Gene Knockdown Studies Revealed CCDC50 As a Candidate Gene in Mantle Cell Lymphoma and Chronic Lymphocytic Leukemia

Gene knockdown studies revealed CCDC50 as a candidate gene in mantle cell lymphoma and chronic lymphocytic leukemia

A Farfsing1, F Engel1, M Seiffert1, E Hartmann2, G Ott2,5, A Rosenwald2, S Stilgenbauer3,HDo¨hner3, M Boutros4, P Lichter1 and A Pscherer1

1Division of Molecular Genetics, German Cancer Research Center (DKFZ), Heidelberg, Germany; 2Institute of Pathology, Junior Research Group ‘Functional Genomics‘, University of Wurzburg, Wurzburg, Germany; 3Department of Internal Medicine III, University hospital Ulm, Ulm, Germany; 4Division of Signaling and Functional Genomics, German Cancer Research Center (DKFZ) and University of Heidelberg, Heidelberg, Germany and 5Institute of Clinical Pathology, Robert-Bosch-Hospital, Stuttgart, Germany

The two B-cell non-Hodgkin’s lymphoma entities, chronic 45, 17 and 14% of cases, respectively.14 Candidate genes within lymphocytic leukemia (CLL) and mantle cell lymphoma (MCL), these chromosomal regions have been proposed by various groups show recurrent chromosomal gains of 3q25–q29, 12q13–q14 and 18q21–q22. The pathomechanisms affected by these on the basis of profiling data acquired on different microarray aberrations are not understood. The aim of this study was to platforms (single-nucleotide polymorphism array, array compara- 7–13,15–24 identify genes, located within these gained regions, which tive genomic hybridization, expression array). Gains of control cell death and cell survival of MCL and CLL cancer cells. genomic DNA may activate oncogenes through gene dosage Blood samples collected from 18 patients with CLL and 6 effects,20,22 such as CDK4 (cyclin-dependent kinase-4) on 12q13 patients with MCL, as well as 6 cell lines representing both and B-cell lymphoma-2 (BCL2) on 18q21 in MCL.1,8,11,15,18,25 It malignancies were analyzed by gene expression profiling. By a comparison of genomic DNA and gene expression, 72 candi- was recently shown that highly proliferative and clinically date genes were identified. We performed a limited RNA aggressive variants of MCL have a complex karyotype with 11,22,26 interference screening with these candidates to identify genes frequent gains on 3q and 12q. Furthermore, the chromoso- affecting cell survival. CCDC50 (coiled coil domain containing mally gained region, 3q25–q29, shows an association with poor protein 50), SERPINI2 and SMARCC2 mediated a reduction of outcome in MCL patients.22 cell viability in primary CLL cells as well as in cell lines. Gene Chronic lymphocytic leukemia is the most common leukemia knockdown and a nuclear factor kappa B (NFjB) reporter gene assay revealed that CCDC50 is required for survival in MCL and among adults of the western world, with a variable survival time CLL cells and controls NFjB signaling. between ca. 3 and 20 years. CLL is characterized by the Leukemia (2009) 23, 2018–2026; doi:10.1038/leu.2009.144; accumulation of mature, but resting B cells in peripheral blood, published online 30 July 2009 bone marrow and lymphatic or extralymphatic tissues. The Keywords: B-cell chronic lymphocytic leukemia; mantle cell majority of leukemic CLL cells are arrested in the cell cycle, lymphoma; siRNA screen; functional assays in primary CLL cells; mainly in the G0/G1 phase.27,28 Unlike other leukemias, there is CCDC50 only a small proportion of proliferating neoplastic cells that are localized in the so-called ‘pseudofollicular’ proliferation centers Introduction in the lymph nodes or are scattered in the bone marrow of the patients.29,30 The most frequently recurring chromosomal gain, Chronic lymphocytic leukemia (CLL) and mantle cell lymphoma identified in CLL patients, is trisomy 12.27 (MCL) are B-cell non-Hodgkin’s lymphoma subtypes that share The aim of this study was to identify genes with oncogenic patterns of genetic aberrations. The median survival time of potential in recurrently gained chromosomal regions of MCL patients with MCL was reported to be 3–5 years after diagnosis.1 and CLL. To this aim, gene expression profiling was performed, A criterion for diagnosis of MCL is the translocation followed by cell survival and proliferation studies after silencing t(11;14)(q13;q32), resulting in the overexpression of the cyclin of candidate genes. First, we profiled the expression of 18 D1 gene.2–5 In addition to the t(11;14), MCL carries a high primary CLL, 6 primary MCL samples, as well as 6 cell lines, and number of secondary genetic alterations that may contribute to compared all genes identified in the three gained regions (3q, its pathogenesis. Several studies reported the high resolution 12q and 18q) with recently published data. Second, we detection of chromosomal imbalances in MCL using array investigated a set of 72 candidate genes derived from this comparative genomic hybridization,6 accurately defining the analysis by the use of a small interfering RNA (siRNA)-mediated gained regions.7–13 However, these regions still contain too loss of function screen in a multiwell format in MCL cell lines. many genes to enable a reasonable selection of candidates, and Third, we validated the observed changes in cell viability by it is not clear which genes have functional relevance for MCL. gene knockdown in primary CLL cells and analyzed the Recently, the incidence of genomic gains in t(11;14)(q13;q32)- downstream effects of the identified candidate gene, CCDC50 positive MCL cases was assessed by fluorescence in situ (coiled coil domain containing protein 50). hybridization analysis, revealing gains on 3q, 12q and 18q in

