US 20150259395A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0259395 A1 Chalberg et al. (43) Pub. Date: Sep. 17, 2015

(54) COMPOSITIONS AND METHODS FOR Publication Classification ENHANCEO GENE EXPRESSION IN CONE CELLS (51) Int. C. C07K 4/705 (2006.01) (71) Applicants: Avalanche Biotechnologies, Inc., Menlo Park, CA (US); University of CI2N 7/00 (2006.01) Washington, Seattle, WA (US) CI2N 5/86 (2006.01) (52) U.S. C. (72) Inventors: Thomas W. Chalberg, Redwood City, CPC ...... C07K 14/705 (2013.01); C12N 15/86 CA (US); Jay Neitz, Seattle, WA (US); (2013.01); C12N 7/00 (2013.01); A61 K48/00 Maureen Neitz, Seattle, WA (US) (2013.01) (21) Appl. No.: 14/660,657 (22) Filed: Mar 17, 2015 (57) ABSTRACT Related U.S. Application Data (60) Provisional application No. 62/127,185, filed on Mar. The present disclosure provides polynucleotide cassettes, 2, 2015, provisional application No. 61/954,330, filed expression vectors and methods for the expression of a gene on Mar. 17, 2014. in cone cells. Patent Application Publication Sep. 17, 2015 Sheet 1 of 18 US 2015/0259395 A1

transgene poly Á {ading seqience) region

fansgese poly A coding sequence region

G. A

raitsgere troding siegiience:

FG. 8 Patent Application Publication Sep. 17, 2015 Sheet 2 of 18 US 2015/0259395 A1

Patent Application Publication Sep. 17, 2015 Sheet 3 of 18 US 2015/0259395 A1

&

g:ex88-88-88-88K. s

2. 2 Patent Application Publication Sep. 17, 2015 Sheet 4 of 18 US 2015/0259395 A1

FG, 4A

FG. 48 Patent Application Publication Sep. 17, 2015 Sheet 5 of 18 US 2015/0259395 A1

FG, AC Patent Application Publication Sep. 17, 2015 Sheet 6 of 18 US 2015/0259395 A1

F.G. S. Patent Application Publication Sep. 17, 2015 Sheet 7 of 18 US 2015/0259395 A1

F.G. 8 Patent Application Publication Sep. 17, 2015 Sheet 8 of 18 US 2015/0259395 A1

FG, 7 Patent Application Publication Sep. 17, 2015 Sheet 9 of 18 US 2015/0259395 A1

G. 3A Patent Application Publication Sep. 17, 2015 Sheet 10 of 18 US 2015/0259395 A1

AAV2-7 m8.pr2.1.GFP AAV2-73. VNC.GP

FG. 88 Patent Application Publication Sep. 17, 2015 Sheet 11 of 18 US 2015/0259395 A1

3.

S

G. 9A Patent Application Publication Sep. 17, 2015 Sheet 12 of 18 US 2015/0259395 A1

Fundus fuor. OC: temporal OC macula OC: rasa

3.3

S

G. 93 Patent Application Publication Sep. 17, 2015 Sheet 13 of 18 US 2015/0259395 A1

Fundus fluorescence

3

S

FG. 9C Patent Application Publication Sep. 17, 2015 Sheet 14 of 18 US 2015/0259395 A1

Fundus fluorescence

3.3.

S

G. 9 Patent Application Publication Sep. 17, 2015 Sheet 15 of 18 US 2015/0259395 A1

:

C. C. Patent Application Publication Sep. 17, 2015 Sheet 16 of 18 US 2015/0259395 A1

Patent Application Publication Sep. 17, 2015 Sheet 17 of 18 US 2015/0259395 A1

AWA4. Gerbils Luc week 4 nar8 eyes MEAN w SD 1x107

F.G. OC Patent Application Publication Sep. 17, 2015 Sheet 18 of 18 US 2015/0259395 A1

AWA2-. Gerbiis luc week 8 res3 eyes NEAN w SD 1x107

X s

G. O.) US 2015/0259395 A1 Sep. 17, 2015

COMPOSITIONS AND METHODS FOR cells specifically. One significant challenge is obtaining Suf ENHANCEO GENE EXPRESSION IN CONE ficient expression of the transgene in target cells, especially in CELLS cone cells of the retina. A longstanding unmet need in the art has been sufficiently robust expression of transgenes follow CROSS REFERENCE TO RELATED ing gene transfer. In some cases, more efficient expression is APPLICATIONS required for the efficacy of certain vectors, for example plas 0001 Pursuant to 35 U.S.C. S 119 (e), this application mid DNA vectors. In other cases, more efficient gene expres claims priority to the filing dates of U.S. Provisional Patent sion cassettes are desirable to allow for a lower therapeutic Application Ser. No. 61/954,330 filed Mar. 17, 2014; and U.S. dose that has a more favorable safety profile or a less invasive route of administration (e.g., intravitreal VS. Subretinal). In Provisional Patent Application Ser. No. 62/127,185 filed Mar. Some settings, efficient expression has been achieved using a 2, 2015, the full disclosures of which are herein incorporated strong, ubiquitous promoter, but it is often desirable to have by reference. high transgene expression using a nucleic acid expression STATEMENT REGARDING SEQUENCE cassette that is only expressed in target cell types. LISTING 0008 Previous efforts to express transgenes in cone cells, for example as disclosed in US patent application US 2012/ 0002 The Sequence Listing associated with this applica 0172419, showed some promise, but often the expression tion is provided in text format in lieu of a paper copy, and is levels were lower than optimal or not cell specific. Given that hereby incorporated by reference into the specification. The a number of vision disorders result from primary defects in name of the text file containing the Sequence Listing is cone cells, specific expression of transgenes in cone cells, AVBI 005 O2US ST25.txt. The text file is 308 KB, was with high expression levels, would represent a meaningful created on Mar. 17, 2015, and is being submitted electroni advance in the art. Therefore, there remains a need for cally via EFS-Web. improved methods and optimized nucleic acid cassettes and vectors for expressing genes in cone cells. FIELD OF THE INVENTION 0003. This invention pertains to gene therapy of retinal SUMMARY OF THE INVENTION disorders. 0009. The present disclosure provides polynucleotide cas settes, expression vectors and methods for the expression of a BACKGROUND OF THE INVENTION gene in cone cells. 0004 Vision disorders of the eye often relate to known 0010. In some aspects of the invention, polynucleotide primary defects in cone cells. These include macular dystro cassettes are provided for the expression of a transgene in phies Such as Stargardt’s macular dystrophy, cone dystrophy, cone cells of a mammalian retina. In some embodiments, the cone-rod dystrophy, Spinocerebellar ataxia type 7, and Bar expression of the transgene is enhanced expression. In certain det-Biedl syndrome-1, as well as color vision disorders, embodiments, the expression of the coding sequence is including achromotopsia, blue cone monochromacy, and pro greater than expression of the transgene operably linked to tan, deutan, and tritan defects. SEQID NO:1. In some embodiments, the expression of the 0005. In addition to those disorders where the known transgene is cone-specific. cause is intrinsic to cone photoreceptors, there are vision 0011. In some embodiments, the polynucleotide cassette disorders of the central macula (within primates) that may be comprises a promoter region, wherein the promoter region treated by targeting cone cells. These include age-related promotes the expression of a gene in retinal cone cells; and a macular degeneration, macular telangiectasia, retinitis pig polyadenylation site. In some embodiments, the expression is mentosa, diabetic retinopathy, retinal vein occlusions, glau specifically in cone cells. In some such embodiments, the coma, Sorsby's fundus dystrophy, adult Vitelliform macular promoter region comprises a polynucleotide sequence having dystrophy, Best's disease, and X-linked retinoschisis. a sequence identity of 85% or more to a sequence selected 0006 A promising approach to treating and preventing from the group consisting of SEQ ID NO:1, SEQ ID NO:2, ophthalmic disease that addresses the limitations of existing SEQ ID NO:3, SEQ ID NO:53, SEQ ID NO:54, SEQ ID treatment is delivery of therapeutic agents to the eye with a NO:55, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81. genetherapy vector Such as an adeno-associated virus (AAV). SEQIDNO:82, and SEQID NO:83, or a functional fragment AAV is a 4.7 kb, single stranded DNA virus. Recombinant thereof. In some embodiments, the promoter region is less vectors based on AAV are associated with excellent clinical than 492 nucleotides in length. In some embodiments, the safety, since wild-type AAV is nonpathogenic and has no promoter region consists essentially of a polynucleotide etiologic association with any known diseases. In addition, sequence having a sequence identity of 85% or more to the AAV offers the capability for highly efficient gene delivery full length of SEQID NO:55 or a functional fragment thereof. and Sustained transgene expression in numerous tissues, 0012. In some embodiments, the polynucleotide cassette including eye, muscle, lung, and brain. Furthermore, AAV comprises a polynucleotide sequence encoding an untrans has shown promise in human clinical trials. One example is lated region 5' for a coding sequence, referred to herein as a Leber's congenital amaurosis in which patients treated with a 5'UTR. In some such embodiments, the 5' UTR comprises a therapeutic delivered by a single subretinal administration of sequence having a sequence identity of 85% or more to a anra AV vector have experienced sustained clinical benefit sequence selected from the group consisting of SEQ ID from expression of the therapeutic agent for more than four NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:84, years from the initial date of treatment. SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID 0007. A number of challenges remain with regard to NO:88, and SEQ ID NO:89, or a fragment thereof. In some designing polynucleotide cassettes and expression vectors for embodiments, some or all of the 5' UTR sequence is com use in gene therapy to treat eye disease generally and cone prised by a promoter region as disclosed in, for example, SEQ US 2015/0259395 A1 Sep. 17, 2015

IDNO:1, SEQIDNO:2, SEQID NO:3, SEQID NO:53, SEQ open reading frame, that is more than 273 nucleotides in ID NO:54, SEQ ID NO:55, or SEQ ID NO:79. In some length. In some embodiments, the sequence between the tran embodiments, the 5' UTR sequence is heterologous to the Scription initiation site and the end of coding sequence does promoter sequence. In some embodiments, the 5'UTR con not contain an open reading frame, other than the transgene sists essentially of a sequence having a sequence identity of open reading frame, that is more than 250 nucleotides in 85% or more to the full length of SEQID NO:85 or SEQID length. In some embodiments, at least one open reading frame NO:86, or a fragment thereof. In some embodiments, the of the coding sequence has been removed. 5' UTR does not comprise a polynucleotide ATG. 0017. In some embodiments, the polynucleotide com 0013. In some embodiments, the polynucleotide cassette prises a promoter region, wherein the promoter region pro comprises an intron. In some Such embodiments, the intron motes the expression of a gene in retinal cone cells; a 5' comprises a sequence having a sequence identity of 85% or untranslated region; an intron; a translation initiation more to a sequence selected from the group consisting of SEQ sequence; a coding sequence operatively linked to the pro ID NO:5, SEQ ID NO:59, and SEQ ID NO:60. In certain moter region; and a polyadenlyation site. In some embodi embodiments, the intron is located within the polynucleotide ments, the polynucleotide comprises a promoter region, sequence encoding a 5'UTR. wherein the promoter region promotes the expression of a 0014. In some embodiments, the polynucleotide cassette gene specifically in retinal cone cells; a 5' untranslated region; comprises a translation initiation sequence. In some Such an intron; a translation initiation sequence; a coding sequence embodiments, the translation initiation sequence comprises a operatively linked to the promoter region; and a polyadenlya polynucleotide sequence consisting essentially of SEQ ID tion site. NO:72 or SEQID NO:73. 0018. In some aspects of the invention, gene delivery vec 0015. In some embodiments, the polynucleotide cassette tors are provided comprising a polynucleotide cassette of the comprises an enhancer sequence. In some such embodiments, present invention. In some embodiments, the gene delivery the enhancer sequence comprises a polynucleotide sequence vector is a recombinant adeno-associated virus, wherein the having a sequence identity of 85% or more to SEQID NO:52 recombinant adeno-associated virus comprises an AAV or a functional fragment thereof. In certain embodiments, the capsid protein. In some embodiments, the AAV capsid pro enhancer sequence consists essentially of a sequence having tein is a wildtype AAV capsid protein. In other embodiments, a sequence identity of 85% or more to the full length of SEQ the AAV capsid protein is a variant AAV capsid protein. In ID NO:51. certain embodiments, the variant AAV capsid protein com 0016. In some embodiments, the polynucleotide cassette prises a peptide insertion in the AAVGH loop selected from comprises a coding sequence operably linked to the promoter. the group consisting of LGETTRP (SEQ ID NO:96), In some embodiments, the coding sequence is heterologous to NETITRP (SEQ ID NO:97), KAGQANN (SEQID NO:98), the promoter region and/or the 5' UTR sequence. In some KDPKTTN (SEQ ID NO:99), KDTDTTR (SEQ ID embodiments, the coding sequence encodes a polypeptide NO:100), RAGGSVG (SEQID NO:101), AVDTTKF (SEQ having a sequence identity of at least 85%, 90%, or 95% to ID NO:102), and STGKVPN (SEQ ID NO:103). SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID 0019. In some aspects of the invention, pharmaceutical NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, compositions are provided comprising a polynucleotide cas SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID sette of the invention and a pharmaceutical excipient. In some NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, embodiments, the pharmaceutical composition comprises a SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID gene delivery vector of the invention and a pharmaceutical NO:32, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, excipient. SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID 0020. In some aspects of the invention, methods are pro NO:45, SEQID NO:47, SEQID NO:49, and a polymorph of vided for expressing a transgene in cone cells. In some SEQ ID NO:11 selected from the group consisting of: (i) embodiments, the method comprises contacting one or more Thr65Ile (ii) Ile111 Val (iii) Ser116Tyr (iv) Leu153Met (v) cone cells with an effective amount of a polynucleotide cas Ile171Val (vi) Alal 74Val (vii) Ile178Val (viii)Ser180Ala (ix) sette of the invention or a gene delivery vector of the inven Ile230Thr(x) Ala233Ser(xi)Val236Met (xii) Ile274Val (xiii) tion, wherein the transgene is expressed at detectable levels in Phe275Leu(xiv) Tyr277Phe(xv)Val279Phe(xvi) Thr285Ala the one or more cone cells. In some embodiments, the method (xvii) Pro298Ala; and (xviii) Tyr309Phe. In some embodi is in vitro. In other embodiments, the method is in vivo. In ments, the coding sequence has a sequence identity of at least certain Such embodiments, the contacting comprises injec 85%, 90%, or 95% to SEQID NO:6, SEQID NO:8, SEQID tion of the polynucleotide cassette or gene delivery vector NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, into the vitreous of a mammal eye. In other such emobid SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID ments, the method comprises injection of the polynucleotide NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, cassette or gene delivery vector into the Subretinal space of a SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID mammal eye. In some embodiments, the method further com NO:48, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, prises detecting the expression of the trangene in cone cells, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID wherein expression is detected in 80% or more of the cone NO:67, SEQID NO:68, SEQID NO:69, SEQID NO:70, or cells. In some embodiments, the expression is specific for SEQID NO:71. In some embodiments, the sequence between cone cells. the transcription initiation site and the end of coding sequence 0021. In some aspects of the invention, methods are pro does not contain an open reading frame, other than the trans vided for the treatment or prophylaxis of a cone cell disorder gene open reading frame, that is more than 500 nucleotides in in a mammal in need of treatment or prophylaxis for a cone length. In some embodiments, the sequence between the tran cell disorder. In some embodiments, the method comprises Scription initiation site and the end of coding sequence does administering to the eye of the mammal an effective amount not contain an open reading frame, other than the transgene of a pharmaceutical composition of the invention, wherein the US 2015/0259395 A1 Sep. 17, 2015

coding sequence encodes atherapeutic gene product. In some 3A, the 5' UTR of FIG. 3B is shorter, with less base pairing: embodiments, the administering comprises injecting the and the Kozak sequence is longer. pharmaceutical composition into the vitreous of the mammal 0029 FIG. 4A depicts a polynucleotide cassette before eye. In other such embodiments, the method comprises codon optimization. Open reading frames (ORFs) greater injecting the pharmaceutical composition into the Subretinal than 250 nucleotides in length are shown in gray below the space of a mammal eye. Sequence. 0022. In some embodiments, the cone cell disorder is a 0030 FIG. 4B depicts a polynucleotide cassette after color vision disorder. In certain embodiments, the color codon optimization, but before removal of non-transgene vision disorder is selected from the group consisting of ach ORFs. ORFs greater than 250 nucleotides are shown in gray romotopsia, blue cone monochromacy, a protan defect, a below sequence diagram. Note the introduction of a new ORF deutan defect, and a tritan defect. In some such embodiments, in reverse orientation beginning from SV40 polyA and the method further comprises detecting a change in the dis extending 1,365 bases. ease symptoms, wherein the change comprises an increase in 0031 FIG. 4C depicts a polynucleotide cassette after the ability of the mammal to perceive a color. In some codon optimization and removal of ORFs. ORFs greater than embodiments, the cone cell disorder is a macular dystrophy. 250 nucleotides are shown in gray below the sequence dia In certain embodiments, the macular dystrophy is selected gram. Note that the sequence has been optimized so that from the group consisting of Stargardt's macular dystrophy, newly introduced ORFs are shortened or removed. cone dystrophy, cone-rod dystrophy, Spinocerebellar ataxia 0032 FIG.5 illustrates how intravitreally-delivered AAV2 type 7, and Bardet-Biedl syndrome-1. In some embodiments, variant AAV2-7m8 transduces retinal cells in the fovea cen the cone cell disorder is a vision disorder of the central tralis and parafovea of primates more efficiently than intrav macula. In certain embodiments, vision disorder of the cen itreally-delivered AAV2.5x10' vector genomes of AAV2. tral macula is selected from the group consisting of age CMV.GFP (upper left): AAV-2.5TCMV.GFP (upper right) related macular degeneration, macular telangiectasia, retini (Excoffon K. J., et al. 2009. Proc. Natl. Acad. Sci. U.S.A. tis pigmentosa, diabetic retinopathy, retinal vein occlusions, 106:3865-3870); (lower left) AAV2-7.8.CMV.GFP (Dalkara glaucoma, Sorsby's fundus dystrophy, adult Vitelliform D, et al. Sci Transl Med. 2013 Jun. 12; 5(189): 189ra76); or macular dystrophy, Best's disease, rod-cone dystrophy, Leb AAV-ShI10.CMV.GFP (lower right) (Klimczak RR et al. er's congenital amaurosis, and X-linked retinoschisis. In PLoS One. 2009 Oct. 14:4(10):e7467) was injected into the Some such embodiments, the method further comprises vitreous of an African green monkey in a Volume of 50 u, detecting a change in the disease symptoms. In some such and GFP expression was observed 8 weeks later by OCT embodiments, the change comprises a stabilization in the fluorescence imaging in vivo. health of the cone cells and/or a reduction in the rate of visual 0033 FIG. 6 illustrates how robustly the pMNTC regula acuity loss of the mammal In certain Such embodiments, the tory cassette promotes gene expression in foveal cones of change comprises an improvement in the health of the cone primates. (a-b) AAV2-7m8.MNTC.GFP was injected into the cells and/or an improvement in the visual acuity of the mam central vitreous of a baboon and expression was observed (a) mal 5 weeks and (b) 8 weeks later by fundus fluorescence. (c and d) Natural GFP fluorescence within a 15 micron section of the BRIEF DESCRIPTION OF THE DRAWINGS fovea at approximately 6 months after injection with AAV2 0023 The novel features of the disclosure are set forth 7m8.MNTC.GFP at low magnification (c) and high magnifi with particularity in the appended claims. A better under cation (d). standing of the features and advantages of the present inven 0034 FIG. 7 illustrates robust and cone-specific gene tion will be obtained by reference to the following detailed expression in the cones of a mouse retina following intravit description that sets forth illustrative embodiments, in which real injection of AAV-delivery MNTC.GFP. (a-b) Examples the principles of the invention are utilized, and the accompa of GFP fluorescence 11 weeks after mice received intravitreal nying drawings of which: injections of 5.04x10" vector genomes via intravitreal injec tion. (c-e) retinas were harvested for histology 14 weeks after 0024 FIG. 1A depicts the schematic overview of poly injection and cone outersegments were labeled with an anti nucleotide cassettes for enhanced expression of a transgene in body to L/M opsin (red). In (c) the red channel is turned off so cone cells. only the native GFP is visible, (d) is the same image with the 0025 FIG. 1B depicts a schematic overview of viral vec red channel on to allow visualization of cone outersegments. tors comprising polynucleotide cassettes for enhanced Comparison of (c) and (d) shows that most if not all cones expression of a transgene in cone cells. were transduced by the virus. (e) Image from the same retina 0026 FIG.2 depicts an example intron containing canoni as in c and d from different angle showing profiles of cone cal features, including consensus sequences for the splice photoreceptors. donor (A/C) A G G T Pu A G U; branch site CT Pu A Py: 0035 FIG. 8 illustrates gene expression directed by the Py-rich region; and acceptor NCAG G. pMNTC regulatory cassette in the cones of the Mongolian 0027 FIG.3A depicts an example 5'UTR mRNA structure gerbil retina. 1x10'-2x10" vector genomes of virus carry (SEQ ID NO:56), the 5' UTR mRNA structure from pR2.1 ing GFP under the control of the CMV, pR2.1, or MNTC (Mancuso et al.). This 5' UTR has two upstream AUGs and promoter were injected in a volume of 5 ul into the vitreous open reading frames (ORF), a high level of base pairing and of a Mongolian gerbil, and GFP expression visualized at the hairpin structure, and a shorter Kozak sequence. designated time points by fundus fluorescence imaging. (a) 0028 FIG. 3B depicts an example 5' UTR mRNA and Expression of GFP directed by AAV2-7m8.CMV.GFP and structure (SEQID NO:57) from an optimized cassette of the AAV2-7m8.MNTC.GFP, visualized 4 weeks after intravit present disclosure. The 5' UTR comprises no upstream AUG real administration. Gerbils 12-10, 12-11, and 12-12 were and no ORFs. In addition, as compared to the 5' UTR of FIG. injected with AAV2-7m8.CMV.GFP, while gerbils 12-13, US 2015/0259395 A1 Sep. 17, 2015

12-14, and 12-15 were injected with AAV2-7m8.MNTC. rAAV virions, the heterologous gene is expressed in the GFP. O.D. oculus dexter (right eye). OS, oculus sinister (left infected cells, however, due to the fact that the infected cells eye). (b) Expression of GFP directed by AAV2-7m8.pR2.1. lackAAV rep and cap genes and accessory function genes, the GFP and AAV2-7m8.MNTC.GFP, 4 and 8 weeks later as rAAV is not able to replicate further. detected by fundus fluorescence imaging. 0042. An AAV variant' or “AAV mutant as used herein 0036 FIGS. 9A-9D demonstrate that the pMNTC regula refers to a viral particle composed of: a) a variant AAV capsid tory cassette provides for more robust gene expression in protein, where the variant AAV capsid protein comprises at foveal cones of primates than the cone promoter pR2.1. least one amino acid difference (e.g., amino acid substitution, 5x10" vector genomes of AAV2-7m8.MNTC.GFP or amino acid insertion, amino acid deletion) relative to a cor AAV2-7m8.pR2.1.GFP were injected in a volume of 50 uL responding parental AAV capsid protein, and where the vari into the vitreous of African Green Monkeys as indicated ant capsid protein confers increased infectivity of a retinal (AAV2-7m8.MNTC.GFP into animals 271 and 472: AAV2 cell compared to the infectivity of the retinal cell by an AAV 7m8.pR2.1.GFP into animals 500 and 509). Retinas were virion comprising the corresponding parental AAV capsid visualized in vivo at (a) 2 weeks, (b) 4 weeks, (c) 8 weeks, and protein, where the AAV capsid protein does not comprise an (d) 12 weeks for GFP using a fundus fluorescence camera (a, amino acid sequence present in a naturally occurring AAV b,c,d) or autofluorescence on Heidelberg Spectralis OCT (a, capsid protein; and b) a heterologous nucleic acid comprising b; data not shown for weeks 8 and 12). OD, oculus dexter a nucleotide sequence encoding a heterologous gene product. (right eye). OS, oculus sinister (left eye). 0043. The abbreviation “r AAV' refers to recombinant 0037 FIGS. 10A-10D demonstrate the contribution of adeno-associated virus, also referred to as a recombinant each of the optimized pMNTC elements to the more robust AAV vector (or “rAAV vector”). A “rAAV vector” as used expression observed. (a) The pMNTC and pR2.1 expression herein refers to an AAV vector comprising a polynucleotide cassettes. (b) The experimental expression cassettes, in which sequence not of AAV origin (i.e., a polynucleotide heterolo each element in pMNTC is replaced one-by-one by the cor gous to AAV), typically a sequence of interest for the genetic responding element in pR2.1. (c,d) Expression of the transformation of a cell. In general, the heterologous poly luciferase transgene in the retinas of gerbils intravitreally nucleotide is flanked by at least one, and generally by two injected with each of the test articles (n=6-8 eyes per con AAV inverted terminal repeat sequences (ITRs). The term struct) as detected (c) 4 weeks and (d) 8 weeks after injection rAAV vector encompasses both ra AV vector particles and by IVIS imaging. “7m8.CMV served as the positive control. rAAV vector plasmids. 0044 As used herein, the term “gene' or "coding DEFINITIONS sequence” refers to a nucleotide sequence in vitro or in vivo 0038 A“vector” as used herein refers to a macromolecule that encodes a gene product. In some instances, the gene or association of macromolecules that comprises or associ consists or consists essentially of coding sequence, that is, ates with a polynucleotide and which can be used to mediate sequence that encodes the gene product. In other instances, delivery of the polynucleotide to a cell. Illustrative vectors the gene comprises additional, non-coding, sequence. For include, for example, plasmids, viral vectors, liposomes, and example, the gene may or may not include regions preceding other gene delivery vehicles. and following the coding region, e.g. 5' untranslated (5' UTR) 0039. The term “AAV' is an abbreviation for adeno-asso or “leader sequences and 3' UTR or “trailer sequences, as ciated virus, and may be used to refer to the virus itself or well as intervening sequences (introns) between individual derivatives thereof. The term covers all subtypes and both coding segments (exons). naturally occurring and recombinant forms, except where 0045. As used herein, a “therapeutic gene' refers to a gene required otherwise. The term “AAV” includes AAV type 1 that, when expressed, confers a beneficial effect on the cellor (AAV-1), AAV type 2 (AAV-2), AAV type 3 (AAV-3), AAV tissue in which it is present, or on a mammal in which the gene type 4 (AAV-4), AAV type 5 (AAV-5), AAV type 6 (AAV-6), is expressed. Examples of beneficial effects include amelio AAV type 7 (AAV-7), AAV type 8 (AAV-8), avian AAV, ration of a sign or symptom of a condition or disease, preven bovine AAV, canine AAV, equine AAV, primate AAV, non tion or inhibition of a condition or disease, or conferral of a primate AAV, and ovine AAV. “Primate AAV” refers to AAV desired characteristic. Therapeutic genes include genes that that infect primates, “non-primate AAV' refers to AAV that correct a genetic deficiency in a cell or mammal infect non-primate mammals, “bovine AAV' refers to AAV 0046. As used herein, a transgene is a gene that is delivered that infect bovine mammals, etc. to a cell by a vector. 0040. An “AAV virus' or “AAV viral particle' or “rAAV 0047. As used herein, the term “gene product” refers to the vector particle' refers to a viral particle composed of at least desired expression product of a polynucleotide sequence Such one AAV capsid protein (typically by all of the capsid proteins as a polypeptide, peptide, protein or interfering RNA includ of a wild-type AAV) and an encapsidated polynucleotide ing short interfering RNA (siRNA), miRNA or small hairpin rAAV vector. If the particle comprises a heterologous poly RNA (shRNA). nucleotide (i.e. a polynucleotide other than a wild-type AAV 0048. As used herein, the terms “polypeptide.” “peptide.” genome such as a transgene to be delivered to a mammalian and “protein’ refer to polymers of amino acids of any length. cell), it is typically referred to as a “ra AV vector particle' or The terms also encompass an amino acid polymer that has simply a “ra AV vector'. Thus, production of ra AV particle been modified; for example, disulfide bond formation, glyco necessarily includes production of ra AV vector, as Such a Sylation, lipidation, phosphorylation, or conjugation with a vector is contained within a ra AV particle. labeling component. 0041. The term “replication defective' as used herein rela 0049. By “comprising it is meant that the recited ele tive to an AAV viral vector of the invention means the AAV ments are required in, for example, the composition, method, vector cannot independently replicate and package its kit, etc., but other elements may be included to form the, for genome. For example, when a cell of a subject is infected with example, composition, method, kit etc. within the scope of the US 2015/0259395 A1 Sep. 17, 2015 claim. For example, an expression cassette "comprising a determined using the algorithm of E. Meyers and W. Miller gene encoding a therapeutic polypeptide operably linked to a (1989, Cabios, 4: 11-17) which has been incorporated into the promoter is an expression cassette that may include other ALIGN program (version 2.0), using a PAM 120 weight resi elements in addition to the gene and promoter, e.g. poly due table, a gap length penalty of 12 and a gap penalty of 4. adenylation sequence, enhancer elements, other genes, linker The nucleic acid and protein sequences described herein can domains, etc. be used as a “query sequence' to perform a search against 0050. By “consisting essentially of, it is meant a limita public databases to, for example, identify other family mem tion of the scope of the, for example, composition, method, bers or related sequences. Such searches can be performed kit, etc., described to the specified materials or steps that do using the NBLAST and XBLAST programs (version 2.0) of not materially affect the basic and novel characteristic(s) of Altschul, et al., (1990, J. Mol. Biol, 215: 403-10). BLAST the, for example, composition, method, kit, etc. For example, nucleotide searches can be performed with the NBLAST an expression cassette "consisting essentially of a gene program, score=100, wordlength=12 to obtain nucleotide encoding a therapeutic polypeptide operably linked to a pro sequences homologous to nucleic acid molecules of the moter and a polyadenylation sequence may include addi invention. BLAST protein searches can be performed with tional sequences, e.g. linker sequences, so long as they do not the XBLAST program, score=50, wordlength=3 to obtain materially affect the transcription or translation of the gene. amino acid sequences homologous to protein molecules of As another example, a variant, or mutant, polypeptide frag the invention. To obtain gapped alignments for comparison ment “consisting essentially of a recited sequence has the purposes, Gapped BLAST can be utilized as described in amino acid sequence of the recited sequence plus or minus Altschul et al., (1997, Nucleic Acids Res, 25: 3389-3402). about 10 amino acid residues at the boundaries of the When utilizing BLAST and Gapped BLAST programs, the sequence based upon the full length naive polypeptide from default parameters of the respective programs (e.g., XBLAST which it was derived, e.g. 10,9,8,7,6, 5, 4, 3, 2 or 1 residue and NBLAST) can be used. less than the recited bounding amino acid residue, or 1, 2, 3, 0053. The term “yo homology” is used interchangeably 4, 5, 6, 7, 8, 9, or 10 residues more than the recited bounding herein with the term “% identity” herein and refers to the level amino acid residue. of nucleic acid or amino acid sequence identity between two 0051. By "consisting of, it is meant the exclusion from or more aligned sequences, when aligned using a sequence the composition, method, or kit of any element, step, or ingre alignment program. For example, as used herein, 80% homol dient not specified in the claim. For example, an expression ogy means the same thing as 80% sequence identity deter cassette “consisting of a gene encoding a therapeutic mined by a defined algorithm, and accordingly a homologue polypeptide operably linked to a promoter, and a polyadeny of a given sequence has greater than 80% sequence identity lation sequence consists only of the promoter, polynucleotide over a length of the given sequence. sequence encoding the therapeutic polypeptide, and poly 0054 As used herein, the terms “complement” and adenlyation sequence. As another example, a polypeptide “complementary” refer to two antiparallel nucleotide “consisting of a recited sequence contains only the recited sequences capable of pairing with one another upon forma Sequence. tion of hydrogen bonds between the complementary base 0052. As used herein, the terms “sequence identity.’e.g. residues in the antiparallel nucleotide sequences. For “% sequence identity.” refers to the degree of identity example, an shRNA might be complementary, i.e. 100% between two or more polynucleotides when aligned using a complementary, or Substantially complementary, e.g. 80% nucleotide sequence alignment program; or between two or complementary, 85% complementary, 90% complementary, more polypeptide sequences when aligned using an amino 95% complementary, 98% complementary, or more to a tar acid sequence alignment program. Similarly, the term “iden get sequence. The term "expression' as used herein encom tical' or percent “identity” when used herein in the context of passes the transcription and/or translation of an endogenous two or more nucleotide or amino acid sequences refers to two gene, a transgene or a coding sequence in a cell. sequences that are the same or have a specified percentage of 0055 An "expression vector” as used herein encompasses amino acid residues or nucleotides when compared and a vector, e.g. plasmid, minicircle, viral vector, liposome, and aligned for maximum correspondence, for example as mea the like as discussed above or as known in the art, comprising Sured using a sequence comparison algorithm, e.g. the Smith a polynucleotide which encodes a gene product of interest, Waterman algorithm, etc., or by visual inspection. For and is used for effecting the expression of a gene product in an example, the percent identity between two amino acid intended target cell. An expression vector also comprises sequences may be determined using the Needleman and Wun control elements operatively linked to the encoding region to sch, (1970, J. Mol. Biol. 48: 444-453) algorithm which has facilitate expression of the gene product in the target. The been incorporated into the GAP program in the GCG software combination of control elements, e.g. promoters, enhancers, package, using either a Blossum 62 matrix or a PAM250 UTRs, miRNA targeting sequences, etc., and a gene or genes matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a to which they are operably linked for expression is sometimes length weight of 1, 2, 3, 4, 5, or 6. As another example, the referred to as an “expression cassette.” Many such control percent identity between two nucleotide sequences may be elements are known and available in the art or can be readily determined using the GAP program in the GCG software constructed from components that are available in the art. package, using a NWSgapdna. CMP matrix and a gap weight 0056. A "promoter as used herein encompasses a DNA of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or sequence that directs the binding of RNA polymerase and 6. A particularly preferred set of parameters (and the one that thereby promotes RNA synthesis, i.e., a minimal sequence should be used unless otherwise specified) are a Blossum 62 Sufficient to direct transcription. Promoters and correspond scoring matrix with a gap penalty of 12, a gap extend penalty ing protein or polypeptide expression may be ubiquitous, of 4, and a frameshift gap penalty of 5. The percent identity meaning strongly active in a wide range of cells, tissues and between two amino acid or nucleotide sequences can also be species or cell-type specific, tissue-specific, or species spe US 2015/0259395 A1 Sep. 17, 2015

