation risk in minnow schools. Animal Behaviour 38(3) pp. 496-502

Tonn W.M., and J.J. Magnuson 1982. Patterns in the species composition and richness of fish assemblages in northern Wisconsin lakes. Ecology 63(4) pp. 1149-1166

126

Turgeon J., and L. Bernatchez 2001. Clinal variation at microsatellite loci reveals historical secondary intergradation between glacial races of Coregonus artedi (Teleostei: Coregoninae). Evolution 55(11) pp. 2274-2286

Vander Zanden M.J., Casselman J.M., and Rasmussen J.B. 1999. Stable isotope evidence for the food web consequences of species invasions in lakes. Nature 401(6752) pp. 464-467

Vié, J.-C., Hilton-Taylor, C., and S.N. Stuart (Eds.). (2009). Wildlife in a changing world – an analysis of the 2008 IUCN Red List of threatened species. Gland, Switzerland: IUCN. 180 pp.

Walker P. 1993. A list of endemic and introduced fishes of Colorado. Colorado Division of Wildlife, Aquatic Resources Unit. Unpublished manuscript.

Wang Y., Wang Y., Lu P., Zhang F., and L. Yiming 2008. Diet composition of post-metamorphic bullfrogs (Rana catesbeiana) in the Zhoushan archipelago, Zhejiang Province, China. Frontiers of Biology in China 3(2) pp. 219-226

Waples R.S. 1991. Pacific salmon, Oncorhynchus spp. and the definition of a ‘species’ under the Endangered Species Act. Marine Fisheries Review 53(3) pp. 11-22

Ward A.J.W., Webster M.M., and Hart P.B.J. Intraspecific food competition in fishes. 2006. Fish and Fisheries 7(4) pp. 231-261

Wootton J.T., Parker M.S., and M.E. Power 1996. Effects of disturbance on river food webs. Science 273(5281) pp. 1558-1561

Whitlock M., and D. Schluter 2008. The analysis of biological data. Roberts & Co Publishers, 704 pp.

Whittier T.R., Halliwell D.B., and S.G. Paulsen 1997. Cyprinid distributions in northeast USA lakes: evidence for regional-scale minnow biodiversity loss. Canadian Journal of Fisheries and Aquatic Sciences 54(8) pp. 1593-1607

Williams J.E., Johnson J.E., and D.A. Hendrickson 1989. Fishes of North America endangered, threatened, or of special concern. Fisheries 14(6) pp. 2-20

Wilson C.C., and L. Bernatchez 1998. The ghosts of hybrids past: fixation of Arctic char (Salvelinus alpinus) mitochondrial DNA in an introgressed population of lake trout (S. namaycush). Molecular Ecology 7(1) pp. 127-132

Wilson C.C., and P.D.N. Hebert 1998. Phylogeography and postglacial dispersal of lake trout (Salvelinus namaycush) in North America. Canadian Journal of Fisheries and Aquatic Sciences 55 (7) pp. 1010-1024

127

Winemiller K.O. 2005. Life history strategies, population regulation, and their implications for fisheries management. Canadian Journal of Fisheries and Aquatic Sciences 62(5) pp. 872-885

Zampella R.A., Procopio N.A., Lathrop R.G., and C.L. Dow 1997. Relationship of land-use/land- cover patterns and surface-water quality in the Mullica River Basin. Journal of the American Water Resources Association 43(3) pp. 594-604

128

Appendix 1. Sites where brassy minnow were sampled for genetic analysis, numbers correspond to the numbers on Figure 2 and the leaves of gene trees for Figure 3-5. Number Location Tributary

1. New York Lisbon Creek, St. Lawrence River 2. Québec Risseau Charette 3. Québec Kingsmere Lake, Ottawa River 4. Ontario Gatineau River 5. Ontario Trout River 6. Michigan Lake Michigan 7. Wisconsin Wolf River 8. Wyoming Laramie River 9. Wyoming North Platte 10. Colorado South Platte 11. Saskatchewan Frenchman River 12. Alberta Musreau Lake, Peace River 13. BC, Williston Reservoir Mugaha Marsh, Peace River 14. BC, Williston Reservoir km 7 Creek, Peace River 15. BC, Williston Reservoir km 4 Creek, Peace River 16. BC, Williston Reservoir Rocky Marsh, Peace River 17. BC, Bear Lake Thorps Creek, Peace River 18. BC, Bear Lake Hart Lake, Peace River 19. BC, Bear Lake Bear Lake Hwy, Peace River 20. BC, Bear Lake Bear Lake, Peace River 21. BC, Bear Lake Bog Creek, Peace River 22. BC, Bear Lake Huble Lake, Peace River 23. BC, Summit Lake Summit Lake Hwy, upper Fraser River 24. BC, Summit Lake Neilson Lake, upper Fraser River 25. BC, Summit Lake Boot Lake, upper Fraser River 26. BC, Horsefly River Wawn Lake, mid-Fraser River 27. BC, Horsefly River Bell’s Lake, mid-Fraser River 28. BC, Lower Mainland Sumas River, lower Fraser River 29. BC, Lower Mainland Burnaby Lake, lower Fraser River 30. BC, Lower Mainland Deer Lake, lower Fraser River 31. BC, Lower Mainland Richmond, lower Fraser River 32. BC, Lower Mainland Westham Island, lower Fraser River 33. BC, Lower Mainland Delta, Lower Fraser River

129

Appendix 2. Full sequences for cyt b and ND4 loci for all brassy minnow sampled. Entries are as follows: sample name, region (number on map) (where the number on map corresponds to geographic locality on Figure 2.) Additionally, region (number on map) correspond to the branches on all gene trees. Cyt b

>Neilson1

--CATGGAGAGGTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAAAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAAATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCCG GTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTCG GGAGGTCGACTAGTGCATCATTAGCG-TTTTTATTAGTGGGTGGGTTTTTTCGTAGGCTTGCCATTA--

>Neilson2

>BurnL1

--CGTGGGGAGGTGGTCC-CGTT-TACTCGGGGGTTTGTTT-- CTTTTTCTACCGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAAAAGGACATTTGGCCCCATGGGAGAACGTATCCTACAAAGGCTGTCATTATTACTA GAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATGT GTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACGT CCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAAATGTCGGAAGTGTAGTGCATGGCTAGAAATAATCCG GTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAAATATTTGATGGTGTCG GGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAAGCTTGCCATTATT

>HWYSum

--CATGGAGAGGTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT

130

AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAAAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAAATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCCG GTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTCG GGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCATTA--

>Delta188

-TCCGGAAGAGGTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAAATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCCG GTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTCG GGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCATT---

>BootL1

-CAAATAAGAGGTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAAATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCCG GTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTCG GGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCATT---

>WawnL2

>BellL1

-CAAATAAGAGGTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT

131

AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAAATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCCG GTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTCG GGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCATT---

>BellL2

>WawnL1

>Delta388

CAAATAAGAAGTGGAA-GGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAAATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCCG GTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTCG GGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCATT---

>Sumas1

CAAATAAGAAGTGGAA-GGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT

132

>Delta288

>Delta2128

>Delta1128

>DeerL1

CAAATAGAAAGTGGAAAGGCGAATGAATCGCGTCAATGTTTGCTGTTATCTACTGAAAAGCCCCCTCAAATTCATT GCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTTGTAATAACGGTGGCACCTCAGAAGGACATTT GGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACTAGAAGAAGAAGAACAACTCCAATGTTTCAGG