Correspondence: Professor Dr P Lichter, Division of Molecular Materials and methods Genetics, German Cancer Research Center, Im Neuenheimer Feld 280, Heidelberg 69120, Germany. E-mail: [email protected] Cell lines Received 4 June 2009; accepted 12 June 2009; published online 30 Cell lines were obtained from DSMZ (Braunschweig, Germany) July 2009 and from ATTC (American Type Culture Collection, Manassas, CCDC50 as candidate gene in MCL and CLL A Farfsing et al 2019 VA, USA). Granta (ACC 342), Mec-1 (ACC 497) and HEK-293T RNA isolation, synthesis of cDNA, quantitative (Human embryonic kidney 293-T cells, CRL-1573) cells were real-time PCR and flow cytometry cultured in DMEM (Dulbecco’s modified Eagle’s medium) RNA isolation of primary CLL cells and cell lines was performed (Invitrogen, Karlsruhe, Germany). JVM-2 (Human peripheral using the RNeasy Mini Kit (Qiagen, Hilden, Germany). cDNA blood B-cell lymphoma cell line, ACC 12) and LCL-WEI synthesis, quantitative real-time (qRT)-PCR and flow cytometry (Human lympoblastoid B cells, ACC 218) were cultured in of cells were performed as published earlier.32–35 RPMI 1640 medium, including 2 mML-glutamine (Invitrogen, Carlsbad, CA, USA). Both media were supplemented with 10% fetal calf serum and 1% penicillin/streptomycin. siRNA The chemically synthesized siRNAs siCONTROL Non-Targeting Primary cells siRNA Pool 2 (D-001206-14-05) and ON-TARGETplus siCON- TROL Non-targeting Pool (D-001810-10-05) were obtained Peripheral blood samples were collected from patients with CLL from Dharmacon Inc. (Chicago, IL, USA). The siRNAs for and MCL, as well as from healthy donors after informed consent CCDC50 (siCCDC50 1:ID129977, siCCDC50 2: ID129978, was obtained from them (Supplementary Tables S1–S6). All siCCDC50 3: ID129979), Silencer Firefly Luc GL2/3 (AM4629), cases matched standard diagnostic criteria.31 The human bone Negative Control 1 (AM4636) and Silencer Select negative marrow stromal cell line, HS-5, was purchased from the ATCC. control (4390844) were obtained from Ambion Inc. The Cells were cultured and prepared as published earlier.32 negative control Control_AllStars_1 (SI03650318), as well as the 72 siRNA pools for the RNA interference screen, were Nucleofection of cell lines and primary CLL cells obtained from Qiagen. Information about individual siRNA Using the Human B-cell Nucleofector Kit and program U-015, sequences used in the screening can be found in Supplementary 6 5 10 primary B cells were transfected with 500 nM siRNA (in Table S10. 100 ml volume), according to the manufacturer’s instructions (Lonza, Cologne, Germany). After nucleofection, primary cells were added to a sterile filtered conditioned medium, obtained Western blot analysis from HS-5 cells, and cultured as published earlier.32 Transfec- Transfected CLL cells were harvested by centrifugation tions of cell lines were performed by nucleofection (solution T, (800 r.p.m., 10 min, room temperature). Cell pellets were lysed program O-017), according to the manufacturer’s instructions, and protein extracts were purified using the All Prep RNA/ 6 using 2 10 cells and 2 mg DNA or 500 nM siRNA (in 100 ml Protein Kit (Qiagen). Western blot analysis was carried out as volume). Cells were harvested 24, 48 and 72 h after transfection published previously.34 After immunoblotting, polyvinylidene for RNA isolation and functional assays. Using 96-well Shuttle fluoride membranes were probed with primary antibodies system with the 96-well Nucleofector Kit SF and program specific for CCDC50 (HPA001336, Sigma Aldrich, St Louis, 96-DN-100, a total of 4 105 cells of the cell lines JVM-2 or MO, USA) and GAPDH (glyceraldehyde-3-phosphate dehydro- Granta-519 were transfected with 500 nM siRNA (in 20 ml genase) (CB1001, Calbiochem, Darmstadt, Germany). Second- volume), according to the manufacturer’s instructions (Lonza). ary antibodies used were anti-rabbit HRP (horseradish peroxidase) and anti-mouse HRP (Cell Signaling Inc., Danvers, MA, USA). Transfection of HEK-293T cells 5 A total of 4 10 HEK-293T cells were transfected with 50 nM m siRNA or 2.5 g plasmid DNA using the TransIT transfection Cell viability assay reagent, according to the manufacturer’s instructions (Mirus Bio The viability of transfected cells was assayed using the Cell Titer LLC, Madison, WI, USA). Glo Cell Viability Assay (Promega, Madison, WI, USA) in opaque-walled multiwell plates (Costar, Baar, Germany). At 24, Cloning of short hairpin coding plasmids 48 and 72 h after transfection, an aliquot of 100 ml of cell The plasmid pSUPERdL_Zeo was created by cloning the zeocin suspension was assayed for its adenosine triphosphate content resistance gene, including an SV40 promoter and an SV40 according to the manufacturer’s instructions. Each assay polyA sequence, from the pTER plasmid33 into the NotI and was carried out in triplicate. An integration time of 0.3 s per BamHI sites of pSUPERdL.34 To obtain the PCR insert out of the well was used. pTER plasmid, the following primers were used: NotI_pTER_fw 50-cgattgcggccgctgatttaac-30 and BamHI_pTER_rev 50-cggag- gatccaagctctagcta-30. The sequence for cloning of a short NFkB reporter assay hairpin of CCDC50 into the pSUPERdL_Zeo plasmid was The firefly luciferase plasmid containing six binding sites for designed according to the siRNA sequence for CCDC50 nuclear factor kappa B (NFkB) and the renilla luciferase plasmid (Ambion Inc., Austin, TX, USA; 129979). Short hairpin were obtained as generous gifts from Professor Bernd Doerken sequences specific for CCDC50 are sh_CCDC50_sense: (Max Delbrueck Center, Berlin, Germany). Cells were trans- ATCCCCCCCTATGCTGCATATACTTTCAAGAGAAGTATATGC fected with 500 nM siRNAs targeting or 1.25 mg of the plasmids AGCATAGAGGTTTTTGGAAA and sh_CCDC50_antisense: AG coding for CCDC50, together with 0.83 mg of firefly-luciferase CTTTTCCAAAAACCTCTATGCTGCATATACTTCTCTTGAAAGT reporter plasmid and 0.42 mg of renilla-luciferase reporter ATATGCA GCATAGAGG. Cloning was performed as described plasmid. At 24 h after transfection, tumor necrosis factor-a previously,34 and pSUPERdL_Zeo_sh_CCDC50 was sequenced. (TNFa) induction (50 ng/ml) was performed. Immediately (0 h), 3 Stable transfection of the plasmid pSUPERdL_Zeo_sh_CCDC50 and 6 h after TNFa induction, luciferase activities of firefly and into the cell line Mec-1 and JVM-2 was performed by renilla were assayed with a luminometer (LB-940 Mithras nucleofection. The transfected MCL cells were selected with Multilabel Reader, Berthold Technologies, Bad Wildbach, 50 ng/ml zeocin. Germany), using a Dual-Luciferase Reporter System (Promega).

