LXH254, a Potent and Selective ARAF-Sparing Inhibitor of BRAF And

Published OnlineFirst December 22, 2020; DOI: 10.1158/1078-0432.CCR-20-2563

CLINICAL CANCER RESEARCH | TRANSLATIONAL CANCER MECHANISMS AND THERAPY

LXH254, a Potent and Selective ARAF-Sparing Inhibitor of BRAF and CRAF for the Treatment of MAPK-Driven Tumors A C Kelli-Ann Monaco1, Scott Delach2, Jing Yuan2, Yuji Mishina2, Paul Fordjour2, Emma Labrot2, Daniel McKay3, Ribo Guo2, Stacy Higgins2, Hui Qin Wang2, Jinsheng Liang2, Karen Bui2, John Green2, Peter Aspesi2, Jessi Ambrose2, Felipa Mapa2, Lesley Griner2, Mariela Jaskelioff4, John Fuller5, Kenneth Crawford6, Gwynn Pardee5, Stephania Widger5, Peter S. Hammerman2, Jeffrey A. Engelman2, Darrin D. Stuart7, Vesselina G. Cooke2, and Giordano Caponigro2

ABSTRACT ◥ Purpose: Targeting RAF for antitumor therapy in RAS-mutant only modest activity in KRAS mutants. In RAS-mutant lines, loss of tumors holds promise. Herein, we describe in detail novel properties ARAF, but not BRAF or CRAF, sensitized cells to LXH254. ARAF- of the type II RAF inhibitor, LXH254. mediated resistance to LXH254 required both kinase function and Experimental Design: LXH254 was profiled in biochemical, dimerization. Higher concentrations of LXH254 were required to in vitro,andin vivo assays, including examining the activities of the inhibit signaling in RAS-mutant cells expressing only ARAF relative drug in a large panel of cancer-derived cell lines and a comprehensive to BRAF or CRAF. Moreover, specifically in cells expressing only set of in vivo models. In addition, activity of LXH254 was assessed in ARAF, LXH254 caused paradoxical activation of MAPK signaling cells where different sets of RAF paralogs were ablated, or that in a manner similar to dabrafenib. Finally, in vivo, LXH254 drove expressed kinase-impaired and dimer-deficient variants of ARAF. complete regressions of isogenic variants of RAS-mutant cells Results: We describe an unexpected paralog selectivity of lacking ARAF expression, while parental lines were only modestly LXH254, which is able to potently inhibit BRAF and CRAF, but sensitive. has less activity against ARAF. LXH254 was active in models Conclusions: LXH254 is a novel RAF inhibitor, which is able to harboring BRAF alterations, including atypical BRAF alterations inhibit dimerized BRAF and CRAF, as well as monomeric BRAF, coexpressed with mutant K/NRAS, and NRAS mutants, but had while largely sparing ARAF.

Introduction combined removal of either MEK1/MEK2 or ERK1/ERK2 is lethal (8). Second, RAF inhibitors selective for V600 genetic Activation of the RAS/RAF pathway due to oncogenic lesions variants have been developed, and tellingly these inhibitors have occurs in more than one third of human cancers, most commonly proven far more effective clinically than have MEK inhibitors, via mutations in KRAS, NRAS,andBRAF (1, 2). Not surprisingly, which equally inhibit both MEK1 and MEK2 (9–19). The simplest signiﬁcant effort has gone into developing inhibitors targeting interpretation of differing clinical results for these two inhibitor different nodes in this pathway, most notably the RAF, MEK, and classes is that mutant selectivity of the BRAF inhibitors confers a ERK kinases and more recently the KRAS G12C variant (3–7). favorable TI enabling relatively greater systemic drug exposure The requirement for RAS/RAF signaling in normal tissues limits and correspondingly improved pathway suppression in tumors. the potential therapeutic index (TI) of RAF/MEK/ERK inhibitors. Thus, agents that selectively target speciﬁc RAF isoforms or However, studies in mice and humans indicate that selective genetic variants should have improved TIs relative to agents that inhibition of RAF paralogs and/or oncogenic variants may enable inhibit equally all family members of any given node in the the development of inhibitors with favorable TIs. First, in adult pathway. mice, combined deletion of BRAF and CRAF is tolerated, whereas V600E/D/K The mutant selectivity of BRAF inhibitors precludes their use in KRAS-, NRAS-, and atypical BRAF–mutant tumors. Unfortunately, MEK inhibitors, which effectively inhibit signaling 1 2 Bristol Myers-Squibb, Cambridge, Massachusetts. Novartis Institutes for Bio- by mutant RAS in preclinical models, have proven largely ineffec- 3 medical Research, Cambridge, Massachusetts. Ventus Therapeutics, Montreal, tive in RAS-mutant tumors clinically (20). This failure likely results Quebec, Canada. 4Skyhawk Therapeutics, Waltham, Massachusetts. 5Novartis Institutes for Biomedical Research, Emeryville, California. 6AbSci, Vancouver, from two nonmutually exclusive sources. First, RAS activates Washington. 7Scorpion Therapeutics, Boston, Massachusetts. multiple downstream pathways. Thus, although RAF/MEK/ERK is a major RAS effector pathway, in many tumors, additional path- Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/). ways may be the major oncogenic driver, or provide redundancy, should RAF signaling be impaired (21). Second, the intricate Corresponding Author: Giordano Caponigro, Novartis Institutes for Biomedical feedback mechanisms that serve to control RAF pathway output Research, 250 Massachusetts Avenue, Cambridge, MA 02139. Phone: 617-871- V600 7395; Fax: 617-871-5245; E-mail: [email protected] in normal tissues, while disabled in BRAF -mutant disease (22), are largely intact in RAS-mutant tumors. Thus, RAS-mutant tumors Clin Cancer Res 2021;XX:XX–XX contain evolutionarily honed mechanisms that can buffer tumor doi: 10.1158/1078-0432.CCR-20-2563 cells against the effects of RAF pathway inhibitors (21, 23). This 2020 American Association for Cancer Research. feedback effect, coupled with the relatively low systemic exposures

AACRJournals.org | OF1

Monaco et al.