133

TTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATGTGTATGTAGATACAGATGAAGAAAAAGGATG CCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACGTCCCGGCAAATGTGTGTGACGGATGAAAATG CAGTTGAAATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCCGGTTAGGATTTGAGTAATTAAGCATAACCCTA GCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTCGGGAGGTCGACTAGTGCATCATTAGCGATTTT TATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCATT---

>Musreau2

--GAAATAAGAAGGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAATTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAAATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCCG GTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTCG GGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>DeerL2

-CAAATAAAGAAGGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAAATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCCG GTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAAATATTTGATGGTGTCG GGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCATT---

>Bear5

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAAATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCCG GTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTCG GGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>Gilbert2

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT

134

>FrenchmR7

>FrenchmR6

>FrenchmR5

>West4

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT

135

>West3

>Gilbert1

>Finn2

>BogC3

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT

136

>Delta380

>Musreau1

>Hart1

>Hart2

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT

137

>FrenchmR2

>FrenchmR1

>Delta180

>Delta280

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT

138

>Huble7

>BogC2

>BogP2

>BogP3

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT

139

>BogC1

>West2

>West1

>FrenchmR4

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT

140

>FrenchmR3

>Delta480

>West5

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAAATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCCG GTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGANATATTTGATGGTGTCG GGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>Thorps6

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCCCATGGGAGAACGTAGCCTACAAAGGCTGTCATTATTACT

141

AGAAGAAGAAGAACAACTCCGATGTTTCAGGTTTCTTTGTARAGGTASGACCCGTATTATAAGCCACGGGCAATGT GTATGTARATACAGATGAARAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGATGACGT CCCGGCAAATGTGTGTGACGGATGAAAATGCWGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCCG GTTAGGATTTGAGTAATTAATCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAAATATTTGATGGTGTCG GGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>Laramie1

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGATATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGTCATTATCACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGAATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>Laramie2

>NPlatte4

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGATATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGTCATTATCACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGAATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGATTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>NPlatte5

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGATATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGTCATTATCACT

142

AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGAATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGATTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>NPlatte3

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGATATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGTCATTATCACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGAATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGATTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>NPlatte2

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGATATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGTCATTATCACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGAATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGATTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>NPlatte1

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGATATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGTCATTATCACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGAATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGATTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>Laramie3

GAAATAAGAA-GTGGAAGGCGAA-GAATCGTGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGATATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGCCATTATCACT

143

AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGAATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>SPlatte1

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGATATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGAATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>Gat1

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>Gat2

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>NYBM1

GAAATAAGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGTCATTATTACT

144

AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTGTAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAGATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>NYBM2

GAAATAGGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTATAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAAATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>Wisconsin

>NYBM3

GAAATAGGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTGTCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCTCATGGGAAAACGTANCCTACAAAGGCCGTCATTATTACT AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTATAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAAATACAGATGAAGAAAAAGGATGCCCCGTTAGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>MichAF452080

GAAATAGGAA-GTGGAAGGCGAA-GAATCGCGTCAATGTTG-- CGTTATCTACTGAAAAGCCCCCTCAAATTCATTGCACTAGGGTATCTCCCATATAAGGTACTGCTGATAGGAGATTT GTAATAACGGTGGCACCTCAGAAGGACATTTGGCCTCATGGGAGAACGTAGCCTACAAAGGCCGTCATTATTACT

145

AGAAGAAGAAGAACAACTCCAATGTTTCAGGTTTCTTTATAGAGGTAGGACCCGTAGTATAAGCCACGGGCAATG TGTATGTAAATACAGATGAAGAAGAAGGATGCCCCGTTGGCATGTATATTACGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGTGTGACGGATGAAAATGCAGTTGAGATGTCGGAGGTGTAGTGCATGGCTAGAAATAATCC GGTTAGGATTTGAGTAATTAAGCATAACCCTAGCAGTGATCCGAAGTTTCATATTGCTGAGATATTTGATGGTGTC GGGAGGTCGACTAGTGCATCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>WestSilv1

GAAAAGGGGATGTGAAAGGCGAA-CAAACGCGTTAACGTCG-- CGTTATCTACTGAAAAGCCCCCTCAGATTCATTGCACAAGGGTATCACCCATATAAGGAACTGCTGATAGAAGATT TGTAATAACGGTGGCACCTCAAAAGGACATTTGACCTCATGGGAGAACATAGCCCACAAAGGCCGTCATTATTACT AAAAGAAGTAGGACGACTCCAATGTTTCAGGTTTCCTTGTAGAGGTAAGATCCGTAGTAAAGGCCGCGGGCAATG TGCATATAAATACAGATGAAGAAAAAGGATGCGCCATTAGCATGTATGTTTCGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATATGTGTGACGGATGAGAATGCAGTTGAGATATCAGAGGTGTAGTGTATCGCTAGAAATAATCCG GTCAGGATTTGGGTAATTAAGCATAATCCTAGCAGAGATCCAAAGTTTCATATTGCTGANATATTTGATGGTGTTG GAAGGTCAACTAGTGCACCATTAACGATTTTTATTAGTGGATGGGTTTTT-CGTAGGCTTGCCAT----

>WestSilv2

GAAAAGGGGATGTGAAACCCGAA-CAAACGCGTCAACGTCG-- CGTTATCTACTGAAAAGCCCCCTCAGATTCATTGCACAAGGGTATCACCCATATAAGGAACTGCTGATAGAAGATT TGTAATAACGGTGGCACCTCAAAAGGACATTTGACCTCATGGGAAAACATATCCCACAAAGGCTGTCATTATTACT AAAAGAAGTAGGACGACTCCAATGTTTCAGGTTTCCTTGTACAGGTAAGATCCGTAGTAAAGGCCGCGGGCAATG TGCATATAAATACAGATGAAGAAAAAGGATGCGCCATTAGCATGTATGTTTCGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATATGTGTGACGGATGAGAATGCAGTTGAGATATCAGAGGTGTAGTGTATCGCTAGAAATAATCCG GTCAGGATTTGGGTAATTAAGCATAATCCTAGCAGAAATCCAAAGTTTCCCATTGCTGAAATATTTGATGGTGTTG GAAGGTCAACTAGTGCACCATTAACGATTTTTATTAGTGGATGGGTTTTT-CGTAAGCTTGCCAT----

>TurklckLux2

GGAATAGGAA-GTGGAAGGCGAA-GAATCGTGTTAGTGTTG-- CATTATCCACCGAAAAGCCCCCTCAAATTCATTGTACAAGGGTATCTCCCATATAGGGTACCGCTGATAGTAGATTT GTAATGACTGTGGCACCTCAGAAGGATATCTGCCCTCATGGGAGTACATAGCCTACAAAGGCTGTTATTATAACGA GAAGAAGTAGTACGACTCCAATATTTCAGGTTTCTTTGTAGAGGTAAGATCCGTAATAAAGGCCACGAGCAATGT GTATGTAAATACAGATGAAGAAAAATGATGCGCCGTTGGCATGTATATTTCGGATGAGTCAGCCATAATTAACATC CCGACAAATATGTGTGACGGATGAGAATGCGGTAGAAATATCAGAGGTGTAGTGTATTGCTAGAAATAAACCGGT TAGGATTTGAGTAATTAAGCATAATCCCAGTAGAGATCCGAAGTTTCATAGTGCTGAAATATTAGATGGCGTTGGG AGGTCAACTAGTGCATCATTAGCAATTTTCATCAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>QueLux1

GGAATAGGAA-GTGGAAGGCGAA-GAATCGCGTTAATGTTG-- CGTTATCTACTGAGAAGCCCCCTCAAATCCATTGCACAAGGGTGTCTCCTATGTAAGGTACTGCTGATAGGAGGTT CGTAATGACGGTGGCACCCCAGAAGGATATTTGGCCCCATGGGAGTACGTAGCCAACAAAGGCTGTCATCATAAC