cific. Promoters may "constitutive.” meaning continually amino acid difference (e.g., amino acid Substitution, amino active, or “inducible” meaning the promoter can be activated acid insertion, amino acid deletion) relative to a reference or deactivated by the presence or absence of biotic or abiotic polynucleotide sequence, e.g. a native polynucleotide or factors. Also included in the nucleic acid constructs or vectors polypeptide sequence. For example, a variant may be a poly of the invention are enhancer sequences that may or may not nucleotide having a sequence identity of 70% or more with a be contiguous with the promoter sequence. Enhancer full length native polynucleotide sequence, e.g. an identity of sequences influence promoter-dependent gene expression 75% or 80% or more, such as 85%, 90%, or 95% or more, for and may be located in the 5' or 3' regions of the native gene. example, 98% or 99% identity with the full length native 0057 An'enhancer as used herein encompasses a cis polynucleotide sequence. As another example, a variant may acting element that stimulates or inhibits transcription of be a polypeptide having a sequence identity of 70% or more adjacent genes. An enhancer that inhibits transcription also is with a full length native polypeptide sequence, e.g. an identity termed a “silencer. Enhancers can function (i.e., can be of 75% or 80% or more, such as 85%, 90%, or 95% or more, associated with a coding sequence) in either orientation, over for example, 98% or 99% identity with the full length native distances of up to several kilobase pairs (kb) from the coding polypeptide sequence. Variants may also include variant frag sequence and from a position downstream of a transcribed ments of a reference, e.g. native, sequence sharing a sequence region. identity of 70% or more with a fragment of the reference, e.g. 0058. A “termination signal sequence” as used herein native, sequence, e.g. an identity of 75% or 80% or more, such encompasses any genetic element that causes RNA poly as 85%, 90%, or 95% or more, for example, 98% or 99% merase to terminate transcription, Such as for example a poly identity with the native sequence. adenylation signal sequence. 0063 As used herein, the terms “biological activity” and 0059 A“polyadenylation signal sequence” as used herein “biologically active' refer to the activity attributed to a par encompasses a recognition region necessary for endonu ticular biological element in a cell. For example, the “biologi clease cleavage of an RNA transcript that is followed by the cal activity” of an “immunoglobulin”, “antibody' or frag polyadenylation consensus sequence AATAAA. A polyade ment or variant thereof refers to the ability to bind an nylation signal sequence provides a “polyA site', i.e. a site on antigenic determinant and thereby facilitate immunological a RNA transcript to which adenine residues will be added by function. As another example, the biological activity of a post-transcriptional polyadenylation. polypeptide or functional fragment or variant thereofrefers to 0060. As used herein, the terms “operatively linked' or the abilty of the polypeptide or functional fragment or variant “operably linked refers to a juxtaposition of genetic ele thereof to carry out its native functions of, e.g., binding, ments, e.g. promoter, enhancer, termination signal sequence, enzymatic activity, etc. As a third example, the biological polyadenylation sequence, etc., wherein the elements are in a activity of agene regulatory element, e.g. promoter, enhancer, relationship permitting them to operate in the expected man kozak sequence, and the like, refers to the ability of the ner. For instance, a promoter is operatively linked to a coding regulatory element or functional fragment or variant thereof region if the promoter helps initiate transcription of the cod to regulate, i.e. promote, enhance, or activate the translation ing sequence. There may be intervening residues between the of respectively, the expression of the gene to which it is promoter and coding region so long as this functional rela operably linked. tionship is maintained. As used herein, the term "heterolo 0064. The terms “administering or “introducing, as used gous' means derived from a genotypically distinct entity herein refer to delivery of a vector for recombinant protein from that of the rest of the entity to which it is being com expression to a cell, to cells and/or organs of a subject, or to a pared. For example, a polynucleotide introduced by genetic Subject. Such administering or introducing may take place in engineering techniques into a plasmid or vector derived from Vivo, in vitro or ex vivo. A vector for expression of a gene a different species is a heterologous polynucleotide. As product may be introduced into a cell by transfection, which another example, a promoter removed from its native coding typically means insertion of heterologous DNA into a cell by sequence and operatively linked to a coding sequence with physical means (e.g., calcium phosphate transfection, elec which it is not naturally found linked is a heterologous pro troporation, microinjection or lipofection); infection, which moter. Thus, for example, an ira AV that includes a heterolo typically refers to introduction by way of an infectious agent, gous nucleic acid encoding a heterologous gene product is an i.e. a virus; or transduction, which typically means stable rAAV that includes a nucleic acid not normally included in a infection of a cell with a virus or the transfer of genetic naturally-occurring, wild-type AAV, and the encoded heter material from one microorganism to another by way of a viral ologous gene product is a gene product not normally encoded agent (e.g., a bacteriophage). by a naturally-occurring, wild-type AAV. 0065 “Transformation' is typically used to refer to bac 0061 The term “endogenous” as used herein with refer teria comprising heterologous DNA or cells which express an ence to a nucleotide molecule or gene product refers to a oncogene and have therefore been converted into a continu nucleic acid sequence, e.g. gene or genetic element, or gene ous growth mode such as tumor cells. A vector used to “trans product, e.g. RNA, protein, that is naturally occurring in or form a cell may be a plasmid, virus or other vehicle. associated with a host virus or cell. 006.6 Typically, a cell is referred to as “transduced, 0062. The term “native' as used herein refers to a nucle “infected”; “transfected or “transformed dependent on the otide sequence, e.g. gene, or gene product, e.g. RNA, protein, means used for administration, introduction or insertion of that is present in a wildtype virus or cell. The term “variant” heterologous DNA (i.e., the vector) into the cell. The terms as used herein refers to a mutant of a reference polynucleotide “transduced, “transfected” and “transformed may be used or polypeptide sequence, for example a native polynucleotide interchangeably herein regardless of the method of introduc or polypeptide sequence, i.e. having less than 100% sequence tion of heterologous DNA. identity with the reference polynucleotide or polypeptide 0067. The term “host cell, as used herein refers to a cell sequence. Put another way, a variant comprises at least one which has been transduced, infected, transfected or trans US 2015/0259395 A1 Sep. 17, 2015

formed with a vector. The vector may be a plasmid, a viral should be understood that numerous specific details, relation particle, a phage, etc. The culture conditions, such as tem ships, and methods are set forth to provide a full understand perature, pH and the like, are those previously used with the ing of the invention. One having ordinary skill in the relevant host cell selected for expression, and will be apparent to those art, however, will readily recognize that the invention can be skilled in the art. It will be appreciated that the term “host practiced without one or more of the specific details or with cell refers to the original transduced, infected, transfected or other methods. The present invention is not limited by the transformed cell and progeny thereof. illustrated ordering of acts or events, as some acts may occur 0068. The terms “treatment”, “treating” and the like are in different orders and/or concurrently with other acts or used herein to generally mean obtaining a desired pharmaco events. Furthermore, not all illustrated acts or events are logic and/or physiologic effect. The effect may be prophylac required to implement a methodology in accordance with the tic in terms of completely or partially preventing a disease or present invention. symptom thereof, e.g. reducing the likelihood that the disease 0073. The terminology used herein is for the purpose of or symptom thereof occurs in the Subject, and/or may be describing particular embodiments only and is not intended to therapeutic interms of a partial or complete cure for a disease be limiting of the invention. As used herein, the singular and/or adverse effect attributable to the disease. "Treatment’ forms “a”, “an and “the are intended to include the plural as used herein covers any treatment of a disease in a mammal, forms as well, unless the context clearly indicates otherwise. and includes: (a) preventing the disease from occurring in a Furthermore, to the extent that the terms “including, subject which may be predisposed to the disease but has not “includes”, “having”, “has”, “with', or variants thereofare yet been diagnosed as having it; (b) inhibiting the disease, i.e., used in either the detailed description and/or the claims, such arresting its development; or (c) relieving the disease, i.e., terms are intended to be inclusive in a manner similar to the causing regression of the disease. The therapeutic agent may term "comprising. be administered before, during or after the onset of disease or injury. The treatment of ongoing disease, where the treatment 0074 The term “about' or “approximately” means within stabilizes or reduces the undesirable clinical symptoms of the an acceptable error range for the particular value as deter patient, is of particular interest. Such treatment is desirably mined by one of ordinary skill in the art, which will depend in performed prior to complete loss of function in the affected part on how the value is measured or determined, i.e., the tissues. The subject therapy will desirably be administered limitations of the measurement system. For example, “about during the symptomatic stage of the disease, and in some can mean within 1 or more than 1 Standard deviation, per the cases after the symptomatic stage of the disease. practice in the art. Alternatively, “about can mean a range of 0069. The terms “individual,” “host,” “subject,” and up to 20%, preferably up to 10%, more preferably up to 5%, “patient” are used interchangeably herein, and refer to a and more preferably still up to 1% of a given value. Alterna mammal, including, but not limited to, human and non-hu tively, particularly with respect to biological systems or pro man primates, including simians and humans; mammalian cesses, the term can mean within an order of magnitude, sport animals (e.g., horses); mammalian farm animals (e.g., preferably within 5-fold, and more preferably within 2-fold, sheep, goats, etc.); mammalian pets (dogs, cats, etc.); and of a value. Where particular values are described in the appli rodents (e.g., mice, rats, etc.). cation and claims, unless otherwise stated the term “about 0070 The various compositions and methods of the inven meaning within an acceptable error range for the particular tion are described below. Although particular compositions value should be assumed. and methods are exemplified herein, it is understood that any 0075 All publications mentioned herein are incorporated of a number of alternative compositions and methods are herein by reference to disclose and describe the methods applicable and Suitable for use in practicing the invention. It and/or materials in connection with which the publications will also be understood that an evaluation of the expression are cited. It is understood that the present disclosure Super constructs and methods of the invention may be carried out sedes any disclosure of an incorporated publication to the using procedures standard in the art. extent there is a contradiction. 0071. The practice of the present invention will employ, 0076. It is further noted that the claims may be drafted to unless otherwise indicated, conventional techniques of cell exclude any optional element. As such, this statement is biology, molecular biology (including recombinant tech intended to serve as antecedent basis for use of such exclusive niques), microbiology, biochemistry and immunology, which terminology as “solely”, “only' and the like in connection are within the scope of those of skill in the art. Such tech with the recitation of claim elements, or the use of a “nega niques are explained fully in the literature, such as, “Molecu tive' limitation. lar Cloning: A Laboratory Manual, second edition (Sam brook et al., 1989); “Oligonucleotide Synthesis” (M. J. Gait, 0077. The publications discussed herein are provided ed., 1984): “Animal Cell Culture' (R.I. Freshney, ed., 1987); solely for their disclosure prior to the filing date of the present “Methods in Enzymology” (Academic Press, Inc.); “Hand application. Nothing-herein is to be construed as an admis book of Experimental Immunology' (D. M. Weir & C. C. sion that the present invention is not entitled to antedate Such Blackwell, eds.); “Gene Transfer Vectors for Mammalian publication by virtue of prior invention. Further, the dates of Cells” (J. M. Miller & M. P. Calos, eds., 1987); “Current publication provided may be different from the actual publi Protocols in Molecular Biology” (F. M. Ausubel et al., eds., cation dates which may need to be independently confirmed. 1987); “PCR: The Polymerase Chain Reaction', (Mullis et 0078. Unless otherwise indicated, all terms used herein al., eds., 1994); and “Current Protocols in Immunology” (J. E. have the same meaning as they would to one skilled in the art Coligan et al., eds., 1991), each of which is expressly incor and the practice of the present invention will employ, conven porated by reference herein. tional techniques of microbiology and recombinant DNA 0072. Several aspects of the invention are described below technology, which are within the knowledge of those of skill with reference to example applications for illustration. It of the art. US 2015/0259395 A1 Sep. 17, 2015

DETAILED DESCRIPTION OF THE INVENTION 0089 (b) a 5' untranslated region; 0090 (c) a translation initiation sequence; and 007.9 The present disclosure provides polynucleotide cas 0.091 (d) a coding sequence operatively linked to the settes and expression vectors for the expression of a gene in promoter region. cone cells. Also provided are methods for the use of these compositions in promoting the expression of a gene in cone As a fourth example, in some embodiments, the polynucle cells, for example, in an individual, e.g. for the treatment or otide cassette comprises: prophylaxis of a cone cell disorder. These and other objects, 0092 (a) a promoter region, wherein the promoter advantages, and features of the invention will become appar region promotes the expression of a coding sequence in ent to those persons skilled in the art upon reading the details retinal cone cells; of the compositions and methods as more fully described (0.093 (b) a 5' untranslated region; below. 0094) (c) an intron: 0.095 (d) a translation initiation sequence; and Compositions 0.096 (e) a coding sequence operatively linked to the promoter region. 0080. In some aspects of the disclosure, compositions are As a fifth example, in some embodiments, the polynucleotide provided for the expression of a transgene in cone cells. By a cassette comprises: “cone cell’, also referred to herein as a "cone photoreceptor 0097 (a) a promoter region, wherein the promoter or “cone', it is meant the subtype of photoreceptor cells in the region promotes the expression of a coding sequence in retina of the eye that function best in relatively bright light. retinal cone cells; Cones are sensitive to specific wavelengths of light and hence 0.098 (b) a 5' untranslated region; Support the perception of color. In addition, cones respond 0099 (c) an intron: faster to stimuli than rod photoreceptors, perceiving finer 0.100 (d) a translation initiation sequence; and detail and more rapid changes in images than rods, and hence, 0101 (e) a polyadenylation sequence. Support high acuity vision for activities where visual detail is 0102. In some embodiments, the polynucleotide cassettes of primary importance Such as reading and driving. Cones are of the present disclosure provide for enhanced expression of readily identifiable in cross-sections of the retina by the cone a transgene in cone cells. As demonstrated by the working like shape of their outer segments. They are also readily examples of the present disclosure, the present inventors have identifiable by their location in the retina, the highest density discovered a number of polynucleotide elements, i.e. of cones existing at the 1.5 mm depression located in the improved elements as compared to those known in the art, center of the macula of the retina, called the “fovea centralis' which individually and synergistically provide for the or “foveal pit”. enhanced expression of transgenes in cone cells. By 0081. In some embodiments of the disclosure, the compo "enhanced it is meant that expression of the transgene is sition that provides for the expression of a transgene in cone increased, augmented, or stronger, in cone cells carrying the cells is a polynucleotide cassette. By a "polynucleotide cas polynucleotide cassettes of the present disclosure relative to sette’ it is meant a polynucleotide sequence comprising two in cone cells carrying the transgene operably linked to com or more polynucleotide sequences, e.g. regulatory elements, parable regulatory elements, e.g. as known in the art. Put translation initiation sequences, coding sequences, termina another way, expression of the transgene is increased, aug tion sequences, etc., typically in operably linkage to one mented, or stronger, from the polynucleotide cassettes of the another. Likewise, by a “polynucleotide cassette for the present disclosure relative to expression from a polynucle expression of a transgene in a cone cell, it is meant a com otide cassette not comprising the one or more optimized bination of two or more polynucleotide sequences, e.g. pro elements of the present disclosure, i.e. a reference control. For moter, enhancer, 5'UTR, translation initiation sequence, cod example, expression of the transgene is enhanced, or aug ing sequence, termination sequences, etc. that promotes the mented, or stronger, in cone cells comprising a polynucle expression of the transgene in a cone cell. otide cassette comprising a promoter disclosed herein than in 0082 For example, in some embodiments, the polynucle cone cells that carry the transgene operably linked to a dif otide cassette comprises: ferent promoter, e.g. as known in the art. As another example, I0083 (a) a promoter region, wherein the promoter expression of the transgene is enhanced, or increased, aug region promotes the expression of a coding sequence in mented, or stronger, in cone cells comprising a polynucle cone cells; and otide cassette comprising an enhancer sequence disclosed I0084 (b) a coding sequence operatively linked to the herein than in cone cells that carry the transgene operably promoter region. linked to a different enhancer sequence. As another example, As another example, in Some embodiments, the polynucle expression of the transgene is enhanced, or increased, aug otide cassette comprises: mented, or stronger, in cone cells comprising a polynucle I0085 (a) a promoter region, wherein the promoter otide cassette encoding a 5'UTR disclosed herein than in cone region promotes the expression of a coding sequence in cells that carry the transgene operably linked to a different retinal cone cells; 5'UTR coding sequence. As another example, expression of I0086 (b) a translation initiation sequence; and the transgene is enhanced, or increased, augmented, or stron I0087 (c) a coding sequence operatively linked to the ger, in cone cells comprising a polynucleotide cassette com promoter region. prising an intron as disclosed herein than in cone cells that As a third example, in Some embodiments, the polynucleotide carry the transgene operably linked to a different intronic cassette comprises: sequence as known in the art. Exemplary sequences compris I0088 (a) a promoter region, wherein the promoter ing elements (e.g., promoters, enhancer sequences, 5'UTRS, region promotes the expression of a coding sequence in and intons) that may be used as references for comparison retinal cone cells; include sequences encompassed by the native L-opsin pro US 2015/0259395 A1 Sep. 17, 2015

moter (SEQ ID NO: 1) and variants thereof, sequences expression in cone cells is employed, more than 50% of the encompassed by the synthetic promoter pR2.1 (SEQ ID expression, for example, at least any of 60%. 65%, 70% or NO:50) and variants thereof (e.g. pR1.7, pR1.5, pR1.1) as 75% or more of the expression, e.g. at least any of 80%, 85%, disclosed in, e.g. US Application No. 2013/0317091, and 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97%, 98%, sequences encompassed by the IRBP/GNAT2 promoter (US 99%, 99.5%, or more of expression of the gene after delivery Applicaton No. 2014/0275231). of the subject pollunucleotide cassette to the eye will be in 0103 Without wishing to be bound by theory, enhanced cone cells. expression of a transgene in cells is believed to be due to a 0105 Exemplary suitable promoter regions include the faster build-up of gene product in the cells or a more stable promoter region for any cone-specific gene. Such as a 492 gene product in the cells. Thus, enhanced expression of a L-opsin promoter region (SEQ ID NO:1), a 491 L-opsin transgene by the polynucleotide cassettes of the Subject dis promoter region (SEQ ID NO:53), a 496 L-opsin promoter closure may be observed in a number of ways. For example, region (SEQID NO:79), an M-opsin promoter region (SEQ enhanced expression may be observed by detecting the ID NO:2, SEQ ID NO:54), a minimal M-opsin promoter expression of the transgene following contact of the poly region (SEQ ID NO:55, SEQ ID NO: 93), a core M-opsin nucleotide cassette to the cone cells Sooner, e.g. 7 days promoter sequence as disclosed for the first time herein (SEQ Sooner, 2 weeks. Sooner, 3 weeks sooner, 4 weeks sooner, 8 ID NO:80), an S-opsin promoter region (SEQID NO:3), an weeks sooner, 12 weeks. Sooner, or more, than expression hRK promoter region, and a cone arrestin promoter region; or would be detected if the transgene were operably linked to portions or variants thereof which retain activity promoting comparable regulatory elements, e.g. as known in the art. the expression of a gene in cone cells. Nonlimiting examples Enhanced expression may also be observed as an increase in of portions, or fragments, of promoter regions that find use in the amount of gene product per cell. For example, there may the Subject polynucleotide cassetttes include promoter be a 2-fold increase or more, e.g. a 3-fold increase or more, a sequence immediately upstream of the 5'UTR, and canonical 4-fold increase or more, a 5-fold increase or more, or a binding sequences for transcription factors as known in the 10-fold increase or more in the amount of gene product per art. Such portions, or fragments, may be readily determined cone cell. Enhanced expression may also be observed as an using any convenient method as known in the art or described increase in the number of cone cells that express detectable herein. For example, the promoter sequence immediately levels of the transgene carried by the polynucleotide cassette. upstream of the 5' UTR in SEQID NO:54 and SEQID NO:55 For example, there may be a 2-fold increase or more, e.g. a may readily determined by in silico evaluation of the 3-fold increase or more, a 4-fold increase or more, a 5-fold sequence as consisting essentially of nucleotides 1-406 of increase or more, or a 10-fold increase or more in the number SEQID NO:54 or nucleotides 1-154 of SEQID NO:55 using of cone cells that express detectable levels of the transgene. publicly available tools such as, e.g. the UCSC genome BLAT As another example, the polynucleotide of the present inven browser; or by empirical testing through operable linkage tion may promote detectable levels of the transgene in a with a reporter gene and introduction into cone cells, e.g. as greater percentage of cells as compared to a conventional described in the working examples herein. Shorter promoter polynucleotide cassette; for example, where a conventional sequences are, in some embodiments, preferable to longer cassette may promote detectable levels of transgene expres promoter sequences, as they provide for more space in the Sionin, for example, less than 5% of the cone cells in a certain vector for other nucleotide elements. In some embodiments, region, the polynucleotide of the present invention promotes the promoter region is less than 492 base pairs in length. For detectable levels of expression in 5% or more of the cone cells example, in Some embodiments, the functional fragment does in that region; e.g. 10% or more, 15% or more, 20% or more, not comprise nucleotides 1-10 or more of SEQID NO:1, for 25% or more, 30% or more, 35% or more, 40% or more, or example, the functional fragment does not comprise nucle 45% or more, in some instances 50% or more, 55% or more; otides 1-20 or more, nucleotides 1-30 or more, nucleotides 60% or more, 65% or more, 70% or more, or 75% or more, for 1-40 or more, nucleotides 1-50 or more of SEQID NO:1, e.g. example 80% or more, 85% or more, 90% or more, or 95% or nucleotides 1-60 or more, nucleotides 1-70 or more, nucle more of the cone cells that are contacted, will express detect otides 1-80 or more, nucleotides 1-90 or more, nucleotides able levels of gene product. Enhanced expression may also be 1-100 or more of SEQ ID NO:1, in some instances nucle observed as an alteration in the viability and/or function of the otides 1-120 or more, nucleotides 1-140 or more, nucleotides cone cells, e.g. as measured using assessment tools such as 1-160 or more, nucleotides 1-180 or more, nucleotides 1-200 fundus photography, OCT, adaptive optics, cERG, color or more, nucleotides 1-220 or more, nucleotides 1-240 or vision tests, visual acuity tests, and the like, as known in the more, or about nucleotides 1-260 of SEQ ID NO:1. Any art and as described herein. Suitable method for identifying a promoter region capable of 0104. The polynucleotide cassettes of the present disclo driving expression in mammalian or primate cone cells can be Sure typically comprise a promoter region. Any Suitable pro used to identify promoter regions and promoter sequences moter region or promoter sequence therein can be used in the therein that find use in the polynucleotide cassettes of the Subject polynucleotide cassettes, so long as the promoter present disclosure. region promotes expression of a coding sequence in retinal 0106. In some embodiments, the promoter region of the cone cells. In some embodiments, the promoter specifically Subject polynucleotide cassette comprises one of the pro promotes expression of the gene in mammalian retinal cone moter regions disclosed herein, e.g. a 492 L-opsin promoter cell; more preferably primate retinal cone cells; more prefer region (SEQID NO:1), a 491 L-opsin promoter region (SEQ ably in Catarrhini retinal cone cells; even more preferably in ID NO:53), a 496 L-opsin promoter region (SEQID NO:79), human retinal cone cells. By “specifically' it is meant that the an Mopsin promoter region (SEQID NO:2, SEQID NO:54), promoter predominately promotes expression of the gene in a minimal Mopsin promoter region (SEQID NO:55, SEQID the target cells as compared to other cell types. Thus, for NO:93), the core M-opsin promoter sequence disclosed example, when a promoter region that specifically promotes herein (SEQID NO:80), or the Sopsin promoter region (SEQ US 2015/0259395 A1 Sep. 17, 2015