RAF in vitro enzyme assays Translational Relevance Biochemical inhibition of ARAF, BRAF, and CRAF, shown in The RAS/RAF/MEK/ERK pathway is activated in greater than Fig. 1A, was performed as described for RAF709 in Shao and collea- 30% of human cancers, primarily via mutations in KRAS, NRAS, gues (25). In brief, the catalytically inactive MEK1K97R variant was used and BRAF. The development of highly selective and genetic as a substrate for either full-length BRAF, full-length activated CRAF context–specific RAF inhibitors has led to spectacular improve- (Y340E/Y341E variant), or a full-length N-terminal GST-ARAF ments in patients with BRAFV600-mutant disease. Unfortunately, fusion. In all cases, LXH254 was preincubated with CRAF/BRAF/ the BRAF V600E selectivity of these inhibitors prevents their utility ARAF for 30 minutes prior to substrate addition/reaction initiation. in RAS-mutant tumors. Here, we describe an unexpected paralog Biochemical activity of LXH254 in the extended panel of kinases, selectivity for the type II RAF inhibitor, LXH254, that is currently shown in Supplementary Table S1, was determined as described undergoing clinical trials in RAS-driven tumors in combination in Wylie and colleagues (26). with MEK and ERK inhibitors. LXH254 is a potent inhibitor of both monomeric and dimeric BRAF and CRAF, but a comparably Generation of knockout cell lines poor inhibitor of ARAF. This paralog selectivity permits robust To generate RAF-knockout lines, clustered regularly interspersed inhibition of dimeric BRAF and CRAF simultaneously with poten- short palindromic repeat (CRISPR) genome editing (27, 28) was used tially improved therapeutic index. This tolerability profile has for all lines, except HCT 116. Guide sequences for ARAF enabled vertical combinations with MEK and ERK inhibitors for (CCTGCCCAACAAGCAACGCA), BRAF (ATATCAGTGTCC- the treatment of RAS-driven tumors in clinic. CAACCAAT), and CRAF (TGTTGCAGTAAAGATCCTAA) were synthesized using standard chemistry and cloned into in-house generated lentiviral expression vectors. Lentiviral vectors were packaged in 293T cells with TransIT-293 Transfection Reagent (Mirus, #MIR2700) afforded by the narrow TI, likely places severe constraints on using 5.4 mg of plasmid per 10-cm plate. Virus was harvested after potential single-agent activity of such inhibitors. Inhibitors that 48 hours and passed through a 0.45-mm filter. Cell lines stably impair RAF pathway signaling with at least some degree of bias for expressing Cas9 were incubated with lentivirus and 8 mg/mL Polybrene the RAS-mutant context relative to the wild-type setting will be (Millipore, #TR-1003-G) for 24 hours, and subsequently cultured in required to test the dependency of mutant RAS on RAF/MEK/ERK media containing puromycin. Following selection in puromycin, signaling in clinic. reductions in target protein levels were assessed via immunoblotting Herein, we describe LXH254, a RAF inhibitor with potent activity and single clones with complete loss of target protein expression were against both BRAF and CRAF, but 30- to 50-fold lower activity isolated from pools via serial dilutions. HCT 116–knockout lines were against ARAF in cells. LXH254 was predominantly active in tumor generated in parental and BRAF / lines from Horizon Discovery by modelsharboringactivatingvariantsofBRAFandNRAS,butless transfection with zinc finger mRNAs against ARAF, BRAF, and CRAF so in KRAS mutants, with the exception of KRAS mutants harboring purchased from Sigma. coincident mutations in BRAF.Critically,ablationofARAFexpres- sion combined with LXH254 elicited profound antiproliferative Generation of cell lines expressing exogenous ARAF constructs WT D447A K336M activity in vitro and antitumor activity in vivo. Collectively, these ARAF -FLAG, ARAF -FLAG, ARAF -FLAG, and R362H data suggest that LXH254 exemplifies a novel class of RAF inhi- ARAF -FLAG cDNA constructs were synthesized and cloned into bitors with selectivity for specific RAF paralogs. Reduced inhibitory in-house generated lentiviral vectors and expressed from either a activity against ARAF may limit LXH2540s single-agent activity to constitutive (pXP1704) or doxycycline-inducible (pXP1509A) EF1- either tumors within specific genetic contexts, such as BRAF- alpha promoter by GeneArt (Thermo Fisher Scientific). Lentivirus was mutant tumors or RAS-mutant tumors positive for biomarkers packaged, harvested, and used to infect cells as described previously. indicative of a lack of ARAF utilization. However, partial pathway Cells were cultured in media containing G418 MIA PaCa-2 until stable inhibition provided by LXH254 in many tumor cells due to potent pools were generated. Protein expression was confirmed by immu- inhibition of BRAF and CRAF, coupled with improved tolerability noblotting and mutations by MassArray (Agena Biosciences). in normal tissues due to ARAF avoidance, may enable tolerable combinations with additional agents targeting downstream effec- Cell proliferation assays tors, such as MEK, ERK, or CDK4/6. Cells were seeded in 96-well plates (Corning, #3903), and 24 hours later, compound dilution series (1:3, starting at 10 mmol/L) was added to wells in duplicate or triplicate. All compounds were synthesized at Materials and Methods Novartis Pharma AG. Plates were incubated for 72–120 hours, and Cell culture then CellTiter-Glo Luminescent Cell Viability Assay (Promega, HCT 116 RAF single- and double-knockout lines were generated #G7573) was added to wells to assess ATP levels. All points were / using parental and BRAF cells from Horizon Discovery. All other normalized to DMSO control samples when determining IC50 values cells lines were obtained from the BROAD/Novartis Cell Line and calculations were performed using GraphPad Prism 7.0. Encyclopedia collection (24) and maintained in DMEM (MIA High-throughput profiling of the cell line panel, described in PaCa-2, 293T, and HEK-293), McCoy's 5A (HCT 116), Eagle Min- Supplementary Fig. 1A, was performed as described in Barretina and imal Essential Medium (Calu-6, HeyA8, and SK-MEL-2), or RPMI colleagues (24). (all other lines) supplemented with 10% FBS (VWR Life Sciences Seradigm, #1500-500). Cell lines were confirmed Mycoplasma free by pMEK1/2 and pERK1/2 Meso Scale Discovery assays PCR and cell line identity was confirmed by SNP genotyping. All cell For Meso Scale Discovery (MSD) assays, cells were incubated with lines were maintained at 37C in a humidified atmosphere containing compound for 4 or 24 hours at 37C and subsequently lysed for 5% CO2. 30 minutes at 4 C. Assays were performed as described in the

OF2 Clin Cancer Res; 2021 CLINICAL CANCER RESEARCH

LXH254 a Potent and Selective BRAF and CRAF Inhibitor

Figure 1.

Characterization of LXH254 in biochemical and cellular assays. A, Shown are the calculated IC50 values against purified ARAF, BRAF, and CRAF in biochemical assays and structure of LXH254. B, Western blot analysis of whole-cell lysates (WCL) and BRAF, CRAF, and MEK IPs from HCT 116, MEL-JUSO, and MIA PaCa-2 cells either untreated, or following 1-hour treatments with either 1 mmol/L LXH254 or 1 mmol/L LY3009120. Proteins detected by immunoblotting (IB) are indicated to the right of each panel. C, Western blot analysis (top) and quantitation via densitometry (bottom) of the indicated proteins in A375 and HCT 116 cells following treatment with increasing amounts of LXH254. LXH254 concentrations (mmol/L) are indicated above each lane and immunoblotted proteins to the right of each panel. HCT 116 cells were treated for 1 hour with encorafenib that was subsequently washed out prior to treatment with LXH254. D, Assessment of interactions between LXH254 and kinases in HCT 116 cells. Individual kinases are depicted as circles along the x-axis and fractional inhibition of kinase interactions with an ATP competitive probe by LXH254 are given on the y-axis. manufacturer's protocol for Phospho/Total ERK1/2 (MSD, #8146), phospho-MEK1/2 (S217/S221) (Cell Signaling Technology, #K15107D-1), phosphoprotein levels were normalized to DMSO- #9154), phospho-ERK1/2 (T202/Y204) (Cell Signaling Technology, treated parental samples, and fold change was calculated based upon #4370), and GAPDH (Millipore, #MAB374) diluted 1:1,000 or with percentage phosphoprotein in each sample as described in the man- b-actin antibody (Life Technologies, #AM4302) diluted 1:5,000. ufacturer's protocol. Washout experiments, described in Fig. 1C, were performed as described in Shao and colleagues (25). Coimmunoprecipitations For immunoprecipitations, shown in Fig. 1B, cells were seeded in Protein immunoblots 15-cm dishes and incubated with 1 mmol/L of the indicated com- Cells were plated in 6-well dishes (Corning, #3506) and treated with pounds for 1 hour. Cell lysates were prepared in immunoprecipitation inhibitors for 4–72 hours. Cells were harvested in RIPA Lysis and buffer [10 mmol/L Tris, pH 7.4, 50 mmol/L NaCl, 0.5% (volume/ Extraction Buffer (Thermo Fisher Scientific, #89900) containing 1 volume) NP-40, and 1 mmol/L EDTA] supplemented with 1 Halt Protease Inhibitor Cocktail (Thermo Fisher Scientific, #87785) protease and 1 phosphatase inhibitor cocktails. Cleared lysates were and Halt Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific, normalized for protein concentration and incubated with BRAF #78420). Lysates were used for Western blot analysis with antibodies (Sigma, #HPA001328), CRAF [Bethyl Laboratories, (A301-519A) recognizing ARAF (Cell Signaling Technology, #4432), BRAF (Sigma- (HCT 116) and Millipore, #04-739], or MEK (Millipore, #07-641) Aldrich, #HPA00132), CRAF (Cell Signaling Technology, #12552), antibodies as indicated, overnight at 4C. Protein A Ultra Link Resin CRAF (BD Biosciences, #610151), FLAG (Cell Signaling Technology, (Thermo Fisher Scientific) was then added to each sample, incubated

AACRJournals.org Clin Cancer Res; 2021 OF3

Monaco et al.