146

CAGGAGAAGTAGGACGACCCCGATGTTTCAGGTCTCTTTATAAAGGTAGGATCCGTAGTAAAGGCCACGAGCAAT GTGTATGTAAATACAGATGAAGAAAAAAGATGCTCCATTGGCATGTATATTTCGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGCGTGACGGAGGAAAATGCGGTTGAGATGTCAGAGGTATAATGCATAGCTAGGAATAATCC GGTTAGGATTTGGGTAATTAGACATAATCCTAGGAGGGATCCGAAGTTTCATAGTGCTGAGATATTTGATGGTGTT GGAAGGTCAACTAGTGCACCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>QueLux5

GGAATAGGAA-GTGGAAGGCGAA-GAATCGCGTTAATGTTG-- CGTTATCTACTGAGAAGCCCCCTCAAATCCATTGCACAAGGGTGTCTCCTATGTAAGGTACTGCTGATAGGAGGTT CGTAATGACGGTGGCACCCCAGAAGGATATTTGGCCCCATGGGAGTACGTAGCCAACAAAGGCTGTCATCATAAC CAGGAGAAGTAGGACGACCCCGATGTTTCAGGTCTCTTTATAAAGGTAGGATCCGTAGTAAAGGCCACGAGCAAT GTGTATGTAAATACAGATGAAGAAAAAAGATGCTCCATTGGCATGTATATTTCGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGCGTGACGGAGGAAAATGCGGTTGAGATGTCAGAGGTATAATGCATAGCTAGGAATAATCC GGTTAGGATTTGGGTAATTAGACATAATCCTAGGAGGGATCCGAAGTTTCATAGTGCTGAGATATTTGATGGTGTT GGAAGGTCAACTAGTGCACCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>QueLux6

>QueLux8

>QueLux2

GGAATAGGAA-GTGGAAGGCGAA-GAATCGCGTTAATGTTG-- CGTTATCTACTGAGAAGCCCCCTCAAATCCATTGCACAAGGGTGTCTCCTATGTAAGGTACTGCTGATAGGAGGTT CGTAATGACGGTGGCACCCCAGAAGGATATTTGGCCCCATGGGAGTACGTAGCCAACAAAGGCTGTCATCATAAC

147

>OntLux9

>OntLux4

GGAATAGGAA-GTGGAAGGCGAA-GAATCGTGTTAATGTTG-- CGTTATCTACTGAGAAGCCCCCTCAAATTCATTGCACAAGGGTGTCTCCTATGTAAGGTACTGCTGATAGGAGGTT CGTAATGACGGTGGCACCTCAGAAGGATATTTGGCCTCATGGGAGTACGTAGCCAACAAAGGCTGTCATCATAAC CAGGAGAAGTAGGACGACCCCGATGTTTCAGGTCTCTTTATAAAGGTAGGATCCGTAGTAAAGGCCACGAGCAAT GTGTATGTAAATACAGATGAAGAAAAAAGATGCTCCATTGGCATGTATATTTCGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGCGTGACGGAGGAAAATGCGGTTGAGATGTCAGAGGTATAATGCATAGCTAGGAATAATCC GGTTAGGATTTGGGTAATTAGACATAATCCTAGGAGGGATCCGAAGTTTCATAGTGCTGAGATATTTGATGGTGTT GGAAGGTCAACTAGTGCACCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>QueLux4

GGAATAGGAA-GTGGAAGGCGAA-GAATCGTGTTAATTTTG-- CGTTATCTACTGAGAAGCCCCCTCAAATTCATTGCACAAGGGTGTCTCCTATGTAAGGTACTGCTGATAGGAGGTT CGTAATGACGGTGGCACCTCAGAAGGATATTTGGCCTCATGGGAGTACGTAGCCAACAAAGGCTGTCATCATAAC CAGGAGAAGTAGGACGACCCCGATGTTTCAGGTCTCTTTATAAAGGTAGGATCCGTAGTAAAGGCCACGAGCAAT GTGTATGTAAATACAGATGAAGAAAAAAGATGCTCCATTGGCATGTATATTTCGGATAAGTCAGCCATAGTTGACG TCCCGGCAAATGTGCGTGACGGAGGAAAATGCGGTTGAGATGTCAGAGGTATAATGCATAGCTAGGAATAATCC GGTTAGGATTTGGGTAATTAGACATAATCCTAGGAGGGATCCGAAGTTTCATAGTGCTGAGATATTTGATGGTGTT GGAAGGTCAACTAGTGCACCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>LkChub1

-GTAGGAGGAAGTGGAATGCGAA-GAACCGCGTTAGGGTTG-- CGTTGTCTACTGAGAAGCCCCCTCAAATTCACTGAACAAGGGTGTCTCCTATATAAGGGACTGCTGATAGCAGGTT GGTAATGACTGTGGCACCTCAAAAAGATATTTGTCCCCATGGGAGGACATAGCCAACAAAGGCTGTTATCATGAC

148

CAAAAGAAGTAGCACCACGCCAATATTTCAGGTTTCTTTATAAAGATAGGACCCATAGTATAGGCCGCGGGCAAT GTGTATGTAGATACAGATAAAGAAGAATGATGCTCCGTTGGCATGTAGGTTTCGGATAAGTCAGCCGTAATTTAC ATCTCGGCAAATATGGGCCACTGATGAAAATGCAGTTGAGATGTCAGAGGTATAGTGTATGGCTAGGAACAATCC TGTTAGAATTTGGGTAATTAAACATAGTCCTAGGAGGGACCCGAAGTTTCAGAGTGCTGAAATATTGGATGGTGT TGGGAGATCAACTAATGCACCATTAGCGATTTTTATTAGTGGGTGGGTTTTT-CGTAGGCTTGCCAT----

>LkChub2

-GTAGGAGGAAGTGGAATGCGAA-GAACCGCGTTAGGGTTG-- CGTTGTCTACTGAGAAGCCCCCTCAAATTCACTGAACAAGGGTGTCTCCTATATAAGGGACTGCTGATAGCAGGTT GGTAATGACTGTGGCACCTCAAAAAGATATTTGCCCCCATGGGAGGACATAGCCAACAAAGGCTGTTATCATGAC CAAAAGAAGTAGCACCACGCCAATATTTCAGGTTTCCTTATAAAGATAGGACCCATAGTATAGGCCGCGGGCAAT GTGTATGTAGATACAGATAAAGAAGAATGATGCTCCGTTGGCATGTAGATTTCGGATAAGTCAGCCGTAATTTACA TCTCGGCAAATATGGGCCACTGATGAAAATGCAGTTGAGATGTCAGAGGTATAGTGTATGGCTAGGAATAATCCT GTTAGAATTTGGGTAATTAAACATAGCCCTAGGAGGGACCCGAAGTTTCAGAGTGCTGAAATATTGGATGGTGTT GGGAGATCAACTAATGCACCATTAGCGATTTTTATTAGTGGATGAGTTTTT-CGTAGGCTTGCCAT----