ID NO:3), or a functional fragment or variant thereof, e.g. a Furthermore, a functional fragment consisting essentially of a sequence having an identity of 75% or more, e.g. 80% or 36 by “core” LCR sequence has been identified that is nec more, 85% or more, 90% or more, or 95% or more, (e.g., 80%, essary and Sufficient for expression from the opsin promoter 85%, 90% Or 95%), to an aforementioned sequence or func in cone cells (Komaromy et al. Targeting gene expression to tional fragment thereof. In some embodiments, the promoter cones with human cone opsin promoters in recombinant AAV. sequence of the Subject polynucleotide cassette consists Gene Ther. 2008: 15(14):1049-55) (SEQID NO:51). In some essentially of one of the promoter regions disclosed herein, embodiments, the enhancer of the polynucleotide cassette i.e. SEQID NO:1, SEQID NO:53, SEQID NO:79, SEQID comprises SEQ ID NO:51 or SEQ ID NO:52. In certain NO:2, SEQID NO:54, SEQID NO:55, SEQID NO:93, SEQ embodiments, the enhancer of the polynucleotide cassette ID NO:80, or SEQ ID NO:3, or a functional fragment or consists essentially of SEQID NO:51 or SEQID NO:52. variant thereof, e.g. a sequence having an identity of 75% or 0109 L/M enhancer elements of 100, 200, 300, 400, 500, more, e.g. 80%, or more 85% or more, 90% or more, or 95% 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, or more, (e.g., 80%, 85%, 90% Or 95%), to the full length of 1600, 1700, 1800, 1900, 2000, or more nucleotides that com an aforementioned sequence plus or minus 1, 2, 3, 4, 5, 6, 7, prise one or more copies of the L/M minimal opsin enhancer, 8, 9, or 10 nucleotides, or functional fragment thereof. In and the full L/M opsin enhancer, or other portions or variants Some embodiments, the promoter region of the Subject poly thereof which retain activity enhancing expression of genes in nucleotide cassette consists of one of the promoter regions a cone-specific manner find use in the present compositions. disclosed herein, i.e. SEQID NO:1, SEQID NO:53, SEQID Any suitable method for identifying enhancer sequences NO:79, SEQID NO:2, SEQID NO:54, SEQID NO:55, SEQ capable of driving expression in primate cone cells can be ID NO:93, SEQID NO:80, or SEQID NO:3, or a functional used to identify such enhancers, as will be understood by fragment or variant thereof, e.g. a sequence having an identity those of skill in the art based on the teachings herein. of 75% or more, e.g.80%, 85%, 90%, 95% or more, to the full 0110. The length of the promoter and enhancer regions length of an aforementioned sequence or functional fragment can be of any suitable length for their intended purpose, and thereof. In certain embodiments, the promoter region consists the spacing between the promoter and enhancer regions can essentially of SEQID NO:74. In some such embodiments, the be any suitable spacing to promote cone-specific expression promoter sequence consists essentially of SEQID NO:80. In of the gene product. In various preferred embodiments, the Some embodiments, the promoter results in enhanced expres enhancer is located 0-1500; 0-1250; 0-1000; 0-750; 0-600; sion in cone cells compared to other promoters known in the 0-500; 0-400; 0-300; 0-200; 0-100; 0-90; 0-80; 0-70; 0-60; art, e.g., the synthetic promoters pR2.1, pR1.7.pR1.1, and 0-50; 0-40; 0-30; 0-20; or 0-10 nucleotides upstream of the IRBP/GNAT2. promoter. The promoter can be any Suitable distance 0107. In some embodiments, the polynucleotide cassette upstream of the encoded gene. further comprises an enhancer element. Enhancers are 0111. In some embodiments, the subject polynucleotide nucleic acid elements known in the art to enhance transcrip cassette comprises a sequence encoding a 5' untranslated tion, and can be located anywhere in association with the gene region, i.e. polynucleotide sequence encoding an untrans they regulate, e.g. upstream, downstream, within an intron, lated region 5' to the coding sequence, also called the 5' UTR. etc. Any enhancer element can be used in the polynucleotide In an expression cassette, the 5' UTR is known in the art as the cassettes and gene therapy vectors of the present disclosure, sequence between the transcription initiation site and the So long as it enhances expression of the gene when used in Kozak sequence where protein translation begins. Secondary combination with the promoter. In a preferred embodiment, mRNA structure of the 5'UTR is known to affect transcription the enhancer element is specific for retinal cone cells; more levels. Specifically, for enhanced gene expression, the preferably, it is specific for primate retinal cone cells; more sequence of the 5' UTR region in the present invention is preferably in Catarrhini retinal cone cells; even more prefer selected to minimize or avoid secondary structures and ably in human retinal cone cellsBy “specifically' it is meant upstream AUG (uAUG) codons which are known to decrease that the enhancer predominately enhances expression of the translation efficiency due to inefficient ribosome scanning gene in the target cells compared to other cell types. Thus, for and false translational starts (Kozak, 1995. PNAS 92:2662). example, when an enhancer that specifically enhances See Davuluri et al., Genome Research, 2000: 10 (11): 1807 expression in cone cells is employed, more than 50% of the 1816. For example, the 5' UTR sequence from the human gene expression, for example, at least any of 60%. 65%, 70%, 75% HSP70 (SEQ ID NO:58) has been identified for its unusual or more of the expression, e.g., at least 80%, and preferably ability to enhance mRNA translation, possibly due to an IRES 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97%, mechanism (Rubtsova et al., 2003. PNAS 278(25): 22350 98%, 99%, 99.5%, or more of expression of the gene after 22356; Vivinus et al., 2001. Eur J. Biochem. 268: 1908-1917). delivery of the vector to the eye will be in cone cells. Any 5' UTR can be used, but ideally the sequence of the 0108 Exemplary enhancer regions that find use in the 5'UTR has minimal secondary mRNA structure and upstream polynucleotide cassettes of the present disclosure include AUG sequences. Put another way, in Some embodiments, the those that comprise, consist essentially of, or consist of the sequence between the transcription initiation site and the enhancer region for any cone-specific gene or fragments or translation initiation site of the polynucleotide cassette does variants thereof which retain enhancer activity. For example, not contain the polynucleotide ATG. In some embodiments, the L/M minimal opsin enhancer, referred to as the Locus the 5' UTR comprises, consists essentially, or consists of SEQ Control Region (LCR) (Wang et al., 1992. Neuron 9: 429 ID NO:56, SEQID NO:57, SEQID NO:58, SEQID NO:84, 440) (SEQ ID NO:52) can be used to enhance gene expres SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID sion in cone cells; its absence results in blue cone monochro NO:88, or SEQID NO:89; or a functional fragment or variant macy (Nathans et al., 1989; Science, 245:831-838). The LCR thereof, for example, a polynucleotide sequence having a has been shown to be useful in genetherapy, for example with sequence identity of 85% or more to a sequence selected from AAV vectors (Liet al., Vision Research 48(2008): 332-338). the group consisting of SEQID NO:56, SEQID NO:57, SEQ US 2015/0259395 A1 Sep. 17, 2015

ID NO:58, SEQID NO:84, SEQID NO:85, SEQID NO:86, NO:5, SEQ ID NO:59, and SEQ ID NO:60. Typically, the SEQ ID NO:87, SEQID NO:88, and SEQ ID NO:89, or a intron is heterologous to the promoter region and/or the fragment thereof. In some embodiments, some or all of the 5' UTR. 5'UTR sequence is comprised by a promoter region as dis 0114. In some embodiments, the intron resides within a closed in, for example, SEQID NO:1, SEQID NO:2, SEQID 5'UTR. In other words, the DNA sequence encoding the NO:3, SEQID NO:53, SEQID NO:54, SEQ ID NO:55, or 5'UTR is interrupted by intronic DNA sequence. For SEQ ID NO:79. In other embodiments, the 5' UTR is not example, the coding sequence for the 5'UTR that is SEQID comprised by the promoter region; see, e.g. the core promoter NO:84 may be encoded in two parts, e.g. SEQID NO:85 and sequence SEQID NO:84, which does not encode for 5' UTR SEQID NO:86, with an intronic sequence between them. As sequence. In some embodiments, the 5' UTR sequence is het another example, the coding sequences for the 5'UTR that is erologous to the promoter sequence. In various preferred SEQ ID NO:88 may be encoded in two parts, e.g. SEQ ID embodiments, the 3' end of the UTR is 0-20; 0-15; 0-10; 0-9: NO:89 and SEQ ID NO:73, with an intronic sequence between them. In various embodiments, the 3' end of the 0-8; 0-7; 0-6; or 0-5 nucleotides upstream of the coding intron is 0-20; 0-15; 0-10; 0-9, 0-8: 0-7; 0-6; or 0-5 nucle sequence, and its 5' end is 0-20; 0-15; 0-10; 0-9:0-8: 0-7:0-6: otides upstream of the gene, and its 5' end is 0-20; 0-15; 0-10; or 0-5 nucleotides downstream of the proximal promoter 0-9, 0-8; 0-7, 0-6; or 0-5 nucleotides downstream of the region. In some embodiments, the 5' UTR element results in proximal promoter region. In other embodiments, the intron enhanced expression in cone cells compared to other 5' UTRs resides within the coding sequene of the gene. known in the art, e.g., the 5' UTRs comprised by the synthetic 0.115. In some embodiments, the polynucleotides cas promoters pR2.1, pR1.7, pR1.1, and IRBP/GNAT2. settes of the present disclosure comprise a translation initia 0112. In some embodiments, the subject polynucleotide tion sequence, also know as a "Kozak sequence' or “Kozak cassette further comprises an intron comprising a splice translation initiation sequence. This is the nucleic acid donor/acceptor region. In some embodiments, the intron is sequence where the ribosome attaches and translation begins. located downstream of the promoter region and is located Examples include ACCATGG (Kozak, 1986. Cell, 44:283 upstream of the translation initiation sequence of the gene, i.e. 292) and (GCC)GCC(A/G)CCATGG (Kozak, 1987. Nucl Acid Res; 15(20): 8125) (SEQ ID NO:73). Any suitable the intron is located within the 5' UTR. In other embodiments, Kozak sequence can be used in the polynucleotide cassette, the intron is located downstream of the translation initiation preferably selected to increase expression of the coding sequence of the gene, i.e. the intron is located within the sequence in retinal cone cells. In one embodiment, the trans coding sequence. As is generally known in the art, introns are lation initiation sequence comprises SEQ ID NO:72. In an DNA polynucleotides that are transcribed into RNA and alternative embodiment, the translation initiation sequence removed during mRNA processing through intron splicing. comprises SEQID NO:73. In some embodiments, the Kozak Polynucleotide cassettes containing introns generally have element results in enhanced expression in cone cells com higher expression than those without introns. Introns can pared to other Kozak sequences known in the art, e.g., the stimulate expression between 2- and 500-fold (Buchman and Kozak sequences comprised by the synthetic promoters pR2. Berg, 1988. Mol Cel Bio, 8(10): 4395). Efficiently spliced 1, pR1.7, pR1.1, and IRBP/GNAT2. introns contain a pre-splice donor, branchpoint, and Py rich 0116. In some aspects of the present invention, the subject region (Senapathy et al., 1990; Meth. Enzymol. 183,252-78; polynucleotide cassettes are used to deliver a gene to cone Wu and Krainer, 1999; Mol Cell Biol 19(5):3225-36). 5' cells of an animal, e.g. to determine the effect that the gene introns are generally more efficient compared to introns at the has on cell viability and/or function, to treat a cone cell 3' end (Huang and Gorman, 1990; Mol Cell Bio, 10:1805). disorder, etc. Accordingly, in Some embodiments, the poly Although introns are known generally to increase the level of nucleotide cassettes of the present disclosure further com gene expression, the specific increase (if any) of a given prise a gene to be delivered as a transgene to cone cells of an cDNA is empirical and must be tested; for example the chi animal in vitro or in vivo. The gene coding sequence is typi meric intron in the pSI vector increases CAT expression by cally operatively linked to the promoter region of the subject 21-fold, but luciferase expression by only 3-fold. polynucleotide cassette, and in instances in which an an 0113 Any intron can be used in the subject polynucleotide enhancer element is present, to the enhancer element of the cassettes, so long as it comprises a splice donor/acceptor Subject polynucleotide cassette, such that the promoter and region recognized in mammalian or in primate cone cells, so optionally enhancer elements promote the expression of the that the intron can be spliced out of the resulting mRNA coding sequence or cDNA in cone cells of the Subject. product. In one embodiment, the intron comprises, consists 0117 The coding sequence to be expressed in the cone essentially of, or consists of an SV40 intron according to SEQ cells can be any polynucleotide sequence, e.g. gene or cDNA ID NO:5. In another embodiment, the intron comprises, con that encodes a gene product, e.g. polypeptide or RNA-based sists essentially of, or consists of the chimeric intron from pSI therapeutic (siRNA, antisense, ribozyme, shRNA, etc.). The (SEQID NO:60) or a variant thereof. In another embodiment, coding sequence may be heterologous to the promoter the intron comprises, consists essentially of or consists of the sequence and/or 5' UTR sequence to which it is operably CMV intron A or a variant thereof. In yet another embodi linked, i.e. not naturally operably associated with it. Alterna ment, the intron comprises, consists essentially of, or consists tively, the coding sequence may be endogenous to the pro of the pR2.1 intron (SEQ ID NO:59) or a variant thereof, or moter sequence and/or 5'UTR sequence to which it is oper alternatively, the rabbit or human beta globin intron (Xu et al. ably linked, i.e. is associated in nature with that promoter or 2001, Gene 272:149; Xu et al.2002: J Control Rel 81:155) or 5'UTR. The gene product may act intrinsically in the cone a variant thereof. In some such embodiments, the intron com cell, or it may act extrinsically, e.g. it may be secreted. For prises a sequence having a sequence identity of 85% or more example, when the transgene is a therapeutic gene, the coding to a sequence selected from the group consisting of SEQID sequene may be any gene that encodes a desired gene product US 2015/0259395 A1 Sep. 17, 2015

or functional fragment or variant thereofthat can be used as a 0140 (w) SEQ ID NO:43 (SEQ ID NO:42) IMP therapeutic for treating a cone cell disease or disorder, or as a (inosine 5'-monophosphate) dehydrogenase 1 (IM means to otherwise enhance vision, including but not limited PDH1), transcript variant 1; to promoting tetrachromatic color vision. In various preferred 0141 (x) SEQID NO:45 (SEQID NO:44) aryl hydro embodiments, the transgene encodes atherapeutic protein or carbon receptor interacting protein-like 1 (AIPL1), tran functional fragment or variant thereof selected from the group Script variant 1; consisting of: 0142 (y) SEQID NO.47 (SEQID NO:46) retinoldehy 0118 (a) SEQID NO:7 (SEQID NO:6) Homo sapiens drogenase 12 (all-trans/9-cis/11-cis) (RDH12); opsin 1 (cone pigments), short-wave-sensitive 0143 (z) SEQ ID NO:49 (SEQID NO:48) Leber con (OPN1SW), mRNA NCBI Reference Sequence: genital amaurosis 5 (LCAS), transcript variant 1; and NM 001708.2: 0144 (aa) exemplary OPN1LW/OPN1MW2 polymor 0119 (b) SEQID NO:9 (SEQID NO:8) Homo sapiens phs (compared to OPN1LW (L opsin) polypeptide opsin 1 (cone pigments), medium-wave-sensitive sequence; the amino acid to the left of the number is the (OPN1 MW), mRNA NCBI Reference Sequence: residue present in the L opsin sequence; the number is NM 000513.2: the reside number in Lopsin, and the reside to the right 0120 (c) SEQID NO:11 (SEQID NO:10) Homo sapi of the number is the variation from Lopsin. Polymorphs ens opsin 1 (cone pigments), long-wave-sensitive according to these embodiments may comprise one or (OPN1LW), mRNA NCBI Reference Sequence: more of the amino acid substitutions selected from NM 020061.4: Thr65Ile: Ile111Val; Ser116Tyr; Leu153Met: 0121 (d) SEQID NO:13 (SEQID NO:12) ATPbinding Ile171Val; Alal 74Val: Ile178Val; Ser180Ala: cassette retina gene (ABCR) gene (NM 000350); Ile23OThr; Ala233Ser; Val236Met: Ile274Val; I0122) (e) SEQID NO:15 (SEQID NO:14) retinal pig Phe275Leu: Tyr277Phe: Val279Phe: Thr285Ala: mented epithelium-specific 65 kD protein gene (RPE65) Pro298Ala: Tyr309Phe; (NM. 000329); 0145 (ab) Additional Opsin Sequence Variation 1 (SEQ (0123 (f) SEQID NO:17 (SEQID NO:16) retinal bind ID NO:61); ing protein 1 gene (RLBP1) (NM. 000326); 0146 (ac) Additional Opsin Sequence Variation 2 (SEQ (0.124 (g) SEQID NO:19 (SEQID NO:18) peripherin/ ID NO:62); retinal degeneration slow gene, (NM 000322); 0147 (ad) Additional Opsin Sequence Variation3 (SEQ (0.125 (h) SEQ ID NO:21 (SEQ ID NO:20) arrestin ID NO:63); (SAG) (NM 000541); 0.148 (ae) Additional Opsin Sequence Variation 4 (SEQ (0.126 (i) SEQID NO:23 (SEQID NO:22) alpha-trans ID NO:64); ducin (GNAT1) (NM 000172); 0.149 (af) Additional Opsin Sequence Variation 5 (SEQ I0127 () SEQID NO:24 guanylate cyclase activator 1A ID NO:65); (GUCA1A) (NP 000400.2): 0.150 (ag) Additional Opsin Sequence Variation 6 (SEQ I0128 (k) SEQ ID NO:25 retina specific guanylate ID NO:65); cyclase (GUCY2D), (NP 000171.1); 0151 (ah) Additional Opsin Sequence Variation 7 (SEQ I0129 (1) SEQID NO:26 & 27alpha subunit of the cone ID NO:66); cyclic nucleotide gated cation channel (CNGA3) (NP 0152 (ai) Additional Opsin Sequence Variation 8 (SEQ 001073347.1 or NP 001289.1); ID NO:67); I0130 (m) SEQID NO:28 Human cone transducinalpha 0.153 (a) Additional Opsin Sequence Variation 9 (SEQ Subunit (incomplete achromotopsia); ID NO:68); I0131 (n) SEQ ID NO:29 cone coMP-specific 3',5'- 0154 (ak) hCHR2 (channel rhodopsin) (SEQ ID cyclic phosphodiesterase Subunit alpha', protein (cone NO:69); dystrophy type 4): (O155 (al) NpHR (halorhodopsin) (SEQ ID NO:70); (0132 (o) SEQID NO:30 retinal cone rhodopsin-sensi and tive c(GMP 3',5'-cyclic phosphodiesterase subunit 0156 (am) eGFP (SEQ ID NO:71). gamma, protein (retinal cone dystrophy type 3A); 0157. In some embodiments, the coding sequence (0.133 (p) SEQID NO:31 cone rod homeobox, protein encoded by the transgene encodes a polypeptide having at (Cone-rod dystrophy): least 85% sequence identity to a polypeptide encoded by a sequence disclosed above or herein, for example at least 90% I0134 (q) SEQ ID NO:32 cone photoreceptor cyclic sequence identity, e.g. at least 95% sequence identity, at least nucleotide-gated channel beta Subunit, protein (achro 98% sequence identity, or at least 99% sequence identity. matopsia); Thus, for example, the coding sequence encodes a cone opsin I0135 (r) SEQ ID NO:33 cone photoreceptor cGMP having at least 85%, at least 90%, at least 95% identity, at least gated cation channel beta-subunit, protein (total color 98% sequence identity, or at least 99% sequence identity, to blindness, for example, among Pingelapese Islanders); the polypeptide encoded by OPN1LW, OPNIMW, or (0.136 (s) SEQID NO:35 (SEQID NO:34) retinitis pig OPN1SW. In some embodiments, the coding sequence has a mentosa 1 (autosomal dominant) (RP 1); sequence identity of at least 85%, 90%, 95%, 98% or at least 0.137 (t) SEQID NO:37 (SEQID NO:36) retinitis pig 99% to SEQID NO:6, SEQID NO:8, SEQID NO:10, SEQ mentosa GTPase regulator interacting protein 1 (RP ID NO:12, SEQID NO:14, SEQID NO:16, SEQID NO:18, GRIP 1); SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:34, SEQ ID 0138 (u) SEQID NO:39 (SEQID NO:38) PRP8; NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, 0.139 (v) SEQID NO:41 (SEQID NO:40) centrosomal SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ ID protein 290 kDa (CEP290); NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, US 2015/0259395 A1 Sep. 17, 2015

SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID (ATG) and introducing stop codons (TAG, TAA, or TGA) in NO:68, SEQID NO:69, SEQID NO:70, or SEQID NO:71. reverse orientation or out-of-frame ORFs, while preserving 0158. The proteins recited in (a)-(c) and (aa-aj) are all the amino acid sequence and maintaining highly utilized involved in color vision. The exemplary polymorphs include codons in the gene of interest (i.e., avoiding codons with ones at positions 65, 116, 180, 230, 233,277, 285, and 309 frequency (20%). In the present invention, the transgene cod that affect the spectra of the pigments in cone cells expressing ing sequence may be optimized by either of codon optimiza them. Positions 274,275,277,279,285,298 and 309 together tion and removal of non-transgene ORFs or using both tech distinguish Lopsin from Mopsin. niques. As will be apparent to one of ordinary skill in the art, 0159. The proteins recited (d)-(z) are exemplary eye dis it is preferable to remove or minimize non-transgene ORFs ease-associated genes such as in retinitis pigmentosa after codon optimization in order to remove ORFs introduced (polypeptides “e'-'l', 's-“y”), incomplete achromatopsia during codon optimization. Examples of codon optimization (polypeptide “m'), Stargardt's (polypeptide “d’); Leber con and removal of ORFs are shown in FIGS 3A-3C. genital amaurosis (polypeptide “Z”); cone dystrophy, Such as 0162. In some embodiments, the polynucleotide cassette cone dystrophy type 4 (polypeptide “n”); retinal cone dystro of the present invention further comprises a polyadenylation phy; for example, retinal cone dystrophy type 3A (polypep region. As is understood in the art, RNA polymerase II tran tide “o') : Cone-rod dystrophy (polypeptide “p'); achro Scripts are terminated by cleavage and additional of a poly matopsia (polypeptide "q"); and total color blindness, for adenylation region, also known as a poly A signal, poly A example, among Pingelapese Islanders (polypeptide “r”). region or poly A tail. The poly A region contains multiple 0160. In one embodiment of the invention, the transgene consecutive adenosine monophosphates, often with repeats coding sequence is modified, or "codon optimized to of the motif AAUAAA. Several efficient polyadenylation enhance expression by replacing infrequently represented sites have been identified, including those from SV40, bovine codons with more frequently represented codons. The coding growth hormone, human growth hormone and rabbit beta sequence is the portion of the mRNA sequence that encodes globin (Xu et al., 2001; Gene 272: 149; Xu et al., 2002: J the amino acids for translation. During translation, each of 61 Control Rel. 81:155). The most efficient polyA signal for trinucleotide codons are translated to one of 20 amino acids, expression of a transgene in cone cells may depend on the cell leading to a degeneracy, or redundancy, in the genetic code. type and species of interest and the particular vector used. In However, different cell types, and different animal species, Some embodiments of the invention, the polynucleotide cas utilize tRNAs (each bearing an anticodon) coding for the sette comprises, consists essentially of, or consists of the same amino acids at different frequencies. When a gene polyA region selected from the group consisting of SEQID sequence contains codons that are infrequently represented NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, by the corresponding tRNA, the ribosome translation SEQID NO:78, SEQID NO:90 or SEQID NO:91 or func machinery may slow, impeding efficient translation. Expres tional fragment or variant thereof of any of the preceding sion can be improved via "codon optimization for a particu sequences. In certain embodiments, the polyA region com lar species, where the coding sequence is altered to encode the prises SEQ ID NO:90 or a variant thereof. In some such same protein sequence, but utilizing codons that are highly embodiments, the polyA region consists essentially of SEQ represented, and/or utilized by highly expressed human pro ID NO:90 or a variant thereof. teins (Cid-Arregui et al., 2003; J. Virol. 77: 4928). In one 0163 As will be appreciated by the ordinarily skilled arti aspect of the present invention, the coding sequence of the san, two or more of the aforementioned polynucleotide ele transgene is modified to replace codons infrequently ments may be combined to create the polynucleotide cas expressed in mammal or in primates with codons frequently settes of the present disclosure. Thus, for example, the subject expressed in primates. For example, in some embodiments, polynucleotide cassette may comprise a promoter region the coding sequence encoded by the transgene encodes a comprising an improved promoter sequence in operable link polypeptide having at least 85% sequence identity to a age with an improved 5' UTR sequence, for example SEQID polypeptide encoded by a sequence disclosed above or NO:80 in operable combination with SEQID NO:84 or SEQ herein, for example at least 90% sequence identity, e.g. at ID NO:85, see, e.g. SEQID NO:2, SEQID NO:54, SEQID least 95% sequence identity, at least 98% identity, at least NO:55, SEQID NO:93, SEQID NO:94, or SEQID NO:95. 99% identity, wherein at least one codon of the coding As another example, the Subject polynucleotide cassette may sequence has a higher tRNA frequency in humans than the comprise an improved enhancer sequence or region in oper corresponding codon in the sequence disclosed above or able linkage with an improved promoter sequence or region, herein. for example SEQ ID NO:51 or SEQ ID NO:52 in operable 0161. In an additional embodiment of the invention, the combination with SEQ ID NO:80, SEQ ID NO:2, SEQ ID transgene coding sequence is modified to enhance expression NO:54, SEQID NO:55, or SEQID NO:93; see, e.g. SEQID by termination or removal of open reading frames (ORFs) NO:92 or SEQ ID NO:95. As another example, the subject that do not encode the desired transgene. An open reading polynucleotide cassette may comprise an improved 5'UTR frame (ORF) is the nucleic acid sequence that follows a start sequence in operable linkage with an improved intron codon and does not contains a stop codons. ORFs may be in sequence, for example SEQID NO:84 or SEQID NO:86 in the forward or reverse orientation, and may be “in frame” or operable combination with SEQID NO:60; see, e.g. SEQID “out of frame” compared with the gene of interest. Such open NO:94 or SEQ ID NO:95. As another example, the subject reading frames have the potential to be expressed in an polynucleotide cassette may comprise an improved 5'UTR expression cassette alongside the gene of interest, and could sequence in operable linkage with an improved intron lead to undesired adverse effects. In one aspect of the present sequence and an improved Kozak sequence, for example, invention, the coding sequence of the transgene has been SEQ ID NO:84 or SEQID NO:86 in operable combination modified to remove open reading frames by further altering with SEQID NO:60 and with SEQID NO:73; see, e.g. SEQ codon usage. This was done by eliminating start codons ID NO:95. As another example, the subject polynucleotide US 2015/0259395 A1 Sep. 17, 2015 cassette may comprise an improved enhancer, improved pro 0.168. In such embodiments, the subject polynucleotide moter, improved 5'UTR, improved intron, improved kozak cassette is encapsidated within an AAV capsid, which may be and improved polyA region in operable linkage; see, e.g. SEQ derived from any adeno-associated virus serotype, including ID NO:95. Other combinations of elements both as disclosed without limitation, AAV1, AAV2, AAV3, AAV4, AAVS, herein or as known in the art will be readily appreciated by the AAV6, AAV7, AAV8, AAV9, AAV10, etc. For example, the ordinarily skilled artisan. AAV capsid may be a wild type, or native, capsid. Wild type 0164. Additionally, as will be recognized by one of ordi AAV capsids of particular interest include AAV2, AAVS, and nary skill in the art, the polynucleotide cassettes may option AAV9. However, as with the ITRs, the capsid need not have a ally contain other elements including, but not limited to wild-type nucleotide sequence, but rather may be altered by restriction sites to facilitate cloning and regulatory elements the insertion, deletion or substitution of nucleotides in the for a particular gene expression vector. Examples of regula VP1,VP2 or VP3 sequence, so long as the capsid is able to tory sequence include ITRs for AAV vectors, bacterial transduce cone cells. Put another way, the AAV capsid may be sequences for plasmid vectors, attP or attB sites for phage a variant AAV capsid. Variant AAV capsids of particular inter integrase vectors, and transposable elements for transposons. est include those comprising a peptide insertion within resi dues 580-600 of AAV2 or the corresponding residues in Gene Therapy Vectors another AAV, e.g. LGETTRP, NETITRP. KAGQANN, KDP 0.165. As alluded to above, in some aspects of the present KTTN, KDTDTTR, RAGGSVG, AVDTTKF, orSTGKVPN, invention, the Subject polynucleotide cassettes are used to as disclosed in US Application No. US 2014/0294771, the deliver a gene to cone cells of an animal, e.g. to determine the full disclosure of which is incorporated by reference herein. effect that the gene has on cell viability and/or function, to In some embodiments, the AAV vector is a “pseudotyped treat a cone cell disorder, etc. Accordingly, in Some aspects of AAV created by using the capsid (cap) gene of one AAV and the invention, the composition that provides for the expres the rep gene and ITRs from a different AAV, e.g. a pseudot sion of a transgene in cone cells is a gene delivery vector, yped AAV2 created by using rep from AAV2 and cap from wherein the gene delivery vector comprises the polynucle AAV1, AAV3, AAV4, AAVS, AAV6, AAV7, AAV8, or AAV9 otide cassettes of the present disclosure. together with a plasmid containing a vector based on AAV2. 0166 Any convenient gene therapy vector that finds use For example, the AAV vector may be rAAV2/1, ra AV2/3, delivering polynucleotide sequences to cone cells is encom rAAV2/4, ra AV2/5, ra AV2/6, ra AV2/7, ra AV2/8, ra AV2/ passed by the gene delivery vectors of the present disclosure. 9, etc. Preferably, the rAAV is replication defective, in that the For example, the vector may comprise single or double AAV vector cannot independently further replicate and pack Stranded nucleic acid, e.g. single stranded or double stranded age its genome. For example, when cone cells are transduced DNA. For example, the gene delivery vector may be a naked with ra AV virions, the gene is expressed in the transduced DNA, e.g. a plasmid, a minicircle, etc. As another example, cone cells, however, due to the fact that the transduced cone the gene delivery vector may be a virus, e.g. an adenovirus, an cells lack AAV rep and cap genes and accessory function adeno-associated virus, or a retrovirus, e.g. Moloney murine genes, the rAAV is not able to replicate. leukemia virus (M-MuDV), Moloney murine sarcoma virus 0169 Gene therapy vectors, e.g. ra AV) virions encapsu (MoMSV), Harvey murine sarcoma virus (HaMuSV), lating the polynucleotide cassettes of the present disclosure, murine mammary tumor virus (MuMTV), gibbon ape leuke may be produced using standard methodology. For example, mia virus (Gal. V), feline leukemia virus (FLV), spumavirus, in the case of ra AV virions, an AAV expression vector Friend murine leukemia virus, Murine Stem Cell Virus according to the invention may be introduced into a producer (MSCV) and Rous SarcomaVirus (RSV)) or lentivirus. While cell, followed by introduction of an AAV helper construct, embodiments encompassing the use of adeno-associated where the helper construct includes AAV coding regions virus are described in greater detail below, it is expected that capable of being expressed in the producer cell and which the ordinarily skilled artisan will appreciate that similar complement AAV helper functions absent in the AAV vector. knowledge and skill in the art can be brought to bear on This is followed by introduction of helper virus and/or addi non-AAV gene therapy vectors as well. See, for example, the tional vectors into the producer cell, wherein the helper virus discussion of retroviral vectors in, e.g., U.S. Pat. No. 7,585, and/or additional vectors provide accessory functions 676 and U.S. Pat. No. 8,900,858, and the discussion of aden capable of supporting efficient ra AV virus production. The oviral vectors in, e.g. U.S. Pat. No. 7,858.367, the full disclo producer cells are then cultured to producer AAV. These steps sures of which are incorporated herein by reference. are carried out using standard methodology. Replication-de 0167. In some embodiments, the gene delivery vector is a fective AAV virions encapsulating the recombinant AAV vec recombinant adeno-associated virus (ra AV). In Such tors of the instant invention are made by standard techniques embodiments, the Subject polynucleotide cassette is flanked known in the art using AAV packaging cells and packaging on the 5' and 3' ends by functional AAV inverted terminal technology. Examples of these methods may be found, for repeat (ITR) sequences. By “functional AAVITR sequences example, in U.S. Pat. Nos. 5,436,146; 5,753,500, 6,040,183, is meant that the ITR sequences function as intended for the 6,093,570 and 6,548,286, expressly incorporated by refer rescue, replication and packaging of the AAV virion. Hence, ence herein in their entirety. Further compositions and meth AAVITRs for use in the gene delivery vectors of the invention ods for packaging are described in Wang et al. (US 2002/ need not have a wild-type nucleotide sequence, and may be 0168342), also incorporated by reference herein in its altered by the insertion, deletion or substitution of nucleotides entirety. or the AAV ITRs may be derived from any of several AAV 0170 Any suitable method for producing viral particles serotypes, e.g. AAV1, AAV2, AAV3, AAV4, AAVS, AAV6, for delivery of the subject polynucleotide cassettes can be AAV7, AAV8, AAV9, AAV10. Preferred AAV vectors have used, including but not limited to those described in the the wild type REP and CAP genes deleted in whole or part, examples that follow. Any concentration of viral particles but retain functional flanking ITR sequences. suitable to effectively transducer cone cells can be prepared US 2015/0259395 A1 Sep. 17, 2015 for contacting cone cells in vitro or in vivo. For example, the insect cells (e.g. SF9 cells), microorganisms and yeast. Host viral particles may be formulated at a concentration of 10 cells can also be packaging cells in which the AAV rep and vector genomes per ml or more, for example, 5x10 vector cap genes are stably maintained in the host cell or producer genomes per mL. 10 vector genomes per mL: 5x10 vector cells in which the AAV vector genome is stably maintained genomes permL, 10" vector genomes permL,5x10" vector and packaged. Exemplary packaging and producer cells are genomes per mL. 10' vector genomes permL: 5x10" vector genomes per mL 10" vector genomes permL: 5x10" vector derived from SF-9, 293, A549 or HeLa cells. AAV vectors are genomes per mL. 10" vector genomes per mL 1.5x10' purified and formulated using standard techniques known in vector genomes per mL: 3x10" vector genomes per mL. the art. 5x10" vector genomes per mL; 7.5x10" vector genomes per (0175 For instances in which cone cells are to be contacted mL. 9x10" vector genomes per mL, 1x10" vector genomes in Vivo, the Subject polynucleotide cassettes or gene delivery per mL, 5x10" vector genomes per mL or more, but typically vectors comprising the Subject polynucleotide cassette can be not more than 1x10" vector genomes per mL. Similarly, any treated as appropriate for delivery to the eye. In particular, the total number of viral particles suitable to provide appropriate present invention include pharmaceutical compositions com transduction of retinal cone cells to confer the desired effect prising a polynucleotide cassetee or gene delivery vector or treat the disease can be administered to the mammal or to described herein and a pharmaceutically-acceptable carrier, the primate's eye. In various preferred embodiments, at least diluent or excipient. The Subject polynucleotide cassettes or 108; 5x108; 109; 5x10°, 100, 5x100; 10!'; 5x101; 1012; gene delivery vector can be combined with pharmaceutically 5x10° 10'; 1.5x10's 3x10'; 5x10'; 7.5x10'; 9x10', acceptable carriers, diluents and reagents useful in preparing 1x10" viral particles, or 5x10" viral particles or more, but a formulation that is generally safe, non-toxic, and desirable, typically not more than 1x10" viral particles are injected per and includes excipients that are acceptable for primate use. eye. Any suitable number of administrations of the vector to the mammal or the primate eye can be made. In one embodi Such excipients can be solid, liquid, semisolid, or, in the case ment, the methods comprise a single administration; in other of an aerosol composition, gaseous. Examples of such carri embodiments, multiple administrations are made overtime as ers or diluents include, but are not limited to, water, saline, deemed appropriate by an attending clinician. Ringer's solutions, dextrose solution, and 5% human serum 0171 The subject viral vector may be formulated into any albumin. Supplementary active compounds can also be incor suitable unit dosage, including, without limitation, 1x10 porated into the formulations. Solutions or Suspensions used vector genomes or more, for example, 1x10, 1x10". for the formulations can include a sterile diluent such as water 1x10'', 1x10', or 1x10" vector genomes or more, in certain for injection, Saline solution, fixed oils, polyethylene glycols, instances, 1x10" vector genomes, but usually no more than glycerine, propylene glycolor other synthetic solvents; anti 4x10" vector genomes. In some cases, the unit dosage is at bacterial compounds such as benzyl alcohol or methyl para most about 5x10" vector genomes, e.g. 1x10" vector bens; antioxidants such as ascorbic acid or sodium bisulfate; genomes or less, for example 1x10", 1x10", 1x10', chelating compounds Such as ethylenediaminetetraacetic 1x10', or 1x10 vector genomes or less, in certain instances acid (EDTA); buffers such as acetates, citrates orphosphates: 1x10 vector genomes or less, and typically no less than detergents such as Tween 20 to prevent aggregation; and 1x10 vector genomes. In some cases, the unit dosage is compounds for the adjustment of tonicity Such as Sodium 1x10' to 1x10" vector genomes. In some cases, the unit chloride or dextrose. The pH can be adjusted with acids or dosage is 1x10" to 3x10" vector genomes. In some cases, bases, such as hydrochloric acid or Sodium hydroxide. the unit dosage is 1x10 to 3x10" vector genomes. In some 0176 Pharmaceutical compositions suitable for internal cases, the unit dosage is 1x10 to 3x10" vector genomes. use in the present invention further include sterile aqueous 0172 In some cases, the unit dosage of pharmaceutical Solutions or dispersions and sterile powders for the extempo composition may be measured using multiplicity of infection raneous preparation of sterile injectable solutions or disper (MOI). By MOI it is meant the ratio, or multiple, of vector or Sion. For intravenous administration, Suitable carriers include viral genomes to the cells to which the nucleic acid may be physiological saline, bacteriostatic water, or phosphate buff delivered. In some cases, the MOI may be 1x10'. In some ered saline (PBS). In somecases, the composition is sterile cases, the MOI may be 1x10-1x10'. In some cases, the MOI and should be fluid to the extent that easy syringability exists. may be 1x10-1x10'. In some cases, recombinant viruses of In certain embodiments, it is stable under the conditions of the disclosure are at least about 1x10", 1x10, 1x10, 1x10", manufacture and storage and is preserved against the con 1x10, 1x10°, 1x107, 1x10, 1x10, 1x10, 1x10'', 1x10, taminating action of microorganisms such as bacteria and 1x10", 1x10", 1x10", 1x10", 1x10'7, and 1x10" MOI. In fungi. The carrier can be, e.g., a solvent or dispersion medium some cases, recombinant viruses of this disclosure are 1x10 containing, for example, water, ethanol, polyol (for example, to 3x10" MOI. In some cases, recombinant viruses of the glycerol, propylene glycol, and liquid polyethylene glycol, disclosure are at most about 1x10", 1x10, 1x10, 1x10", and the like), and suitable mixtures thereof. The proper flu 1x10, 1x10°, 1x107, 1x10, 1x10, 1x10, 1x10'', 1x10, idity can be maintained, for example, by the use of a coating 1x10", 1x10, 1x10", 1x10", 1x107 and 1x10' MOI. Such as lecithin, by the maintenance of the required particle 0173. In some aspects, the amount of pharmaceutical size in the case of dispersion and by the use of Surfactants. composition comprises about 1x10 to about 1x10" recom Prevention of the action of microorganisms can be achieved binant viruses, about 1x10 to about 1x10" recombinant by various antibacterial and antifungal agents, for example, viruses, about 1x10' to about 1x10" recombinant viruses, or parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, about 1x10' to about 3x10" recombinant viruses. and the like. In many cases, it will be preferable to include 0.174. In preparing the subject ra AV compositions, any isotonic agents, for example, Sugars, polyalcohols such as host cells for producing ra AV virions may be employed, manitol, sorbitol, sodium chloride in the composition. Pro including, for example, mammalian cells (e.g. 293 cells), longed absorption of the internal compositions can be US 2015/0259395 A1 Sep. 17, 2015 brought about by including in the composition an agent which desired biological activity of the parent compound and do not delays absorption, for example, aluminum monostearate and impart undesired toxicological effects thereto. A variety of gelatin. pharmaceutically acceptable salts are known in the art and (0177 Sterile solutions can be prepared by incorporating described, e.g., in in “Remington's Pharmaceutical Sci the active compound in the required amount in an appropriate ences', 17th edition, Alfonso R. Gennaro (Ed.), Mark Pub solvent with one or a combination of ingredients enumerated lishing Company, Easton, Pa., USA, 1985 (and more recent above, as required, followed by filtered sterilization. Gener editions thereof), in the “Encyclopaedia of Pharmaceutical ally, dispersions are prepared by incorporating the active Technology', 3rd edition, James Swarbrick (Ed.). Informa compound into a sterile vehicle that contains a basic disper Healthcare USA (Inc.), NY, USA, 2007, and in J. Pharm. Sci. sion medium and the required other ingredients from those 66: 2 (1977). Also, for a review on suitable salts, see Hand enumerated above. In the case of sterile powders for the book of Pharmaceutical Salts: Properties, Selection, and Use preparation of sterile injectable solutions, methods of prepa by Stahl and Wermuth (Wiley-VCH, 2002). ration are vacuum drying and freeze-drying that yields a 0184 Pharmaceutically acceptable base addition salts are powder of the active ingredient plus any additional desired formed with metals or amines, such as alkali and alkaline ingredient from a previously sterile-filtered solution thereof. earth metals or organic amines. Metals used as cations com 0178. In one embodiment, active compounds are prepared prise sodium, potassium, magnesium, calcium, and the like with carriers that will protect the compound against rapid Amines comprise N-N'-dibenzylethylenediamine, chlorop elimination from the body, such as a controlled release for rocaine, choline, diethanolamine, dicyclohexylamine, ethyl mulation, including implants and microencapsulated delivery enediamine, N-methylglucamine, and procaine (see, for systems. Biodegradable, biocompatible polymers can be example, Berge et al., “Pharmaceutical Salts.” J. Pharma Sci., used, such as ethylene vinyl acetate, polyanhydrides, polyg 1977, 66, 119). The base addition salts of said acidic com lycolic acid, collagen, polyorthoesters, and polylactic acid. pounds are prepared by contacting the free acid form with a Methods for preparation of such formulations will be appar sufficient amount of the desired base to produce the salt in the ent to those skilled in the art. The materials can also be conventional manner. The free acid form may be regenerated obtained commercially. Liposomal suspensions (including by contacting the salt form with an acid and isolating the free liposomes targeted to infected cells with monoclonal antibod acid in the conventional manner. The free acid forms differ ies to viral antigens) can also be used as pharmaceutically from their respective salt forms somewhat in certain physical acceptable carriers. These can be prepared according to meth properties such as solubility in polar solvents, but otherwise ods known to those skilled in the art, for example, as the salts are equivalent to their respective free acid for pur described in U.S. Pat. No. 4,522,811. poses of the present invention. (0179. It is especially advantageous to formulate oral or (0185. The subject polynucleotide cassette or gene delivery parenteral compositions in dosage unit form for ease of vector, e.g.recombinant virus (virions), can be incorporated administration and uniformity of dosage. Dosage unit form as into pharmaceutical compositions for administration to mam used herein refers to physically discrete units suited as unitary malian patients, particularly primates and more particularly dosages for the subject to be treated; each unit containing a humans. The subject polynucleotide cassette or gene delivery predetermined quantity of active compound calculated to pro vector, e.g. virions can be formulated in nontoxic, inert, phar duce the desired therapeutic effect in association with the maceutically acceptable aqueous carriers, preferably at a pH required pharmaceutical carrier. The specification for the dos ranging from 3 to 8, more preferably ranging from 6 to 8. age unit forms of the invention are dictated by and directly Such sterile compositions will comprise the vector or virion dependent on the unique characteristics of the active com containing the nucleic acid encoding the therapeutic mol pound and the particular therapeutic effect to be achieved, and ecule dissolved in an aqueous buffer having an acceptable pH the limitations inherent in the art of compounding such an upon reconstitution. active compound for the treatment of individuals. 0186. In some embodiments, the pharmaceutical compo 0180. The pharmaceutical compositions can be included sition provided herein comprise a therapeutically effective in a container, pack, or dispenser, e.g. Syringe, e.g. a prefilled amount of a vector or virion in admixture with a pharmaceu syringe, together with instructions for administration. tically acceptable carrier and/or excipient, for example saline. 0181. The pharmaceutical compositions of the invention phosphate buffered saline, phosphate and amino acids, poly encompass any pharmaceutically acceptable salts, esters, or mers, polyols, sugar, buffers, preservatives and other pro salts of such esters, or any other compound which, upon teins. Exemplary amino acids, polymers and sugars and the administration to an animal comprising a human, is capable like are octylphenoxy polyethoxyethanol compounds, poly of providing (directly or indirectly) the biologically active ethylene glycol monostearate compounds, polyoxyethylene metabolite or residue thereof. Accordingly, for example, the sorbitan fatty acid esters, sucrose, fructose, dextrose, maltose, disclosure is also drawn to prodrugs and pharmaceutically glucose, mannitol, dextran, sorbitol, inositol, galactitol. Xyli acceptable salts of the compounds of the invention, pharma tol, lactose, trehalose, bovine or human serum albumin, cit ceutically acceptable salts of such prodrugs, and other bio rate, acetate, Ringer's and Hank’s solutions, cysteine, argin equivalents. ine, carnitine, alanine, glycine, lysine, Valine, leucine. 0182. The term “prodrug” indicates a therapeutic agent polyvinylpyrrolidone, polyethylene and glycol. Preferably, that is prepared in an inactive form that is converted to an this formulation is stable for at least six months at 4°C. active form (i.e., drug) within the body or cells thereof by the 0187. In some embodiments, the pharmaceutical compo action of endogenous enzymes or other chemicals and/or sition provided herein comprises a buffer, such as phosphate conditions. buffered saline (PBS) or sodium phosphate/sodium sulfate, 0183. The term “pharmaceutically acceptable salt” refers tris buffer, glycine buffer, sterile water and other buffers to physiologically and pharmaceutically acceptable salts of known to the ordinarily skilled artisan such as those described the compounds of the invention: i.e., salts that retain the by Good et al. (1966) Biochemistry 5:467. The pH of the US 2015/0259395 A1 Sep. 17, 2015

buffer in which the pharmaceutical composition comprising times, and the cells allowed to incubate with the agent(s) for the tumor Suppressor gene contained in the adenoviral vector Some amount of time following each contacting event e.g. delivery system, may be in the range of 6.5 to 7.75, preferably 16-24 hours, after which time the media is replaced with fresh 7 to 7.5, and most preferably 7.2 to 7.4. media and the cells are cultured further. Contacting the cells may occur in any culture media and under any culture condi Methods tions that promote the survival of the cells. For example, cells 0188 As alluded to above, the subject polynucleotide cas may be suspended in any appropriate nutrient medium that is settes and gene delivery vectors, referred to collectively convenient, such as Iscove’s modified DMEM or RPMI 1640, herein as the “subject compositions, find use in expressing a Supplemented with fetal calf serum or heat inactivated goat transgene in cone cells of an animal. For example, the Subject serum (about 5-10%), L-glutamine, a thiol, particularly compositions may be used in research, e.g. to determine the 2-mercaptoethanol, and antibiotics, e.g. penicillin and strep effect that the gene has on cone cell viability and/or function. tomycin. The culture may contain growth factors to which the As another example, the Subject compositions may be used in cells are responsive. Growth factors, as defined herein, are medicine, e.g. to treat a cone cell disorder. Thus, in some molecules capable of promoting Survival, growth and/or dif aspects of the invention, methods are provided for the expres ferentiation of cells, either in culture or in the intact tissue, sion of a gene in cone cells, the method comprising contacting through specific effects on a transmembrane receptor. Growth cone cells with a composition of the present disclosure. In factors include polypeptides and non-polypeptide factors. Some embodiments, contacting occurs in vitro. In some embodiments, contacting occurs in Vivo, i.e., the Subject com 0.192 Typically, an effective amount of subject polynucle position is administered to a subject. otide cassette or gene delivery vector comprising a subject 0189 For instances in which cone cells are to be contacted polynucleotide cassette is provided to produce the expression in vitro with a Subject polynucleotide cassette or gene deliv of the transgene in cells. As discussed elsewhere herein, the ery vector comprising a subject polynucleotide cassette, the effective amount may be readily determined empirically, e.g. cells may be from any mammalian species, e.g. rodent (e.g. by detecting the presence or levels of transgene gene product, mice, rats, gerbils, squirrels), rabbit, feline, canine, goat, by detecting an effect on the viability or function of the cone ovine, pig, equine, bovine, primate, human. Cells may be cells, etc. Typically, an effect amount of Subject polynucle from established cell lines, e.g. WERI cells, 661W cells, or otide cassette or gene delivery vector comprising a subject they may be primary cells, where “primary cells”, “primary polynucleotide cassette will promote greater expression of cell lines, and “primary cultures are used interchangeably the transgene in cone cells than the same amount of a poly herein to refer to cells and cells cultures that have been nucleotide cassette as known in the art, e.g. a pR2.1 (nucle derived from a subject and allowed to grow in vitro for a otides 1-2274 of SEQ ID NO:50), pR1.7, pR1.5, pR1.1, or limited number of passages, i.e. splittings, of the culture. For IRBP/GNAT2 cassette. Typically, expression will be example, primary cultures are cultures that may have been enhanced 2-fold or more relative to the expression from a passaged 0 times, 1 time, 2 times, 4 times, 5 times, 10 times, reference, or control, polynucleotide cassette e.g. as known in or 15 times, but not enough times go through the crisis stage. the art, for example 3-fold, 4-fold, or 5-fold or more, in some Typically, the primary cell lines of the present invention are instances 10-fold, 20-fold or 50-fold or more, e.g. 100-fold. maintained for fewer than 10 passages in vitro. 0193 In some embodiments, as when the transgene is a 0190. If the cells are primary cells, they may be harvested selectable marker, the population of cells may be enriched for from a mammal by any convenient method, e.g. whole those comprising the Subject polynucleotide cassette by sepa explant, biopsy, etc. An appropriate solution may be used for rating the modified cells from the remaining population. dispersion or Suspension of the harvested cells. Such solution Separation may be by any convenient separation technique will generally be a balanced salt solution, e.g. normal saline, appropriate for the selectable marker used. For example, if the PBS, Hank's balanced salt solution, etc., conveniently transgene is a fluorescent marker, cells may be separated by supplemented with fetal calf serum or other naturally occur fluorescence activated cell sorting, whereas if the transgene is ring factors, in conjunction with an acceptable buffer at low a cell Surface marker, cells may be separated from the hetero concentration, generally from 5-25 mM. Convenient buffers geneous population by affinity separation techniques, e.g. include HEPES, phosphate buffers, lactate buffers, etc. The magnetic separation, affinity chromatography, "panning cells may be used immediately, or they may be stored, frozen, with an affinity reagent attached to a solid matrix, or other for long periods of time, being thawed and capable of being convenient technique. Techniques providing accurate separa reused. In such cases, the cells will usually be frozen in 10% tion include fluorescence activated cell sorters, which can DMSO, 50% serum, 40% buffered medium, or some other have varying degrees of Sophistication, such as multiple color Such solution as is commonly used in the art to preserve cells channels, low angle and obtuse light scattering detecting at Such freezing temperatures, and thawed in a manner as channels, impedance channels, etc. The cells may be selected commonly known in the art for thawing frozen cultured cells. against dead cells by employing dyes associated with dead 0191 To promote expression of the transgene, the subject cells (e.g. propidium iodide). Any technique may be polynucleotide cassette or gene delivery vector comprising a employed which is not unduly detrimental to the viability of subject polynucleotide cassette will be contacted with the the cells. Cell compositions that are highly enriched for cells cells for about 30 minutes to 24 hours or more, e.g., 1 hour, 1.5 comprising the Subject polynucleoties are achieved in this hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours 4 hours, 5 hours, manner. By “highly enriched, it is meant that the genetically 6 hours, 7 hours, 8 hours, 12 hours, 16 hours, 18 hours, 20 modified cells will be 70% or more, 75% or more, 80% or hours, 24 hours, etc. The Subject polynucleotide cassette or more, 85% or more, 90% or more of the cell composition, for gene delivery vector comprising a subject polynucleotide example, about 95% or more, or 98% or more of the cell cassette may be provided to the Subject cells one or more composition. In other words, the composition may be a Sub times, e.g. one time, twice, three times, or more than three stantially pure composition of genetically modified cells. US 2015/0259395 A1 Sep. 17, 2015 18