for 2 hours at 4 C, washed with immunoprecipitation lysis buffer, and Percent change in body weight (BW) was calculated as (BWcurrent eluted in SDS sample buffer. In all other immunoprecipitations, cells BWinitial)/(BWinitial) 100%. Data were presented as mean percent were treated þ/ compound for 2–24 hours, cells were lysed in Pierce body weight change from the day of treatment initiation SEM. IP Lysis Buffer (Thermo Fisher Scientific, #87787) containing 1 Tumor volume was determined as published previously (25). All data Protease (Thermo Fisher Scientific, #87785) and Phosphatase Inhib- were expressed as mean SEM. Changes in tumor volume were used itor (Thermo Fisher Scientific, #78420) cocktails, and lysates were for statistical analysis, and between-group comparisons were carried clarified by centrifugation. For each sample, 1–2 mg of lysate was out using a one-way ANOVA. For all statistical evaluations, the level of incubated with antibodies to ARAF (Cell Signaling Technology, significance was set at P < 0.05. Significance compared with the vehicle #4432), BRAF (Sigma-Aldrich, #HPA00132), or FLAG (Sigma- control group is reported, unless otherwise stated. Aldrich, #F7425) and Protein G Sepharose Beads (GE Healthcare, #17-0618-01) for 3 hours at 4C. Complexes were washed three times Drug formulation with IP lysis buffer and analyzed by immunoblotting. LXH254 was dosed orally in MEPC4 vehicle [45% Cremophor RH40 þ 27% PEG400 þ 18% Corn Oil Glycerides (Maisine CC) þ Cell-based kinase assays 10% ethanol] for all experiments, except PC3, where LXH254 was þ In-cell kinase selectivity profiling was performed by KiNativ. Brief- formulated in 90% PEG400 10% Tween80. MEPC4 stock was ly, HCT 116 cells were treated with LXH254 for 2 hours at 10 mmol/L, diluted 5 (1:4 with de-ionized water) prior to dosing. Trametinib and then lysates were processed, probe labeled, and analyzed by LC/ was dosed orally as a suspension in 0.5% HPMC and 0.2% Tween80 in MS-MS, as described previously (29). For immunoprecipitate (IP)- distilled water at pH 8. Trametinib was stirred overnight and protected kinase assays, cells were cultured in compound for 4–24 hours prior to from light at room temperature prior to dosing. protein immunoprecipitation, as described above. IPs were washed Xenograft qPCR once with IP lysis buffer and twice with 1 Kinase Buffer (Cell Tumors were homogenized and RNA was extracted using the Signaling Technology, #9802), and protein-bound beads were incu- Qiagen RNeasy Mini Qiacube Kit (Qiagen, catalog no., 74116) per bated in 2 kinase buffer with 250 mmol/L ATP (Cell Signaling the manufacturer's instructions. For RT-qPCRs, 4 mL/well of a 10 ng/ Technology, #9804) and 0.5 mg MEK1 (Millipore, #14-420) or MEK1- mL suspension of RNA was loaded into 384-well plates along with 16 K97M (Proqinase, #0785-0000-1) for 30 minutes at 30 C. Beads were mL of Master Mix (Qiagen, catalog no, 204645), containing primers for then washed three times with IP lysis buffer and prepared for immu- hDUSP6 (Life Technologies, catalog no., Hs00737962) and hRPLPO noblotting as described above. (Life Technologies, catalog no., 4326314E), and reverse transcriptase. In vivo studies Reactions were run for 20 minutes at 50 C, 15 minutes at 95 C, followed by 45 cycles of 45 seconds at 94C and 45 seconds at 60C. Mice and statement of welfare Outbred athymic (nu/nu) female mice (“HSD: Athymic Nude-nu”; Gene expression analysis Charles River Laboratories) and SCID Beige mice (Charles River ARAF RNA sequencing (RNA-seq) expression, as well as BRAF, Laboratories) were allowed to acclimate in the Novartis NIBRI animal NRAS, KRAS, and HRAS mutation data from all The Cancer Genome facility with access to food and water ad libitum for a minimum of Atlas (TCGA) Pan-Cancer Atlas studies were downloaded from the 3 days prior to manipulation. Animals were handled in accordance cBioPortal data viewer (https://www.cbioportal.org/). RNA-seq by with Novartis Animal Care and Use Committee regulations and expectation-maximization (RSEM) values were converted to tran- guidelines. scripts per million (TPM) and log2 transformed. Only samples with ARAF expression were considered. Differential expression normali- in vivo fi Cell culture and ef cacy zation was performed using Limma/VOOM for differential expression Mycoplasma All cell lines were shown to be free of species and in R (30). murine viruses in the IMPACT VIII PCR Assay Panel (IDEXX RADIL, IDEXX Laboratories Inc). In all cases, cells were harvested at 80%–95% Structural modeling confluence with 0.25% trypsin-EDTA (Gibco, #25200-056), washed The in-house X-ray structure (PDB entry: 6N0P) of LXH254 bound with PBS, detached with 0.25% trypsin-EDTA (Gibco, #25200-056), to BRAF was used in conjunction with an X-ray structure of CRAF and neutralized with growth medium. Following centrifugation for 5 (PDB entry: 3OMV) to build a homology model of ARAF with minutes at 1,200 rpm, all cells, except HEY-A8 cells (PBS), were LXH254 bound in the molecular operating environment (31). This resuspended in either cold Hank's Balanced Salt Solution (HBSS; model was extensively refined with explicated solvent molecular Gibco, #14175-095, HCT 116 and A375) or cold HBSS and an equal dynamics simulations at 300 K, 1 atm, AM1BCC/ELF charges, TIP3P volume of Matrigel Matrix (Corning, #354234, all other cells). Cells water, and ff14SB (32) force field with the PARM@FROSST (33) were then injected in 100–200 mL volumes into either the right or left extension within the AMBER (34) suite of simulation tools. Ten- flanks of female nude mice, with the exception of MEL-JUSO cells, nanosecond simulations for each system were run and time average which were injected into SCID beige mice. Total cell numbers injected structures were extracted. per mouse were 2 106 (HCT 116 and HEY-A8), 5 106 (MIA PaCa- 2, HPAF-II, A375, Hs944.T, and SK-MEL-30), or 1 107 (MEL JUSO, Calu-6, and PC-3). Five to 7 mice were used for each group. Results 3990HPAX, 2043HPAX, 1290HCOX, 2861HCOX, 1855HCOX, LXH254 inhibits both monomeric and dimeric RAF and 2094HLUX, and 3486HMEX patient-derived tumor xenograft tumors promotes RAF dimer formation and the WM793 xenograft were propagated by serial passage of tumor LXH254 is a potent inhibitor of the BRAF and CRAF kinases, fragments in nude mice. Briefly, 3 3 3 mm fragments of fresh inhibiting their catalytic activity at picomolar (pmol/L) concentrations tumor from a previous passage were implanted subcutaneously into in biochemical assays (35). Consistent with LXH254 being a type II the mice. Efficacy was carried with n ¼ 6–12 mice per group. inhibitor, LXH254-bound BRAF adopts an inactive DFG out, aC-helix