Leukemia CCDC50 as candidate gene in MCL and CLL A Farfsing et al 2020 Results cell viability assay (Figure 1) and FACS analysis (not shown). A direct correlation between cell viability and cell vitality was Expression profiling revealed 72 overexpressed genes in observed (not shown). The siRNAs directed against CCND1, frequently gained regions KIF11, DUSP5, PLK1 and BCL2 served as positive controls. After Transcriptomes of 6 primary MCL and 18 primary CLL patient the silencing of these genes, cell viability of MCL cell lines was samples, as well as 6 cell lines, were profiled to identify reduced to 30–80%. For each of the 72 genes, a pool consisting overexpressed genes. The gene expression of cell lines was of four siRNA sequences was transfected into MCL cell lines. normalized to the lymphoblastoid non-tumor cell line LCL-WEI, After their transient knockdown, 18 genes revealed a reduction whereas the gene expression of primary MCL and CLL cells was of cell viability when compared with negative controls. normalized to a pool of CD19 þ -sorted B cells from healthy donors. Results were compared with recent publications and revealed 37 novel and 35 predicted candidate genes (Supple- CCDC50, SERPINI2 and SMARCC2 affect cell survival mentary Information, Supplementary Table S7). These genes are Validation of the 18 candidate genes was performed by highly expressed and map to the respective gained chromoso- transfecting up to four single siRNA molecules for each gene mal regions in MCL and CLL: 27 genes on chromosome bands separately into the appropriate cell lines. Owing to the limited 3q25–q29, 32 genes on bands 12q13–q14 and 13 genes on availability of primary cell material, pools of 2–4 siRNAs against bands 18q21–q22 (Table 1). the same gene were transfected into primary CLL cells. Validation of the candidate genes was scored positive if two or more siRNAs reduced cell viability in cell lines, and the pool Loss of function screen revealed 18 candidate genes of siRNAs reduced cell viability in primary CLL cells (Supple- mentary Information, Supplementary Figure S1). The single A total of 72 overexpressed genes were functionally analyzed in siRNA duplexes or pools of siRNAs showing the most effective a transient RNA interference screen in MCL cell lines showing reduction of cell viability are shown in Figure 2. For three genes, the respective chromosomal gain in 3q25–q29 (JVM-2), 12q13– loss of viability was detected in cell lines (Figure 2a) as well as in q14 (JVM-2) or 18q21–q22 (Granta-519). For all functional primary cells (Figure 2b), namely CCDC50, SERPINI2 and assays, negative controls, such as scrambled siRNAs and siRNAs SMARCC2. The most prominent reduction of cell viability was directed against firefly luciferase, were tested for unspecific observed after gene knockdown of CCDC50 in primary CLL effects on cell viability. Two assays were used as read out of the cells. This gene was selected for further analysis. screen after functional gene knockdown: a luminescent-based

CCDC50 is overexpressed in MCL and CLL Table 1 Overexpressed candidate genes on chromosome bands The CCDC50 transcript expression was analyzed in B-cell 3q25–q29, 12q13–q14 and 18q21–q22 neoplasia cell lines, as well as in primary MCL and CLL cells. The quantitative realtime PCR (qRT-PCR) experiments that were Chromosome 3 Chromosome 12 Chromosome 18 conducted with 16 lymphoma cell lines, comprising Burkitt’s Gene Band Gene Band Gene Band lymphoma, Hodgkin’s lymphoma, diffuse large BCL, MCL and CLL (Figure 3a), revealed an increased expression of CCDC50 RARRES1 3q25 IRAK3 12q13 PIAS2 18q21 only in MCL and CLL cells (ranging from 1.3- to 2.9-fold), except PFN2 3q25 SLC38A2 12q13 IER3IP1 18q21 for the cell line Jeko-1. The qRT-PCR experiments with primary GPR160 3q26 HOXC6 12q13 RKHD2 18q21 cells showed that 5 out of 8 MCL patients and 24 out of 28 CLL ACTL6A 3q26 RAPGEF3 12q13 NARS 18q21 USP13 3q26 KIAA0286 12q13 TXNL1 18q21 patients showed an upregulation of CCDC50 ranging from 1.5- BCHE 3q26 ARHGAP9 12q13 MALT1 18q21 to 10-fold, with a mean expression of 3.4-fold (MCL) and 3.5- APOD 3q26 DDIT3 12q13 BCL2 18q21 fold (CLL) and a threshold of 1.5-fold overexpression, when PIK3CA 3q26 MBD6 12q13 VPS4B 18q21 compared with CD19 þ -selected B cells of healthy donors SerpinI2 3q26 RHEBL1 12q13 ZNF532 18q21 (Figure 3b). ECT2 3q26 TIMELESS 12q13 SerpinB2 18q21 SMC4 3q26 SMARCC2 12q13 CCDC5 18q21 YEATS2 3q27 RARG 12q13 TCF4 18q21 RFC4 3q27 STAT6 12q13 ZADH2 18q22 Silencing of CCDC50 inhibits survival ECE2 3q27 CDK2 12q13 To validate the reduction of cell viability after transient CCDC50 C3ORF40 3q27 FAM112B 12q13 gene knockdown, we determined the silencing effect of three DVL3 3q27 PA2G4 12q13 independent siRNAs (siCCDC50 1, siCCDC50 2 and siCCDC50 3) KLHL6 3q27 FAM113B 12q13 in the cell line JVM-2. All siRNAs that were tested showed a ETV5 3q28 ITGB7 12q13 LEPREL1 3q28 INHBE 12q13 signiﬁcant RNA knockdown of 35–83% at 48 h post transfection FLJ42393 3q28 GLI1 12q13 (p.t.). The siCCDC50 2 and 3 revealed a decrease in cell CCDC50 3q29 MYL6B 12q13 viability to 51 and 44% at 72 h p.t. (Supplementary Figure S2). LAMP3 3q29 METTL1 12q13 We generated cell lines of the CLL and MCL origin (Mec-1 and FAM43A 3q29 DTX3 12q13 JVM-2), in which CCDC50 was stably silenced by the genomic C3orf34 3q29 DGKA 12q13 introduction of a short hairpin RNA coding vector. As shown by RPL39L 3q29 TUBA1B 12q13 PAK2 3q29 PTGES3 12q13 the results obtained from qRT-PCR experiments, the wild-type LRCH3 3q29 GDF11 12q13 JVM-2 and Mec-1 cell lines showed a 2.9- and a 2.0-fold CDK4 12q14 CCDC50 overexpression, respectively (Figure 3a). CCDC50 FAM119B 12q14 RNA levels were reduced after stable CCDC50 silencing by 50% MARCH-IX 12q14 (JVM2 þ sh_CCDC50 1 and 3) and 80% (Mec1 þ sh_CCDC50 1) TSFM 12q14 when compared with their parental cell lines (Figure 4a), KUB3 12q14 accompanied by reduced protein levels (Figure 4b) and reduced

Leukemia CCDC50 as candidate gene in MCL and CLL A Farfsing et al 2021 Candidate gene

Positive control Negative control

100

40 Cell survival (%) Cell survival

0 PLK1 ECT2 BCL2 PAK2 TSFM KIF11 DDIT3 ITGB7 Gene IRAK3 USP13 KLHL6 MALT1 DUSP5 CCND1 HOXC6 FAM43A CCDC50 RHEBL1 Negative SERPINI2 RAPGEF3 RARRES1 ARHGAP9 SMARCC2