0194 For instances in which cone cells are to be contacted cedure, and activities are not restricted. Sometimes, an anti in vivo with a Subject polynucleotide cassette or gene delivery biotic eye drop is prescribed for several days to help prevent vector comprising a subject polynucleotide cassette, the Sub infection. ject may be any mammal, e.g. rodent (e.g. mice, rats, gerbils), 0198 The methods and compositions of the present dis rabbit, feline, canine, goat, Ovine, pig, equine, bovine, or closure find use in the treatment of any condition that can be primate. In certain embodiments, the Subject is a primate of addressed, at least in part, by gene therapy of cone photore the Parvorder Catarrhini. As is known in the art, Catarrhini is ceptor cells. Thus, the compositions and methods of the one of the two subdivisions of the higher primates (the other present disclosure find use in the treatment of individuals in being the New World monkeys), and includes Old World need of a cone cell therapy. By a person in need of a cone cell monkeys and the apes, which in turn are further divided into therapy, it is meant an individual having or at risk of devel the lesserapes or gibbons and the great apes, consisting of the oping a cone cell disorder. By a “cone cell disorder it is orangutans, gorillas, chimpanzees, bonobos, and humans. In meant any disorder impacting retinal cone cells, including but a further preferred embodiment, the primate is a human. not limited to vision disorders of the eye that are associated 0.195 The subject composition may be administered to the with a defect within cone cells, i.e. a cone-instrinsic defect, retina of the subject by any suitable method. For example, the e.g. macular dystrophies such as Stargardt’s macular dystro Subject composition may be administered intraocularly via phy, cone dystrophy, cone-rod dystrophy, Spinocerebellar intravitreal injection or Subretinal injection. The general ataxia type 7, and Bardet-Biedl syndrome-1; as well as color methods for delivering a vector via intravitrealinjection or via vision disorders, including achromatopsia, incomplete ach subretinal injection may be illustrated by the following brief romatopsia, blue cone monochromacy, and protan, deutan, outlines. These examples are merely meant to illustrate cer and tritan defects; as well as vision disorders of the central tain features of the methods, and are in no way meant to be macula (within primates) that may be treated by targeting limiting. cone cells, e.g. age-related macular degeneration, macular telangiectasia, retinitis pigmentosa, diabetic retinopathy, reti 0196. For subretinal administration, the vector can be nal vein occlusions, glaucoma, Sorsby's fundus dystrophy, delivered in the form of a suspension injected subretinally adult Vitelliform macular dystrophy, Best's disease, rod-cone under direct observation using an operating microscope. dystrophy, Leber's congenital amaurosis, and X-linked reti Typically, a volume of 1 to 200 uL, e.g. 50 uL. 100 uL. 150 ul, noschisis. or 200 uL, but usually no more than 200 uL, of the subject 0199 Stargardt’s macular dystrophy. Stargardt’s macular composition will be administered by such methods. This pro dystrophy, also known as Stargardt Disease and fundus fla cedure may involve vitrectomy followed by injection of vec Vimaculatus, is an inherited form of juvenile macular degen tor Suspension using a fine cannula through one or more Small eration that causes progressive vision loss usually to the point retinotomies into the subretinal space. Briefly, an infusion of legal blindness. The onset of symptoms usually appears cannula can be sutured in place to maintain a normal globe between the ages of six and thirty years old (average of about Volume by infusion (of e.g. saline) throughout the operation. 16-18 years). Mutations in several genes, including ABCA4, A vitrectomy is performed using a cannula of appropriate CNGB3, ELOVL4, PROM1, are associated with the disorder. bore size (for example 20 to 27 gauge), wherein the volume of Symptoms typically develop by twenty years of age, and vitreous gel that is removed is replaced by infusion of saline include wavy vision, blind spots, blurriness, impaired color or other isotonic solution from the infusion cannula. The vision, and difficulty adapting to dim lighting. The main vitrectomy is advantageously performed because (1) the symptom of Stargardt disease is loss of visual acuity, which removal of its cortex (the posterior hyaloid membrane) facili ranges from 20/50 to 20/200. In addition, those with Stargardt tates penetration of the retina by the cannula; (2) its removal disease are sensitive to glare; overcast days offer some relief. and replacement with fluid (e.g. saline) creates space to Vision is most noticeably impaired when the macula is dam accommodate the intraocular injection of vector, and (3) its aged, which can be observed by fundus exam. controlled removal reduces the possibility of retinal tears and 0200 Cone dystrophy. Cone dystrophy (COD) is an inher unplanned retinal detachment. ited ocular disorder characterized by the loss of cone cells. 0197) For intravitreal administration, the vector can be The most common symptoms of cone dystrophy are vision delivered in the form of a suspension. Initially, topical anes loss (age of onset ranging from the late teens to the sixties), thetic is applied to the surface of the eye followed by a topical sensitivity to bright lights, and poor color vision. Visual acu antiseptic solution. The eye is held open, with or without ity usually deteriorates gradually, but it can deteriorate rap instrumentation, and the vector is injected through the Sclera idly to 20/200; later, in more severe cases, it drops to “count with a short, narrow, for example a 30 gauge needle, into the ing fingers' vision. Color vision testing using color test plates vitreous cavity of the eye of a subject under direct observa (HRR series) reveals many errors on both red-green and blue tion. Typically, a volume of 1 to 100 uL, e.g. 25ul, 50 uL, or yellow plates. It is believed that the dystrophy is primary, 100 uL, and usually no more than 100uIL, of the subject since Subjective and objective abnormalities of cone function composition may be delivered to the eye by intravitreal injec are found before ophthalmoscopic changes can be seen. How tion without removing the vitreous. Alternatively, a vitrec ever, the retinal pigment epithelium (RPE) rapidly becomes tomy may be performed, and the entire Volume of vitreous gel involved, leading to a retinal dystrophy primarily involving is replaced by an infusion of the Subject composition. In Such the macula. The fundus exam via ophthalmoscope is essen cases, up to about 4 mL of the Subject composition may be tially normal early on in cone dystrophy, and definite macular delivered, e.g. to a human eye. Intravitreal administration is changes usually occur well after visual loss. The most com generally well tolerated. At the conclusion of the procedure, mon type of macular lesion seen during ophthalmoscopic there is sometimes mild redness at the injection site. There is examination has a bull's-eye appearance and consists of a occasional tenderness, but most patients do not report any doughnut-like Zone of atrophic pigment epithelium Surround pain. No eye patch or eye shield is necessary after this pro ing a central darker area. In another, less frequent form of US 2015/0259395 A1 Sep. 17, 2015 cone dystrophy there is rather diffuse atrophy of the posterior Most people with Bardet-Biedl syndrome also develop pole with spotty pigment clumping in the macular area. blurred central vision (poor visual acuity) and become legally Rarely, atrophy of the choriocapillaris and larger choroidal blind by adolescence or early adulthood. Bardet-Biedl syn vessels is seen in patients at an early stage. Fluorescein drome can result from mutations in at least 14 different genes angiography (FA) is a useful adjunct in the workup of some (often called BBS genes) known or suspected to play critical one suspected to have cone dystrophy, as it may detect early roles in cilia function, with mutations in BBS1 and BBS10 changes in the retina that are too subtle to be seen by ophthal being the most common. moscope. Because of the wide spectrum of fundus changes and the difficulty in making the diagnosis in the early stages, 0204 Achromatopsia. Achromatopsia, or Rod monochro electroretinography (ERG) remains the best test for making matism, is a disorder in which subjects experience a complete the diagnosis. Abnormal cone function on the ERG is indi lack of the perception of color, Such that the Subject sees only cated by a reduced single-flash and flicker response when the in black, white, and shades of grey. Other symptoms include test is carried out in a well-lit room (photopic ERG). Muta reduced visual acuity, photophobia, nystagmus, Small central tions in several genes, including GUCA1A, PDE6C, PDE6H, Scotoma, and eccentric fixation. The disorder is frequently and RPGR, are associated with the disorder. noticed first in children around six months of age by their 0201 Cone-rod dystrophy. Cone-rod dystrophy (CRD, or photophobic activity and/or their nystagmus. Visual acuity CORD) is an inherited retinal dystrophy that belongs to the and Stability of the eye motions generally improve during the group of pigmentary retinopathies. CRD is characterized by first 6-7 years of life (but remain near 20/200). Mutations in retinal pigment deposits visible on fundus examination, pre CNGB3, CNGA3, GNAT2, PDE6C, and PDE6HI have been dominantly localized to the macular region and the loss of associated with the disorder. both cone and rod cells. In contrast to rod-cone dystrophy 0205 Incomplete achromatopsia. Incomplete achro (RCD) resulting from the primary loss in rod photoreceptors matopsia is similar to Achromatopsia but with less pen and later followed by the secondary loss in cone photorecep etrance. In incomplete achromatopsia, the symptoms are tors, CRD reflects the opposite sequence of events: primary similar to those of complete achromatopsia except in a dimin cone involvement, or, sometimes, by concomitant loss of both ished form. Individuals with incomplete achromatopsia have cones and rods. Symptoms include decreased visual acuity, reduced visual acuity with or without nystagmus or photo color vision defects, photoaversion and decreased sensitivity phobia. Furthermore, these individuals show only partial in the central visual field, later followed by progressive loss in impairment of cone cell function but again have retained rod peripheral vision and night blindness. Mutations in several cell function. genes, including ADAM9, PCDH21, CRX, GUCY2D, PIT PNM3, PROM1, PRPH2, RAX2, RIMS1, RPGR, and 0206 Blue cone monochromacy. Blue cone (S cone) RPGRIP1, are associated with the disorder. monochromatism (BCM) is a rare X-linked congenital sta 0202 Spinocerebellar ataxia type 7. Spinocerebellar tionary cone dysfunction syndrome, affecting approximately ataxia is a progressive, degenerative, inherited disease char 1 in 100,000 individuals. Affected males with BCM have no acterized by slowly progressive incoordination of gait and is functional long wavelength sensitive (L) or medium wave often associated with poor coordination of hands, speech, and length sensitive (M) cones in the retina, due to mutations at eye movements. There are multiple types of SCA, with the genetic locus for the Land M-opsin genes. Color discrimi Spinocerebellar ataxia type 7 (SCA-7) differing from most nation is severely impaired from birth, and vision is derived other SCAS in that visual problems can occur in addition to from the remaining preserved S cones and rod photorecep poor coordination. SCA-7 is associated with automoSmal tors. BCM typically presents with reduced visual acuity (6/24 dominant mutations in the ATXN7/SCA7 gene. When the to 6/60), pendular nystagmus, photophobia, and patients disease manifests itself before age 40, visual problems rather often have myopia. The rod-specific and maximal electrore than poor coordination are typically the earliest signs of dis tinogram (ERG) usually show no definite abnormality, ease. Early symptoms include difficulty distinguishing colors whereas the 30 Hz, cone ERG cannot be detected. Single flash and decreased central vison. In addition, symptoms of ataxia photopic ERG is often recordable, albeit small and late, and (incoordination, slow eye movements, and mild changes in the Scone ERG is well preserved. sensation or reflexes) may be detectable. Loss of motor con 0207 Color vision deficiency. Color vision deficiency trol, unclear speech, and difficulty Swallowing become (CVD), or colorblindness, is the inability or decreased ability prominent as the disease progresses. to see color, or perceive color differences, under normal light 0203 Bardet-Biedl syndrome-1. Bardet-Biedl syn ing conditions. Individuals Suffering from color blindness drome-1 (BBS-1) is a pleiotropic disorder with variable may be identified as Such using any of a number of color expressivity and a wide range of clinical variability observed vision tests, e.g., color ERG (cERG), pseudoisochromatic both within and between families. The main clinical features plates (Ishihara plates, Hardy-Rand-Ritter polychromatic are rod-cone dystrophy, with childhood-onset visual loss pre plates), the Farnsworth-Munsell 100 hue test, the Farn ceded by nightblindness; postaxial polydactyly; truncal obe sworth’s panel D-15, the City University test, Kollner's rule, sity that manifests during infancy and remains problematic etc. Examples of color vision deficiencies include protan throughout adulthood; specific learning difficulties in some defects, deutan defects, and tritan defects. Protan defects but not all individuals; male hypogenitalism and complex include protanopia (an insensitivity to red light) and prota female genitourinary malformations; and renal dysfunction, a nomaly (a reduced sensitivity to red light), and are associated major cause of morbidity and mortality. Vision loss is one of with mutations in the L-Opsin gene (OPN1LW). Deutan the major features of Bardet-Biedl syndrome. Problems with defects include deuteranopia (an insensitivity to green light) night vision become apparent by mid-childhood, followed by and deutanomaly (a reduced sensitivity to green light), and blind spots that develop in the peripheral vision. Over time, are associated with mutations in the M-Opsin gene these blind spots enlarge and merge to produce tunnel vision. (OPN1 MW). Tritan defects include tritanopia (an insensitiv US 2015/0259395 A1 Sep. 17, 2015 20 ity to blue light) and tritanomaly (a reduced sensitivity to blue reduced retinal transparency, crystalline deposits, mildly light), and are associated with mutations in the S-Opsin gene ectatic capillaries, blunted Venules, retinal pigment plaques, (OPN1SW). foveal atrophy, and neovascular complexes. Fluorescein 0208 Age-related macular degeneration. Age-related angiography shows telangiectatic capillaries predominantly macular degeneration (AMD) is one of the leading causes of temporal to the foveola in the early phase and a diffuse hyper vision loss in people over the age of 50 years. AMD mainly fluorescence in the late phase. High-resolution optical coher affects central vision, which is needed for detailed tasks such ence tomography (OCT) may reveal disruption of the photo as reading, driving, and recognizing faces. The vision loss in receptor inner segment-outer segment border, hyporeflective this condition results from a gradual deterioration of photo cavities at the level of the inner or outer retina, and atrophy of receptors in the macula. Side (peripheral) vision and night the retina in later stages. InType 1 macular telangiectasia, the vision are generally not affected. disease almost always occurs in one eye, which differentiates 0209 Researchers have described two major types of age it from Type 2. While MacTel does not usually cause total related macular degeneration, known as the dry, or “nonexu blindness, it commonly causes loss of the central vision, dative' form, and the wet, or "exudative' or “neovascular, which is required for reading and driving vision, over a period form, both of which may be treated by delivering transgenes of 10-20 years. in the context of the Subject polynucleotide cassettes. 0213 Retinitis pigmentosa. Retinitis Pigmentosa (RP) is a 0210 Dry AMD is characterized by a buildup of yellow group of inherited disorders characterized by progressive deposits called drusen between the retinal pigment epithe peripheral vision loss and night vision difficulties (nyctalo lium and the underlying choroid of the macula, which may be pia) that can lead to central vision loss. Presenting signs and observed by Fundus photography. This results in a slowly symptoms of RP vary, but the classic ones include nyctalopia progressive loss of vision. The condition typically affects (night blindness, most commonly the earliest symptom in vision in both eyes, although vision loss often occurs in one RP); visual loss (usually peripheral, but in advanced cases, eye before the other. Other changes may include pigment central visual loss); and photopsia (seeing flashes of light). changes and RPE atrophy. For example, in certain cases Because RP is a collection of many inherited diseases, sig called central geographic atrophy, or 'GA', atrophy of the nificant variability exists in the physical findings. Ocular retinal pigment epithelial and Subsequent loss of photorecep examination involves assessment of visual acuity and pupil tors in the central part of the eye is observed. Dry AMD has lary reaction, as well as anterior segment, retinal, and fundu been associated with mutations in CD59 and genes in the scopic evaluation. In some instances, the RP is one aspect of complement cascade. a syndrome, e.g. syndromes that are also associated with 0211 Wet AMD is a progressed state of dry AMD, and hearing loss (Usher syndrome, Waardenburg Syndrome, occurs in abut 10% of dry AMD patients. Pathological Alport syndrome, Refsum disease); Kearns-Sayre syndrome changes include retinal pigment epithelial cells (RPE) dys (external ophthalmoplegia, lid ptosis, heart block, and pig function, fluid collecting under the RPE, and choroidal mentary retinopathy); Abetalipoproteinemia (Fat malabsorp neovascularization (CNV) in the macular area. Fluid leakage, tion, fat-soluble vitamin deficiencies, spinocerebellar degen RPE or neural retinal detachment and bleeding from ruptured eration, and pigmentary retinal degeneration); blood vessels can occur in severe cases. Symptoms of wet mucopolysaccharidoses (eg. Hurler syndrome, Scheie Syn AMD may include visual distortions, such as straight lines drome, Sanfilippo syndrome); Bardet-Biedl syndrome (Poly appearing wavy or crooked, a doorway or street sign looking dactyly, truncal obesity, kidney dysfunction, short stature, lopsided, or objects appearing Smaller or farther away than and pigmentary retinopathy); and neuronal ceroid lipofusci they really are; decreased central vision; decreased intensity nosis (Dementia, seizures, and pigmentary retinopathy; or brightness of colors; and well-defined blurry spot or blind infantile form is known as Jansky-Bielschowsky disease, spot in the field of vision. Onset may be abrupt and worsen juvenile form is Vogt-Spielmeyer-Batten disease, and adult rapidly. Diagnosis may include the use of an Amsler grid to form is Kufs syndrome). Retinitis pigmentosa is most com test for defects in the Subject's central vision (macular degen monly associated with mutations in the RHO, RP2, RPGR, eration may cause the straightlines in the grid to appear faded, RPGRIP1, PDE6A, PDE6B, MERTK, PRPH2, CNGB1, broken or distorted), fluorescein angiogram to observe blood USH2A, ABCA4, BBS genes. vessel or retinal abnormalities, and optical coherence tomog 0214 Diabetic retinopathy. Diabetic retinopathy (DR) is raphy to detect retina Swelling or leaking blood vessels. A damage to the retina caused by complications of diabetes, number of cellular factors have been implicated in the gen which can eventually lead to blindness. Without wishing to be eration of CNV, among which are vascular endothelial growth bound by theory, it is believed that hyperglycemia-induced factor (VEGF), platelet-derived growth factor (PDGF), pig intramural pericyte death and thickening of the basement ment epithelium-derived factor (PEDF), hypoxia inducible membrane lead to incompetence of the vascular walls. These factor (HIF), angiopoietin (Ang), and other cytokines, mito damages change the formation of the blood-retinal barrier gen-activated protein kinases (MAPK) and others. and also make the retinal blood vessels become more perme 0212 Macular telangiectasia. Macular telangiectasia able. (MacTel) is a form of pathologically dilated blood vessels 0215. There are two stages of diabetic retinopathy: non (telangiectasia) in the parafoveal region of the macula. The proliferative diabetic retinopathy (NPDR), and proliferative tissue deteriorates and the retinal structure becomes Scarred diabetic retinopathy (PDR). Nonproliferative diabetic retin due to the development of liquid-filled cysts, which impairs opathy is the first stage of diabetic retinopathy, and is diag nutrition of the photoreceptor cells and destroys vision per nosed by fundoscopic exam and coexistent diabetes. In cases manently. There are two types of MacTel, type 1 and type 2. of reduced vision, fluorescein angiography may be done to Macular telangiectasia type 2 is a bilateral disease, whose visualize the vessles in the back of the eye to and any retinal prevalence has recently been shown to be as high as 0.1% in ischemia that may be present. All people with diabetes are at persons 40 years and older. Biomicroscopy may show risk for developing NPDR, and as such, would be candidates US 2015/0259395 A1 Sep. 17, 2015 for prophylactic treatment with the subject vectors. Prolifera pain, seeing halos around lights, red eye, very high intraocu tive diabetic retinopathy is the second stage of diabetic retin lar pressure (>30 mmHg), nausea and Vomiting, Suddenly opathy, characterized by neovascularization of the retina, Vit decreased vision, and a fixed, mid-dilated pupil. It is also reous hemorrhage, and blurred vision. In some instances, associated with an oval pupil in Some cases. Modulating the fibrovascular proliferation causes tractional retinal detach activity of proteins encoded by DLK, NMDA, INOS, CASP ment. In some instances, the vessels can also grow into the 3, Bcl-2, or Bcl-Xl may treat the condition. angle of the anterior chamber of the eye and cause neovascu 0220 Sorsby's fundus dystrophy. Sorsby's fundus dystro larglaucoma. Individuals with NPDR are at increased risk for phy is an autosomal dominant, retinal disease associated with developing PDR, and as such, would be candidates for pro mutations in the TIMP3 gene. Clinically, early, mid-periph phylactic treatment with the subject vectors. eral, drusen and colour vision deficits are found. Some 0216 Diabetic macular edema. Diabetic macular edema patients complain of night blindness. Most commonly, the (DME) is an advanced, vision-limiting complication of dia presenting symptom is Sudden acuity loss, manifest in the betic retinopathy that affects nearly 30% of patients who have third to fourth decades of life, due to untreatable submacular had diabetes for at least 20 years, and is responsible for much neovascularisation. Histologically, there is accumulation of a of the vision loss due to DR. It results from retinal microvas confluent lipid containing material 30 um thick at the level of cular changes that compromise the blood-retinal barrier, Bruch's membrane. causing leakage of plasma constituents into the Surrounding 0221 Vitelliform macular dystrophy. Vitelliform macular retina and, consequently, retinal edema. Without wishing to dystrophy is a genetic eye disorder that can cause progressive be bound by theory, it is believed that hyperglycemia, sus vision loss. Vitelliform macular dystrophy is associated with tained alterations in cell signaling pathways, and chronic the buildup of fatty yellow pigment (lipofuscin) in cells microvascular inflammation with leukocyte-mediated injury underlying the macula. Over time, the abnormal accumula leads to chronic retinal microvascular damage, which triggers tion of this substance can damage cells that are critical for an increase in intraocular levels of VEGF, which in turn clear central vision. As a result, people with this disorder increases the permeability of the vasculature. often lose their central vision, and their eyesight may become 0217 Patients at risk for developing DME include those blurry or distorted. Vitelliform macular dystrophy typically who have had diabetes for an extended amount of time and does not affect side (peripheral) vision or the ability to see at who experience one or more of severe hypertension (high night. blood pressure), fluid retention, hypoalbuminemia, or hyper 0222 Researchers have described two forms of Vitelli lipidemia. Common symptoms of DME are blurry vision, form macular dystrophy with similar features. The early floaters, double vision, and eventually blindness if the condi onset form (known as Best disease) usually appears in child tion is allowed to progress untreated. DME is diagnosed by hood; the onset of symptoms and the severity of vision loss funduscopic examination as retinal thickening within 2 disc vary widely. It is associated with mutations in the VMD2/ diameters of the center of the macula. Other methods that may BEST1 gene. The adult-onset form (Adult Vitelliform macu be employed include Optical coherence tomography (OCT) lar dystrophy) begins later, usually in mid-adulthood, and to detect retinal Swelling, cystoid edema, and serous retinal tends to cause vision loss that worsens slowly overtime. It has detachment; fluorescein angiography, which distinguishes been associated with mutations in the PRPH2 gene. The two and localizes areas of focal versus diffuse leakage, thereby forms of Vitelliform macular dystrophy each have character guiding the placement of laser photocoagulation if laser pho istic changes in the macula that can be detected during an eye tocoagulation is to be used to treat the edema; and color stereo examination. fundus photographs, which can be used to evaluate long-term 0223 Rod-cone dystrophy. Rod-cone dystrophies are a changes in the retina. Visual acuity may also be measured, family of progressive diseases in which rod dysfunction, especially to follow the progression of macular edema and which leads to night blindness and loss of peripheral visual observe its treatment following administration of the subject field expanses, is either the prevailing problem or occurring at pharmaceutical compositions. least as severely as cone dysfunction. A scallop-bordered 0218. Retinal vein occlusions. A retinal vein occlusion lacunaratrophy may be seen in the midperiphery of the retina. (RVO) is a blockage of the portion of the circulation that The macula is only mildly involved by clinical examination drains the retina of blood. The blockage can cause back-up although central retinal thinning is seen in all cases. Dyschro pressure in the capillaries, which can lead to hemorrhages and matopsia is mild early and usually becomes more severe. The also to leakage of fluid and other constituents of blood. visual fields are moderately to severely constricted although 0219 Glaucoma. Glaucoma is a term describing a group in younger individuals a typical ring Scotoma is present. The of ocular (eye) disorders that result in optic nerve damage, peripheral retina contains white dots and often resembles often associated with increased fluid pressure in the eye (in the retinal changes seen in retinitis punctate albescens. traocular pressure)(IOP). The disorders can be roughly Retinitis pigmentosa is the main group of diseases included divided into two main categories, “open-angle' and "closed under this definition and, as a whole, is estimated to affect angle' (or “angle closure') glaucoma. Open-angle glaucoma approximately one in every 3,500 people. Depending on the accounts for 90% of glaucoma cases in the United States. It is classification criteria used, about 60-80% of all retinitis pig painless and does not have acute attacks. The only signs are mentosa patients have a clear-cut rod-cone dystrophy pattern gradually progressive visual field loss, and optic nerve of retinal disease and once other syndromic forms are taken changes (increased cup-to-disc ratio on fundoscopic exami into account, about 50-60% of all retinitis pigmentosas fall in nation). Closed-angle glaucoma accounts for less than 10% of the rod-cone dystrophy nonsyndromic category. glaucoma cases in the United States, but as many as half of 0224 Leber's congenital amaurosis. Leber's congenital glaucoma cases in other nations (particularly Asian coun amaurosis (LCA) is a severe dystrophy of the retina that tries). About 10% of patients with closed angles present with typically becomes evident in the first year of life. Visual acute angle closure crises characterized by Sudden ocular function is usually poor and often accompanied by nystag US 2015/0259395 A1 Sep. 17, 2015 22 mus, sluggish or near-absent pupillary responses, photopho 0227. In practicing the subject methods, the subject com bia, high hyperopia, and keratoconus. Visual acuity is rarely position is typically delivered to the retina of the subject in an better than 20/400. A characteristic finding is Franceschetti's amount that is effective to result in the expression of the oculo-digital sign, comprising eye poking, pressing, and rub transgene in the cone cells. In some embodiments, the method bing. The appearance of the fundus is extremely variable. comprises the step of detecting the expression of the trans While the retina may initially appear normal, a pigmentary gene in the cone cells. retinopathy reminiscent of retinitis pigmentosa is frequently 0228. There are a number of ways to detect the expression observed later in childhood. The electroretinogram (ERG) is of a transgene, any of which may be used in the Subject characteristically “nondetectable' or severely subnormal. embodiments. For example, expression may be detected Mutations in 17 genes are known to cause LCA: GUCY2D directly, i.e. by measuring the amount of gene product, for (locus name: LCA1), RPE65 (LCA2), SPATA7 (LCA3), example, at the RNA level, e.g. by RT-PCR, Northern blot, AIPL1 (LCA4), LCAS (LCAS), RPGRIP1 (LCA6), CRX RNAse protection; or at the protein level, e.g. by Western blot, (LCAT), CRB1 (LCAS), NMNAT1 (LCAS), CEP290 ELISA, immunohistochemistry, and the like. As another (LCA10), IMPDH1 (LCA 11), RD3 (LCA12), RDH12 example, expression may be detected indirectly, i.e. by (LCA13), LRAT (LCA14), TULP1 (LCA15), KCNJ13 detecting the impact of the gene product on the viability or (LCA16), and IQCB1. Together, mutations in these genes are function of the cone photoreceptor in the subject. For estimated to account for over half of all LCA diagnoses. At example, if the gene product encoded by the transgene least one other disease locus for LCA has been reported, but improves the viability of the cone cell, the expression of the the gene is not known. transgene may be detected by detecting an improvement in viability of the cone cell, e.g. by fundus photography, Optical 0225 X-linked retinoschisis. X-linked retinoschisis coherence tomography (OCT), Adaptive Optics (AO), and the (XLRS) is characterized by symmetric bilateral macular like. If the gene product encoded by the transgene alters the involvement with onset in the first decade of life, in some activity of the cone cell, the expression of the transgene may cases as early as age three months. Fundus examination be detected by detecting a change in the activity of the cone shows areas of schisis (splitting of the nerve fiber layer of the cell, e.g. by electroretinogram (ERG) and color ERG (cERG); retina) in the macula, Sometimes giving the impression of a functional adaptive optics; color vision tests Such as pseudo spoke wheel pattern. Schisis of the peripheral retina, pre isochromatic plates (Ishihara plates, Hardy-Rand-Ritter dominantly inferotemporally, occurs in approximately 50% polychromatic plates), the Farnsworth-Munsell 100 hue test, of individuals. Affected males typically have vision of 20/60 the Farnsworth's panel D-15, the City university test, Koll to 20/120. Visual acuity often deteriorates during the first and ner's rule, and the like; and visual acuity tests such as the second decades of life but then remains relatively stable until ETDRS letters test, Snellen visual acuity test, visual field test, the fifth or sixth decade. The diagnosis of X-linked juvenile contrast sensitivity test, and the like, as away of detecting the retinoschisis is based on fundus findings, results of electro presence of the delivered polynucleotide. In some instances, physiologic testing, and molecular genetic testing. RS1 is the both an improvement in viability and a modification in cone only gene known to be associated with X-linked juvenile cell function may be detected. retinoschisis. 0229. In some embodiments, the subject method results in 0226. An individual affected by a cone cell disorder or at a therapeutic benefit, e.g. preventing the development of a risk for developing a cone cell disorder can be readily iden disorder, halting the progression of a disorder, reversing the tified using techniques to detect the symptoms of the disorder progression of a disorder, etc. In some embodiments, the as known in the art, including, without limitation, fundus Subject method comprises the step of detecting that a thera photography: Optical coherence tomography (OCT); adap peutic benefit has been achieved. The ordinarily skilled arti tive optics (AO); electroretinography, e.g. ERG, color ERG san will appreciate that such measures of therapeutic efficacy (cERG); color vision tests such as pseudoisochromatic plates will be applicable to the particular disease being modified, (Ishihara plates, Hardy-Rand-Ritter polychromatic plates), and will recognize the appropriate detection methods to use to the Farnsworth-Munsell 100 hue test, the Farnsworth’s panel measure therapeutic efficacy. For example, therapeutic effi D-15, the City university test, Kollner's rule, and the like; and cacy in treating macular degeneration may be observed as a visual acuity tests such as the ETDRS letters test, Snellen reduction in the rate of macular degeneration or a cessation of visual acuity test, visual field test, contrast sensitivity test, and the progression of macular degeneration, effects which may the like; as will be known by the ordinarily skilled artisan. be observed by, e.g., fundus photography, OCT, or AO, by Additionally or alternatively, the individual affected by a comparing test results after administration of the Subject cone cell disorder or at risk for developing a cone cell disorder composition to test results before administration of the sub can be readily identified using techniques to detect gene ject composition. As another example, therapeutic efficacy in mutations that are associated with the cone cell disorder as treating a progressive cone dysfunction may be observed as a known in the art, including, without limitation, PCR, DNA reduction in the rate of progression of cone dysfunction, as a sequence analysis, restriction digestion, Southern blot cessation in the progression of cone dysfunction, or as an hybridization, mass spectrometry, etc. In some embodiments, improvement in cone function, effects which may be the method comprises the step of identifying the individual in observed by, e.g., ERG and/or cRRG; color vision tests; func need of a cone cell therapy. In such instances, any convenient tional adaptive optics; and/or visual acuity tests, for example, method for determining if the individual has the symptom(s) by comparing test results after administration of the Subject of a cone cell disorder or is at risk for developing a cone cell composition to test results before administration of the sub disorder, for example by detecting the symptoms described ject composition and detecting a change in cone viability herein or known in the art, by detecting a mutation in a gene and/or function. As a third example, therapeutic efficacy in as herein or as known in the art, etc. may be utilized to identify treating a color vision deficiency may be observed as an the individual in need of a cone cell therapy. alteration in the individual’s perception of color, e.g. in the US 2015/0259395 A1 Sep. 17, 2015 perception of red wavelengths, in the perception of green In some cases, the MOI may be 1x10-1x10'. In some cases, wavelengths, in the perception of blue wavelengths, effects recombinant viruses of the disclosure are at least about 1x10", which may be observed by, e.g., cERG and color vision tests, 1x10, 1x10, 1x10, 1x10, 1x10, 1x107, 1x10, 1x10, for example, by comparing test results after administration of 1x10, 1x10'', 1x10°, 1x10, 1x10, 1x10, 1x10', the Subject composition to test results before administration 1x10'7, and 1x10"MOI. In some cases, recombinant viruses of the Subject composition and detecting a change in cone of this disclosure are 1x10 to 3x10'. MOI. In some cases, viability and/or function. recombinant viruses of the disclosure are at most about 0230 Expression of the transgene using the subject trans 1x10", 1x10, 1x10, 1x10, 1x10, 1x10, 1x107, 1x10, gene is expected to be robust. Accordingly, in some instances, 1x10, 1x10, 1x10'', 1x10, 1x10, 1x10, 1x10', the expression of the transgene, e.g. as detected by measuring 1x10", 1x107 and 1x10" MOI. levels of gene product, by measuring therapeutic efficacy, 0234. In some aspects, the amount of pharmaceutical etc., may be observed two months or less after administration, composition comprises about 1x10 to about 1x10' particles e.g. 4, 3 or 2 weeks or less after administration, for example, of recombinant viruses, about 1x10 to about 1x10' particles 1 week after administration of the Subject composition. of recombinant viruses, about 1x10" to about 1x10" par Expression of the transgene is also expected to persist over ticles of recombinant viruses, or about 1x10' to about time. Accordingly, in some instances, the expression of the 3x10' particles of recombinant viruses. transgene, e.g. as detected by measuring levels of gene prod 0235 Individual doses are typically not less than an uct, by measuring therapeutic efficacy, etc., may be observed amount required to produce a measurable effect on the Sub 2 months or more after administration of the Subject compo ject, and may be determined based on the pharmacokinetics sition, e.g., 4, 6, 8, or 10 months or more, in some instances 1 and pharmacology for absorption, distribution, metabolism, year or more, for example 2, 3, 4, or 5 years, in certain and excretion (ADME) of the subject composition or its instances, more than 5 years. by-products, and thus based on the disposition of the compo 0231. In certain embodiments, the method comprises the sition within the subject. This includes consideration of the step of detecting expression of the transgene in the cone cells, route of administration as well as dosage amount, which can wherein expression is enhanced relative to expression from a be adjusted for subretinal (applied directly to where action is polynucleotide cassette not comprising the one or more desired for mainly a local effect), intravitreal (applied to the improved elements of the present disclosure, i.e. a reference vitreaous for a pan-retinal effect), or parenteral (applied by control, e.g. the pR2.1 promoter or variants thereof (e.g. systemic routes, e.g. intravenous, intramuscular, etc.) appli pR1.7, pR 1.5, pR1.1, etc.) as disclosed in, e.g., US Applica cations. Effective amounts of dose and/or dose regimen can tion No. 2013/0317091, or the synthetic IRBP/GNAT2 pro readily be determined empirically from preclinical assays, moter as disclosed in US Application No. 2014/0275231; the from safety and escalation and dose range trials, individual full disclosures of which are incorporated herein by refer clinician-patient relationships, as well as in vitro and in vivo ence. Typically, expression will be enhanced 2-fold or more assays Such as those described herein and illustrated in the relative to the expression from a reference, i.e. a control Experimental section, below. polynucleotide cassette, e.g. as known in the art, for example 0236 All of the above U.S. patents, U.S. patent applica 3-fold, 4-fold, or 5-fold or more, in some instances 10-fold, tion publications, U.S. patent applications, foreign patents, 20-fold or 50-fold or more, e.g. 100-fold, as evidenced by, e.g. foreign patent applications and non-patent publications earlier detection, higher levels of gene product, a stronger referred to in this specification and/or listed in the Application functional impact on the cells, etc. Data Sheet, are incorporated herein by reference, in their 0232 Typically, if the subject composition is an ira AV entirety. comprising the Subject a polynucleotide cassette of the 0237 From the foregoing it will be appreciated that, present disclosure, an effective amount to achieve a change in although specific embodiments of the invention have been will be about 1x10 vector genomes or more, in some cases described herein for purposes of illustration, various modifi 1x10, 1x10', 1x10'', 1x10', or 1x10" vector genomes or cations may be made without deviating from the spirit and more, in certain instances, 1x10" vector genomes or more, Scope of the invention. Accordingly, the invention is not lim and usually no more than 1x10" vector genomes. In some ited except as by the appended claims. cases, the amount of vector genomes that is delivered is at most about 1x10" vector genomes, e.g. 1x10" vector EXAMPLES genomes or less, for example 1x10", 1x10", 1x10', 0238. The following examples are put forth so as to pro 1x10', or 1x10 vector genomes or less, in certain instances vide those of ordinary skill in the art with a complete disclo 1x10 vector genomes, and typically no less than 1x10 vec Sure and description of how to make and use the present tor genomes. In some cases, the amount of vector genomes invention, and are not intended to limit the scope of what the that is delivered is 1x10' to 1x10" vector genomes. In some inventors regard as their invention nor are they intended to cases, the amount of vector genomes that is delivered is represent that the experiments below are all or the only 1x10' to 3x10' vector genomes. In some cases, the amount experiments performed. Efforts have been made to ensure of vector genomes that is delivered is 1x10 to 3x10" vector accuracy with respect to numbers used (e.g. amounts, tem genomes. In some cases, the amount of vector genomes that is perature, etc.) but some experimental errors and deviations delivered is 1x10 to 3x10" vector genomes. should be accounted for. Unless indicated otherwise, parts are 0233. In some cases, the amount of pharmaceutical com parts by weight, molecular weight is weight average molecu position to be administered may be measured using multiplic lar weight, temperature is in degrees Centigrade, and pressure ity of infection (MOI). In some cases, MOI may refer to the is at or near atmospheric. ratio, or multiple of vector or viral genomes to the cells to 0239 General methods in molecular and cellular bio which the nucleic may be delivered. In some cases, the MOI chemistry can be found in Such standard textbooks as may be 1x10°. In some cases, the MOI may be 1x10-1x107. Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sam US 2015/0259395 A1 Sep. 17, 2015 24 brooketal. HaRBor Laboratory Press 2001); Short Protocols transduction of cone photoreceptors following intravitreal in Molecular Biology, 4th Ed. (Ausubeletal. eds., John Wiley delivery of AAV or lentivirus has never been demonstrated: & Sons 1999); Protein Methods (Bollaget al., John Wiley & while reports exist of AAVs with the ability to transduce Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et retinal cone cells with high efficiency (Merigan et al. IOVS al. eds., Academic Press 1999); Viral Vectors (Kaplift & 2008.49 E-abstract 4514), later reports have questioned the Loewy eds. Academic Press 1995); Immunology Methods efficacy of these vectors (Yin et al. IOVS 2011, 52(5):2775 Manual (I. Lefkovits ed., Academic Press 1997); and Celland 2783). Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures Results of which are incorporated herein by reference. Reagents, 0243 Directed evolution of AAV2 has led to the identifi cloning vectors, and kits for genetic manipulation referred to cation of the viral variant “7m8” that is able to transduce in this disclosure are available from commercial vendors such photoreceptors better than wildtype AAV2 (Dalkara et al. Sci as BioRad, Stratagene. Invitrogen, Sigma-Aldrich, and Clon Transl Med2013). However, the retina contains two types of Tech. photoreceptors—rods and cones—and no reports exist dem onstrated whether AAV2-7m8 can transduce cone photore Background ceptors, perse, and more particularly, cone photoreceptors in 0240 New therapies are needed for the treatment of many the highly cone-enriched area of the fovea. To test this pos cone photoreceptor associated disorders, including macular sibility, we delivered AAV2-7m8 carrying an expression cas dystrophies such as cone-rod dystrophy, cone dystrophy, sette of the ubiquitous promoter CMV operably linked to GFP Stargardt macular dystrophy, and achromatopsia; color vision to the retina of African Green monkey by intravitreal injec disorders such as protan, deutan, and tritan defects; and vision tion. Intravitreally delivered AAV2-7m8.CMV.GFP appeared disorders of the central macula such as age-related macular to transduce retinal cells in the fovea centralis (the 0.35 mm degeneration, macular telangiectasia, retinitis pigmentosa, diameter rod-free region of retina at the center of the foveal diabetic retinopathy, retinal vein occlusions, glaucoma, Sors pit) and parafovea (the lip of the depression) of primates more by's fundus dystrophy, adult vitelliform macular dystrophy, efficiently than intravitreally-delivered AAV2 or other AAV Best's disease, and X-linked retinoschisis. As these vision Variants previously shown in the art to transduce retinal cells. disorders are associated with a loss of function and/or viabil Neither AAV2-7m8 nor the other AAVs tested tested ity of the cone photoreceptors, it is hypothesized that these appeared to be able to transduce the cones of the primate disorders may be treatable by delivering atherapeutic gene to fovea, the 15 mm-diameter cone-enriched region of retina cone photoreceptors to rescue cone viability and function. that surrounds the foveola and forms the slopes of the pit 0241. To that end, the polynucleotide cassette “pMNTC (FIG. 5). was designed in which enhancer, promoter, 5'UTR, intron, 0244) We next packaged a genome comprising pMNTC Kozak, and polyadenylation sequences were designed for operably linked to GFP within the AAV2-7m8 capsid, and cone-specific expression (FIG.10a). The cassette included an assessed the ability of this vector composition to express the LCR enhancer sequence from the L- and M-opsin genomic GFP transgene in cone cells in vivo when injected intravitre locus and a truncated promoter sequence from the M-Opsin ally. Expression was evaluated in a number of species with gene, comprising about 140 nucleotides upstream of the tran varying numbers of retinal cones cells among total photore scriptional start site. In addition, the cassette included a 5' ceptors, including mouse (3% cones), rat (1% cones), gerbil untranslated region (5' UTR) based on the M-opsin 5'UTR but (13% cones), and nonhuman primate (5% cones). Contrary to modified to have minimal secondary structure (see FIG. 3) our results in FIG. 5, strong gene expression could be detected and to include additional sequence at its 3' end into which an throughout the nonhuman primate fovea (FIG. 6). These data intron was inserted. The intronic sequence used was a pSI indicate that intravitreally delivered AAV2-7m8 can, in fact, chimeric intron having the 5'-donor site from the first intron of transduce retinal cones, and that pMNTC acts as a robust the human f3-globin gene and the branch and 3'-acceptor site expression cassette in cone cells. Robust reporter gene from the intron that lies between the leader and the body of an expression was also seen in the intravireally injected retina of immunoglobulin gene heavy chain variable region (Bothwell, the rat (data not shown) and gerbil (FIG.8A), with expression A. L. etal. (1981) Heavy chain variable region contribution to levels and anatomic location correlating with cone abundance the NPb family of antibodies: Somatic mutation evident in a and location in all species. gamma2a variable region. Cell 24,625-37). The sequences of 0245) To determine the cell-specificity of pMNTC-di the donor and acceptor sites, along with the branchpoint site, rected expression, whole mounts of transduced mouse retina were changed to match the consensus sequences for splicing were analyzed by immunohistochemistry using an antibody (Senapathy, P., Shapiro, M. B. and Harris, N. L. (1990) Meth. that is specific for cone L and Mopsins. The expression of Enzymol. 183,252-78). Also included in the pMNTC poly L/M opsin, which labels the outer segments of cone photore nucleotide cassette was a strong Kozak sequence and an ceptors only, was observed in virtually all of the cones of the SV40 polyadenylation sequence. mouse retina that expressed GFP from the AAV2-7m8. 0242 Experiments were also performed to identify the MNTC.GFP vector (FIG. 7), indicating that MNTC-directed best AAV with which to deliver transgenes to cone cells. expression of transgenes is highly cone-specific. Moreover Successful delivery of polynucleotides to cells of the retina 80% or more of the cone outer segments that were labelled by for the purposes of gene therapy has been achieved using viral the L/M opsin-specific antibody also expressed the GFP vectors such as AAV and lentivirus. However, these viruses transgene, indicating that AAV2-7m8 transduces cones must be injected subretinally to reach the cells of the non highly efficiently (FIG. 7). human primate (NHP) retina, a procedure that carries with it 0246 We next compared the ability of pMNTC to promote the risk of retinal damage. A less disruptive approach is expression in cone cells to that of pR2.1. pR2.1 comprises the administration by intravitreal injection. However, efficient human L/M opsin enhancer (“LCR”) and the promoter region US 2015/0259395 A1 Sep. 17, 2015