OF4 Clin Cancer Res; 2021 CLINICAL CANCER RESEARCH

LXH254 a Potent and Selective BRAF and CRAF Inhibitor

in conformation, and treatment of cells with LXH254 promotes BRAF/ consistent with results from both the biochemical and KINOMEscan CRAF heterodimer formation most likely due to antagonism of the profiling (35). Moreover, weaker binding of LXH254 to p38a in both autoinhibited state of the kinase, which enables RAS-mediated dimer binding assay formats corresponds to relatively poor biochemical ¼ m formation (35, 36). We further extended characterization of RAF inhibition of this kinase (IC50 2.1 mol/L), relative to BRAF inhibition by LXH254 in several ways. First, we measured the bio- (0.0002 mmol/L) and CRAF (0.00007 mmol/L). Collectively, these data chemical inhibition of ARAF, BRAF, and CRAF by LXH254 (Fig. 1A). indicate that within the kinome, LXH254 is highly selective for RAF Consistent with values reported previously (35), LHX254 inhibited kinases. BRAF and CRAF with IC50 values of 0.2 and 0.07 nmol/L, respectively. In vitro in vivo Inhibition of ARAF, while robust, occurred with a higher IC50 value of and activity of LXH254 6.4 nmol/L. Second, the ability of LXH254 to promote B/CRAF We next profiled 291 cell lines for sensitivity to LXH254 in a high- heterodimer formation of endogenous proteins was examined in three throughput format (Supplementary Table S3). Using IC50 value cutoffs RAS-mutant cell lines via IP-Western blot analysis (Fig. 1B). In all ranging from 1 to 2.5 mmol/L, concentrations that approximate Cavg instances, both LXH254, and the type II RAF inhibitor, LY3009120 (37) concentrations in clinic (data not shown), we found that cell lines V600E/K promoted heterodimer formation as judged by analysis of pull-downs harboring BRAF , as well as activating mutations in NRAS, were using either BRAF- or CRAF-directed antibodies. MEK1 and MEK2 enriched in the subset of sensitive cells. KRAS mutants were only were not detected in either BRAF or CRAF IPs, however, both BRAF weakly enriched, with cells lacking RAS/RAF mutations being pre- < m and CRAF were detected upon compound treatment following immu- dominantly insensitive (22/146 with an IC50 2 mol/L; Supplemen- noprecipitation with MEK1/2-directed antibodies. Finally, we com- tary Fig. S1A; Supplementary Table S3). In the case of wild-type cell pared the relative ability of LXH254 to inhibit monomeric BRAFV600E lines, in an insensitive model tested, LXH254 effectively suppressed in A-375 cells compared with RAS-induced wild-type RAF dimers in RAF signaling, suggesting that some insensitivity may result from a G13D HCT 116 KRAS cells. For this assessment we used an approach lack of pathway dependence (Supplementary Fig. S3F). To identify described by Yao and colleagues (22), in which cells were preincubated potential marker of either resistance or sensitivity in MAPK-altered and subsequently washed following treatment with 1 mmol/L encor- models, we performed differential gene expression analysis, in both the afenib such that inhibition likely reflects LXH254 binding to the second entire set of cell lines, as well as the KRAS-, NRAS-, and BRAF-mutant protomer in RAF dimers unoccupied by encorafenib. In contrast to the subsets. Unfortunately, this analysis did not reveal any predictors of approximately 600-fold greater inhibition of monomeric BRAFV600 sensitivity beyond melanoma lineage makers in the BRAF subset, versus wild-type dimeric RAF by dabrafenib, which we reported which was likely a consequence of the high fraction of BRAFV600E previously, LXH254 displayed similar inhibition of monomeric models derived from this lineage (Supplementary Table S9). Cell line V600 BRAF and wild-type dimeric RAF (IC50 for p-ERK levels of 59 sensitivities to LXH254 were very similar to those previously obtained and 78 nmol/L in A-375 and HCT 116 cells, respectively, Fig. 1C). for the type II RAF inhibitor, RAF709 (ref. 25; Supplementary An issue that has potentially limited the efficacy of type II RAF Fig. S1B). inhibitors in clinic is a lack of selectivity for RAF versus other We subsequently examined the antitumor effects of LXH254 in a set kinases (37–39). LXH254 displayed a high degree of selectivity for of BRAF-, NRAS-, and KRAS-mutant xenograft models, as well as a BRAF and RAF-1 (CRAF) relative to other kinases, as judged by RAS/RAF wild-type model. In general, and concordant with cell line KINOMEscan (35). We further interrogated the selectivity of LXH254 sensitivity in vitro, models harboring BRAF mutations either alone V600E in two orthogonal screening formats. First, in biochemical assays (e.g., BRAF ) or coincident with either activated NRAS (SK-MEL- fi > m KRAS using puri ed proteins, LXH254 had IC50 values 10 mol/L against 30) or (HEYA8 and 1855HCOX), either regressed or demon- 60 of 62 non-RAF kinases, with only MAPK14 (p38a) and ABL1 strated prolonged stasis following treatment with LXH254 (Fig. 2A–C; having IC50 values below 10 mmol/L (2.1 and 4.1 mmol/L, respectively; Supplementary Table S7). In contrast to RAF-mutant models, and Supplementary Table S1). Second, we profiled LXH254 using the similar to in vitro cell line data, the majority of KRAS-mutant models, KiNativ platform, wherein kinase selectivity is determined in cells via as well as the RAS/RAF wild-type model, displayed best modest competition with an ATP competitive covalent probe followed by mass responses to LXH254, although there were notable outliers (e.g., spectrometry (29). In HCT 116 cells incubated for 2 hours with 10 Calu-6 cells; Fig. 2D; Supplementary Table S7). When examined in mmol/L LXH254, the only kinases where probe binding was inhibited a subset of models, pathway inhibition was consistent with antitumor >80% were BRAF (90%) and CRAF (88%; Fig. 1D; Supplementary results (Fig. 2A–D). Table S2). Beyond BRAF and CRAF, only two, ARAF (58%) and p38a (66%), of the additional 184 kinases, detected in this cell line, dem- Loss of ARAF expression sensitizes RAS-mutant cells to LXH254 onstrated >50% inhibition of probe binding. High selectivity for BRAF On the basis of the dual observations that (i) LXH254 had reduced and CRAF, and to a lesser extent for p38a, in HCT 116 cells was binding of ARAF relative to BRAF and CRAF in the Kinativ assay and

Table 1.

pERK IC50 (nmol/L) Cell line variant SK-MEL-30 MEL-JUSO HCT 116 COR-L23 Mia PaCa-2 Mia PaCa-2 (24 hours)

Wild-type 90 77 12 889 687 >10,000 ARAFD 60 10 5 43 85 170 BRAFD 650 94 18 1,072 262 >10,000 CRAFD 300 531 357 1,358 3,627 >10,000

Note: p-ERK IC50 results as measured by MSD.

AACRJournals.org Clin Cancer Res; 2021 OF5

Monaco et al.

Figure 2. Representative xenograft models treated with LXH254. Changes in tumor volume over time (days, left) and changes in DUSP6 mRNA level (right) after a single administration of LXH254 for the WM-793 (BRAFV600E, A), SK-MEL-30 (NRASQ61K and BRAFD287H, B), HEYA8 (KRASG12D and BRAFG464E, C), and 3390HPAX (KRASG12D, D) models. In all compound-treated models, LXH254 was given at 100 mg/kg, every day (QD). Tumor over control (T/C) determinations were made at the time when control animals were sacriﬁced because of tumor size (1,000–1,500 mm3) and denoted with an asterisk.

(ii) RAS mutants, particularly KRAS, are largely insensitive to decreased sensitivity to LXH254 (Table 1). Moreover, in both HCT LXH254, we hypothesized that insensitivity might stem from 116 cells and MIA PaCa-2 cells, where p-ERK levels were monitored poor ARAF inhibition by LXH254. To test this hypothesis, we used beyond 4 hours, the difference in p-ERK reduction by LXH254 CRISPR-Cas9 or zinc finger nucleases to functionally delete ARAF, between cells lacking versus expressing ARAF increased further BRAF, or CRAF from a series of RAS-mutant cell lines, including two (Table 1; Supplementary Fig. S3A). Thus, increased sensitivity to NRAS-mutant melanoma cell lines (MEL-JUSO and SK-MEL-30), LXH254 in cells lacking ARAF corresponds to improved pathway and three KRAS-mutant cell lines (COR-L23, MIA PaCa-2, and HCT suppression. Reduced, albeit transient pathway inhibition by LXH254 116; Supplementary Fig. 2). Loss of ARAF expression resulted in 3- to in cells lacking CRAF suggests that in the absence of CRAF, ARAF 11-fold increases in sensitivity to LXH254 relative to parental cell lines might play a larger role in signaling. To test this, we immunopreci- in all models tested (Fig. 3; Supplementary Table S3). Loss of BRAF did pitated ARAF and BRAF from parental and CRAF-deficient MIA not alter sensitivity to LXH254 in the wild-type BRAF cell lines; PaCa-2 cells following 2 and 24 hours of incubation with 1 mmol/L however, loss of BRAF expression in NRAS-mutant SK-MEL-30 cells, LXH254. In parental cells, increasing amounts of BRAF and CRAF which also harbor a kinase-impaired class III variant (BRAFD287H; copurified with immunoprecipitated ARAF over time after LXH254 ref. 40), greatly reduced sensitivity to LXH254 (14-fold). Loss of CRAF treatment (Supplementary Fig. S3B). Similarly, increasing amounts of either did not change (MIA PaCa-2 and COR-L23) or only slightly both ARAF and, more prominently, CRAF copurified with BRAF. In altered (HCT 116) sensitivity to LXH254 in KRAS-mutant models; cells lacking CRAF expression, similar patterns of increasing levels of however, CRAF loss in both NRAS-mutant cell lines reduced copurified BRAF following ARAF pull-down, and ARAF following sensitivity to LXH254 by 3- to 9-fold. In contrast, loss of any of BRAF pull-down were observed. However, in the absence of CRAF, the three RAF paralogs did not consistently alter sensitivity to either greater amounts of BRAF/ARAF heterodimers were present at all the MEK1/2 inhibitor, trametinib, or ERK1/2 inhibitor, ulixertinib times despite similar efficiencies of immunoprecipitation. Moreover, (Supplementary Tables S4 and S8). increased levels of BRAF/ARAF heterodimers in CRAF-deficient cells We then examined the effect of loss of the various RAF proteins on following the 2-hour LXH254 treatment corresponded to failure of pathway suppression by LXH254. Cells were treated with increasing LXH254 to inhibit signaling. These data are consistent with a model concentrations of LXH254 for 4 hours, and in some cases for 24, 48, where LXH254 has reduced ability to suppress MAPK signaling driven and 72 hours, and p-ERK levels were determined using the MSD by ARAF and further that the contribution of ARAF to MAPK platform, and/or Western blot analysis using antibodies that detect signaling increases in the absence of CRAF expression. phosphorylated ERK1/2. Loss of ARAF improved pathway suppression by LXH254 relative to parental cells and cells lacking either BRAF ARAF-mediated resistance to LXH254 is dependent on both or CRAF (Table 1; Supplementary Fig. S3A). Similarly, reduced ARAF kinase activity and ability to form dimers pathway inhibition occurred in cases where loss of BRAF (SK- To determine whether ARAF-mediated LXH254 insensitivity MEL-30) or CRAF (SK-MEL-30 and MEL-JUSO) expression depends on ARAF catalytic function or the ability to form RAF dimers,

OF6 Clin Cancer Res; 2021 CLINICAL CANCER RESEARCH

LXH254 a Potent and Selective BRAF and CRAF Inhibitor

MEL-JUSO (NRASQ61L) SK-MEL-30 (NRAS Q61K, BRAFD287H) 125 125

100 100

75 75 Parental ARAF knockout 50 50 BRAF knockout CRAF knockout % Control growth 25 % Control growth 25