Chr. 3q 12q 18q Control

Cell line JVM-2Granta-519 J JVM-2

Figure 1 Cell viability assay of the 18 candidate genes resulting from the small interfering RNA (siRNA) screening. Three independent replicates of the siRNA screening were performed in mantle cell lymphoma (MCL) cell lines. Genes located on chromosomes 3q25–q29 and 12q13–q14 were transfected into the MCL cell line JVM-2. MALT1 on chromosome 18q21 was transfected into Granta-519. Candidates are shown as white bars, positive controls as gray bars and the mean of three independent negative controls (siCONTROL Non-Targeting siRNA Pool 2, ON- TARGETplus siCONTROL Non-targeting Pool and Silencer-Firefly-LucGL2/3) as a black bar. Cell viability was measured 72 h after transfection. JVM-2 and Granta-519; Human peripheral blood B-cell lymphoma cell lines. cell viability as shown for JVM-2 (Figure 4c). To investigate the expression levels revealed a 16-fold NFkB induction by TNFa, impact of CCDC50 on primary CLL cells, we transiently whereas low CCDC50 expression levels only revealed a 6- to 7- transfected siCCDC50 3 into cells of five different CLL patients. fold induction (Figure 6). The qRT-PCR experiments revealed a 50–60% RNA knockdown of CCDC50 in all patients (Figure 5a), correlating with decreased CCDC50 protein levels (Figure 5b) as well as a 40– Genome-wide expression changes after CCDC50 80% reduction of cell viability (Figure 5c). modification To investigate genome-wide gene expression changes, CCDC50 was transiently silenced by siCCDC50 3 or overexpressed by Low NFkB inducibility in CCDC50-silenced cells the plasmid pCMV_CCDC50 in MCL cell lines, JVM-2 and CCDC50, also known as Ymer, was previously identified in HeLa Granta-519. Seventy-two hours after transfection, the expression cells as a suppressor of NFkB activity through its interaction changes were analyzed using the Illumina expression array with the NFkB inhibitor, tumor necrosis factor, alpha-inducing platform (Illumina Inc, San Diego, CA, USA) (Supplementary protein 3 (TNFAIP3) 36,37 To elucidate a possible downstream Figure S3). Expression array results were normalized to transfec- effect of CCDC50 expression, NFkB luciferase reporter assays tion of cells with negative controls, such as siRNA non-template were carried out. Therefore, we used HEK-293T cells because control or plasmid pCMV. Expression profiling in the cell line they combine the following three major advantages: (1) a high JVM-2 revealed a total of 28 deregulated genes (17 upregulated transfection efficiency, (2) a high inducibility of the NFkBreporter and 11 downregulated) and 58 aberrantly expressed genes (39 by TNFa (sevenfold) and (3) a 9.3-fold lower CCDC50 expression upregulated and 19 downregulated) in the cell line Granta-519 level than that of JVM-2 cells. NFkB reporter plasmids were (Supplementary Tables S8 and S9). Among the deregulated transfected together with either a siRNA targeting CCDC50 or an genes, a majority of genes were involved in p53 signaling expression construct coding for CCDC50. Twenty-four hours after pathways, as well as in the control of cell cycle progression and transfection, NFkB activity was induced by TNFa and measured apoptosis. In JVM-2 and Granta-519, the genes TP53I3, immediately, as well as 3 and 6 h after induction. After CDKN1A and FDXR showed inverse expression levels when normalizing the activity of the firefly luciferase to the activity of compared with CCDC50. Among the differentially expressed the renilla luciferase, our results showed a direct correlation genes that were observed only in the cell line JVM-2 were between inducibility and CCDC50 expression. High CCDC50 PRODH, LAMP3, FAM129A, MAD4 and SENS1, which are

Leukemia CCDC50 as candidate gene in MCL and CLL A Farfsing et al 2022 Cell lines CCND1 BCL2 KIF11 PLK1 CCDC50 1 1 1 1 1 0.8 0.8 0.8 0.8 0.8 0.6 0.6 0.6 0.6 0.6 0.4 0.4 0.4 0.4 0.4 0.2 0.2 0.2 0.2 0.2 Cell viability 0 0 0 0 0 Fold change to NC to change Fold siRNA 4 siRNA 4 siRNA 3 siRNA 3 siRNA 2

KLHL6 PAK2 ECT2 SERPINI2 RARRES1 1 1 1 1 1 0.8 0.8 0.8 0.8 0.8 0.6 0.6 0.6 0.6 0.6 0.4 0.4 0.4 0.4 0.4 0.2 0.2 0.2 0.2 0.2 Cell viability 0 0 0 0 0 Fold change to NC to change Fold siRNA 3 siRNA 2 siRNA 3 siRNA 3 siRNA 2

IRAK3 RAPGEF3 ARHGAP3 RHEBL1 ITBG7 1 1 1 1 1 0.8 0.8 0.8 0.8 0.8 0.6 0.6 0.6 0.6 0.6 0.4 0.4 0.4 0.4 0.4 0.2 Cell viability 0.2 0.2 0.2 0.2 0 Fold change to NC to change Fold 0 0 0 0 siRNA 2 siRNA 3 siRNA 1 siRNA 4 siRNA 1

SMARCC2 TSFM MALT1 1 1 1 0.8 0.8 0.8 0.6 0.6 0.6 0.4 0.4 0.4 0.2 0.2 0.2 Cell viability 0 0 0 Fold change to NC to change Fold siRNA 2 siRNA 4 siRNA 4

Primary CLL cells PLK1 BCL2 KIF11 CCDC50 SERPINI2 1 1 1 1 1 0.8 0.8 0.8 0.8 0.8 0.6 0.6 0.6 0.6 0.6 0.4 0.4 0.4 0.4 0.4 0.2 0.2 0.2 0.2 0.2 Cell viability 0 0 0 0 0 Fold change to NC to change Fold siRNA 1–4 siRNA 1–4 siRNA 1–4 siRNA 1–3 siRNA 1–4

SMARCC2 DDIT3 1 1 0.8 0.8 Legend 0.6 0.6 24 h 0.4 0.4 48 h 0.2 0.2 Cell viability 0 0

Fold change to NC to change Fold 72 h siRNA 3+, 4 siRNA 1+, 2

Figure 2 Validation of positive-scored candidate genes resulting from the small interfering RNA (siRNA) screening. (a) Cell survival was measured after transfection of single siRNA molecules targeting 14 candidate genes and was compared with negative control transfections at 24 h (light gray bar), 48 h (dark gray bar) and 72 h p.t.(black bar). Changes of cell viability after transfection of the negative control as well as positive controls CCND1, BCL2, KIF11 and PLK1 are shown. (b) Pools of siRNAs, consisting of 2–4 siRNA molecules were transfected into primary chronic lymphocytic leukemia (CLL) cells. Cell viability was measured 24, 48 and 72 h after transfection (dark gray, light gray and black bar). Candidate genes as well as positive controls (PLK1, BCL2 and KIF11) are shown. The negative controls used for normalization were SilencerFireﬂy-LucGL2/3, ON-TARGET-plus-siCONTROL, siControl Non-Targeting siRNA and siNegative Control 1.