>Carpcytb

GTAGTAGGAA-GTGGAATGCGAA-GAATCGTGTTAGTGTTG-- CATTGTCTACTGAGAACCCACCTCAGATTCATTGGACTAACATGTCTCCCATGTATGGTACGGCAGATAGGAGGTT TGTGATTACTGTGGCGCCTCAAAAGGATATTTGTCCTCATGGAAGAACATAGCCAACGAAGGCTGTTATCATGACT AGTAGTAGAAGGACTACACCAATGTTTCAGGTTTCTTTGTAAAGGTATGATCCGTAGTATAGGCCTCGGGCGATGT GTATGTAGATGCAAATGAAGAAGAATGATGCTCCGTTGGCGTGTACATTACGGATTAGTCAGCCGTAATTTACGTC TCGGCAGATGTGGGTAACAGATGAGAATGCGGTTGAAATGTCTGAGGTGTAGTGTATGGCTAGGAATAGGCCGG TTAAAATTTGGGTAATTAAGCATAGTCCTAGGAGGGATCCAAAGTTTCATCATGCTGAGATGTTGGATGGTGTTGG TAGGTCAACTAGTGCGTCGTTAGCGATTTTAATGAGAGGGTGTGTTTTT-CGTAGGCTTGCCAT----

ND4

>BootL2

AAAT-GG- CTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGAAG CTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCAGTCAAAACCATATTAACCCTGAACCCATT- GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>RusLux1

AAAT-- GGCTATGGACAATTACTGCCACCCATGGCCTCTTAATTGCCCTTGTAAGCCTTACATGATTTAGCTGAACTTCAGAG GCTGGATGAGCTTCATCCAACGCCTACTTAGCCACAGACCCCTTATCAACACCTCTTTTAGTCTCGACATCGCTGGC TCCTCCCCTTAATAATCTTGGCCAGCCAAAACCATATTAACCCAGAACCCATTCGCACGTCAACGTCTCTATATTACA

149

CTTCTCACTTCACTACAAGCTTTCCT-AATCATAGCCTT- CGGCGCCACAGAAATTATTATGTTTTACATTATGTTTGAA

>BurnL2

AAAT-GG- CTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGAAG CTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTGGCCAGTCAAAACCATATTAACCCTGAACCCATT- GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>DeerL1

AAAT-GG- CTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGAAG CTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTGGCCAGTCAAAACCATATTAACCCTGAACCCATT- GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>RockyM1

AAAT-- GGCTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGA AGCTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCAGGCGAAACCATATTAACCCTGAACCCATT- GGCCGGCAACGCCTGTACATCACACTTCTCACTTAAGTAAAGACTTTCTT-GAGTAAGGCCTT- CGGGGCCGCAAAAAAA-TTTTGTTCTACATAAAATGTGAA

>HWYB1

>BellL2

AAAT-- GGCTCTGAACAACTCCAGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGA AGCTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACACTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCAGGCGAAACCATATTAACCCTGAACCCCTT-

150

GGGCGGCAACGCCTGGTCATCACACTTCTCACTTCACTACAGACTTTCTT-GAGTATGGCCTT- CGGGGCGGCAAAAATCACTTTGTTCTACATCAAATTTGAA

>NPlatte2

AAAT-- GGCTATGAACAACCACCGCCACCCACGGCCTCCTAATTGCCCTTGCAAGCCTTACATGATTCAGCTGAACTTCGGA AGCTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCGGTCGAAACCATATTAACCCTGAACCCATT- GGACGGCAACGCCTATACATCACACTTTTCACTTCACTACAGACTTTCTT-GATTATGGTCTT- GGGTGCGACAAAAATCATTTTGTTCAACATCAAATTTGAA

>NPlatte3

>Thorps2

>WestSilv1

AAAT-- GATTATGAACAACTACCGCTACTCACGGCCTTTTAATTGCCCTTACAAGCCTCACATGATTCAGTTGAACTTCAGAA GCCGGGTGAACTTCATCAAACGCCTATTTAGCCACAGACCCCTTATCAACACCTCTTTTAGTCTTAACAT- GCTGGCTCCTCCCTTTAATAATCTTAGCCAGTCAAAACCATATTAACCCTGAGCCCATT- GCACGTCAACGCCTATACATCACACTTCTCACTTCACTACAAGCTTTCTT-AATTATAGCCTT- CGGCGCCACAGAGATCATCATATTCTACATTATATTTGAA

>WestSilv2

151

GCACGTCAACGCCTATACATCACACTTCTCACTTCACTACAAGCTTTCTT-AATTATAGCCTT- CGGCGCCACAGAGATCATCATATTCTACATTATGTTTGAA

>NY1

AAAT-- GGCTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGA AGCTGGGTGGACTTCATCCAACGCTTACTTAGCTACAGACCCTCTATCAACACATCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTGGCCAGGGGAAACCATATTAACCCTGAACCCATT- GCGCGTCAACGCCTATACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAAAAATCATTTTGTTCTACATCAAAGTTGAA

>NPlatte5

>NPlatte1

>Hart1

>FrenchmR1

AAAT-GG- CTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGAAG CTGAGGTGGATTCATCCAACGCCTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCAGTCAAAACCATATTAACCCTGAACCCATT-

152

GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTTAGATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>Westham2

AAAT- GGGCTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGG AAGCTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCAGTCAAAACCATATTAACCCTGAACCCATT- GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTTAGATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>Delta1128

>Bear2

>HWYB2

>BellL1

153

GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>QueLux

AAAT-- GGCTATGGACAATTACTGCCACCCATGGCCTCTTAATTGCCCTTGTAAGCCTTACATGATTTAGCTGAACTTCAGAG GCTGGATGAGCTTCATCCAACGCCTACTTAGCCACAGACCCCTTATCAACACCTCTTTTAGTCTTGACAT- GCTGGCTCCTCCCCTTAATAATCTTGGCCAGCCAAAACCATATTAACCCAGAACCCATT- GCACGTCAACGTCTCTATATTACACTTCTCACTTCACTACAAGCTTTCCT-AATCATAGCCTT- CGGCGCCACAGAAATTATTATGTTTTACATTATGTTTGAA

>BogC1

AAAT-- GGCTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGA AGCTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACACTCTATCAACACATCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCATAGCCAGGAGGAACCATATTAACCCTGAACCCATT- GGGCGGCAACTCCTGTACATCACACTTCTCAGTTAACTTAATACTTTGTT-GATTAAGGGCTT- AAATGAGGGAAAAAAATTTTTGGGCACTGACAGATTTGAA

>BogC2

>NY2

AAAT-- GGCTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGA AGCTGGGTGGACTTCATCCAACGCTTACTTAGCCACAGACACTCTATCAACACATCTTTTAGTCTTAACGT- GCTGACTCCTCCACCTAATAATCTTGGCCAGGCGAAACCATATTAACCCTGAACCCATT- GGGCGGGCGCACCTATACATCACACTTTTCACTTAGGTACAAACTTTCGT-GATTATGGCCTT-CGG- GAGGGAAAAAAAATCATGAGGAACATCAAAGGTGAA

>Neilson1

154

GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTTAGATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>FrenchmR2

>FrenchmR3

>NPlatte4

AAAT-- GGCTATGAACAACCACCGCCACCCACGGCCTCTTAATTGCCCTTGCAAGCCTTACATGATTCAGCTGAACTTCGGA AGCTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCAGTCAAAACCATATTAACCCTGAACCCATT- GCACGTCAACGCCTATACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTTTCGGCGCCA- AGAGATCATCATGTTCTACATTATATTTGAA

>Delta180

AAATTGGGCTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAAC TTCGGAAGCTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACACTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCACCCCCCTAATAATCTTAGCCGGGCGGAACCATATTAACCCTGGAACGCTG- TGGCGGCCGCGCCTGGTCCTCACACTTTTCACTTCACTTAAGAATTTCTT-GGGTAAGGCCTT- CGGGGCCACAAAAAAAATTTTGGGCTTCATCAAAGGTGAA