0 0 1 10 100 1,000 10,000 1 10 100 1,000 10,000 LXH254 (nmol/L) LXH254 (nmol/L)

COR-L23 (KRAS G12V) HCT 116 (KRAS G13D) MIA PaCa-2 (KRAS G12C) 125 125 125

100 100 100

75 75 75

50 50 50 % Control growth % Control growth 25 % Control growth 25 25

0 0 0 1 10 100 1,000 10,000 1 10 100 1,000 10,000 1 10 100 1,000 10,000 LXH254 (nmol/L) LXH254 (nmol/L) LXH254 (nmol/L)

Figure 3. Loss of ARAF expression sensitizes RAS-mutant cell lines to LXH254. Shown are proliferation curves for ﬁve cell lines and derived variants lacking expression of either ARAF, BRAF, or CRAF. Cell line identity and RAS (or RAF) mutation status are shown above each graph. Concentrations of LXH254 (nmol/L) and percentage of cells remaining relative to an untreated control, as judged by ATP levels, are given on the x-axis and y-axis, respectively. Effects of LXH254 on proliferation were determined after either 3 (MEL-JUSO, SK-MEL-30, HCT 116, and MIA PaCa-2) or 5 (COR-L23) days of incubation with LXH254.

we reintroduced either N-terminally FLAG-tagged wild-type ARAF, cells treated for 24 hours with LXH254, and RAF kinase activity was kinase dead ARAF (K336M or D447A), or dimer-deficient ARAF assessed using recombinant MEK1 as a substrate for the immunopre- (R362H) variants into cells lacking endogenous ARAF. In all models cipitated material and monitoring production of phosphorylated examined, reintroduction of wild-type ARAF reverted sensitivity to MEK1 (p-MEK1) using a phospho-MEK–specific antibody. IP- LXH254 to levels seen in parental cells (Fig. 4A and B). In contrast, kinase assays using precipitates from all ARAFwt-expressing cells expression of either kinase dead variants, K336M (Fig. 4A and C) produced p-MEK1 (Fig. 5A–D). In MEL-JUSO and COR-L23 cells, and D447A (Fig. 4B and C), or dimer-deficient variant, ARAFR362H IP-kinase activity was largely dependent on pretreatment of cells with (Fig. 4B), did not revert sensitivity to LXH254. Concordant with LXH254 (Fig. 5A and C), although examination of IP-kinase activity sensitivity to LXH254, overexpression of wild-type ARAF, but from lysates from wild-type cells suggest that stimulation of ARAF neither kinase dead nor dimer-deficient ARAF, reduced pathway kinase activity by LXH254 pretreatment occurred only in the context suppression by LXH254 (Supplementary Table S5). Failure of of ARAF overexpression (Supplementary Fig. S3C). Phosphorylated kinase dead and dimer-deficient variants to complement loss of MEK1 was unlikely to result from autophosphorylation by recombi- endogenous ARAF did not result from poor transgene expression, nant MEK1, as IP-kinase assays carried out in HEK293 cells using as protein levels of all introduced ARAF variants exceeded the recombinant catalytically inert MEK1K97M also generated phosphor- expression of endogenous ARAF, although it should be noted that ylated MEK1 (Supplementary Fig. S3D). Cells expressing ARAFK336M kinase dead variants were consistently expressed at lower levels than or ARAFD447A either produced significantly less (COR-L23) or failed either wild-type or dimer-deficient versions of ARAF (Supplemen- to generate detectable p-MEK1 despite similar efficiencies of ARAF tary Fig. S2). immunoprecipitation. In all cell lines expressing exogenous wild-type To ensure that kinase dead and dimer-deficient RAF variants lacked and kinase dead ARAF variants, treatment with LXH254 promoted kinase activity and failed to form heterodimers, respectively, we heterodimer formation between ARAF and both BRAF and CRAF, performed IP-kinase assays using material isolated from RAS- with the exception of MEL-JUSO cells, where only ARAF-CRAF mutant cell lines expressing the various FLAG-tagged ARAF variants. heterodimers were detected. In contrast, IPs from HCT 116 and In these experiments, the MEL-JUSO, HCT 116, and MIA PaCa-2, but MEL-JUSO cells expressing ARAFR362H were largely devoid of both not COR-L23, cell lines lacked endogenous ARAF expression due to BRAF and CRAF and generated very little p-MEK1. These data CRISPR/Cas9 editing. ARAF was immunoprecipitated using antibo- indicate that kinase dead and dimer-impaired variants lack catalytic dies directed against the FLAG epitope from either untreated cells, or activity and heterodimer forming capability, respectively. Failure of

AACRJournals.org Clin Cancer Res; 2021 OF7

Monaco et al.

Figure 4. Expression of either kinase dead or dimer-deﬁcient ARAF fails to reverse sensitivity to LXH254 in cells lacking ARAF expression. Shown are proliferation curves for the COR-L23, MIA PaCa-2, HCT 116, and MEL-JUSO cell lines, both wild-type (closed blue circle) and variants lacking ARAF expression (closed green triangle). Also shown are proliferation curves for cell lines lacking endogenous ARAF expression, but expressing exogenous wild-type ARAF (closed black diamond), kinase-impaired ARAF (closed purple square), either K336M (A) or D447A (B), or dimer-deﬁcient R362H ARAF (closed orange triangle). Effects of LXH254 on proliferation were determined after either 3 (MEL-JUSO, SK-MEL-30, HCT 116, and MIA PaCa-2) or 5 (COR-L23) days of incubation with LXH254. In the case of MIA PaCa-2 cells shown in A, expression of exogenous ARAF variants was under the transcriptional control of the doxycycline (dox)-regulated TET-3G promoter with cells grown in the absence of doxycycline depicted with hashed lines. IC50 values determined for the curves shown in A and B are provided in C. Values denoted with and were determined in the absence of presence of doxycycline, respectively.

these variants to restore LXH254 insensitivity indicates that both (Fig. 6A). After 4 hours of treatment, LXH254 effectively inhibited catalytic function and the ability to dimerize are required for signaling in BRAF- and CRAF-only cells, with IC50 values below ARAF-mediated resistance to LXH254. 100 nmol/L (Fig. 6B). In contrast, in ARAF-only cells, signal inhibition required higher drug concentrations with IC50 values measured at Cells expressing only ARAF are less sensitive to LXH254 than >1,500 nmol/L in all cell lines (Fig. 6B; Supplementary Table S6). cells expressing only BRAF or CRAF Moreover, treatment of all ARAF-only cell lines with LXH254 resulted To investigate further differential inhibition of RAF paralogs by in modestly increased p-ERK (25%–50%) at LXH254 concentrations LXH254, we generated isogenic cell lines using CRISPR/Cas-9 that ranging from 10 to 370 nmol/L in a manner reminiscent of paradoxical expressed only one of the three RAF genes. Clonal isolates expressing activation described for type 1/1.5 RAF inhibitors (41–43). As described only ARAF (BRAFD/CRAFD) or CRAF (ARAFD/BRAFD) were gen- previously for cells lacking ARAF (Fig. 3; Table 1), pathway reactivation erated in HCT 116, MIA PaCa-2, and MEL-JUSO cells. BRAF-only over time after LXH254 treatment in BRAF- and CRAF-only cells was cells were more difﬁcult to generate, and while MIA PaCa-2 (ARAFD/ reduced relative to parental cells (Supplementary Fig. S3E). CRAFD) cells were generated, BRAF-only HCT 116 cells maintained a To compare the effects of LXH254 on signaling with that of a type low level of CRAF (ARAFD/CRAF-low) and we were unable to 1.5 inhibitor, we treated parental and individual RAF paralog– generate BRAF-only MEL-JUSO cells (Supplementary Fig. S2). Con- expressing MIA PaCa-2 cells for 4 hours with the type 1.5 RAF sistent with results in cells lacking ARAF (Fig. 4), BRAF-only and inhibitor, dabrafenib, and measured the effects on p-ERK levels by CRAF-only cells were 5- to 10-fold more sensitive to LXH254 in 3-day MSD. Consistent with previous results reported in RAS-mutant growth assays than parental cells (Fig. 6A; Supplementary Table S6). models, treatment of MIA PaCa-2 cells with dabrafenib resulted in In contrast, ARAF-only cells were less (HCT 116 and MEL-JUSO) or increased p-ERK levels to a peak approximately 4-fold greater than similarly sensitive (MIA PaCa-2) to LXH254 than parental cells baseline at concentrations up to 3 mmol/L (Fig. 6C). At concentrations