involved in the control of cell cycle progression and apoptosis, Out of these, CCDC50, SERPINI2 and SMARCC2 controlled cell whereas genes found differentially expressed only in Granta-519 viability also in primary CLL cells. As CCDC50 showed the most were PHLDA3, GADD45A, BAX and RARRES3. Among the prominent effect on patient cells, it was further functionally downregulated genes in JVM-2 after CCDC50 silencing were characterized. NFkB reporter assays and genome-wide expres- BNIP3L and LGMN, as well as BRWD1 and MDM4 in the cell sion profiling studies showed an effect of CCDC50 on NFkB and line Granta-519. We identified TP53I3 as a significantly p53 signaling pathways. regulated gene in JVM-2 and Granta-519, showing an inverse In the RNA interference screen, 18 candidate genes have been expression status compared with that of CCDC50.These results identified, of which 12 were novel and 6 have previously been indicate a role of CCDC50 in p53 signaling pathways. associated with MCL or CLL: CCDC50,22,38,39 ECT2,11,14,25 SERPINI2,10 PAK2,22 KLHL622 and ITGB7.40 In all, 14 of the 18 candidates could be confirmed in the validation experiment. Discussion DDIT3 was shown to reduce cell viability only in primary CLL cells. It has been reported to show higher expression levels in The expression analysis of genes located in commonly gained progressive CLL than in clinically stable CLL cells.41 Other chromosomal regions 3q25–q29, 12q13–q14 and 18q21–q22 previously predicted genes such as GLI1,14 Timeless23 and revealed 72 overexpressed genes in MCL and CLL. Silencing of TCF421 did not show an effect on cell viability in the focused these genes in a limited RNA interference screen identified 18 siRNA screen. Validation of the candidates by transfecting single candidates that affect cell survival in the MCL cell line, JVM-2. siRNAs targeting the same gene separately revealed four genes

Leukemia CCDC50 as candidate gene in MCL and CLL A Farfsing et al 2023 3 CCDC50

2.5

1.5

0.5 Expression level 0 (Fold change to LCL-WEI) –0.5 HT Raji L428 L540 Eheb Mec-1 Mec-2 CA-46 JVM-2 DG-75 Jeko-1 Ramos MC-116 SUDHL6 SUDHL5 Granta-519

Burkitt DLBCL HL MCL CLL

10 CCDC50 9

Expression level 3 (Fold change to CD19+) 2 T 1

Patient number 4 5 8 6 7 3 1 2 9 5 6 7 44 15 39 12 21 16 14 32 35 34 40 29 11 25 37 26 18 30 41 28 22 19 48 45

Primary cells MCL M CLL M

Figure 3 Expression of coiled-coil domain containing protein 50 (CCDC50) in B-cell lines and primary mantle cell lymphoma (MCL) and chronic lymphocytic leukemia (CLL) cells was measured by quantitative real-time (qRT)-PCR. (a) The expression of CCDC50 was analyzed by qRT-PCR in 16 cell lines: ﬁve Burkitt’s lymphoma (Burkitt), three diffuse large B-cell lymphoma (DLBCL), two Hodgkin’s lymphoma (HL), three MCL and three CLL cell lines. Expression levels were ﬁrst normalized by the two housekeeping genes PGK1 and DCTN2. Each sample was then compared with the lymphoblastoid non-tumor B-cell line, LCL-WEI. (b) CCDC50 expression was analyzed in 28 primary CLL and 8 primary MCL samples. Results were normalized to CD19 þ B cells obtained from healthy donors (n ¼ 10). M ¼ median expression, T ¼ Threshold of 1.5-fold, overexpressed after normalization.

JVM2 1 CCDC50 JVM2+sh_CCDC50#1 CCDC50 JVM2+sh_CCDC50#3 0.5 6000000 GAPDH 5000000 high CCDC50 0 4000000 expression WT WT WT WT 3000000 [Fold change to WT] CCDC50 expression 2000000 low Cell viability 1000000 CCDC50 expression

[Relative Light Units] 0 sh_CCDC50#3 sh_CCDC50#1 sh_CCDC50#1 sh_CCDC50 #1 sh_CCDC50 #3 sh_CCDC50 #1 24h 48h 72h 96h JVM2 Mec1 JVM2 Mec1 time in h

Figure 4 Functional analyses of stably silenced coiled-coil domain containing protein 50 (CCDC50) cell lines. (a) quantitative real-time (qRT)- PCR analysis showed that CCDC50 expression was reduced in stable clones JVM-2 þ sh_CCDC50 1, JVM-2 þ sh_CCDC50 3 and Mec1+sh_CCDC50 1. LCL-WEI was used as a reference cell line because of a low CCDC50 expression level. (b) Western blot analysis revealed a CCDC50 protein decrease in stable cell lines JVM-2 þ sh_CCDC50 3 and Mec-1 þ sh_CCDC50 1 in comparison with the loading control glyceraldehyde-3-phosphate dehydrogenase (GAPDH). (c) Cell viability analysis was carried out by seeding 3 106 JVM-2 cells and measuring adenosine triphosphate (ATP)-dependent cell viability at 24 h intervals for 96 h.

Leukemia CCDC50 as candidate gene in MCL and CLL A Farfsing et al 2024 CCDC50 expression CLL patient 49 Cell viability

1 100 80 60 0.5 40 siCCDC50#3 siNTC Mock siCCDC50#3 siNTC Mock 20 Viability in (%) CCDC50 0 0

Expression level CLL 48 CLL 49 CLL 50 GAPDH CLL 48 CLL 49 CLL 50 CLL 51 CLL 61 (Fold change to NC) siCCDC50 siNTC 48 h 72 h siCCDC50 siNTC

Figure 5 Functional analyses of primary chronic lymphocytic leukemia (CLL) cells after chronic lymphocytic leukemia (CCDC50) silencing. (a) Quantitative real-time (qRT)-PCR measuring CCDC50 expression in CLL samples 48, 49 and 50. Values were normalized by CCDC50 expression after transfection of a small interfering RNA (siRNA) non-template control (NTC). (b) Western blot analysis showed CCDC50 knockdown in CLL cells from patient 49 at 48 and 72 h after transfection compared with transfection with a non-template control siRNA (siNTC) and with mock transfection (Mock). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. (c) A cell viability assay was carried out 72 h p.t. in primary CLL cells after transient transfection of siCCDC50. Values were normalized to transfection with a siNTC set to 100% viability.