>Laramie1

155

GCACGTCAACGCCTATACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>Delta280

>Finn

AAAT-- GGCTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGA AGCTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACACTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCAGTCGGAACCAAATTAACCCTGAACGGCTT- GGGGGGCAGGGCCTGTCAAAAAAACTTCTAACTTCACTACGAACTTTCTT-GAGTAAGGCCTT- CGGCGCCCCAAAAACCATTTTGTTCTACATAAAAGTTAAA

>FrenchmR5

>Sumas1

AAAT-GG- CTATGAACAACTCCCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGAAGC TGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCAGTCAAAACCATATTAACCCTGAACCCATT- GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>MugahaM1

156

GCCCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>NY3

>Westham1

>SPlatte

>Sumas2

>Laramie2

157

GCACGTCAACGCCTATACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>HWYSum1

>Gat2

>Hart2

AAAT-GG- CTATGAACAACTCCCGCCACCCACGGCCTCCTAATTGCCCTCGCGAGCCTCACACGATTCAGCTGAACTTCGGAAG CTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCAGTCAAAACCATATTAACCCTGAACCCATT- GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>RusLux2

AAAT- GGGCTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGG AAGCTGGGTGGACTTCATCCAACGCTTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCAGTCAAAACCATATTAACCCTGAACCCATT- GCGCGTCAACGCCTATACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>WillistonR1

158

GCCCGGCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>OntLux

AAAT-GG- CTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGAAG CTGGGTGGACTTCATCCAACGCTTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCAGTCAAAACCATATTAACCCTGAACCCATT- GCGCGTCAACGCCTATACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>HubbleL2

AAAT-GG- CTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGTGAGCCTCACATGATTCAGCTGAACTTCGGAAGC TGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTAGCCAGTCAAAACCATATTAACCCTGAACCCATT- GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>Thorps1

>Gilbert

AAAT-- GGCTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGA AGCTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACACTCTATCAACACATCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCATGGCCGGGGGAAACCATATTAACCCTGAACCCCTT- GGGGGGCAACGCCTGTTCATCACACTTCTCAGTTCACTACGGACTTTCTT-GATTAAGGCCTT- CGGCGCCCCAAAAATCACTTTGTTCATCATAAAATGTGAA

>Winsconsin

159

GCGCGTCAACGCCTATACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAAAAATCATTTTGTTCTACATCAAAGTTGAA

>BootL1

>Gat1

>DeerL2

AAAT-GG- CTATGAACAACTACCGCCACCCACGGCCTCCTAATTGCCCTTGCGAGCCTCACATGATTCAGCTGAACTTCGGAAG CTGGGTGGACTTCATCCAACGCCTACTTAGCTACAGACCCTCTATCAACACCTCTTTTAGTCTTAACGT- GCTGACTCCTCCCCCTAATAATCTTGGCCAGTCAAAACCATATTAACCCTGAACCCATT- GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>WawnL2

>FrenchmR4

160

GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>Bear1

>Musreau2

>WawnL1

>Musreau1

>Thorps6

161

GCGCGTCAACGCCTGTACATCACACTTCTCACTTCACTACAGACTTTCTT-GATTATGGCCTT- CGGCGCCACAGAAATCATCATGTTCTACATCATATTTGAA

>Carassus

AAAT-- GACTATGAACAACTACAACCGCACACAGCCTCCTAATTGCCTCCATTAGCCTAATATGATTTAAATGAACATCTGAA ACTGGATGAACTTCCTCCAACACATACTTAGCCACAGATCCACTGTCAACACCCCTTTTAGTACTAACGT- GCTGACTACTCCCCCTTATAATTTTAGCCAGCCAAAACCACATTAACCCAGAGCCAATCAGC- CGACAACGGTTGTATATTACACTCCTAGCCTCACTACAAACCTTTCT-AATTATAGCATT- CAGTGCCACAGAAATTATTATATTTTATATTATATTTGAA

162

Appendix 3. Qualitative habitat features and position of sites sampled across the Lower Mainland. For cover, C = cut bank, LWD = large woody debris, SWD = small woody debris, B = boulders. For substrate, M = mud (silt), O = organic matter, S = fine sand, G = gravel, C = cobble. For macrophyte presence, S = submerged, O = overhanging bank vegetation, E = emergent macrophytes. Site UTMs Cover Substrate Macrophytes Present

1. Coquitlam R 10 514293 5453230 C, LWD M,O S,O 2. Katzie Slough 10 522599 5454062 LWD M,O S,E 3. Alouette R 10 524729 5458002 B M S 4. Pitt Ditch 10 525839 5462560 - M,O S 5. Sturgeon Sl 10 525839 5457648 - S,O S, E 6. S Alouette R 10 525915 5455157 B M S 7. S Alouette R 10 527496 5454306 C S,G S,O 8. S Alouette R 10 529160 5453573 C G, C, S S,O 9. Stave Slough 10 543035 5446145 C M,O S 10. Stave Slough 10 543034 5446186 LWD M,O S, E 11. Hatzic Slough 10 555789 5444856 - M,O S 12. Hatzic Lake 10 555811 5444916 B M S 13. Chilqua Slough 10 556861 5446611 B M,O S, E 14. Upper Hatzic 10 555643 5448168 B S S 15. Upper Hatzic 10 554810 5448753 LWD, SWD S S 16. Upper Hatzic 10 554807 5450043 - M, O S, E 17. Lower Hatzic 10 556552 5444119 - M,O S 18. Nicomen Sl 10 558917 5444802 B, LWD S, C S 19. Nicomen Sl 10 558917 5444337 LWD, SWD S,O S 20. Sumas River 10 562961 5437811 C, B M,O S 21. Sumas River 10 562952 5437796 C, B, LWD M,O S 22. Vedder Canal 10 567383 5434034 SWD S, G S 23. Sumas River 10 559921 5434034 LWD M,O S 24. Saar Creek 10 559273 5429652 - M,O S,E,O 25. Sumas River 10 556908 5429644 LWD M,O S,E,O 26. Marshall Creek 10 554829 5430695 B, LWD M, O, G S, E,O 27. Sumas River 10 557099 5430781 B M,O S,E,O 28. Sumas River 10 557100 5430792 - M S,O 29. Woodward S 10 491623 5440931 SWD M,O S,O 30. Woodward S 10 4914115 5440031 SWD M,O S 31. No3 Ditch 10 490009 5440031 - M,O S,E,O 32. No3 End D 10 489561 5439802 B M,O,G S,E 33. Gilbert Slough 10 489222 5440723 - M,O S,E,O 34. Gilbert-Finn S 10 489220 5440724 C M,O S,E

163

Site UTMs Cover Substrate Macrophytes Present

35. Deas Slough 10 489222 5440722 C, LWD M - 36. Crescent S 10 494771 5439075 B, SWD M,O S,O 37. NW Tamboline 10 488733 5437557 C M,O S,E 38. SW Tamboline 10 488735 5437559 - M,O S 39. London Slough 10 488063 5437527 - M,O S,E 40. 80Rd Ditch W 10 499858 5437440 B,C M,O S,E,O 41. 80Rd Ditch E 10 499881 5437423 C M,O S,E,O 42. 88Rd Slough E 10 501500 5438424 - M,O S,O 43. 88Rd Slough W 10 501489 5436644 SWD M,O S,O 44. 128 Rd Ditch 10 506783 5438424 - M,O S,O 45. Delta GC Ditch 10 507493 5438735 SWD M,O S,E,O 46. Deer Lake Dock 10 502489 5453564 LWD M,G,O S,E 47. Deer Lake PN 10 502491 5453498 LWD,SWD M,O S,E 48. Deer Lake Inlet 10 501828 5453590 - S,G,O,M S,E 49. Beaver Creek 10 501573 5453819 - M,O S,E,O 50. Deer Lake End 10 501735 5453932 LWD M,O S,E 51. Owl Creek 10 501657 5453933 SWD M,O S,E,O 52. Deer Lake Out 10 502253 5453945 B, SWD M,O S,E 53. Deer Lake Brk 10 502865 5454350 B,C, SWD M,O S,O 54. Pavilion Creek 10 502844 5454375 - M,O S,O 55. Burnaby Lake 10 503015 5454745 LWD M,O S,E 56. Still Creek B 10 502678 5455563 - M,O S,O 57. Eagle Creek 10 504714 5454503 SWD G,S,O S,O 58. Burnaby Lake 10 504702 5454400 - M,O S,E 59. Cariboo Dam 10 505995 5454947 SWD,LWD M,O S,E 60. Brunette 10 505995 5454954 SWD, LWD M,O S,E