from the human L-Opsin gene. In addition, pR2.1 comprises struct. Thus, the L/M opsin LCR, the inclusion of the Mopsin the L-Opsin 5' UTR fused to additional 5'UTR sequence at its core promoter rather than the L opsin promoter, and the 3' end, into which modified SV40 late 16s intronic sequence exclusion of false starts in the 5'UTR all contribute to the has been inserted. This is followed by the L-Opsin Kozak enhancement in gene expression achieved using the pMNTC sequence, which is then typically linked in-frame to a trans promoter. gene. At the end of the cassette is an SV40 polyA tail. (0250. In conclusion, we have identified an AAV variant, 0247 Viral preparations of AAV2-7m8.MNTC.GFP and the AAV variant comprising a 7m.8 peptide in the GH loop, AAV2-7m8.pR2.1.GFP were delivered intravitreally to the which may be used for the intravitreal delivery of polynucle retinas of gerbils and nonhuman primates in Vivo, and the otides to retinal cones. Likewise, we have identified a number retinas imaged in vivo 2 weeks, 4 weeks, 8 weeks, and 12 of polynucleotide cassette elements that may be used to pro weeks later by fundus autofluorescence and OCT. GFP mote strong expression in cone photoreceptors. Together, reporter expression was detected Sooner, more strongly, and these discoveries represent improvements that may facilitate in more cones in gerbil retina transduced with ra AV carrying the development of therapeutic agents for cone-associated the pMNTC.GFP expression cassette than in gerbil retinas disorders. carrying the pR2.1.GFP expression cassette (FIG. 8B). Like wise, GFP reporter expression was detected sooner and in Materials and Methods more cones in nonhuman primate retinas transduced with 0251 Transgene expression in vitro in WERI-RB-1 cells. rAAV carrying the pMNTC.GFP expression cassette as com WERI-Rb-1 retinoblastoma cells expressing cone photore pared to NHP retinas transduced with the pR2.1 expression ceptor pigments cells are transfected with a polynucleotide cassette (FIG.9, n=4 eyes). In bothgerbils and NHP, GFP was cassette of the present disclosure according to the method consistently observed to be stronger from pMNTC than from described by Shaaban and Deeb, 1998: IOVS 39(6)885-896. pR2.1 throughout the duration of the study. The polynucleotide cassettes are transfected as plasmid DNA 0248. To determine the contribution of each of the ele using well established techniques of molecular biology. Such ments in the pMNTC expression cassette to the overall as cloning (Maniatis et al.) or via denovo DNA synthesis. All improvement in expression, a series of expression constructs regulatory elements are placed in the cassette and used to were cloned in which each of the elements in pMNTC was drive the enhanced GFP protein. Plasmid DNA is then intro Substituted one-by-one with the corresponding element from duced into cells using established techniques for non-viral the pR2.1 expression cassette. These constructs were then transfection, for example using a lipid-based transfection packaged into AAV2-7m8 and delivered by intravitreal injec reagent (Altogen Biosystems, NV) or Lipofectamine LTX tion to the gerbil retina. Gerbil retinas were assessed 4 and 8 (Life Technologies). Cells are then cultured for 72 hours and weeks later in vivo by in vivo bioluminescence (IVIS imaging eGFP expression is measured using flow cytometry and fluo system, PerkinElmer), which provides a quantitative readout rescence microscopy. Transgene expression in cells trans of reporter expression across the entire eye. fected with the polynucleotide cassette of the present inven 0249. As expected, expression of the luciferase reporter tion (i.e., constructs designed for cone photoreceptor under the control of pMNTC was higher than expression of expression) is compared to the un-optimized counterparts the luciferase reporter under the control of pR2.1. Replace (i.e., those based on pR2.1) and is found to be stronger from ment of the pMNTC promoter sequence with the pR2.1 pro cassettes carrying improved elements moter sequence having the most sequence homology to it 0252. In vitro expression is also evaluated using other (SEQ ID NO:83) reduced expression (construct pMNTC mammalian cell lines that express cone opsins, such as 661W pR2.1 L3 P), as did the inclusion of pR2.1 promoter cells (Tanet al., IOVS 2004: 45(3) 764-768). sequence that lies more distal to the 5' UTR of pR2.1 (SEQID 0253) Similarly, in vitro expression is evaluated using non NO:82) (construct pMNTCpR2.1-L5'P). Expression was also photoreceptor cell lines that have been engineered to express reduced by the introduction into the pMNTC 5' UTR of two cone photoreceptor-specific proteins. Such a system has been false start sequences (AUG1 and AUG2) that were described with HEK293 cells that have been genetically engi observed in the pR2.1 5'UTR (construct pMNTC 2.1- neered to express CRX/Spl (Khani et al., IOVS 2007:48: AUG1/2). Interestingly, expression was not reduced when the 3954). Marker genes are also used (eGFP, dsRed, mCherry, pMNTC 5'UTR was replaced with a modified pR2.1 5'UTR luciferase) as well as physiologic genes (opsin, ACHR sequence in which these false starts had been removed (SEQ genes). Physiologic genes are tested by examining mRNA ID NO:87, nucleotide 17 changed to C, nt 61 and 62 changed levels (e.g., by RT-PCR) or protein levels (e.g., by ELISA or to CA) (pMNTC pR2.1-5'UTR), suggesting that the pR2.1 Western blot). 5' UTR would promote strong expression in cone cells but for 0254 Animal care. All experiments conformed to the prin the false AUGs in the pR2.1 5' UTR element. Also interest ciples regarding the care and use of animals adopted by the ingly, the pR2.1 intron (SEQID NO:59) appeared to provide American Physiological Society and the Society for Neuro more robust expression than the pSI chimeric intron of Science, and were approved by the Institutional Animal Care pMNTC, suggesting that inclusion of the pR2.1 intron in the and Use Committee (IACUC). polynucleotide cassettes of the present disclosure may be 0255 Small animal studies. The expression of the gene used to further improve expression in cone cells. Lastly, product encoded by the coding sequence of the expression removal of the L/M enhancer (found in both pR2.1 and cassettes are evaluated in vivo in mice, rats, and gerbils. This pMNTC) reduced expression as well. While the polyA tailed is accomplished by intravitreal injection in vivo of an ra AV seemed at first to also have a significant impact on expression, preparation comprising the expression cassette (Li et al., re-sequencing of the pMNTC construct comprising this 2008; Mol Vis 48: 332-338). Note that electroporation of pR2.1 element revealed that the polyA tail was not operably plasmid DNA may be performed instead (Matsuda/Cepko). linked to the transgene, thereby explaining why only back 0256 Mouse studies. Mice used in this study were ground levels of expression were observed from this con C57BL/6. Animals were anesthetized with ketamine/xyla US 2015/0259395 A1 Sep. 17, 2015 26

Zine (110 mg/kg intraperitoneal). A beveled 34 gauge dispos to the limbus under a Surgical magnification to allow full able needle loaded with test article was inserted into the visualization of extraocular and intraocular needle place vitreous of the eye, and 5.04x10" vector genomes ofra AV in ment. Central vitreous placement was confirmed by direct a volume of 1.5ul was injected into the vitreous. observation of the needle tip at the time of the injection. 0257 Gerbil and rat studies. Mongolian gerbils (Meriones Following ITV injections a topical triple antibiotic ointment unguiculatus) and brown Norway rats were used in this study. was administered. Pupils were dilated with 10% phenylephrine and 0.5% tropi 0260 Slit-lamp biomicroscopy. The anterior segment of camide. Animals were anesthetized with an intraperitoneal or each monkey eye was examined by slit-lamp biomicroscopy intramuscular injection of 0.1-0.2 mL of a ketamine/xylazine during baseline screening and at week 4 (day 28), week 8 (day Solution (70 mg/mL, ketamine and 10 mg/mL Xylazine for 56) and week 12 (day 84) post-injection to monitor inflam rats; 25 mg/mL, ketamine and 0.3 mg/mL Xylazine for ger mation. No abnormalities were observed. bils). A beveled 34 gauge disposable needle loaded with test 0261 Fundus examination and photography. Eye exami article in a 100 uL Hamilton syringe was inserted into the nation and fundus photography of rat and gerbil retinas was vitreous of the eye through the Sclera at an optimized Supe performed using a Phoenix Micron IV fundus microscope. rior-temporal point about 1 mm from Limbus. 1x10'-2x10' All animals received a baseline Screening/photographing to vector genomes of test article (2x10" vg of ra AVGFP or confirm ocular health, and then photographed at the desig 1.15x10" vg of ra AV.luciferase) in a 5 uL volume was nated timepoints to monitor the expression of the GFP trans injected slowly with a micro-injection pump into the vitreous, gene. Any change to the optic nerves and retina or appearance after which the needle tip was held in the injected eye at the of gross lesions were recorded by a colorfundus photography injected position for 10 seconds so as to ensure adequate test and expression of GFP was visualized using fluorescence article dispensing. The needle was then withdrawn. fundus imaging with a fluorescein filter. 0258 Non-human primate (NHP) studies. The polynucle 0262 Retinal examination, fundus color and fluorescence otide cassettes and expression vectors are also tested in large photography, and autofluorescence OCT of NHP were per animals. This is done by using AAV, for example using the formed by using a Topcon TRC-50EX retinal camera with techniques of Mancuso et al. Briefly, an AAV cassette is Canon 6D digital imaging hardware and New Vision Fundus made, the AAV encapsidating the expression cassette is Image Analysis System software and Spectralis OCT Plus. manufactured, and the viral prep is injected intravitreally (up All animals received a baseline imaging. GFP expression was to 170 u, in the vitreous) or subretinally (up to 3, 100 ul also documented at week 2, 4, 8, and 12 post-intravitreal injections at different locations; vitrectomy may be per Vector injection. formed prior to injection) in nonhuman primates. Expression 0263 IVIS Imaging System. Expression of luciferase in is evaluated by reporter (GFP), color ERG, and/or behavioral the retina following delivery of ra AV.luciferase was quanti testing using the Cambridge Color Test or on animals trained fied in vivo 2, 4 and 8 weeks post-intravitreal injection using to make a saccade (eye movement) when a target enters the an IVIS Imaging System. Gerbils were injected subcutane field of view. The Saccades are monitored using an eye ously with 150 mg/kg luciferin (PerkinElmer) (15 mg/ml tracker. Prior to treatment animals are trained to perform a luciferin at a dose of 15 ml/kg). Approximately 22 minutes color vision test or to make a saccade when it sees a colored later, animals were sedated by inhalation of 4% isoflurane for target. An ERG is performed to estimate the spectral sensi 3-5 minutes. Immediately thereafter, animals were placed on tivity of the cones present. Data from the color vision test the imaging platform in pairs, and the luminescence of the performance and the ERG provide evidence that the animal is one eye of each animal quantified followed immediately by dichromatic (colorblind). For animals that receive a vector imaging of the contralateral eye. A naive gerbil was used as a carrying the GFP gene, expression is monitored using fundus negative standard, with background levels of luminescence imaging with RetCam II or similar device under light that typically registering a luminescence of 1x10" photons/sec produces excitation of the GFP. For animals receiving a pho ond. Bioluminescence verification using a phantom mouse topigment gene that differs in spectral sensitivity compared to (XPM-2 PerkinElmer phantom mouse for bioluminescence the animal's endogenous pigments, expression is monitored imaging) was performed prior to imaging to ensure calibra using the multifocal color ERG to measure spectral sensitiv tion of the imaging system. ity at up to 106 different retinal locations, and by behavioral 0264. Immunohistochemistry. Mice were euthanized with testing. a lethal dose of sodium pentobarbital and tissues fixed via 0259 Baboons were sedated with 10-15 mg/kg ketamine cardiac perfusion first with 0.13M phosphate buffered saline following by sevofluorane. African Green monkeys were (PBS) pH 7.2-7.4 containing 2 units of heparin per mL, fol sedated with an intramuscular injection of 5:1 ketamine:Xy lowed by 4% paraformaldehyde (PFA) in PBS, followed by lazine mix (0.2 ml/kg of 100 mg/ml ketamine and 20 mg/ml 4% paraformaldehyde plus 1% glutaraldehyde in PBS. Glu xylazine). Mydriasis was achieved with topical 10% phenyle taraldehyde served to keep the neural retina attached to the phrine. An eye speculum was placed in the eye to facilitate RPE so that the cone outer segments would remain intact. injections. A drop of proparacaine hydrochloride 0.5% and Each solution was warmed to ~37° C. just prior to adminis then 5% betadine solution was applied, followed by a rinse tration and ~35-40mL of perfusate was delivered at each with sterile saline. Baboons (FIG. 6) received 60 ul of a stage. Once the perfusion was stopped, the mouse was 3.4x10" vg preparation of ra AV by intravitreal (ITV) injec wrapped in a moist paper towel and left to further fix for 2-3 tion to yield a final dose of 2.02x10" vg per eye. African hours before enucleation and dissection. Green monkeys received 50 uL of a 1x10" preparation of 0265 Permanent ink was used to mark the orientation of rAAV vector by ITV injection to yield a final dose of 5x10' the eye, the anterior segment was removed, and the eye-cup vg per eye. ITV injections to the central vitreous were admin was fixed in 4% PFA overnight at 4°C. and then stored in PBS istered using a 31-gauge 0.375 inch needle (Terumo) inserted at 4°C. Retinal whole-mounts were made by flattening the inferotemporally at the level of the ora serrata ~25 mm poster dissected retina between tissues soaked in 4% PFA for two US 2015/0259395 A1 Sep. 17, 2015 27 hours and then transferring them to a culture plate for 6 more 0269 Experiments testing the tissue specificity of the hours of fixation. Afterward, the PFA was replaced with PBS polynucleotide cassettes. In this instance, a construct encod containing 0.03% sodium azide (Sigma). ing GFP is injected via one or more routes of administration, 0266 Antibody labeling was carried out on a rotating table Such as intravitreal, Subretinal, or intravenously. The animal is then sacrificed and tissues are analyzed by qPCR to shaker. To block non-specific labeling, whole mounts were detect DNA sequences indicating presence of the construct— incubated overnight at 4°C. with a solution containing 5% and GFP expression to detect areas where the construct is donkey serum (Jackson ImmunoResearch, Cat #004-000 actively expressed. Whereas absence of DNA sequence indi 120), 1 mg/ml BSA (Jackson ImmunoResearch, Cat #001 cates lack of biodistribution to a given tissue, the presence of 000-161), and 0.03% Triton X-100 in PBS (pH 7.4). The DNA sequence together with the lack of transgene expression primary antibody used in this study was rabbit anti red-green (mRNA or protein level) indicates presence of vector but lack (L/M) opsin diluted 1:200 (Millipore, Cat #AB5405. Speci of expression in that tissue. In this way, the level of specificity mens were washed in PBS 3 times for 30 minutes each, then for cone photoreceptors can be established, and used to deter incubated at 4° C. overnight with DAPI (4,6-diamidino-2- mine the utility of this invention interms of restricting expres phenylindole, dihydrochloride 1:10,000: Invitrogen, Cat sion to target cone photoreceptor cells without expression in #D-21490) plus secondary antibodies. The secondary anti non-targeted tissues such as optic nerve, liver, spleen, or brain body for the L/M-opsin antibody was Alexa Fluor 488 labeled tissue. Intravitreal AAV is known to biodistribute to the brain donkey anti-rabbit IgG(H+L) diluted 1:200 in antibody dilu (Provost et al) so highly expressed, improved constructs for tion buffer (Invitrogen, Cat if A21206). The incubation with targeting cone photoreceptors would be useful to limit secondary antibody was followed by three 30 minute PBS expression to target cells of the retina and limit potential washes, 30 minutes of post-fixation with 4% paraformalde adverse events associated with off-target transgene expres hyde, and three more 30 minute PBS washes. Finally, the Sion. retinal slices were placed on slides with 2% DABCO in glyc 0270. The preceding merely illustrates the principles of erol and covered with cover slips. the invention. It will be appreciated that those skilled in the art 0267 Microscopy. Widefield images of mouse retina will be able to devise various arrangements which, although whole mounts were acquired using a Nikon Eclipse E1000 not explicitly described or shown herein, embody the prin with a 20x (open-air) objective and camera set with a 1.5x ciples of the invention and are included within its spirit and optical Zoom. For each specimen, 50 optical sections were Scope. Furthermore, all examples and conditional language taken 0.5 um apart and the M-opsin Z-Stack was recon recited herein are principally intended to aid the reader in structed in Image.J. The Z-stack was oriented so that the understanding the principles of the invention and the concepts lengths of the outer segments were in plane, and the distance contributed by the inventors to furthering the art, and are to be between where antibody staining began and ended was mea construed as being without limitation to such specifically Sured as an estimate of the length of the outer segments. recited examples and conditions. Moreover, all statements Further, a 3D projection of the Z-stack was generated and the herein reciting principles, aspects, and embodiments of the number of cones with visible M-opsin in the outer segment invention as well as specific examples thereof, are intended to could be quantified. encompass both structural and functional equivalents thereof. 0268 Confocal image slices were acquired using an Additionally, it is intended that such equivalents include both Olympus FluoViewTM FV1000. Sections were imaged using currently known equivalents and equivalents developed in the a 20x oil immersion lens (40 images taken 0.5um apart) and future, i.e., any elements developed that perform the same the Z-Stacks were reconstructed in Image.J. Channel exposure function, regardless of structure. The scope of the present levels were balanced within and across images using Adobe invention, therefore, is not intended to be limited to the exem Photoshop. For the retinal whole mounts, images were taken plary embodiments shown and described herein. Rather, the using a 10x open-air lens and mosaics were constructed with scope and spirit of the present invention is embodied by the Adobe Photoshop's native mosaic construction software. appended claims.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 103

<21 Os SEQ ID NO 1 &211s LENGTH: 494 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs SEQUENCE: 1 ggat.ccggitt CC aggcctic gcc.ctaaat a gt ct coctgg gCtttcaaga galacca catg 60

agaaaggagg attcgggct C tagcagttt caccacccac cc cc cagtct gcaaatcCt9 12O accc.gtgggit coacctg.ccc calaaggcgga cqcaggacag tagaagggala cagaga acac 18O

ataaacacag agagggccac agcggct coc acagt caccg cc acct tcct gg.cggggatg 24 O ggtgggg.cgt. Ctgagtttgg tt CCC agcaa at CCCtctga gcc.gcc ctitg cgggct coc 3 OO

tdaggagcag gggagcaaga ggtgggagga ggaggtotaa gtcc caggcc caattalagag 360

US 2015/0259395 A1 Sep. 17, 2015 30

- Continued cgct acaaaa agttgcggca gcc cct caac tacattctgg toaacgtgtc. Cttctgaggc 24 O titcc to ct cit gcatcttct c tdtct tcc ct gtc.tt cqtcg ccagotgtaa cqgatacttic 3OO gtct tcggtc gcc atgtttgttgctttggag ggct tcc tdg gCactgtagc aggtotggitt 360 acaggatggit cactggcct t c ct ggcctitt gag cqctaca ttgtcatctg. taag.cccttic 42O ggcaacttico gottcagotc Caagcatgca Ctgacggtgg to Ctggctac Ctggaccatt 48O gg tattggcg tct coat CCC accct tctitt ggctggagcc ggttcatCcc tagggcctg 54 O Cagtgttcct gtggcc ctga Ctggtacacc gtgggcacca aat accgcag cagt cctat 6OO acgtggttcc tictt catctt ctoctitcatt gtgcct citct c cct catctg. cittct cotac 660 acticagotgc tigagggcc ct gaaagctgtt gcagcticago agcaggagtic agctacgacc 72 O Cagaaggctgaacgggaggit gagcc.gcatg gtggttgttga tigg taggat C Cttctgtgtc. 78O tgctacgtgc cct acgcggc ctitcgc.catg tacatggtca acaac cqtaa C catgggctg 84 O gacttacggc titgtcaccat tcc tt cattc ttct c caaga gtgcttgcat citacaatcc c 9 OO atcatctact gct tcatgaa taa.gcagttc Caagcttgca toatgaagat ggtgtgtggg 96.O aaggcc atga Cagatgaatc. cacacatgc agctic ccaga aaacagaagt ttctactgtc. 1 O2O tcqtct accc aagttggc cc caact gagga cccaatattg gcc tdtttgc aac agctaga 108 O attalaattitt acttittaaaa aaaaaaaaaa aaaa. 1114