20 HEK 18 HEK+siCCDC50 HEK+siNTC High 16 HEK+pCMV__CCDC50 CCDC50 HEK+pCMV expression 14 ) α 12

/-TNF 10 α B induction κ 8 Low NF (+TNF CCDC50 6 expression 4

0 0 h 3 h 6 h Hours after TNFα induction

Figure 6 Nuclear factor kappa B (NFkB) reporter assay in HEK-293T cells after chronic lymphocytic leukemia (CCDC50) gene modulation. Tumor necrosis factor-a (TNFa) induction in HEK-293T cells was performed 24 h after transfection of the two reporter plasmids. NFkB reporter activity was measured before (0 h), as well as 3 and 6 h after TNFa induction. Normalization was performed when comparing the activity of the ﬁreﬂy luciferase with the activity of the renilla luciferase. Finally, fold induction was calculated as a correlation between TNFa-induced cells and uninduced cells. HEK-293T; human embryonic kidney 293-T cell line.

with a false-positive effect (Supplementary Figure S1c). Off- decreases NFkB signaling.46,47 Interestingly, our data showed a target effects of single siRNA molecules, as well as technical survival-stimulating effect of CCDC50 in MCL and CLL cells, limitations, may have contributed to the false positives and which might be mediated by enhanced NFkB signaling and negatives, wherein the loss of cell viability could not be implicate that the influence of CCDC50 on cell viability might validated in the majority of tested individual siRNA sequences be cell-type specific. Recent literature reported that TNFa in cell lines. Such effects are key limitations in respective induced NFkB activation is leading to the survival of MCL and screening approaches, as siRNAs may produce a ‘signature’ of CLL cells.46–48 In this study, we showed that the TNFa inhibited transcripts in addition to the intended targets.42–44 stimulation of the NFkB reporter plasmid revealed a 56% less CCDC50 was earlier identified to be overexpressed in MCL inducibility in human embryonic kidney 293-T (HEK-293T) cells in comparison with other lymphomas22,39and with benign cells, transiently silenced for CCDC50, compared with cells reactive lymph node tissue of MCL patients.38 We showed that with CCDC50 overexpression (Figure 6). These findings, as well MCL and CLL cell lines with a stable CCDC50 knockdown as cell viability assays carried out in MCL and CLL cells, support revealed 75% less proliferation than the parental cell lines our hypothesis that CCDC50 has a survival-stimulating effect. (Figure 4a). Recent publications reported an involvement of Low CCDC50 expression levels correlated with reduced cell CCDC50 in NFkB and epidermal growth factor receptor viability, which may be caused by low NFkB inducibility. signaling pathways.45,36,37CCDC50 is phosphorylated and Genome-wide expression changes after CCDC50 modulation ubiquitinated on epidermal growth factor stimulation and discovered genes mainly involved in the p53 signaling pathway inhibits epidermal growth factor receptor downregulation.44 (BAX, CDKN1A, FDXR, GADD45A, LAMP3, PRODH, On the basis of investigations conducted in HeLa cells, CCDC50 PHLDA3, SESN1 and TP53I3), as well as those involved in the was postulated as a negative regulator of the NFkB path- inhibition of cell cycle progression and the induction of way.36,37 CCDC50 was found to interact with TNFAIP3,46 apoptosis (FAM129A, MAD4 and RARRES3).49–55 BAX, GAD- which acts as a negative feedback regulator of NFkB and D45A, CDKN1A and SESN1 were previously reported as direct