164

Appendix 4. Sites and tributaries in BC where brassy minnow were sampled. Region - Site Description Tributary UTMs

Lower Fraser River

1. No 3 Road, Abbotsford Sumas River 10 562961 5437811

2. No3 Road, Abbotsford Sumas River 10 562952 5437796

3. Vyes Road, Yarrow Saar Creek 10 559273 5429652

4. Vyes Road, Yarrow Sumas River 10 556908 5429652

5. Whatcom Road, Yarrow Sumas River 10 557099 5430781

6. No 3 Road End, Richmond No3 Ditch 10 489561 5439802

7. Gilbert & Finn, Richmond Gilbert Slough 10 489222 5440723

8. NE Tamboline, Westham Isl Tamboline Slough 10 488733 5437557

9. SW Tamboline, Westham Isl Tamboline Slough 10 488735 5437559

10. London Slough, Westham Isl London Slough 10 488063 5437527

11. 80 Road, Delta 80Rd Ditch 10 499858 5437440

12. 88 Road West, Delta 88Rd Slough 10 501500 5436640

13. 88 Road East, Delta 88Rd Slough 10 501489 5436644

14. 128 Road, Delta 128Rd Ditch 10 506783 5438424

15. Boat Rental Dock, Burnaby Deer Lake 10 502489 5453564

16. Third Point Inlet, Burnaby Deer Lake 10 501828 5453590

17. Beaver Creek, Burnaby Beaver Creek 10 501573 5453819

18. Owl Creek, Burnaby Owl Creek 10 501657 5453933

19. Log Site, Burnaby Deer Lake 10 501735 5453932

20. Deer Lake Brook, Burnaby Burnaby Lake 10 502865 5454350

165

Region – Site Description Tributary UTMs

21. Pavilion Trail, Burnaby Pavilion Creek 10 502844 5454375

22. Rowing Club Pier, Burnaby Burnaby Lake 10 503015 5454745

23. Eagle Creek, Burnaby Eagle Creek 10 504714 5454503

24. Turner Loat, Burnaby Burnaby Lake 10 504702 5454400

25. Cariboo Dam, Burnaby Brunette River 10 505995 5454947

26. Cariboo Dam, Burnaby Burnaby Lake 10 505995 5454954

Upper Fraser River

27. Boot Lake, Prince George Boot Lake 10 5418526 122444

28. Boot Lake, Prince George Boot Lake 10 5418526 1224413

29. Neilson Lake, Prince George Neilson Lake 10 522717 6018683

30. Neilson Lake, Prince George Neilson Lake 10 524455 6017976

31. Highway 97, Prince George Hwy97 Marsh 10 520718 6037945

32. Highway 97, Prince George Hwy97 Marsh 10 520690 6037938

Peace River

33. Rocky Marsh, Williston Res Rocky Marsh 10 493673 6121725

34. Km4 Causeway, Williston Res Km4 Marsh 10 492572 6125420

35. Km4 Causeway, Williston Res Km4 Marsh 10 492555 6125392

36. Km7 Causeway, Williston Res Km7 Marsh 10 489578 6135547

37. Km7 Causeway, Williston Res Km7 Marsh 10 489557 6135535

38. Mugaha Marsh, Williston Res Mugaha Marsh 10 486680 6139035

Mid-Fraser River

39. Wawn Lake, Horsefly Wawn Lake 10 613228 5801945

40. Bell’s Lake Rd, Horsefly Bell’s Lake Marsh 10 598250 5792896

166

Appendix 5. Brassy minnow monthly presence at sites. Sumas River

Site June July Aug Sept Oct Nov Dec Jan Feb March April May

No3 0 0 0 0 1 0 0 0 0 0 0 0

Saar 1 0 0 0 0 0 0 0 0 0 0 0

Vyes 0 0 0 0 0 6 0 0 0 0 0 0

Whatcom 0 0 0 0 0 1 0 0 0 0 0 0

Richmond

Site June July Aug Sept Oct Nov Dec Jan Feb March April May

No3 0 1 0 0 1 0 0 0 0 0 0 0

Gilbert 0 6 0 0 1 0 0 3 0 0 0 0

Finn 0 0 0 0 0 0 13 0 0 0 0 0

Westham Island

Site June July Aug Sept Oct Nov Dec Jan Feb March April May

Tamb NE 661 0 0 0 16 0 0 0 0 10 3 1

Tamb SW 772 0 0 8 1 0 0 9 1 0 1 25

London 2 0 0 0 1 0 0 0 2 0 4 12

Delta

Site June July Aug Sept Oct Nov Dec Jan Feb March April May

80St W 1 0 0 0 0 0 0 0 0 0 0 0

80St E 0 0 0 0 0 0 0 0 1 0 0 0

88St W 0 0 0 0 2 0 1 0 0 8 0 0

88St E 9 0 0 0 0 6 18 2 6 16 5 0

128St 41 12 6 0 6 4 0 0 3 1 5 1

167

Deer Lake

Site June July Aug Sept Oct Nov Dec Jan Feb March April May

Dock 30 0 0 0 0 1 3 0 0 0 0 0

Beaver 0 0 0 0 0 11 55 0 0 0 0 0

Log 0 0 0 0 0 1 3 0 0 0 0 0

Owl 0 0 0 0 0 1 122 0 0 0 0 0

Burnaby Lake-Brunette River

Site June July Aug Sept Oct Nov Dec Jan Feb March April May

Deer Bk 0 0 0 0 0 0 0 0 0 0 0 6

Pavilion 0 0 0 0 1 47 10 11 18 0 0 0

Rowing 0 0 1 0 3 0 0 0 0 0 0 0

Eagle Ck 0 0 0 22 0 0 0 0 0 1 0 0

Nature 0 0 0 3 0 0 0 0 0 0 0 0

Cariboo 0 0 0 3 0 0 0 0 0 0 0 7

168

Appendix 6. Durbin-Watson test for autocorrelation for repeated temporal sampling for brassy minnow across 25 sites for one year (DW of 2 is no autocorrelation, near 0 = positive autocorrelation, and 4 = negative autocorrelation). Bolded p-values are significant for lagged sampling autocorrelation if sampling of brassy minnow in more than one month. Site Durbin-Watson Statistic Autocorrelation p