OF8 Clin Cancer Res; 2021 CLINICAL CANCER RESEARCH

LXH254 a Potent and Selective BRAF and CRAF Inhibitor

Figure 5. Kinase-impaired and dimer-deﬁcient ARAF variants lack in vitro kinase activity and have reduced interactions with BRAF and CRAF, respectively. Shown are Western blots using the indicated antibodies performed on either whole-cell lysates (WCL) or material immunoprecipitated using a FLAG-directed antibody (IP:FLAG) from COR-L23 (A), MIA PaCa-2 (B), MEL-JUSO (C), and HCT 116 (D) cell lines. In the cases of COR-L23 and MIA PaCa-2 cells, exogenously expressed ARAF variants were under the transcriptional control of the doxycycline (dox)-regulated TET-3G promoter. Concentrations of LXH254 used for cell line pretreatment are shown above each sample. For the IP-kinase assay, puriﬁed recombinant HISx6-tagged MEK1 and ATP were added to immunoprecipitated material. exceeding 3 mmol/L, p-ERK levels declined, returning to original observed, however, increases were modest (50%) relative to what baseline levels at dabrafenib concentrations of 10 mmol/L. Dabrafenib occurred in parental and CRAF-only cells. These data are consistent exerted distinctly different effects on p-ERK levels in cells expressing with previous reports suggesting that CRAF activation is the major only one of each of the three RAF proteins. In CRAF-only cells, driver of paradoxical activation (17, 41, 44). Comparing the effects of treatment with dabrafenib resulted in a similar pattern of pathway signaling indicated that while both drugs similarly and modestly activation to parental MIA PaCa-2 cells, although activation was subtly induced paradoxical activation in ARAF-only–expressing cells, greater at all concentrations up to approximately 600 nmol/L. In cells LXH254, but not dabrafenib, is able to inhibit wild-type BRAF and expressing only BRAF or ARAF, increases in p-ERK levels were also CRAF in cells (Fig. 6B and C)

AACRJournals.org Clin Cancer Res; 2021 OF9

Monaco et al.

Figure 6. RAS-mutant cells expressing only ARAF are resistant to LXH254. Shown are proliferation (A) and p-ERK (B) inhibition curves for parental (closed blue circles) HCT 116, MIA PaCa-2, and MEL-JUSO cell lines, as well as variants lacking BRAF and CRAF expression (closed maroon triangles), ARAF and BRAF expression (closed light blue triangles), and ARAF and CRAF expression (closed green squares), following treatment with increasing concentrations of LXH254. In all cases, changes in cell number were determined after 72 hours and p-ERK levels after 4 hours of incubation with LXH254. p-ERK levels following 4 hours of treatment of MIA PaCa-2 cells with increasing concentrations of either LXH254 or dabrafenib are shown in C.

RAS mutants lacking ARAF are more sensitive to LXH254 in vivo (MIA PaCa-2, M2, and M5) became resistant due to RAF pathway We next determined the effect of ARAF ablation on sensitivity to reactivation, with reactivation in one case potentially attributable to MAPK inhibitors in vivo. Tumors formed from parental and ARAF- restoration of ARAF expression (M5). Lack of clear pathway reacti- deleted variants of the HCT 116, MIA PaCa-2, and MEL-JUSO models vation in the other six tumors suggested resistance occurred via a were treated with vehicle, 0.3 mg/kg every day trametinib, or 50 mg/kg MAPK bypass mechanism (Supplementary Fig. S4D). Strikingly, two twice a day LXH254. Doses of trametinib and LXH254 were selected of three of the regressed HCT 116 tumors failed to regrow after that matched AUC values for the approved dose of trametinib (2 mg, cessation of drug treatment consistent with complete eradication of twice a day) or the recommended phase II dose of LXH254 (400 mg, the tumor (Supplementary Fig. S4A). In contrast, variants lacking twice a day). ARAF-deleted xenografts either grew with similar kinetics ARAF expression had similar sensitivities to trametinib as parental (HCT 116 cells) or slightly slower (MIA PaCa-2 and MEL-JUSO) than MIA PaCa-2 cells. their parental counterparts, indicating that ARAF ablation has at most These data indicate that RAS-driven activation of BRAF and CRAF modest effects on the fitness of these models. In all parental models, is inhibited sufficiently by LXH254 to eradicate tumors, and conversely LXH254 and trametinib exerted similar effects on tumor growth, that poor ARAF inhibition is a critical contributor to the relative resulting in a slow growth phenotype, which was most pronounced insensitivity of RAS-mutant models to LXH254. Accordingly, we in MEL-JUSO cells (Fig. 7A–C). Treatment with LXH254 in the ARAF tested whether cotreatment of tumors with LXH254 and low doses knockouts led to complete regression of HCT 116 and MEL-JUSO and of trametinib, aimed at inhibiting residual ARAF-driven signaling, near-complete regression of MIA PaCa-2 xenografts. Several tumors improved antitumor effects in MIA PaC-2 cells. Combining LXH254 from each KRAS-mutant models regrew after prolonged treatment, with either 50% (0.3 mg/kg, every 2 days) or 10% (0.03 mg/kg once a including three of six from the HCT 116 and five of six of the MIA day) doses of trametinib improved efficacy relative to both LXH254 PaCa-2 tumors (Supplementary Fig. S4A–S4C). Initial analysis of these and a full dose of trametinib (0.3 mg/kg, twice a day), although efficacy variants by Western blot analysis suggested that at least two tumors was inferior to that seen for single-agent LXH254 in cells lacking ARAF

OF10 Clin Cancer Res; 2021 CLINICAL CANCER RESEARCH

LXH254 a Potent and Selective BRAF and CRAF Inhibitor

Figure 7. RAS-mutant cell lines lacking ARAF are sensitive to LXH254 in vivo. Shown are changes in tumor volume until the time of T/C determination results for HCT 116 (A), MIA PaCa-2 (B and D), and MEL-JUSO (C) models. Parental models are denoted with solid lines and variants lacking ARAF expression with dashed lines. Vehicle treated animals are shown in black (open squares), 0.3 mg/kg trametinib daily treated in blue (open triangles), and 50 mg/kg LXH254 twice a day in red (open circles). D, The MIA PaCa-2 model treated as in B, but with additional combinations of 50 mg/kg LXH254 twice a day with either 0.3 mg/kg once every 2 days (open purple hexagons) or 0.03 mg/kg daily (open green diamonds) trametinib. , P ¼ 0.0007; , P ¼ 0.0001, against vehicle by one-way ANOVA.

(Fig. 7D), and tumors regrew over time (data not shown). Thus, LXH254 did not translate to robust inhibition in the cellular setting. combining LXH254 with even small amounts of an MEK inhibitor can Ablation of ARAF expression in five of five RAS-mutant cell lines result in significant antitumor effects. resulted in more potent antiproliferative effects and RAF/MEK/ERK signal suppression by LXH254 (Fig. 3; Table 1). The mechanistic basis for the failure of LXH254 to inhibit ARAF is Discussion unknown and insights into a structural explanation are hampered by LXH254 is a type II RAF inhibitor with a high degree of the lack of a crystal structure for ARAF. However, as suggested here selectivity for BRAF and CRAF, which predominantly binds the (Supplementary Table S8) and elsewhere (37), failure to inhibit ARAF inactive, DFG-out kinase configuration, and promotes the forma- may not be a property of all type II RAF inhibitors. Simulations of tion of BRAF/CRAF heterodimers (ref. 35; Fig. 1; Supplementary ARAF structure using information available for BRAF and CRAF (see Tables S1 and S2). LXH254 treatment also promoted MEK1/2– Materials and Methods) suggest a possible explanation for reduced B/CRAF interactions in IPs using MEK-directed antibodies, activity of LXH254 against ARAF (Supplementary Fig. S5B). The however, this interaction was not reciprocated in IPs using RAF- terminal hydroxyl group of the alkane chain of LXH254 forms a directed antibodies. This discrepancy may be an artifact due to the hydrogen bond with the backbone carbonyl of F595 in BRAF (and choice of RAF antibodies used for the IPs. Alternatively, this may CRAF) in the DFG-out configuration of the protein (35). Simulations reflect the existence of a substantial pool of dimerized RAF that is of the ARAF structure place this carbonyl shifted to a position more not complexed with MEK1/2. proximal to the hydroxyl group on LXH254, which would likely Here, we further describe an unexpected paralog selectivity of this eliminate this hydrogen bond, instead creating a steric clash. Inter- molecule, wherein it is a relatively poor inhibitor of ARAF. Poor ARAF estingly, RAF709, a similarly poor inhibitor of ARAF (Supplementary inhibitory activity in cells was somewhat unanticipated on the basis of Table S8) also forms a hydrogen bond with the same carbonyl on F595, biochemical analysis that indicated single-digit nmol/L inhibition of albeit via a water intermediary, which is also predicted to be lost in the ARAF kinase in cell-free assays. However, as has been described for ARAF. An understanding of the basis for the decreased inhibitory CRAF inhibition by type 1.5 inhibitors, in vitro inhibition of ARAF by activity of LXH254 against ARAF requires further study.