Leukemia CCDC50 as candidate gene in MCL and CLL A Farfsing et al 2025 p53 target genes.56 Among the downregulated genes were translocation involves the immunoglobulin heavy chain locus. BNIP3L and LGMN (JVM-2), as well as MDM4 and BRWD1 Proc Natl Acad Sci USA 1984; 81: 4144–4148. (Granta-519). These genes have previously been identified in 3 Tsujimoto Y, Finger LR, Yunis J, Nowell PC, Croce CM. Cloning of cell cycle progression and p53 pathways.49–55 TP53I3 is the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science 1984; 226: 1097–1099. described as an oxidoreductase that acts in p53-mediated 4 Bentz M, Plesch A, Bullinger L, Stilgenbauer S, Ott G, Muller- apoptosis. MCL and CLL cells show, after CCDC50 silencing, Hermelink HK et al. t(11;14)-positive mantle cell lymphomas increased TP53I3 expression levels and reduced cell viability. exhibit complex karyotypes and share similarities with B-cell Increased inducibility of TP53I3 could be protective against chronic lymphocytic leukemia. Genes Chromosomes Cancer cancer because cells might more readily undergo apoptosis after 2000; 27: 285–294. stress. Further studies revealed mir-34a as a novel target of p53 5 Schaffner C, Idler I, Stilgenbauer S, Dohner H, Lichter P. Mantle in primary CLL cells.24,57 Reduction of mir-34a expression was cell lymphoma is characterized by inactivation of the ATM gene. Proc Natl Acad Sci USA 2000; 97: 2773–2778. associated with increased cell viability after DNA damage. 6 Solinas-Toldo S, Durst M, Lichter P. Specific chromosomal Upregulation of mir-34a induced the expression of BAX and imbalances in human papillomavirus-transfected cells during 24,57 p21. As we identified an overexpression of BAX and p21,as progression toward immortality. Proc Natl Acad Sci USA 1997; well as a reduction of cell viability after CCDC50 silencing, 94: 3854–3859. we postulated an involvement of CCDC50 in p53 signaling 7 Monni O, Oinonen R, Elonen E, Franssila K, Teerenhovi L, Joensuu pathways. H et al. Gain of 3q and deletion of 11q22 are frequent aberrations In summary, the reduction of cell viability after CCDC50 in mantle cell lymphoma. Genes Chromosomes Cancer 1998; 21: 298–307. silencing might be explained by the overexpression of apopto- 8 de Leeuw RJ, Davies JJ, Rosenwald A, Bebb G, Gascoyne RD, Dyer sis-stimulating genes involved in the p53 signaling pathways as MJ et al. Comprehensive whole genome array CGH profiling of well as by the downregulation of apoptosis-protecting genes. mantle cell lymphoma model genomes. Hum Mol Genet 2004; 13: Moreover, the involvement of CCDC50 in NFkB signaling 1827–1837. pathways may have major effects on cell survival. 9 Kohlhammer H, Schwaenen C, Wessendorf S, Holzmann K, Kestler HA, Kienle D et al. Genomic DNA-chip hybridization in t(11;14)-positive mantle cell lymphomas shows a high frequency of Conclusions aberrations and allows a refined characterization of consensus regions. Blood 2004; 1: 104 (3): 795-801. 10 Tagawa H, Karnan S, Suzuki R, Matsuo K, Zhang X, Ota A et al. Expression profiling of primary MCL and CLL cells identified 72 Genome-wide array-based CGH for mantle cell lymphoma: upregulated genes in recurrently gained regions 3q, 12q and identification of homozygous deletions of the proapoptotic gene 18q. Knockdown of these genes applying a siRNA screen BIM. Oncogene 2005; 24: 1348–1358. revealed for CCDC50, SERPINI2 and SMARCC2 a reduction of 11 Rubio-Moscardo F, Climent J, Siebert R, Piris MA, Martin-Subero cell viability in primary CLL cells as well as in cell lines. Stable JI, Nielander I et al. Mantle-cell lymphoma genotypes identified silencing of CCDC50 inhibited cell proliferation in MCL and with CGH to BAC microarrays define a leukemic subgroup CLL cell lines. Furthermore, our data indicated that CCDC50 has of disease and predict patient outcome. Blood 2005; 105: an important function in TNFa-induced NFkB signaling. 4445–4454. 12 Schraders M, Pfundt R, Straatman HM, Janssen IM, van Kessel AG, Schoenmakers EF et al. Novel chromosomal imbalances in mantle cell lymphoma detected by genome-wide array-based compara- Conflict of interest tive genomic hybridization. Blood 2005; 105: 1686–1693. 13 Schraders M, Jares P, Bea S, Schoenmakers EF, van Krieken JH, The authors declare no conflict of interest. Campo E et al. Integrated genomic and expression profiling in mantle cell lymphoma: identification of gene-dosage regulated candidate genes. Br J Haematol 2008; 143: 210–221. Acknowledgements 14 Sander S, Bullinger L, Leupolt E, Benner A, Kienle D, Katzenberger T et al. Genomic aberrations in mantle cell lymphoma detected We thank Dr Michael Rogers for helpful discussions and a critical by interphase fluorescence in situ hybridization. Incidence review of this paper, Professor Reiner Siebert and Dr Inga Vater and clinicopathological correlations. Haematologica 2008; 93: from the University of Kiel for kindly providing additional MCL 680–687. 15 Hofmann WK, de Vos S, Tsukasaki K, Wachsman W, Pinkus GS, patient material, Verena Gschwend and Angela Schulz for Said JW et al. Altered apoptosis pathways in mantle cell lymphoma brilliant laboratory support and Dr Ludger Altrogge (Lonza, detected by oligonucleotide microarray. Blood 2001; 98: Cologne, Germany) for the excellent collaboration and technical 787–794. support. This study is supported by the German Jose´-Carreras 16 Zhu Y, Hollmen J, Raty R, Aalto Y, Nagy B, Elonen E et al. leukemia foundation (DJCLS R 06/13v) (DJCLS R 08/22v) and the Investigatory and analytical approaches to differential gene Fritz Thyssen foundation (10.04.1.169). MB is funded by the expression profiling in mantle cell lymphoma. Br J Haematol Helmholtz Alliance for Systems Biology. AR and EH are supported 2002; 119: 905–915. 17 Martinez N, Camacho FI, Algara P, Rodriguez A, Dopazo A, Ruiz- by the Interdisciplinary Center for Clinical Research (IZKF), Ballesteros E et al. The molecular signature of mantle cell University of Wu¨rzburg, Germany. GO is supported by the lymphoma reveals multiple signals favoring cell survival. Cancer Robert-Bosch-Foundation. Res 2003; 63: 8226–8232. 18 Rosenwald A, Wright G, Wiestner A, Chan WC, Connors JM, Campo E et al. The proliferation gene expression signature is a quantitative integrator of oncogenic events that predicts References survival in mantle cell lymphoma. Cancer Cell 2003; 3: 185–197. 1 Campo E, Raffeld M, Jaffe ES. Mantle-cell lymphoma. Semin 19 de Vos S, Krug U, Hofmann WK, Pinkus GS, Swerdlow SH, Hematol 1999; 36: 115–127. unbedingt noch neuere Wachsman W et al. Cell cycle alterations in the blastoid variant of Referenzen dazu. mantle cell lymphoma (MCL-BV) as detected by gene expression 2 Erikson J, Finan J, Tsujimoto Y, Nowell PC, Croce CM. The profiling of mantle cell lymphoma (MCL) and MCL-BV. Diagn Mol chromosome 14 breakpoint in neoplastic B cells with the t(11;14) Pathol 2003; 12: 35–43.