<210s, SEQ ID NO 7 &211s LENGTH: 348 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OO > SEQUENCE: 7 Met Arg Llys Met Ser Glu Glu Glu Phe Tyr Lieu Phe Lys Asn Ile Ser 1. 5 1O 15 Ser Val Gly Pro Trp Asp Gly Pro Glin Tyr His Ile Ala Pro Val Trp 2O 25 3O Ala Phe Tyr Lieu. Glin Ala Ala Phe Met Gly Thr Val Phe Lieu. Ile Gly 35 4 O 45 Phe Pro Lieu. Asn Ala Met Val Lieu Val Ala Thr Lieu. Arg Tyr Lys Llys SO 55 6 O Lieu. Arg Glin Pro Lieu. Asn Tyr Ile Lieu Val Asn Val Ser Phe Gly Gly 65 70 7s 8O Phe Leu Lieu. Cys Ile Phe Ser Val Phe Pro Val Phe Val Ala Ser Cys 85 90 95 Asn Gly Tyr Phe Val Phe Gly Arg His Val Cys Ala Lieu. Glu Gly Phe 1OO 105 11 O

Lieu. Gly Thr Val Ala Gly Lieu Val Thr Gly Trp Ser Lieu Ala Phe Lieu. 115 12 O 125

Ala Phe Glu Arg Tyr Ile Val Ile Cys Llys Pro Phe Gly Asn Phe Arg 13 O 135 14 O

Phe Ser Ser Lys His Ala Lieu. Thr Val Val Lieu Ala Thr Trp Thir Ile 145 150 155 160

Gly Ile Gly Val Ser Ile Pro Pro Phe Phe Gly Trp Ser Arg Phe Ile 1.65 17O 17s

Pro Glu Gly Lieu Gln Cys Ser Cys Gly Pro Asp Trp Tyr Thr Val Gly 18O 185 19 O

US 2015/0259395 A1 Sep. 17, 2015 32

- Continued ggaggit ct catctgttgtc.ct cq9tatcgcc ticatgagglt Ctgcctic ct a cc catcc.cgc 2OO ccaccgggg.c tittggccacc tict cottt co coct cottct c catc cctdt aaaataaatg 26 O taattitat ct ttgccaaaac caacaaagtic acagaggctt toactgcagt gtgggaccac 32O Ctgagcct ct gcgtgtgcag gcactgggtc. tcgagagggit gcaaggggga taalagaggag 38O agagcgct tc at agactitta agtttitcc.cg agc ct catgt Ctaccgatgg C9tgaaagga 44 O t cctggcaaa acagaagtgt gaggcaggtgggcgt.ctata t cc attt cac Caggctggtg SOO gttacataat cqgcaa.gcaa gagctgtgga ggggcttgct ggatgcc ct c agc acccagg 560 aggagggagg gagctagdaa gCtaaggcag gtggc cct co toccCtta agg to Catct 62O gctggaggcc cagagt cctt ggagtacagt ctacacctgg aggggaccca ttcctgc.ca.g 68O tctgtggcag ggatggcgcg ccaccitctgc Caggc.cagga CCC caa.gc.cc gat cagcatc 74 O agcatggtgc aggtgcacag gcgtgagctg at Cagtgacg aggggcaggc acaca aggtg 8OO gaga caaaga C caagaggac ggttgc.ca.gt gagaggcgcg gacticaggala Cttgaacaac 86 O atctgcgggg gacggctttg gaggtgct Co gctgcct coa gttgggtgac ttgctgtagc 92 O atct coagct tdatatt.cg gct ctitgaag gtc.t.ccgtga t ct cotgcag gagacgaaaa 98 O tgcacgcacc agaagttca 998

<210s, SEQ ID NO 9 & 211 LENGTH: 364 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 9 Met Ala Glin Glin Trp Ser Lieu. Glin Arg Lieu Ala Gly Arg His Pro Glin 1. 5 1O 15 Asp Ser Tyr Glu Asp Ser Thr Glin Ser Ser Ile Phe Thr Tyr Thr Asn 2O 25 3O Ser Asn Ser Thr Arg Gly Pro Phe Glu Gly Pro Asn Tyr His Ile Ala 35 4 O 45 Pro Arg Trp Val Tyr His Lieu. Thir Ser Val Trp Met Ile Phe Val Val SO 55 6 O Ile Ala Ser Val Phe Thr Asn Gly Lieu Val Lieu Ala Ala Thr Met Lys 65 70 7s 8O Phe Llys Llys Lieu. Arg His Pro Lieu. Asn Trp Ile Lieu Val Asn Lieu Ala 85 90 95 Val Ala Asp Lieu Ala Glu Thr Val Ile Ala Ser Thir Ile Ser Val Val 1OO 105 11 O Asn Glin Val Tyr Gly Tyr Phe Val Lieu. Gly His Pro Met Cys Val Lieu. 115 12 O 125

Glu Gly Tyr Thr Val Ser Lieu. Cys Gly Ile Thr Gly Lieu. Trp Ser Lieu. 13 O 135 14 O

Ala Ile Ile Ser Trp Glu Arg Trp Met Val Val Cys Llys Pro Phe Gly 145 150 155 160

Asn Val Arg Phe Asp Ala Lys Lieu Ala Ile Val Gly Ile Ala Phe Ser 1.65 17O 17s

Trp Ile Trp Ala Ala Val Trp Thr Ala Pro Pro Ile Phe Gly Trp Ser 18O 185 19 O Arg Tyr Trp Pro His Gly Lieu Lys Thr Ser Cys Gly Pro Asp Val Phe

US 2015/0259395 A1 Sep. 17, 2015 34

- Continued gcct coaaaa C9gaggtotic atctgtgtcc ticggitat cqc Ctgcatgagg totgcct cot 114 O acccatc.ccg cccaccgggg ctittggccac ct citc ctitt.c ccc ct cottic ticcatcc ctd 12 OO taaaataaat gtaattitatic tittgccaaaa ccaa 1234

<210s, SEQ ID NO 11 &211s LENGTH: 364 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 11 Met Ala Glin Glin Trp Ser Lieu. Glin Arg Lieu Ala Gly Arg His Pro Glin 1. 5 1O 15 Asp Ser Tyr Glu Asp Ser Thr Glin Ser Ser Ile Phe Thr Tyr Thr Asn 2O 25 3O Ser Asn Ser Thr Arg Gly Pro Phe Glu Gly Pro Asn Tyr His Ile Ala 35 4 O 45 Pro Arg Trp Val Tyr His Lieu. Thir Ser Val Trp Met Ile Phe Val Val SO 55 6 O Thr Ala Ser Val Phe Thr Asn Gly Lieu Val Lieu Ala Ala Thr Met Lys 65 70 7s 8O Phe Llys Llys Lieu. Arg His Pro Lieu. Asn Trp Ile Lieu Val Asn Lieu Ala 85 90 95 Val Ala Asp Lieu Ala Glu Thr Val Ile Ala Ser Thir Ile Ser Ile Val 1OO 105 11 O Asn Glin Val Ser Gly Tyr Phe Val Lieu. Gly His Pro Met Cys Val Lieu. 115 12 O 125 Glu Gly Tyr Thr Val Ser Lieu. Cys Gly Ile Thr Gly Lieu. Trp Ser Lieu. 13 O 135 14 O Ala Ile Ile Ser Trp Glu Arg Trp Lieu Val Val Cys Llys Pro Phe Gly 145 150 155 160 Asn Val Arg Phe Asp Ala Lys Lieu Ala Ile Val Gly Ile Ala Phe Ser 1.65 17O 17s Trp Ile Trp Ser Ala Val Trp Thr Ala Pro Pro Ile Phe Gly Trp Ser 18O 185 19 O Arg Tyr Trp Pro His Gly Lieu Lys Thr Ser Cys Gly Pro Asp Val Phe 195 2OO 2O5 Ser Gly Ser Ser Tyr Pro Gly Val Glin Ser Tyr Met Ile Val Lieu Met 21 O 215 22O Val Thr Cys Cys Ile Ile Pro Leu Ala Ile Ile Met Lieu. Cys Tyr Lieu. 225 23 O 235 24 O Glin Val Trp Lieu Ala Ile Arg Ala Val Ala Lys Glin Gln Lys Glu Ser 245 250 255

Glu Ser Thr Gln Lys Ala Glu Lys Glu Val Thr Arg Met Val Val Val 26 O 265 27 O

Met Ile Phe Ala Tyr Cys Val Cys Trp Gly Pro Tyr Thr Phe Phe Ala 27s 28O 285

Cys Phe Ala Ala Ala Asn Pro Gly Tyr Ala Phe His Pro Leu Met Ala 29 O 295 3 OO

Ala Leu Pro Ala Tyr Phe Ala Lys Ser Ala Thir Ile Tyr Asn Pro Val 3. OS 310 315 32O

Ile Tyr Val Phe Met Asn Arg Glin Phe Arg Asn. Cys Ile Lieu. Glin Lieu. 3.25 330 335

US 2015/0259395 A1 Sep. 17, 2015 38

- Continued gcc.gcatgct gtggaacgt.c atcgtgagca toatcagaga agggagggct gtggit cotca 648 O catc.ccacag catggaagaa ttgaggcac ttgt acccg gctggcc at C atggtaaagg 654 O gcgc.ctitt.cg atgitatgggc accattcago atctgaagtic caaatttgga gatggctata 66OO tcgt cacaat galagat caaa t ccc.cgaagg acgacctgct tcc tacct g aaccctgtgg 666 O agcagttctt C caggggaac titcc.caggca gtgtgcagag ggagaggcac tacaiacatgc 672 O tccagttcca ggit citcct co to citc cct gg cdaggat citt ccagotcctic citctic ccaca 678 O. aggacagcct gct catcgag gag tacticag ticacacagaC cacactggac Caggtgtttg 6840 taaattittgc taalacagoag actgaaagtic atgacct coc totgcaccct cqagctgctg 69 OO gagg cagtic acaagcc.cag gactgat Ctt to acaccgct cqttic ctgca gcc agaaagg 696 O aact ctgggc agctggaggc gcaggagcct gtgcc catat ggt catccala atggactggc 7 O2O

Cagcgtaaat gaccc.cactg cagcagaaaa caaac acacg aggagcatgc agc gaattica 708 O gaaagaggltd ttt Cagaagg aaaccgaaac tacttgctic acctggalaca Cctgatggtg 714. O aaac caaaca aatacaaaat cottct coag accc.ca.gaac tagaaac ccc gggc.catcc c f2OO actago agct ttggcc tic ca tattgct citc atttcaa.gca gatctgctitt totgcatgtt 726 O tgtctgttgttgtctg.cgttgt gtgtgattitt catggaaaaa taaaatgcaa atgcact cat 732O

Cacaaa. 7326

<210s, SEQ ID NO 13 &211s LENGTH: 2273 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 13 Met Gly Phe Val Arg Glin Ile Glin Lieu. Lieu. Lieu. Trp Lys Asn Trp Thr 1. 5 1O 15 Lieu. Arg Lys Arg Glin Lys Ile Arg Phe Val Val Glu Lieu Val Trp Pro 2O 25 3O Lieu. Ser Lieu. Phe Lieu Val Lieu. Ile Trp Lieu. Arg Asn Ala Asn Pro Lieu. 35 4 O 45 Tyr Ser His His Glu. Cys His Phe Pro Asn Lys Ala Met Pro Ser Ala SO 55 6 O Gly Met Leu Pro Trp Leu Gln Gly Ile Phe Cys Asn Val Asn Asn Pro 65 70 7s 8O Cys Phe Glin Ser Pro Thr Pro Gly Glu Ser Pro Gly Ile Val Ser Asn 85 90 95 Tyr Asn. Asn. Ser Ile Lieu Ala Arg Val Tyr Arg Asp Phe Glin Glu Lieu. 1OO 105 11 O Lieu Met Asn Ala Pro Glu Ser Glin His Lieu. Gly Arg Ile Trp Thr Glu 115 12 O 125

Lieu. His Ile Leu Ser Glin Phe Met Asp Thr Lieu. Arg Thr His Pro Glu 13 O 135 14 O

Arg Ile Ala Gly Arg Gly Ile Arg Ile Arg Asp Ile Lieu Lys Asp Glu 145 150 155 160

Glu Thir Lieu. Thir Lieu. Phe Lieu. Ile Lys Asn. Ile Gly Lieu. Ser Asp Ser 1.65 17O 17s

Val Val Tyr Lieu. Lieu. Ile Asn. Ser Glin Val Arg Pro Glu Glin Phe Ala 18O 185 19 O US 2015/0259395 A1 Sep. 17, 2015 39

- Continued

His Gly Val Pro Asp Lieu Ala Lieu Lys Asp Ile Ala Cys Ser Glu Ala 195 2OO 2O5 Lieu. Lieu. Glu Arg Phe Ile Ile Phe Ser Glin Arg Arg Gly Ala Lys Thr 21 O 215 22O Val Arg Tyr Ala Lieu. Cys Ser Lieu. Ser Glin Gly Thr Lieu. Glin Trp Ile 225 23 O 235 24 O Glu Asp Thir Lieu. Tyr Ala Asn Val Asp Phe Phe Llys Lieu. Phe Arg Val 245 250 255 Lieu Pro Thir Lieu. Lieu. Asp Ser Arg Ser Glin Gly Ile Asn Lieu. Arg Ser 26 O 265 27 O Trp Gly Gly Ile Leu Ser Asp Met Ser Pro Arg Ile Glin Glu Phe Ile 27s 28O 285 His Arg Pro Ser Met Glin Asp Leu Lleu Trp Val Thr Arg Pro Leu Met 29 O 295 3 OO Gln Asn Gly Gly Pro Glu Thir Phe Thr Lys Lieu Met Gly Ile Leu Ser 3. OS 310 315 32O Asp Lieu. Lieu. Cys Gly Tyr Pro Glu Gly Gly Gly Ser Arg Val Lieu. Ser 3.25 330 335 Phe Asn Trp Tyr Glu Asp Asn. Asn Tyr Lys Ala Phe Lieu. Gly Ile Asp 34 O 345 35. O Ser Thr Arg Lys Asp Pro Ile Tyr Ser Tyr Asp Arg Arg Thr Thr Ser 355 360 365 Phe Cys Asn Ala Lieu. Ile Glin Ser Lieu. Glu Ser Asn Pro Lieu. Thir Lys 37 O 375 38O Ile Ala Trp Arg Ala Ala Llys Pro Lieu. Lieu Met Gly Lys Ile Lieu. Tyr 385 390 395 4 OO Thr Pro Asp Ser Pro Ala Ala Arg Arg Ile Lieu Lys Asn Ala Asn. Ser 4 OS 41O 415 Thir Phe Glu Glu Lieu. Glu. His Val Arg Llys Lieu Val Lys Ala Trp Glu 42O 425 43 O Glu Val Gly Pro Glin Ile Trp Tyr Phe Phe Asp Asn Ser Thr Glin Met 435 44 O 445 Asn Met Ile Arg Asp Thr Lieu. Gly Asn Pro Thr Val Lys Asp Phe Lieu 450 45.5 460 Asn Arg Glin Lieu. Gly Glu Glu Gly Ile Thr Ala Glu Ala Ile Lieu. Asn 465 470 47s 48O Phe Lieu. Tyr Lys Gly Pro Arg Glu Ser Glin Ala Asp Asp Met Ala Asn 485 490 495 Phe Asp Trp Arg Asp Ile Phe Asn. Ile Thr Asp Arg Thr Lieu. Arg Lieu. SOO 505 51O Val Asn Glin Tyr Lieu. Glu. Cys Lieu Val Lieu. Asp Llys Phe Glu Ser Tyr 515 52O 525

Asn Asp Glu Thr Glin Lieu. Thr Glin Arg Ala Lieu. Ser Lieu. Lieu. Glu Glu 53 O 535 54 O

Asn Met Phe Trp Ala Gly Val Val Phe Pro Asp Met Tyr Pro Trp Thr 5.45 550 555 560 Ser Ser Lieu Pro Pro His Val Lys Tyr Lys Ile Arg Met Asp Ile Asp 565 st O sts Val Val Glu Lys Thr Asn Lys Ile Lys Asp Arg Tyr Trp Asp Ser Gly 58O 585 59 O US 2015/0259395 A1 Sep. 17, 2015 40

- Continued Pro Arg Ala Asp Pro Val Glu Asp Phe Arg Tyr Ile Trp Gly Gly Phe 595 6OO 605 Ala Tyr Lieu. Glin Asp Met Val Glu Glin Gly Ile Thr Arg Ser Glin Val 610 615 62O Glin Ala Glu Ala Pro Val Gly Ile Tyr Lieu. Glin Gln Met Pro Tyr Pro 625 630 635 64 O Cys Phe Val Asp Asp Ser Phe Met Ile Ile Lieu. Asn Arg Cys Phe Pro 645 650 655 Ile Phe Met Val Lieu Ala Trp Ile Tyr Ser Val Ser Met Thr Val Lys 660 665 67 O Ser Ile Val Lieu. Glu Lys Glu Lieu. Arg Lieu Lys Glu Thir Lieu Lys Asn 675 68O 685 Gln Gly Val Ser Asn Ala Val Ile Trp Cys Thir Trp Phe Lieu. Asp Ser 69 O. 695 7 OO

Phe Ser Ile Met Ser Met Ser Ile Phe Lieu Lleu. Thir Ile Phe Ile Met 7 Os 71O 71s 72O His Gly Arg Ile Lieu. His Tyr Ser Asp Pro Phe Ile Leu Phe Leu Phe 72 73 O 73 Lieu. Leu Ala Phe Ser Thr Ala Thr Ile Met Lieu. Cys Phe Leu Lleu Ser 740 74. 7 O Thir Phe Phe Ser Lys Ala Ser Lieu Ala Ala Ala Cys Ser Gly Val Ile 7ss 760 765 Tyr Phe Thr Lieu. Tyr Lieu Pro His Ile Lieu. Cys Phe Ala Trp Gln Asp 770 775 78O Arg Met Thir Ala Glu Lieu Lys Lys Ala Val Ser Lieu Lleu Ser Pro Val 78s 79 O 79. 8OO Ala Phe Gly Phe Gly Thr Glu Tyr Lieu Val Arg Phe Glu Glu Glin Gly 805 810 815 Lieu. Gly Lieu Gln Trp Ser Asn. Ile Gly Asn. Ser Pro Thr Glu Gly Asp 82O 825 83 O Glu Phe Ser Phe Lieu Lleu Ser Met Gln Met Met Lieu. Lieu. Asp Ala Ala 835 84 O 845 Val Tyr Gly Lieu. Lieu Ala Trp Tyr Lieu. Asp Glin Val Phe Pro Gly Asp 850 855 860 Tyr Gly Thr Pro Leu Pro Trp Tyr Phe Lieu. Leu Gln Glu Ser Tyr Trp 865 87O 87s 88O Lieu. Gly Gly Glu Gly Cys Ser Thr Arg Glu Glu Arg Ala Lieu. Glu Lys 885 890 895 Thr Glu Pro Leu. Thr Glu Glu Thr Glu Asp Pro Glu. His Pro Glu Gly 9 OO 905 91 O Ile His Asp Ser Phe Phe Glu Arg Glu. His Pro Gly Trp Val Pro Gly 915 92 O 925

Val Cys Wall Lys Asn Lieu Val Lys Ile Phe Glu Pro Cys Gly Arg Pro 93 O 935 94 O

Ala Val Asp Arg Lieu. Asn. Ile Thr Phe Tyr Glu Asn Glin Ile Thir Ala 945 950 955 96.O

Phe Leu Gly His Asn Gly Ala Gly Llys Thr Thr Thr Lieu Ser Ile Leu 965 97O 97.

Thr Gly Lieu. Leu Pro Pro Thr Ser Gly Thr Val Lieu Val Gly Gly Arg 98O 985 99 O

Asp Ile Glu Thir Ser Lieu. Asp Ala Val Arg Glin Ser Lieu. Gly Met Cys US 2015/0259395 A1 Sep. 17, 2015 41

- Continued

995 1OOO 1005

Pro Glin His ASn Ile Lieu. Phe His His Lieu. Thir Wall Ala Glu. His O1O O15 O2O Met Lieu. Phe Tyr Ala Glin Lieu Lys Gly Lys Ser Glin Glu Glu Ala O25 O3 O O35 Glin Lieu. Glu Met Glu Ala Met Lieu. Glu Asp Thr Gly Lieu. His His O4 O O45 OSO Lys Arg Asn. Glu Glu Ala Glin Asp Lieu. Ser Gly Gly Met Glin Arg O55 O6 O O65 Llys Lieu. Ser Val Ala Ile Ala Phe Val Gly Asp Ala Lys Val Val Of O O7 O8O Ile Lieu. Asp Glu Pro Thir Ser Gly Val Asp Pro Tyr Ser Arg Arg O85 O9 O O95 Ser e Trp Asp Lieu. Lieu. Lieu Lys Tyr Arg Ser Gly Arg Thir Ile OO O5 10 Ile Met Ser Thr His His Met Asp Glu Ala Asp Lieu. Lieu. Gly Asp

Arg e Ala Ile Ile Ala Glin Gly Arg Lieu. Tyr Cys Ser Gly Thr

Pro Leu Phe Leu Lys Asn Cys Phe Gly Thr Gly Lieu. Tyr Lieu. Thr

Lieu Val Arg Llys Met Lys Asn. Ile Glin Ser Glin Arg Lys Gly Ser

Glu Gly Thr Cys Ser Cys Ser Ser Lys Gly Phe Ser Thr Thr Cys

Pro Ala His Val Asp Asp Lieu. Thr Pro Glu Glin Val Lieu. Asp Gly 90 95 2OO Asp Wall Asn. Glu Lieu Met Asp Val Val Lieu. His His Val Pro Glu 2O5 21 O 215 Ala Lys Lieu Val Glu. Cys Ile Gly Glin Glu Lieu. Ile Phe Lieu. Lieu.

Pro Asn Lys Asn. Phe Llys His Arg Ala Tyr Ala Ser Lieu. Phe Arg 235 24 O 245 Glu Lieu. Glu Glu Thir Lieu Ala Asp Lieu. Gly Lieu. Ser Ser Phe Gly 250 255 26 O Ile Ser Asp Thr Pro Leu Glu Glu Ile Phe Leu Lys Val Thr Glu 265 27 O 27s Asp Ser Asp Ser Gly Pro Lieu. Phe Ala Gly Gly Ala Glin Glin Lys 28O 285 29 O Arg Glu Asn Val Asn. Pro Arg His Pro Cys Lieu. Gly Pro Arg Glu 295 3OO 305

Lys Ala Gly Glin Thr Pro Glin Asp Ser Asn Val Cys Ser Pro Gly 310 315 32O

Ala Pro Ala Ala His Pro Glu Gly Glin Pro Pro Pro Glu Pro Glu 3.25 33 O 335

Cys Pro Gly Pro Glin Lieu. Asn Thr Gly Thr Gln Leu Val Lieu Gln 34 O 345 350

His Val Glin Ala Lieu. Lieu Val Lys Arg Phe Gln His Thir Ile Arg 355 360 365

Ser His Lys Asp Phe Lieu Ala Glin Ile Val Lieu Pro Ala Thr Phe 37O 375 38O US 2015/0259395 A1 Sep. 17, 2015 42

- Continued

Val Phe Leu Ala Leu Met Leu Ser Ile Val Ile Pro Pro Phe Gly 385 390 395 Glu Tyr Pro Ala Lieu. Thir Lieu. His Pro Trp Ile Tyr Gly Glin Gln 4 OO 405 41 O Tyr Thr Phe Phe Ser Met Asp Glu Pro Gly Ser Glu Glin Phe Thr 415 42O 425 Val Lieu Ala Asp Val Lieu. Lieu. Asn Llys Pro Gly Phe Gly Asn Arg 43 O 435 44 O Cys Lieu Lys Glu Gly Trp Leu Pro Glu Tyr Pro Cys Gly Asn Ser 445 450 45.5 Thr Pro Trp Llys Thr Pro Ser Val Ser Pro Asn Ile Thr Gln Leu 460 465 47 O Phe Gln Lys Gln Lys Trp Thr Glin Val Asn Pro Ser Pro Ser Cys 47s 48O 485 Arg Cys Ser Thr Arg Glu Lys Lieu. Thr Met Leu Pro Glu. Cys Pro 490 495 SOO Glu Gly Ala Gly Gly Leu Pro Pro Pro Glin Arg Thr Glin Arg Ser 5 OS 510 515 Thr Glu Ile Lieu. Glin Asp Lieu. Thir Asp Arg Asn. Ile Ser Asp Phe 52O 525 53 O Lieu Val Llys Thr Tyr Pro Ala Lieu. Ile Arg Ser Ser Lieu Lys Ser 535 54 O 545 Llys Phe Trp Val Asn Glu Glin Arg Tyr Gly Gly Ile Ser Ile Gly 550 555 560 Gly Lys Lieu Pro Val Val Pro Ile Thr Gly Glu Ala Lieu Val Gly 565 st O sts Phe Lieu. Ser Asp Lieu. Gly Arg Ile Met Asn Val Ser Gly Gly Pro 58O 585 590 Ile Thr Arg Glu Ala Ser Lys Glu Ile Pro Asp Phe Lieu Lys His 595 6OO 605 Lieu. Glu Thr Glu Asp Asn. Ile Llys Val Trp Phe Asn. Asn Lys Gly 610 615 62O Trp His Ala Lieu Val Ser Phe Lieu. Asn Val Ala His Asn Ala Ile 625 63 O 635 Lieu. Arg Ala Ser Lieu Pro Lys Asp Arg Ser Pro Glu Glu Tyr Gly 64 O 645 650 Ile Thr Val Ile Ser Glin Pro Leu. Asn Lieu. Thir Lys Glu Gln Leu 655 660 665 Ser Glu Ile Thr Val Lieu. Thir Thr Ser Val Asp Ala Val Val Ala 670 675 68O Ile Cys Val Ile Phe Ser Met Ser Phe Val Pro Ala Ser Phe Val 685 69 O. 695 Lieu. Tyr Lieu. Ile Glin Glu Arg Val Asn Llys Ser Llys His Lieu. Glin 7 OO 7Os 71O

Phe Ile Ser Gly Val Ser Pro Thr Thr Tyr Trp Val Thr Asn Phe 71s 72 O 72

Lieu. Trp Asp Ile Met Asn Tyr Ser Val Ser Ala Gly Lieu Val Val 73 O 73 74 O

Gly Ile Phe Ile Gly Phe Gln Lys Lys Ala Tyr Thr Ser Pro Glu 74. 7 O 7ss US 2015/0259395 A1 Sep. 17, 2015 43

- Continued

Asn Lieu Pro Ala Lieu Val Ala Lieu. Lieu. Lieu. Lieu. Tyr Gly Trp Ala 760 765 770 Val Ile Pro Met Met Tyr Pro Ala Ser Phe Leu Phe Asp Val Pro 775 78O 78s Ser Thr Ala Tyr Val Ala Lieu. Ser Cys Ala Asn Lieu. Phe Ile Gly 79 O 79. 8OO

Ile Asn. Ser Ser Ala Ile Thir Phe Ile Lieu. Glu Lieu. Phe Glu Asn 805 810 815 Asn Arg Thr Lieu. Lieu. Arg Phe Asn Ala Val Lieu. Arg Llys Lieu. Lieu. 82O 825 83 O Ile Val Phe Pro His Phe Cys Lieu. Gly Arg Gly Lieu. Ile Asp Lieu 835 84 O 845 Ala Lieu. Ser Glin Ala Val Thr Asp Val Tyr Ala Arg Phe Gly Glu 850 855 86 O Glu. His Ser Ala Asn Pro Phe His Trp Asp Lieu. Ile Gly Lys Asn 865 87 O 87s Lieu. Phe Ala Met Val Val Glu Gly Val Val Tyr Phe Leu Lleu. Thr 88O 885 890 Lieu. Lieu Val Glin Arg His Phe Phe Lieu. Ser Glin Trp Ile Ala Glu 895 9 OO 905 Pro Thir Lys Glu Pro Ile Val Asp Glu Asp Asp Asp Wall Ala Glu 910 915 92 O Glu Arg Glin Arg Ile Ile Thr Gly Gly ASn Llys Thr Asp Ile Lieu 925 93 O 935 Arg Lieu. His Glu Lieu. Thir Lys Ile Tyr Pro Gly Thr Ser Ser Pro 94 O 945 950 Ala Val Asp Arg Lieu. CyS Val Gly Val Arg Pro Gly Glu. Cys Phe 955 96.O 965 Gly Lieu. Lieu. Gly Val Asin Gly Ala Gly Llys Thir Thir Thr Phe Llys 97O 97. 98 O Met Lieu. Thr Gly Asp Thir Thr Val Thr Ser Gly Asp Ala Thr Val 985 990 995 Ala Gly Llys Ser Ile Lieu. Thir Asn. Ile Ser Glu Val His Glin Asn 2OOO 2005 2010 Met Gly Tyr Cys Pro Glin Phe Asp Ala Ile Asp Glu Lieu. Lieu. Thr 2015 2O2O 2O25 Gly Arg Glu. His Lieu. Tyr Lieu. Tyr Ala Arg Lieu. Arg Gly Val Pro 2O3O 2O35 2O4. O Ala Glu Glu Ile Glu, Llys Val Ala Asn Trp Ser Ile Llys Ser Lieu. 2O45 2OSO 2O55 Gly Lieu. Thr Val Tyr Ala Asp Cys Lieu Ala Gly Thr Tyr Ser Gly 2O60 2O65 2. Of O