AACRJournals.org Clin Cancer Res; 2021 OF11

Monaco et al.

Roles for ARAF in promoting signal transduction in a scaffold- when compared with single-agent treatments in preclinical species ing rather than catalytic capacity have been described previous- (manuscript in preparation). Moreover, combinations between ly (45). However, we found that ARAF-mediated insensitivity to LXH254 and the MEK inhibitor, trametinib, and ERK inhibitor, LXH254 was dependent on ARAF having both kinase activity and LTT462, are currently in dose expansion in patients with a variety the ability to form dimers, strongly suggesting that failure of of RAS/RAF pathway alterations. LXH254 to inhibit ARAF catalytic activity while ensconced as an active member of RAF signaling complexes underlies this pheno- Authors’ Disclosures type. In RAS-mutant tumors engineered to express only ARAF, M. Jaskelioff reports employment with Novartis Institutes for Biomedical LXH254 paradoxically activated signaling to a similar degree, and Research during the conduct of this study. J.A. Engelman reports employment with a similar bell-shaped dose–response curve to the type 1.5 with Novartis and equity in Novartis. D.D. Stuart reports other from Novartis inhibitor, dabrafenib (Fig. 6). In contrast, in RAS-mutant cells during the conduct of the study and outside the submitted work, as well as has a expressing only BRAF or CRAF, LXH254 potently inhibited sig- patent for drug combinations pending to Novartis. V.G. Cooke reports a patent for WO2018/203219 pending, as well as employment with Novartis and naling, whereas dabrafenib caused pathway activation, most nota- ownership of Novartis stock. G. Caponigro reports other from Novartis bly in cells expressing CRAF. Collectively, these data suggest a Institutes for Biomedical Research outside the submitted work. No disclosures model where LXH254 potently inhibits dimeric BRAF and CRAF, were reported by the other authors. but paradoxically activates ARAF-containing dimers (Supplemen- tary Fig. S5A). Authors’ Contributions In the phase I dose escalation trial of LXH254, very few partial K.-A. Monaco: Data curation, formal analysis, investigation, methodology, responses to single-agent LXH254 were observed (46). This trial was writing-review and editing. S. Delach: Data curation, formal analysis, enriched for KRAS-mutant tumors (30%) and consistent with investigation, methodology, writing-review and editing. J. Yuan: Investigation. preclinical data presented herein; the majority of patients with Y. Mishina: Investigation, writing-review and editing. P. Fordjour: Investigation, KRAS-mutant disease progressed on treatment, although a minority writing-review and editing. E. Labrot: Investigation, writing-review and editing. D. McKay: Investigation, writing-review and editing. R. Guo: Investigation. of these patients displayed stabilization of disease. On the basis of fi S. Higgins: Investigation. H.Q. Wang: Investigation. J. Liang: Investigation. the ndings here, LXH254 might have single-agent activity only in K. Bui: Investigation. J. Green: Investigation. P. Aspesi: Investigation. RAS-mutant tumors with either low expression or utilization of J. Ambrose: Supervision, investigation. P. Mapa: Supervision. L. Griner: ARAF. However, no correlation was found between ARAF mRNA Supervision. M. Jaskelioff: Supervision, investigation. J. Fuller: Investigation. expression and sensitivity to LXH254, either in the entire panel of K. Crawford: Investigation. G. Pardee: Investigation. S. Widger: Resources, cell lines profiled, or within specific RAS/RAF-mutated subgroups supervision, investigation, writing-review and editing. P.S. Hammerman: Conceptualization, resources, supervision, writing-review and editing. in vitro (Supplementary Fig. S1C). Moreover, analysis of RAS- fi J.A. Engelman: Conceptualization, resources, supervision, writing-review and mutant tumors in TCGA did not reveal a clearly identi able subset editing. D.D. Stuart: Conceptualization, supervision, investigation, methodology, of RAS-mutant tumors with intrinsically low ARAF expression (ref. writing-review and editing. V.G. Cooke: Conceptualization, data curation, formal 47; Supplementary Fig. S1D). Thus, the primary utility of LXH254 is analysis, supervision, investigation, methodology, writing-original draft, writing- likely to be in combination with additional agents targeting the review and editing. G. Caponigro: Conceptualization, data curation, formal MAPK pathway. analysis, supervision, investigation, writing-original draft. Consistent with this hypothesis, we found that adding even low Acknowledgments doses of trametinib to a full dose of LXH254 improved antitumor We thank David Kodack, Qing Shen, Tina Yuan, Rita Das, Flavio Somanji, Huyen activity relative to single-agent effects in the MIA PaCa-2 model Nguyen, Huaixiang Hao, and Albot Liu for critical reading and comments on the (Fig. 7D). The observation that adult mice tolerate simultaneous loss article. We thank Jodi Meltzer, Qamrul Hassan, Yingyun Wang, and Malika Singh for of BRAF and CRAF (8) suggests that poor ARAF inhibition may technical contributions to the generation of RAF paralog–knockout models, BRAF improve LXH254 tolerability relative to, for example, MEK and ERK and CRAF biochemical assays, and in vivo PC3 experiment. inhibitors, thereby facilitating the achievement of drug exposures where both BRAF and CRAF are strongly inhibited. Such improved The costs of publication of this article were defrayed in part by the payment of page advertisement tolerability might also facilitate combinations with additional MAPK charges. This article must therefore be hereby marked in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. inhibitors for the treatment of RAS-mutant tumors, resulting in improved pathway suppression and antitumor effects. In support of this idea, LXH254-anchored MAPK combinations, such as those Received July 2, 2020; revised October 2, 2020; accepted December 16, 2020; described in Fig. 7, display a superior tolerability/efficacy relationship published first December 22, 2020.

References 1. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio 5. Ostrem JM, Peters U, Sos ML, Wells JA, Shokat KM. K-Ras(G12C) inhibitors cancer genomics portal: an open platform for exploring multidimensional cancer allosterically control GTP affinity and effector interactions. Nature 2013;503: genomics data. Cancer Discovery 2012;2:401–4. 548–51. 2. Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, et al. Integrative 6. Patricelli MP, Janes MR, Li LS, Hansen R, Peters U, Kessler LV, et al. Selective analysis of complex cancer genomics and clinical profiles using the cBioPortal. inhibition of oncogenic KRAS output with small molecules targeting the inactive Science Signaling 2013;6:pl1. state. Cancer Discov 2016;6:316–29. 3. Janes MR, Zhang J, Li LS, Hansen R, Peters U, Guo X, et al. Targeting KRAS 7. Uehling DE, Harris PA. Recent progress on MAP kinase pathway inhibitors. mutant cancers with a covalent G12C-specific inhibitor. Cell 2018;172:578– Bioorg Med Chem Lett 2015;25:4047–56. 89 e17. 8. Blasco RB, Francoz S, Santamaria D, Canamero M, Dubus P, Charron J, 4. Lito P, Solomon M, Li LS, Hansen R, Rosen N. Allele-specific inhibitors et al. c-Raf, but not B-Raf, is essential for development of K-Ras inactivate mutant KRAS G12C by a trapping mechanism. Science 2016;351: oncogene-driven non-small cell lung carcinoma. Cancer Cell 2011;19: 604–8. 652–63.