Leukemia CCDC50 as candidate gene in MCL and CLL A Farfsing et al 2026 20 Mestre-Escorihuela C, Rubio-Moscardo F, Richter JA, Siebert R, 38 Schmechel SC, LeVasseur RJ, Yang KH, Koehler KM, Kussick SJ, Climent J, Fresquet V et al. Homozygous deletions localize novel Sabath DE. Identification of genes whose expression patterns differ tumor suppressor genes in B-cell lymphomas. Blood 2007; 109: in benign lymphoid tissue and follicular, mantle cell, and small 271–280. lymphocytic lymphoma. Leukemia 2004; 18: 841–855. 21 Rizzatti EG, Falcao RP, Panepucci RA, Proto-Siqueira R, Anselmo- 39 Bertoni F, Rinaldi A, Zucca E, Cavalli F. Update on the molecular Lima WT, Okamoto OK et al. Gene expression profiling of mantle biology of mantle cell lymphoma. Hematol Oncol 2006; 24: cell lymphoma cells reveals aberrant expression of genes from the 22–27. PI3K-AKT, WNT and TGFbeta signaling pathways. Br J Haematol 40 Greiner TC, Dasgupta C, Ho VV, Weisenburger DD, Smith LM, 2005; 130: 516–526. Lynch JC et al. Mutation and genomic deletion status of ataxia 22 Salaverria I, Zettl A, Bea S, Moreno V, Valls J, Hartmann E et al. telangiectasia mutated (ATM) and p53 confer specific gene Specific secondary genetic alterations in mantle cell lymphoma expression profiles in mantle cell lymphoma. Proc Natl Acad Sci provide prognostic information independent of the gene USA 2006; 103: 2352–2357. expression-based proliferation signature. J Clin Oncol 2007; 25: 41 Falt S, Merup M, Gahrton G, Lambert B, Wennborg A. Identifica- 1216–1222. tion of progression markers in B-CLL by gene expression profiling. 23 Haslinger C, Schweifer N, Stilgenbauer S, Dohner H, Lichter P, Exp Hematol 2005; 33: 883–893. Kraut N et al. Microarray gene expression profiling of B-cell 42 Jackson AL, Bartz SR, Schelter J, Kobayashi SV, Burchard J, Mao M chronic lymphocytic leukemia subgroups defined by et al. Expression profiling reveals off-target gene regulation by genomic aberrations and VH mutation status. J Clin Oncol 2004; RNAi. Nat Biotechnol 2003; 21: 635–637. 22: 3937–3949. 43 Snove Jr O, Nedland M, Fjeldstad SH, Humberset H, Birkeland 24 Zenz T, Mertens D, Dohner H, Stilgenbauer S. Molecular OR, Grunfeld T et al. Designing effective siRNAs with off-target F diagnostics in chronic lymphocytic leukemia pathogenetic and control. Biochem Biophys Res Commun 2004; 325: 769–773. clinical implications. Leuk Lymphoma 2008; 49: 864–873. 44 Tschuch C, Schulz A, Pscherer A, Werft W, Benner A, Hotz- 25 Jares P, Campo E. Advances in the understanding of mantle cell Wagenblatt A et al. Off-target effects of siRNA specific for GFP. lymphoma. Br J Haematol 2008; 142: 149–165. BMC Mol Biol 2008; 9: 60. 26 Bea S, Ribas M, Hernandez JM, Bosch F, Pinyol M, Hernandez L 45 Tashiro K, Konishi H, Sano E, Nabeshi H, Yamauchi E, Taniguchi et al. Increased number of chromosomal imbalances and high- H. Suppression of the ligand-mediated down-regulation of level DNA amplifications in mantle cell lymphoma are associated epidermal growth factor receptor by Ymer, a novel tyrosine- with blastoid variants. Blood 1999; 93: 4365–4374. phosphorylated and ubiquitinated protein. J Biol Chem 2006; 281: 27 Dohner H, Stilgenbauer S, Benner A, Leupolt E, Krober A, 24612–24622. Bullinger L et al. Genomic aberrations and survival in chronic 46 Beyaert R, Heyninck K, Van Huffel S. A20 and A20-binding lymphocytic leukemia. N Engl J Med 2000; 343: 1910–1916. proteins as cellular inhibitors of nuclear factor-kappa B-dependent 28 Chiorazzi N, Rai KR, Ferrarini M. Chronic lymphocytic leukemia. gene expression and apoptosis. Biochem Pharmacol 2000; 60: N Engl J Med 2005; 352: 804–815. 1143–1151. 29 Messmer BT, Messmer D, Allen SL, Kolitz JE, Kudalkar P, Cesar D 47 Cooper JT, Stroka DM, Brostjan C, Palmetshofer A, Bach FH, et al. In vivo measurements document the dynamic cellular Ferran C. A20 blocks endothelial cell activation through a kinetics of chronic lymphocytic leukemia B cells. J Clin Invest NF-kappaB-dependent mechanism. J Biol Chem 1996; 271: 2005; 115: 755–764. 18068–18073. 30 Dighiero G, Travade P, Chevret S, Fenaux P, Chastang C, Binet JL. 48 Pham LV, Tamayo AT, Yoshimura LC, Lo P, Ford RJ. Inhibition of B-cell chronic lymphocytic leukemia: present status and future constitutive NF-kappa B activation in mantle cell lymphoma B directions. French Cooperative Group on CLL. Blood 1991; 78: 1901–1914. cells leads to induction of cell cycle arrest and apoptosis. 31 Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero J Immunol 2003; 171: 88–95. G, Dohner H et al. Guidelines for the diagnosis and treatment of 49 Contente A, Dittmer A, Koch MC, Roth J, Dobbelstein M. chronic lymphocytic leukemia: a report from the International A polymorphic microsatellite that mediates induction of PIG3 by Workshop on Chronic Lymphocytic Leukemia updating the p53. Nat Genet 2002; 30: 315–320. National Cancer Institute-Working Group 1996 guidelines. Blood 50 Smith ML, Chen IT, Zhan Q, Bae I, Chen CY, Gilmer TM et al. 2008; 111: 5446–5456. Interaction of the p53-regulated protein Gadd45 with proliferating 32 Seiffert M, Stilgenbauer S, Dohner H, Lichter P. Efficient cell nuclear antigen. Science 1994; 266: 1376–1380. nucleofection of primary human B cells and B-CLL cells induces 51 Chipuk JE, Kuwana T, Bouchier-Hayes L, Droin NM, Newmeyer apoptosis, which depends on the microenvironment and on DD, Schuler M et al. Direct activation of Bax by p53 mediates the structure of transfected nucleic acids. Leukemia 2007; 21: mitochondrial membrane permeabilization and apoptosis. Science 1977–1983. 2004; 303: 1010–1014. 33 van de Wetering M, Oving I, Muncan V, Pon Fong MT, Brantjes H, 52 Kerley-Hamilton JS, Pike AM, Li N, DiRenzo J, Spinella MJ. A p53- van Leenen D et al. Specific inhibition of gene expression using a dominant transcriptional response to cisplatin in testicular germ stably integrated, inducible small-interfering-RNA vector. EMBO cell tumor-derived human embryonal carcinoma. Oncogene 2005; Rep 2003; 4: 609–615. 24: 6090–6100. 34 Pscherer A, Schliwka J, Wildenberger K, Mincheva A, Schwaenen 53 Adamsen BL, Kravik KL, Clausen OP, De Angelis PM. Apoptosis, C, Dohner H et al. Antagonizing inactivated tumor suppressor cell cycle progression and gene expression in TP53-depleted genes and activated oncogenes by a versatile transgenesis system: HCT116 colon cancer cells in response to short-term 5-fluoro- application in mantle cell lymphoma. FASEB J 2006; 20: 1188–1190. uracil treatment. Int J Oncol 2007; 31: 1491–1500. 35 Korz C, Pscherer A, Benner A, Mertens D, Schaffner C, Leupolt E 54 Phang JM, Donald SP, Pandhare J, Liu Y. The metabolism of et al. Evidence for distinct pathomechanisms in B-cell chronic proline, a stress substrate, modulates carcinogenic pathways. lymphocytic leukemia and mantle cell lymphoma by quantitative Amino Acids 2008; 35: 681–690. expression analysis of cell cycle and apoptosis-associated genes. 55 Pulverer B, Sommer A, McArthur GA, Eisenman RN, Luscher B. Blood 2002; 99: 4554–4561. Analysis of Myc/Max/Mad network members in adipogenesis: 36 Kameda H, Watanabe M, Bohgaki M, Tsukiyama T, Hatakeyama inhibition of the proliferative burst and differentiation by ectopi- S. Inhibition of NF-kappaB signaling via tyrosine phosphorylation cally expressed Mad1. J Cell Physiol 2000; 183: 399–410. of Ymer. Biochem Biophys Res Commun 2009; 378: 744–749. 56 Whibley C, Pharoah PD, Hollstein M. p53 polymorphisms: cancer 37 Bohgaki M, Tsukiyama T, Nakajima A, Maruyama S, Watanabe M, implications. Nat Rev Cancer 2009; 9: 95–107. Koike T et al. Involvement of Ymer in suppression of NF-kappaB 57 Zenz T, Mohr J, Edelmann J, Sarno A, Hoth P, Heuberger M et al. activation by regulated interaction with lysine-63-linked poly- Treatment resistance in chronic lymphocytic leukemia: the role of ubiquitin chain. Biochim Biophys Acta 2008; 1783: 826–837. the p53 pathway. Leuk Lymphoma 2009; 50: 510–513.

Supplementary Information accompanies the paper on the Leukemia website (http://www.nature.com/leu)

Leukemia