Sumas No.3 2.1818 - 0.0985 0.6277 1

Saar Creek 1.0909 -0.0076 0.0425 1

Vyes Sumas 2.1818 -0.0985 0.6277 1

Whatcom 2.1818 -0.0985 0.6277 1

Richmond No3 2.4 -0.2167 0.7650 2

Gilbert Road 2.4424 -0.2397 0.7884 3

Finn & Gilbert 2.1818 -0.0985 0.6277 1

NW Tamboline 1.1008 -0.0125 0.0440 5

SE Tamboline 1.1029 -0.0110 0.0448 7

London Slough 0.7107 0.2472 0.0042 5

80 St west 1.0909 -0.0076 0.0425 1

80 St east 2.1818 -0.0985 0.6277 1

88 St east 2.34229 -0.1854 0.7312 3

88 St west 1.76377 0.0713 0.3359 7

128 St 0.70963 0.2198 0.0042 9

Deer Lk Dock 1.12331 -0.0201 0.0491 3

Beaver Creek 1.8260 0.0761 0.3777 2

Deer Lk Log 1.8 -0.1167 0.3600 2

Owl Creek 2.167165 -0.0913 0.6176 2

Deer Lk Brook 1.0909 -0.0076 0.0425 1

Pavilion Creek 1.817111 0.0667 0.3716 5

169

Site Durbin-Watson Statistic Autocorrelation p

Burnaby Lake 2.30769 -0.1667 0.7100 2

Eagle Creek 2.19996 -0.1083 0.6399 2

Turner Loat 2.18181 -0.0985 0.6277 1

Cariboo Dam 1.34899 -0.0643 0.1156 2

170

Appendix 7. Habitat measures for 37 sites in the Lower Mainland that were used as parameter inputs for brassy minnow predictive habitat model.

Site Depth Max temp pH Conductivity Turbidity DO Velocity

(cm) (:C) (µS/cm) (NTU) (% O2) (m/s)

Coquitlam R 51 19 6.27 119 18.4 38.8 0

Katzie Sl 50 20 6.21 198 5.73 1.5 0

Alouette R 40 21 6.32 32 0.89 80.1 0.01

Pitt D 25 21 6.26 32 32.8 57.2 0

Sturgeon Sl 36 21 6.27 21 0.26 82.1 0

S Alouette R 40 19 6.26 36 4.71 80.2 0

S Alouette R 30 18 6.43 39 2.94 91 0.20

S Alouette R 53 16 6.50 31 - 0.06 94.7 0.90

Stave Sl 65 22 6.10 72 14.3 32.5 0

Hatzic L 67 23.5 6.70 105 12.9 76.1 0.07

Chilqua Sl 56 20 6.89 85 8.16 71.2 0.50

U Hatzic Sl 70 20 6.90 107 4.54 83.5 0

L Hatzic Sl 44 21 6.56 105 9.67 80.1 0

Nicomen Sl 59 22 6.75 83 2.93 93.6 0

Sumas R 55 25 8.88 266 14.7 183 0.02

Vedder R 33 18 7.88 72 0.40 97.8 0.45

Sumas R 86 22 8.06 307 4.33 115 0

Saar Ck 66 20 6.70 275 9.73 21.8 0.03

Marshall Ck 73 21 7.10 302 10.23 68.2 0.26

Sumas R 63 20 7.55 109 1.11 81.3 0.13

Woodward Sl 23 21 6.82 230 6.82 39 0.01

No3 D 19 21 6.95 980 4.73 54.3 0

171

Site Depth Max temp pH Conductivity Turbidity DO Velocity

(cm) ( (µS/cm) (NTU) (% O2) (m/s)

Gilbert Sl 77 21 7.03 675 6.13 80.1 0

Crescent Sl 70 19 7.40 422 13.6 99.8 0.01

Tamboline Sl 100 21 7.33 2060 4.68 86.9 0

80 Road D 35 20 6.82 1785 11 3.1 0

88 Road Sl 113 20 7.32 780 4.55 117.2 0.07

128 Road D 33 22 5.42 744 24.5 32.2 0

Delta D 45 22 6.13 208 9.45 11.4 0

Deer Lk 110 23 7.19 239 3.84 69.1 0

Beaver Ck 76 20 6.82 104 3.50 20.3 0.02

Owl Ck 78 19 6.09 101 3.03 31 0.01

Deer Lk B 71 21 6.87 238 3.52 72.4 0.01

Burnaby Lk 65 21 6.65 246 6.15 25.4 0

Still Ck 135 21 6.31 94 8.85 51.3 0.01

Eagle Ck 54 18 7.11 171 5.29 75.6 0.01

Cariboo D 88 21 6.62 233 6.91 13.6 0.01

172

Appendix 8. Inter-correlations between parameters of site habitat measures across the Lower Mainland. Inter-correlations in the matrix in excess of r = 0.70 can cause errors in predictions in log-regression based habitat models. The plots show the degree of inter-correlation between parameters.

Multivariate Correlations

Depth (cm) Max T(C) pH Cond microS/cm DO (NTU) Velocity (m/s)

Depth (cm) 1.0000 0.1752 0.2269 0.1106 0.1049 -0.1147

Max T(C) 0.1752 1.0000 0.1850 0.0922 0.1143 -0.5219 pH 0.2269 0.1850 1.0000 0.1698 0.6805 0.1030

Cond microS/cm 0.1106 0.0922 0.1698 1.0000 -0.0791 -0.1916

DO (NTU) 0.1049 0.1143 0.6805 -0.0791 1.0000 0.2291

Flow (m/s) -0.1147 -0.5219 0.1030 -0.1916 0.2291 1.0000

173

Scatterplot Matrix 140 100 60 Depth (cm) 20 25

22 Max T(C) 19 16 8.5 7.5 pH 6.5 5.5 2000 1500

500 Cond microS/cm 200 150 100 DO (NTU) 50

0.9 0.6 0.3 Flow (m/s) 0

20 60 100 14016 19 22 25 5.5 6.5 7.5 8.5 500 1500 50 100 2000 .2 .4 .6 .8 1

174

Appendix 9. Variance inflation factors (VIFs) for exploring the inter-correlation between parameters of site habitat measures across the Lower Mainland. Values for VIFs between parameters that approach 5.00 are considered to be inter-correlated, which can cause errors in log-regression based habitat models via inflated standard errors.

Variance Inflation Factor

Depth

Term Estimate Std Error t Ratio p>t VIF

Intercept -34.564 83.789 -0.41 0.6829 -

Max Temp 2.84233 3.43328 0.83 0.4143 1.67865 pH 6.78813 10.4958 0.65 0.5227 2.23182

Conductivity 0.003657 0.01066 0.34 0.7341 1.15172

DO -0.033519 0.17378 -0.19 0.8484 2.09808

Velocity -10.65867 31.04775 -0.34 0.7338 1.59526

Turbidity -0.947254 0.737865 -1.28 0.2090 1.24435

Max Temperature

Term Estimate Std Error t Ratio p>t VIF

Intercept 15.89165 3.332609 4.77 <0.001 -

Depth 0.007858 0.009492 0.83 0.4143 1.120558 pH 0.5443051 0.546751 1.00 0.3274 2.19057

Conductivity -0.000223 0.00056 -0.40 0.6937 1.150172

DO 0.0054154 0.00909 0.60 0.5558 2.076127

Velocity -4.602292 1.403392 -3.28 0.0026 1.178911

Turbidity 0.0720269 0.037616 1.91 0.0651 1.169760

175

Term Estimate Std Error t Ratio p>t VIF

Intercept 4.7695682 1.161545 4.11 0.0003 -

Depth 0.0020257 0.003132 0.65 0.5227 1.130397

Max Temp 0.0587526 0.059017 1.00 0.3274 1.662094

Conductivity 0.0003053 0.000176 1.73 0.0931 1.0508546

DO 0.0107926 0.002267 4.76 <0.001 1.196819

Velocity 0.1749969 0.53645 0.33 0.7465 1.59587

Turbidity -0.015326 0.01279 -1.20 0.2402 1.2527547

Conductivity

Term Estimate Std Error t Ratio p>t VIF

Intercept -1.075.57 1422.129 -0.76 0.4554 -

Depth 1.067267 3.112904 0.34 0.7341 1.1416845

Max Temp -23.52722 59.1628 -0.40 0.6937 1.707999 pH 298.5484 172.1259 1.73 0.0931 2.056693