OF12 Clin Cancer Res; 2021 CLINICAL CANCER RESEARCH

LXH254 a Potent and Selective BRAF and CRAF Inhibitor

9. Abe H, Kikuchi S, Hayakawa K, Iida T, Nagahashi N, Maeda K, et al. Discovery of 28. Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, et al. RNA-guided a highly potent and selective MEK inhibitor: GSK1120212 (JTP-74057 DMSO human genome engineering via Cas9. Science 2013;339:823–6. solvate). ACS Med Chem Lett 2011;2:320–4. 29. Nomanbhoy TK, Sharma G, Brown H, Wu J, Aban A, Vogeti S, et al. Chemo- 10. Chapman PB, Hauschild A, Robert C, Haanen JB, Ascierto P, Larkin J, et al. proteomic evaluation of target engagement by the cyclin-dependent kinase 4 and Improved survival with vemurafenib in melanoma with BRAF V600E mutation. 6 inhibitor palbociclib correlates with cancer cell response. Biochemistry 2016; N Engl J Med 2011;364:2507–16. 55:5434–41. 11. Davies BR, Logie A, McKay JS, Martin P, Steele S, Jenkins R, et al. AZD6244 30. Law CW, Chen Y, Shi W, Smyth GK. voom: Precision weights unlock linear (ARRY-142886), a potent inhibitor of mitogen-activated protein kinase/extra- model analysis tools for RNA-seq read counts. Genome Biol 2014;15:R29. cellular signal-regulated kinase kinase 1/2 kinases: mechanism of action in vivo, 31. Group CCG. 2018MOE 2018.01. Available from: https://www.chemcomp.com/ pharmacokinetic/pharmacodynamic relationship, and potential for combina- index.html. tion in preclinical models. Mol Cancer Ther 2007;6:2209–19. 32. Maier JA, Martinez C, Kasavajhala K, Wickstrom L, Hauser KE, Simmerling C. 12. Delord JP, Robert C, Nyakas M, McArthur GA, Kudchakar R, Mahipal A, et al. ff14SB: improving the accuracy of protein side chain and backbone parameters Phase I dose-escalation and -expansion study of the BRAF inhibitor encorafenib from ff99SB. J Chem Theory Comput 2015;11:3696–713. (LGX818) in metastatic BRAF-mutant melanoma. Clin Cancer Res 2017;23: 33.BaylyC,McKayD,TruchonJ-F.An informal AMBER small molecule 5339–48. force field: 908 parm@Frosst. Available from: http://www.ccl.net/cca/data/ 13. Dummer R, Ascierto PA, Gogas HJ, Arance A, Mandala M, Liszkay G, et al. parm_at_Frosst/. Encorafenib plus binimetinib versus vemurafenib or encorafenib in patients with 34. DA Case RMB, Cerutti DS, Cheatham TE, Darden TA III, Duke RE, Giese TJ, BRAF-mutant melanoma (COLUMBUS): a multicentre, open-label, rando- Gohlke H, et al. AMBER 2016 reference manual, San Francisco, CA: University mised phase 3 trial. Lancet Oncol 2018;19:603–15. of California; 2016. 14. Flaherty KT, Robert C, Hersey P, Nathan P, Garbe C, Milhem M, et al. Improved 35. Ramurthy S, Taft BR, Aversa RJ, Barsanti PA, Burger MT, Lou Y, et al. Design survival with MEK inhibition in BRAF-mutated melanoma. N Engl J Med 2012; and discovery of N-(3-(2-(2-Hydroxyethoxy)-6-morpholinopyridin-4-yl)-4- 367:107–14. methylphenyl)-2-(trifluorom ethyl)isonicotinamide, a selective, efficacious, and 15. Gilmartin AG, Bleam MR, Groy A, Moss KG, Minthorn EA, Kulkarni SG, et al. well-tolerated RAF inhibitor targeting RAS mutant cancers: the path to the clinic. GSK1120212 (JTP-74057) is an inhibitor of MEK activity and activation with J Med Chem 2020;63:2013–27. favorable pharmacokinetic properties for sustained in vivo pathway inhibition. 36. Jin T, Lavoie H, Sahmi M, David M, Hilt C, Hammell A, et al. RAF inhibitors Clin Cancer Res 2011;17:989–1000. promote RAS-RAF interaction by allosterically disrupting RAF autoinhibition. 16. Hauschild A, Grob JJ, Demidov LV, Jouary T, Gutzmer R, Millward M, et al. Nat Commun 2017;8:1211. Dabrafenib in BRAF-mutated metastatic melanoma: a multicentre, open-label, 37. Peng SB, Henry JR, Kaufman MD, Lu WP, Smith BD, Vogeti S, et al. Inhibition of phase 3 randomised controlled trial. Lancet 2012;380:358–65. RAF isoforms and active dimers by LY3009120 leads to anti-tumor activities in 17. Rheault TR, Stellwagen JC, Adjabeng GM, Hornberger KR, Petrov KG, Waterson RAS or BRAF mutant cancers. Cancer Cell 2015;28:384–98. AG, et al. Discovery of dabrafenib: a selective inhibitor of RAF kinases with anti- 38. Wilhelm SM, Carter C, Tang L, Wilkie D, McNabola A, Rong H, et al. BAY 43- tumor activity against B-Raf-driven tumors. ACS Med Chem Lett 2013;4:358–62. 9006 exhibits broad spectrum oral antitumor activity and targets the RAF/MEK/ 18. Yang H, Higgins B, Kolinsky K, Packman K, Go Z, Iyer R, et al. RG7204 ERK pathway and receptor tyrosine kinases involved in tumor progression and (PLX4032), a selective BRAFV600E inhibitor, displays potent antitumor activity angiogenesis. Cancer Res 2004;64:7099–109. in preclinical melanoma models. Cancer Res 2010;70:5518–27. 39. Williams TE, Subramanian S, Verhagen J, McBride CM, Costales A, Sung L, et al. 19. Yeh TC, Marsh V, Bernat BA, Ballard J, Colwell H, Evans RJ, et al. Biological Discovery of RAF265: a potent mut-B-RAF inhibitor for the treatment of characterization of ARRY-142886 (AZD6244), a potent, highly selective mitogen- metastatic melanoma. ACS Med Chem Lett 2015;6:961–5. activated protein kinase kinase 1/2 inhibitor. Clin Cancer Res 2007;13:1576–83. 40. Yao Z, Yaeger R, Rodrik-Outmezguine VS, Tao A, Torres NM, Chang MT, et al. 20. Blumenschein GR Jr, Smit EF, Planchard D, Kim DW, Cadranel J, De Pas T, et al. Tumours with class 3 BRAF mutants are sensitive to the inhibition of activated A randomized phase II study of the MEK1/MEK2 inhibitor trametinib RAS. Nature 2017;548:234–8. (GSK1120212) compared with docetaxel in KRAS-mutant advanced non- 41. Hatzivassiliou G, Song K, Yen I, Brandhuber BJ, Anderson DJ, Alvarado R, et al. small-cell lung cancer (NSCLC) dagger. Ann Oncol 2015;26:894–901. RAF inhibitors prime wild-type RAF to activate the MAPK pathway and enhance 21. Simanshu DK, Nissley DV, McCormick F. RAS proteins and their regulators in growth. Nature 2010;464:431–5. human disease. Cell 2017;170:17–33. 42. Heidorn SJ, Milagre C, Whittaker S, Nourry A, Niculescu-Duvas I, Dhomen N, 22. Yao Z, Torres NM, Tao A, Gao Y, Luo L, Li Q, et al. BRAF mutants evade ERK- et al. Kinase-dead BRAF and oncogenic RAS cooperate to drive tumor progres- dependent feedback by different mechanisms that determine their sensitivity to sion through CRAF. Cell 2010;140:209–21. pharmacologic inhibition. Cancer Cell 2015;28:370–83. 43. Poulikakos PI, Zhang C, Bollag G, Shokat KM, Rosen N. RAF inhibitors 23. Lake D, Correa SA, Muller J. Negative feedback regulation of the ERK1/2 MAPK transactivate RAF dimers and ERK signalling in cells with wild-type BRAF. pathway. Cell Mol Life Sci 2016;73:4397–413. Nature 2010;464:427–30. 24. Barretina J, Caponigro G, Stransky N, Venkatesan K, Margolin AA, Kim S, et al. 44. Lito P, Pratilas CA, Joseph EW, Tadi M, Halilovic E, Zubrowski M, et al. The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer Relief of profound feedback inhibition of mitogenic signaling by RAF drug sensitivity. Nature 2012;483:603–7. inhibitors attenuates their activity in BRAFV600E melanomas. Cancer Cell 25. Shao W, Mishina YM, Feng Y, Caponigro G, Cooke VG, Rivera S, et al. 2012;22:668–82. Antitumor properties of RAF709, a highly selective and potent inhibitor of 45. Rebocho AP, Marais R. ARAF acts as a scaffold to stabilize BRAF:CRAF RAF kinase dimers, in tumors driven by mutant RAS or BRAF. Cancer Res 2018; heterodimers. Oncogene 2013;32:3207–12. 78:1537–48. 46. Janku F, Iyer G, Spreafico A, Yamamoto N, Bang Y-J, Elez E, et al. A phase I study 26. Wylie AA, Schoepfer J, Jahnke W, Cowan-Jacob SW, Loo A, Furet P, et al. The of LXH254 in patients (pts) with advanced solid tumors harboring MAPK allosteric inhibitor ABL001 enables dual targeting of BCR-ABL1. Nature 2017; pathway alterations. J Clin Oncol 2018;36:2586. 543:733–7. 47. Cancer Genome Atlas Research Network, Weinstein JN, Collisson EA, Mills GB, 27. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al. Multiplex genome Shaw KR, Ozenberger BA, et al. The Cancer Genome Atlas Pan-Cancer analysis engineering using CRISPR/Cas systems. Science 2013;339:819–23. project. Nat Genet 2013;45:1113–20.

AACRJournals.org Clin Cancer Res; 2021 OF13

LXH254, a Potent and Selective ARAF-Sparing Inhibitor of BRAF and CRAF for the Treatment of MAPK-Driven Tumors

Kelli-Ann Monaco, Scott Delach, Jing Yuan, et al.

Clin Cancer Res Published OnlineFirst December 22, 2020.

Updated version Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-20-2563

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2020/12/22/1078-0432.CCR-20-2563.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/early/2021/02/09/1078-0432.CCR-20-2563. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.