DO -3.674228 2.893922 -1.27 0.2140 1.9935715

Velocity -440.7532 525.3158 -0.84 0.4081 1.5648118

Turbidity 6.987944 12.88388 0.54 0.5916 1.2999715

176

Term Estimate Std Error t Ratio p>t VIF

Intercept -246.6235 75.87818 -3.25 0.0028 -

Depth -0.03695 0.191573 -0.19 0.8484 1.144738

Max Temp 2.1592806 3.624295 0.60 0.5558 1.6969252 pH 39.86743 8.37565 4.76 <0.001 1.2892565

Conductivity -0.013878 0.010931 -1.27 0.2140 1.0972753

Velocity 36.32758 31.98163 1.14 0.2650 1.535492

Turbidity 0.0539194 0.795646 0.07 0.9464 1.3125179

Velocity

Term Estimate Std Error t Ratio p>t VIF

Intercept 1.0862261 0.451571 2.41 0.0225 -

Depth -0.000367 0.001069 -0.34 0.7338 1.1416729

Max Temp -0.057338 0.017484 -3.28 0.0026 1.2639114 pH 0.0201982 0.061917 0.33 0.7465 2.2549407

Conductivity -0.000052 0.000062 -0.84 0.4081 1.1297251

DO 0.0011351 0.000999 1.14 0.2650 2.0140698

Turbidity -0.000728 0.004446 -0.16 0.8711 1.3115477

177

Turbidity

Term Estimate Std Error t Ratio p>t VIF

Intercept -0.32253 20.24474 -0.02 0.9874 -

Depth -0.054975 0.042823 -1.28 0.2090 1.0864715

Max Temp 1.5119729 0.789636 1.91 0.0651 1.5300167 pH -2.980523 2.487247 -1.20 0.2402 2.1595697

Conductivity 0.0028387 0.002562 0.54 0.5916 1.1450069

DO 0.0028387 0.041888 0.07 0.9464 2.1003696

Velocity -1.226034 7.490953 -0.16 0.8711 1.600102

178

Appendix 10. Overall relative abundance of all species sampled using both minnow trap and seining methods for one year of sampling in the Lower Mainland. Species Trap Totals Seining Totals Abundance

Three spine stickleback (Gasterosteus aculeatus) 6247 699 0.4552

Brassy minnow (Hybognathus hankinsoni) 2053 110 0.1418

Bullfrog tadpoles (Lithobates catesbieanus) 1584 116 0.1114

Brown bullhead (Ameiurus nebulosus) 369 1311 0.1101

Prickly sculpin (Cottus asper) 1067 51 0.0733

Common carp (Cyprinis carpio) 336 144 0.0315

Pumpkinseed sunfish (Lepomis gibbosus) 354 92 0.0292

Redside shiner (Richardsonius balteatus) 197 18 0.0141

Unidentified tadpoles 175 0 0.0115

Smallmouth bass (Micropterus dolomieu) 6 68 0.0048

Black crappie (Pomoxis nigromaculatus) 46 24 0.0046

Northern pikeminnow (Ptychocheilus oregonensis) 49 5 0.0035

Coho salmon (Oncorhynchus kisutch) 47 0 0.0031

Largemouth bass (Micropterus salmoides) 3 33 0.0024

Long-toed salamander (Ambystoma macrodactylum) 23 0 0.0015

Coastal cutthroat trout (Oncorhynchus clarkii clarkii) 17 2 0.0012

Pea mouth chub (Mylocheilus caurinus) 4 3 0.0005

Yellow bullhead (Ameiurus natalis) 0 7 0.0005

Largescale sucker (Catostomus macrocheilus) 3 0 0.0002

Rainbow trout (Oncorhynchus mykiss) 2 0 0.0001

Chum salmon (Oncorhynchus keta) 1 0 0.0001

179

Species Trap Totals Seining Totals Abundance

Pacific lamprey (Lampetra tridentata) 1 0 0.0001

Pacific staghorn sculpin (Leptocottus armatus) 1 0 0.0001

Totals 12582 2676 1.000

180

Appendix 11. Mean growth for each species (in grams) per treatment.

Brassy minnow growth

Treatment: Alone All Redside Bullhead

0.51 0.29 0.04 Died

0.26 0.51 0.11 0.04

0.50 0.05 0.02 0.02

0.11 0.07 0.15 0.18

0.29 0.02 Died 0.21

0.11 Died 0.03 Died

0.12 0.23 0.02 -0.07

0.19 0.15 0.06 -0.26

0.02 Died 0.03 -0.11

0.18 -0.03 0.05 0.10

0.11 Died -0.03 0.08

0.15 -0.07 -0.33 Died

0.08 -0.32 0.05 0.03

0.12 0.02 0.08 0.16

0.11 Died 0.06 Died

Mean Growth: 0.19 0.08 0.02 0.03

181

Redside shiner growth

Treatment: Alone All Brassy Bullhead

0.29 0.56 0.66 0.86

0.69 0.58 0.87 0.80

0.30 1.22 1.32 0.91

0.50 1.09 0.49 0.72

0.63 1.49 0.86 0.97

0.98 0.68 0.94 0.84

0.04 0.85 0.67 0.51

0.58 0.87 0.79 0.95

0.40 1.12 0.60 0.79

0.44 0.68 0.71 0.61

0.52 0.88 0.63 0.97

0.69 1.04 1.27 1.15

0.35 0.67 0.73 0.47

0.72 0.91 0.84 0.88

0.78 1.01 0.88 0.83

Mean Growth: 0.53 0.91 0.81 0.81

182

Brown bullhead growth

Treatment: Alone All Brassy Redside

0.07 0.25 0.38 0.18

0.11 0.22 0.39 0.26

0.22 0.44 0.15 0.33

0.04 0.02 0.14 0.24

0.08 0.03 0.53 0.01

0.02 0.08 0.42 0.16

0.03 0.01 0.14 0.08

0.08 0.06 0.61 0.15

0.19 0.02 0.17 0.13

0.05 0.09 0.06 0.06

0.15 0.03 0.11 0.06

0.23 0.08 0.06 0.05

0.10 0.78 0.10 0.22

0.17 0.06 0.07 0.05

0.26 0.33 0.29 0.03

Mean Growth: 0.12 0.17 0.24 0.13

183

Appendix 12. JMP 4 outputs for assumption tests for one-way ANOVA. Mean individual growth

Species Mean Growth (g) Standard Error Standard Deviation

Brassy minnow 0.0638333 0.0236895 0.1834979

Redside shiner 0.7680000 0.0342422 0.2652393

Brown bullhead 0.1655000 0.0202044 0.1565023

Shapiro-Wilk test of normality

Species W Prob

Brassy minnow 0.869009 <0.0001 Normal distribution

Redside shiner 0.992995 0.9955 Not normal

Brown bullhead 0.819955 <0.0001 Normal distribution

Test for equal variances

Species Test F-Ratio DF Num DF Den Prob>F Conclusion

Brassy minnow Bartlett’s 2.5337 3 - 0.0550 Variances equal

Redside shiner Levene’s 0.6289 3 56 0.5994 Variances unequal

Brown bullhead Bartlett’s 5.7435 3 - 0.0006 Variances equal

Welch’s ANOVA

Species F-Ratio DF Num DF Den Prob>F

Brassy minnow 5.0350 3 30.059 0.0060

Redside shiner 7.0424 3 30.831 0.0010

Brown bullhead 1.8964 3 29.416 0.1520

184