Gly Asn Lys Arg Llys Lieu. Ser Thir Ala Ile Ala Lieu. Ile Gly Cys 2O75 2O8 O 2O85

Pro Pro Leu Val Lieu. Lieu. Asp Glu Pro Thir Thr Gly Met Asp Pro 2O90 2095 21OO

Glin Ala Arg Arg Met Lieu. Trp Asin Val Ile Val Ser Ile Ile Arg 2105 211 O 2115

Glu Gly Arg Ala Val Val Lieu. Thir Ser His Ser Met Glu Glu. Cys 212O 2125 213 O

Glu Ala Lieu. Cys Thr Arg Lieu Ala Ile Met Val Lys Gly Ala Phe US 2015/0259395 A1 Sep. 17, 2015 44

- Continued

2135 214 O 2145 Arg Cys Met Gly. Thir Ile Gln His Lieu Lys Ser Llys Phe Gly Asp 2150 215.5 216 O Gly Tyr Ile Val Thr Met Lys Ile Llys Ser Pro Lys Asp Asp Lieu. 21 65 217 O 21.75 Lieu Pro Asp Lieu. Asn Pro Val Glu Glin Phe Phe Glin Gly Asn Phe 218O 21.85 219 O Pro Gly Ser Val Glin Arg Glu Arg His Tyr Asn Met Leu Glin Phe 21.95 22 OO 22O5 Glin Val Ser Ser Ser Ser Lieu Ala Arg Ile Phe Glin Lieu Lleu Lieu. 221 O 2215 222 O Ser His Lys Asp Ser Lieu. Lieu. Ile Glu Glu Tyr Ser Val Thr Glin 2225 223 O 2235 Thir Thr Lieu. Asp Glin Val Phe Val Asin Phe Ala Lys Glin Gln Thr 224 O 2.245 225 O Glu Ser His Asp Lieu Pro Lieu. His Pro Arg Ala Ala Gly Ala Ser 2255 226 O 2265 Arg Glin Ala Glin Asp 2270

<210s, SEQ ID NO 14 &211s LENGTH: 2608 &212s. TYPE: DNA <213> ORGANISM; Homo sapiens <4 OOs, SEQUENCE: 14 t cct tctt cattctgcagtt ggtgccagaa citctggatcc togaactggaa gaaaatgtct 6 O atcCaggttg agcatcCtgc tiggtggittac aagaaactgt ttgaaactgt ggaggaactg 12 O t cct cqc.cgc ticacagotca totaa.caggc aggat.ccc.cc tictdgct cac cqgcagt ct c 18O citt.cgatgtg ggc.caggact ctittgaagtt ggatctgagc cattttacca cctdtttgat 24 O gggcaa.gc.cc ticctgcacaa gtttgactitt aaagaaggac atgtcacat a C cacagalagg 3OO ttcatc.cgca Ctgatgctta C9tacgggca atgactgaga aaaggat.cgt catalacagaa 360 tittggcacct gtgctitt.ccc agat.ccctgc aagaatatat titt coaggitt tttitt cittac 42O titt.cgaggag tagaggittac tacaatgcc Cttgttaatgtct acccagt gggggaagat 48O tact acgctt gcacagagac caactittatt acaaagatta atccagagac cittggagaca 54 O attaag cagg ttgatctittg caactatotic tictdt caatig goggcc actgc ticacc cc cac 6OO attgaaaatg atggaacct ttacaatatt ggtaattgct ttggaaaaaa tttittcaatt 660 gcct acaa.ca ttgtaaagat cccaccactg. Caagcagaca aggaagatcc aataa.gcaa.g 72 O t cagagat.cg ttgtacaatt cocctgcagt gaccgattica agc catctta cott catagt 78O tittggtctga citcc.caacta tat cqtttitt gtggagacac cagtcaaaat taacctgttc 84 O aagttc ctitt citt catggag totttgggga gccaactaca toggattgttt tdagt.ccaat 9 OO gaalaccatgg gggtttggct t catattgct gacaaaaaaa ggaaaaagta Cct caataat 96.O aaatacagaa cittct c ctitt caacct ctitc catca catca acaccitatga agacaatggg 1 O2O tittctgattig toggat citctg. citgctggaaa gcatttgagt ttgtttataa ttact tatat 108 O ttagccaatt tacgtgagaa citgggaagag gtgaaaaaaa atgcc agaala ggctic cc caa 114 O

Cctgaagtta ggagatatgt act tcctttgaat attgaca aggctgacac aggcaagaat 12 OO US 2015/0259395 A1 Sep. 17, 2015 45

- Continued ttagt cacgc. tcc ccaatac aactgccact gcaattctgt gcagtgacga gactatotgg 26 O ctggagcctgaagttct citt ttcagggcct cqt caag cat ttgagtttcc ticaaatcaat 32O taccagaagt attgttgggaa acct tacaca tatgcgitatig gacttggctt gaat cactitt 38O gttcCagata ggctctgtaa gctgaatgtc. aaaactaaag aaacttgggt ttggcaa.gag 44 O cctgatt cat acc cat caga acccatctitt gtttctic acc cagatgcctt ggaagaagat SOO gatggtgtag ttctgagtgt ggtggtgagc ccaggagcag gacaaaagcc tictitat ct c 560 Ctgattctga atgccaagga cittaagtgaa gttgc.ccggg ctgaagtgga gattalacat c 62O cctgtcacct tt catggact gttcaaaaaa tottgagcat act coagcaa gatatgttitt 68O tggtagcaaa act gagaaaa totagottcag gtctgcaatc aaattctgtt caattittagc 74 O ctgctatatgtcatggittitt aacttgcaga tigcgcacaat tittgcaatgt tttacagaaa 8OO gcactgagtt gagcaa.gcaa titc ctittatt taaaaaaaaa agtacg tatt tagataatca 86 O tact tcct ct gtgaga cagg ccatalactgaaaaact citta aatatttagc aatcaaatag 92 O gaaatgaatg tdgact tact aaatggcttt taatticcitat tataagagca tattittaggit 98 O acct atctgc ticcaattata tttittaac at ttaaaaacca aagtic ct cta cacttgattit 2O4. O at attatatg toggctittgct gag to aagga agtat catgc aataaggctt aattact aaa 21OO tgtcaaacca aactttitt ct caaac caggg act at catct aagattaatt acagtaatta 216 O ttittgcgt at acgtaactgc t caaagatta taatctitat gaatgttaac ctitt.ccgttt 2220 attacaagca agtact atta tittctgattt tataataaga aaatctgttgt ttaatcaact 228O gaggcct citc aaccaaataa catct cagag attaagttat at attaaaag cittatgtaac 234 O ataaaa.gcaa gtacatatag tagtgacitat atttaaaaaa acago at aaa atgcttaaaa 24 OO atgtaatatt tactaaaatc agattatggg ataatgttgc aggattatac tittattgcat 246 O

Ctttitttgtt taattig tatt taa.gcattgt gcaat cactt gggaaaaata ttaaattatt 252O aacattgagg tattaataca ttittaagcct tttgtttitta aatttcttitt citt coagaga 2580 ttgtttaaaa ataaat attg acaaaaat 2608

<210s, SEQ ID NO 15 &211s LENGTH: 533 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 15 Met Ser Ile Glin Val Glu. His Pro Ala Gly Gly Tyr Lys Llys Lieu Phe 1. 5 1O 15 Glu Thr Val Glu Glu Lieu Ser Ser Pro Leu. Thir Ala His Val Thr Gly 2O 25 3O

Arg Ile Pro Lieu. Trp Lieu. Thr Gly Ser Lieu. Lieu. Arg Cys Gly Pro Gly 35 4 O 45

Lieu. Phe Glu Val Gly Ser Glu Pro Phe Tyr His Leu Phe Asp Gly Glin SO 55 6 O Ala Lieu. Lieu. His Llys Phe Asp Phe Lys Glu Gly His Val Thr Tyr His 65 70 7s 8O

Arg Arg Phe Ile Arg Thr Asp Ala Tyr Val Arg Ala Met Thr Glu Lys 85 90 95

Arg Ile Val Ile Thr Glu Phe Gly Thr Cys Ala Phe Pro Asp Pro Cys US 2015/0259395 A1 Sep. 17, 2015 46

- Continued

1OO 105 11 O Lys Asn Ile Phe Ser Arg Phe Phe Ser Tyr Phe Arg Gly Val Glu Val 115 12 O 125 Thir Asp Asn Ala Lieu Val Asn Val Tyr Pro Val Gly Glu Asp Tyr Tyr 13 O 135 14 O Ala Cys Thr Glu Thr Asn Phe Ile Thr Lys Ile Asn Pro Glu. Thir Lieu. 145 150 155 160 Glu Thir Ile Lys Glin Val Asp Lieu. Cys Asn Tyr Val Ser Val Asn Gly 1.65 17O 17s Ala Thr Ala His Pro His Ile Glu Asn Asp Gly Thr Val Tyr Asn Ile 18O 185 19 O Gly Asn. Cys Phe Gly Lys Asn. Phe Ser Ile Ala Tyr Asn. Ile Val Lys 195 2OO 2O5 Ile Pro Pro Lieu. Glin Ala Asp Llys Glu Asp Pro Ile Ser Lys Ser Glu 21 O 215 22O Ile Val Val Glin Phe Pro Cys Ser Asp Arg Phe Llys Pro Ser Tyr Val 225 23 O 235 24 O His Ser Phe Gly Lieu. Thr Pro Asn Tyr Ile Val Phe Val Glu. Thr Pro 245 250 255 Val Lys Ile Asn Lieu. Phe Llys Phe Lieu. Ser Ser Trp Ser Lieu. Trp Gly 26 O 265 27 O Ala Asn Tyr Met Asp Cys Phe Glu Ser Asn Glu Thr Met Gly Val Trp 275 28O 285 Lieu. His Ile Ala Asp Llys Lys Arg Llys Llys Tyr Lieu. Asn. Asn Llys Tyr 29 O 295 3 OO Arg Thr Ser Pro Phe Asn Lieu Phe His His Ile Asn Thr Tyr Glu Asp 3. OS 310 315 32O Asn Gly Phe Lieu. Ile Val Asp Lieu. Cys Cys Trp Llys Gly Phe Glu Phe 3.25 330 335 Val Tyr Asn Tyr Lieu. Tyr Lieu Ala Asn Lieu. Arg Glu Asn Trp Glu Glu 34 O 345 35. O Val Llys Lys Asn Ala Arg Lys Ala Pro Glin Pro Glu Val Arg Arg Tyr 355 360 365 Val Lieu Pro Lieu. Asn. Ile Asp Lys Ala Asp Thr Gly Lys Asn Lieu Val 37 O 375 38O Thr Lieu Pro Asn Thr Thr Ala Thr Ala Ile Lieu. Cys Ser Asp Glu Thr 385 390 395 4 OO Ile Trp Lieu. Glu Pro Glu Val Lieu Phe Ser Gly Pro Arg Glin Ala Phe 4 OS 41O 415 Glu Phe Pro Glin Ile Asn Tyr Gln Lys Tyr Cys Gly Llys Pro Tyr Thr 42O 425 43 O Tyr Ala Tyr Gly Lieu. Gly Lieu. Asn His Phe Val Pro Asp Arg Lieu. Cys 435 44 O 445

Llys Lieu. Asn. Wall Lys Thr Lys Glu Thir Trp Val Trp Glin Glu Pro Asp 450 45.5 460

Ser Tyr Pro Ser Glu Pro Ile Phe Val Ser His Pro Asp Ala Lieu. Glu 465 470 47s 48O

Glu Asp Asp Gly Val Val Lieu. Ser Val Val Val Ser Pro Gly Ala Gly 485 490 495

Glin Llys Pro Ala Tyr Lieu. Lieu. Ile Lieu. Asn Ala Lys Asp Lieu. Ser Glu SOO 505 51O

US 2015/0259395 A1 Sep. 17, 2015 48

- Continued

<210s, SEQ ID NO 17 &211s LENGTH: 317 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 17 Met Ser Glu Gly Val Gly Thr Phe Arg Met Val Pro Glu Glu Glu Gln 1. 5 1O 15 Glu Lieu. Arg Ala Glin Lieu. Glu Glin Lieu. Thir Thr Lys Asp His Gly Pro 2O 25 3O Val Phe Gly Pro Cys Ser Gln Leu Pro Arg His Thr Lieu Gln Lys Ala 35 4 O 45 Lys Asp Glu Lieu. Asn. Glu Arg Glu Glu Thir Arg Glu Glu Ala Val Arg SO 55 6 O Glu Lieu. Glin Glu Met Val Glin Ala Glin Ala Ala Ser Gly Glu Glu Lieu. 65 70 7s 8O Ala Val Ala Val Ala Glu Arg Val Glin Glu Lys Asp Ser Gly Phe Phe 85 90 95 Lieu. Arg Phe Ile Arg Ala Arg Llys Phe Asin Val Gly Arg Ala Tyr Glu 1OO 105 11 O Lieu. Lieu. Arg Gly Tyr Val Asn. Phe Arg Lieu. Glin Tyr Pro Glu Lieu. Phe 115 12 O 125 Asp Ser Lieu. Ser Pro Glu Ala Val Arg Cys Thir Ile Glu Ala Gly Tyr 13 O 135 14 O Pro Gly Val Lieu. Ser Ser Arg Asp Llys Tyr Gly Arg Val Val Met Lieu. 145 150 155 160 Phe Asin Ile Glu Asn Trp Glin Ser Glin Glu Ile Thr Phe Asp Glu Ile 1.65 17O 17s Lieu. Glin Ala Tyr Cys Phe Ile Lieu. Glu Lys Lieu. Lieu. Glu Asn. Glu Glu 18O 185 19 O Thr Glin Ile Asin Gly Phe Cys Ile Ile Glu Asn Phe Lys Gly Phe Thr 195 2OO 2O5 Met Glin Glin Ala Ala Ser Lieu. Arg Thir Ser Asp Lieu. Arg Llys Met Val 21 O 215 22O Asp Met Lieu. Glin Asp Ser Phe Pro Ala Arg Phe Lys Ala Ile His Phe 225 23 O 235 24 O Ile His Gln Pro Trp Tyr Phe Thr Thr Thr Tyr Asn Val Val Llys Pro 245 250 255 Phe Lieu Lys Ser Llys Lieu. Lieu. Glu Arg Val Phe Val His Gly Asp Asp 26 O 265 27 O Lieu. Ser Gly Phe Tyr Glin Glu Ile Asp Glu Asn. Ile Lieu Pro Ser Asp 27s 28O 285 Phe Gly Gly. Thir Lieu Pro Llys Tyr Asp Gly Lys Ala Val Ala Glu Glin 29 O 295 3 OO

Lieu. Phe Gly Pro Glin Ala Glin Ala Glu Asn Thr Ala Phe 3. OS 310 315

<210s, SEQ ID NO 18 &211s LENGTH: 3027 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 18

Cagcgttcag gctgcc cctt Cttggctggg aagggcgctgaagaaacaac gcc caggacc 6 O

US 2015/0259395 A1 Sep. 17, 2015 50

- Continued tgaaaaacac tatttctgga atgcttctgc atcaaaggag attctittgag atagoccatc 24 OO titcCtgagct agcaaataca ggagttitt Ca Ctttctt tag gaaagagaag Ctttcagggg 246 O aaggagagaa tattittgct gaCtt cocaa goc ctggtga C cagacCaag gCagggcc.ca 252O gCataatticc ticcagttgga tigaac attica agaga.gctcg titcctacct g gctggagacc 2580 gaggcc agaa ggcaaaaac C agaaagggaa cagtic catala Cttacct ctg. Cttctgaccg 264 O atggtgtttg ggaataggitt actittggact gagtttgggit totctgctgt Cctaagaact 27 OO t cagtgtaga gaaaataaga Cttctggtgc tigctggggta tittctgggc titaattic ccc 276 O Caagcagaag accagat.cca agatgtttgg acacic ctgtc. agacgttggit cccaagttta 282O attagattitc taatctogt taggccaag gaatgat coa tactgaaaaa atgctgagcc 288O agcc at Cttt ggcaaagg to cctgagct ct tctat ct ct caagagtgct gagaaccacg 294 O gtgaaagtgc tigctictaggc ccacaagtgt alactatgctg. itta acagctg. t caatagata 3 OOO attaaaattic at actg tatgaaaatca 3 O27

<210s, SEQ ID NO 19 &211s LENGTH: 346 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 19 Met Ala Lieu Lieu Lys Val Llys Phe Asp Glin Llys Lys Arg Val Llys Lieu 1. 5 1O 15 Ala Glin Gly Lieu. Trp Lieu Met Asn Trp Phe Ser Val Lieu Ala Gly Ile 2O 25 3O Ile Ile Phe Ser Lieu. Gly Lieu. Phe Lieu Lys Ile Glu Lieu. Arg Lys Arg 35 4 O 45 Ser Asp Val Met Asn Asn Ser Glu Ser His Phe Val Pro Asn Ser Lieu. SO 55 6 O Ile Gly Met Gly Val Lieu. Ser Cys Val Phe Asn. Ser Lieu Ala Gly Lys 65 70 7s 8O Ile Cys Tyr Asp Ala Lieu. Asp Pro Ala Lys Tyr Ala Arg Trp Llys Pro 85 90 95 Trp Lieu Lys Pro Tyr Lieu Ala Ile Cys Val Lieu. Phe Asn. Ile Ile Lieu. 1OO 105 11 O Phe Lieu Val Ala Lieu. Cys Cys Phe Lieu. Lieu. Arg Gly Ser Lieu. Glu Asn 115 12 O 125 Thir Lieu. Gly Glin Gly Lieu Lys Asn Gly Met Lys Tyr Tyr Arg Asp Thr 13 O 135 14 O Asp Thr Pro Gly Arg Cys Phe Met Lys Llys Thir Ile Asp Met Leu Gln 145 150 155 160

Ile Glu Phe Lys Cys Cys Gly Asn. Asn Gly Phe Arg Asp Trp Phe Glu 1.65 17O 17s

Ile Glin Trp Ile Ser Asn Arg Tyr Lieu. Asp Phe Ser Ser Lys Glu Val 18O 185 19 O

Lys Asp Arg Ile Llys Ser Asn. Wall Asp Gly Arg Tyr Lieu Val Asp Gly 195 2OO 2O5

Val Pro Phe Ser Cys Cys Asn Pro Ser Ser Pro Arg Pro Cys Ile Glin 21 O 215 22O

Tyr Glin Ile Thr Asn Asn Ser Ala His Tyr Ser Tyr Asp His Glin Thr

US 2015/0259395 A1 Sep. 17, 2015 52

- Continued ccagat Caag gtgaagctica cagtgtcagg Ctttctggga gagct cacct C cagtgaagt 144 O cgcc actgag gtcc catt Co gcct catgca C cct cagcct gaggacc cag Ctalaggaaag 15OO titat caggat gcaaatttag tittittgagga gtttgct cqc cataatctga aagatgcagg 1560 agaa.gctgag gaggggaaga gagacaagaa tacgttgat gagtgaagat gtcggct cag 162O gatgc.cggaa aatgacctgt agttaccagt gcaacgagca aagc.cccaca gtttagt cct 168O ttggagtt at gctgcg tatgaaaggatgag ticttctt cog agaaataaag Cttgtttgtt 1740 citcc cctoga aaaaaaaaaa aaaaaaa 1767

<210s, SEQ ID NO 21 &211s LENGTH: 405 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 21 Met Ala Ala Ser Gly Lys Thir Ser Lys Ser Glu Pro Asn His Val Ile 1. 5 1O 15 Phe Llys Lys Ile Ser Arg Asp Llys Ser Val Thir Ile Tyr Lieu. Gly Asn 2O 25 3O Arg Asp Tyr Ile Asp His Val Ser Glin Val Glin Pro Val Asp Gly Val 35 4 O 45 Val Lieu Val Asp Pro Asp Lieu Val Lys Gly Lys Llys Val Tyr Val Thr 50 55 60 Lieu. Thir Cys Ala Phe Arg Tyr Gly Glin Glu Asp Ile Asp Val Ile Gly 65 70 7s 8O Lieu. Thir Phe Arg Arg Asp Leu Tyr Phe Ser Arg Val Glin Val Tyr Pro 85 90 95 Pro Val Gly Ala Ala Ser Thr Pro Thr Lys Lieu Gln Glu Ser Lieu. Leu 1OO 105 11 O Lys Llys Lieu. Gly Ser Asn Thr Tyr Pro Phe Leu Lleu. Thr Phe Pro Asp 115 12 O 125 Tyr Lieu Pro Cys Ser Val Met Leu Gln Pro Ala Pro Glin Asp Ser Gly 13 O 135 14 O Llys Ser Cys Gly Val Asp Phe Glu Val Lys Ala Phe Ala Thir Asp Ser 145 150 155 160 Thir Asp Ala Glu Glu Asp Llys Ile Pro Llys Llys Ser Ser Val Arg Lieu. 1.65 17O 17s Lieu. Ile Arg Llys Val Glin His Ala Pro Lieu. Glu Met Gly Pro Glin Pro 18O 185 19 O Arg Ala Glu Ala Ala Trp Glin Phe Phe Met Ser Asp Llys Pro Lieu. His 195 2OO 2O5 Lieu Ala Val Ser Lieu. Asn Lys Glu Ile Tyr Phe His Gly Glu Pro Ile 21 O 215 22O

Pro Val Thr Val Thr Val Thr Asn Asn Thr Glu Lys Thr Val Lys Lys 225 23 O 235 24 O

Ile Lys Ala Phe Val Glu Glin Val Ala Asn Val Val Lieu. Tyr Ser Ser 245 250 255

Asp Tyr Tyr Val Llys Pro Val Ala Met Glu Glu Ala Glin Glu Lys Val 26 O 265 27 O

Pro Pro Asn Ser Thr Lieu. Thir Lys Thr Lieu. Thir Lieu Lleu Pro Leu Lieu. 27s 28O 285

US 2015/0259395 A1 Sep. 17, 2015 54

- Continued

Cacaagttcat gggcattt at taagtgcc.ca gtgctgggitt gggcatgaag tdggaagatg 38O gcc cct Coca ggaagaagta Cctggcctga Caaggtgggg cacticttggg gg tatgggac 44 O

Caact catgg Cttitt Cacgg gagttgagga gagaggagct gtggaaaata t t cactggga SOO Cagt cttgga t caagaggga gttittgaggt ggaggct cat tctggcaggg accgtagtt 560 Ctaccagc cc Cagaalacatg ggctt atggc cacaggagtt Cagtggagca agagcagggg 62O aggagagacg tdgacaggtg cccaaagcca gtcggagggc Ctgggctitt C tdagalaggtg 68O atggagagtic ttggaa.gc.cc ticgaggcagg alacataattig Cagggctggg attagggtga 74 O gggalagtgag gcacacticac Cttgggtgca acatttalagg catgccaaa aaatttagta 8OO accalaggtaa ataat attag gataatattt ttaaaaatca aatgaatgca aaaccccaca 86 O atgaatgaaa tat caaaatc Caacagagga t caaacagag gCatgctaag atatattggg 92 O gcttgaagica aagggaaaac tatttgttgc tatatgtttg tagggattitt ttgc.cagttt 98 O taaaaataca totatcataa agtttact at ct cagocact togc.cggtgta tagtttggtg 2O4. O gtgttaagta catt cataat gttgtacaac caccgcaact gttcatctoc agaactic citt 21OO t cct cittgta aaactgtaac totgtaccca tdaaaaaata accc.cccatt cotgcct tcc 216 O cc.cggctic ct ggcatccacc attct actitt coat citctat gaatgtgact gctictaagtg 222 O cct cagatgt gtgggit coat gaagt citttgtc.tttittgca actggctitat titcacttagc 228O at catgtc.tt Caaggttt at t catgtgtag catatggcag aatct cott C Ctttittaagg 234 O ttgaataata t t c cattgta tatatt coac actttgttta tittatt catc tattgatgaa 24 OO tggitta catc togccttittgg c tattgttgaa taatgctgct atgaacatgg gtgtacaaat 246 O

Ctect Caaaaa aaaaaaaaaa aaa. 2483

<210s, SEQ ID NO 23 &211s LENGTH: 350 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 23 Met Gly Ala Gly Ala Ser Ala Glu Glu Lys His Ser Arg Glu Lieu. Glu 1. 5 1O 15 Llys Llys Lieu Lys Glu Asp Ala Glu Lys Asp Ala Arg Thr Val Lys Lieu. 2O 25 3O Lieu. Lieu. Lieu. Gly Ala Gly Glu Ser Gly Lys Ser Thir Ile Val Lys Glin 35 4 O 45 Met Lys Ile Ile His Glin Asp Gly Tyr Ser Lieu. Glu Glu. Cys Lieu. Glu SO 55 6 O Phe Ile Ala Ile Ile Tyr Gly Asn. Thir Lieu. Glin Ser Ile Lieu Ala Ile 65 70 7s 8O

Val Arg Ala Met Thir Thr Lieu. Asn. Ile Glin Tyr Gly Asp Ser Ala Arg 85 90 95 Glin Asp Asp Ala Arg Llys Lieu Met His Met Ala Asp Thir Ile Glu Glu 1OO 105 11 O

Gly Thr Met Pro Lys Glu Met Ser Asp Ile Ile Glin Arg Lieu. Trp Llys 115 12 O 125

Asp Ser Gly Ile Glin Ala Cys Phe Glu Arg Ala Ser Glu Tyr Glin Lieu 13 O 135 14 O US 2015/0259395 A1 Sep. 17, 2015 55

- Continued Asn Asp Ser Ala Gly Tyr Tyr Lieu. Ser Asp Lieu. Glu Arg Lieu Val Thr 145 150 155 160 Pro Gly Tyr Val Pro Thr Glu Glin Asp Val Lieu. Arg Ser Arg Val Lys 1.65 17O 17s Thir Thr Gly Ile Ile Glu Thr Glin Phe Ser Phe Lys Asp Lieu. Asn Phe 18O 185 19 O Arg Met Phe Asp Val Gly Gly Glin Arg Ser Glu Arg Llys Llys Trp Ile 195 2OO 2O5 His Cys Phe Glu Gly Val Thr Cys Ile Ile Phe Ile Ala Ala Leu Ser 21 O 215 22O Ala Tyr Asp Met Val Lieu Val Glu Asp Asp Glu Val Asn Arg Met His 225 23 O 235 24 O Glu Ser Lieu. His Lieu. Phe Asn. Ser Ile Cys Asn His Arg Tyr Phe Ala 245 250 255 Thir Thr Ser Ile Val Lieu Phe Lieu. Asn Llys Lys Asp Val Phe Phe Glu 26 O 265 27 O Lys Ile Llys Lys Ala His Lieu. Ser Ile Cys Phe Pro Asp Tyr Asp Gly 27s 28O 285 Pro Asn. Thir Tyr Glu Asp Ala Gly Asn Tyr Ile Llys Val Glin Phe Lieu. 29 O 295 3 OO Glu Lieu. Asn Met Arg Arg Asp Wall Lys Glu Ile Tyr Ser His Met Thr 3. OS 310 315 32O CyS Ala Thr Asp Thr Glin Asn Val Llys Phe Val Phe Asp Ala Val Thr 3.25 330 335 Asp Ile Ile Ile Lys Glu Asn Lieu Lys Asp Cys Gly Lieu. Phe 34 O 345 35. O

<210s, SEQ ID NO 24 &211s LENGTH: 2O1 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 24 Met Gly Asn Val Met Glu Gly Lys Ser Val Glu Glu Lieu Ser Ser Thr 1. 5 1O 15 Glu Cys His Gln Trp Tyr Lys Llys Phe Met Thr Glu. Cys Pro Ser Gly 2O 25 3O Glin Lieu. Thir Lieu. Tyr Glu Phe Arg Glin Phe Phe Gly Lieu Lys Asn Lieu. 35 4 O 45 Ser Pro Ser Ala Ser Glin Tyr Val Glu Gln Met Phe Glu Thr Phe Asp SO 55 6 O Phe Asn Lys Asp Gly Tyr Ile Asp Phe Met Glu Tyr Val Ala Ala Lieu. 65 70 7s 8O Ser Lieu Val Lieu Lys Gly Llys Val Glu Gln Lys Lieu. Arg Trp Tyr Phe 85 90 95

Llys Lieu. Tyr Asp Wall Asp Gly Asin Gly Cys Ile Asp Arg Asp Glu Lieu. 1OO 105 11 O

Lieu. Thir Ile Ile Glin Ala Ile Arg Ala Ile Asn. Pro Cys Ser Asp Thr 115 12 O 125

Thr Met Thr Ala Glu Glu Phe Thr Asp Thr Val Phe Ser Lys Ile Asp 13 O 135 14 O

Val Asn Gly Asp Gly Glu Lieu. Ser Lieu. Glu Glu Phe Ile Glu Gly Val 145 150 155 160 US 2015/0259395 A1 Sep. 17, 2015 56

- Continued

Glin Lys Asp Gln Met Lieu. Lieu. Asp Thir Lieu. Thir Arg Ser Lieu. Asp Lieu. 1.65 17O 17s Thir Arg Ile Val Arg Arg Lieu. Glin Asn Gly Glu Glin Asp Glu Glu Gly 18O 185 19 O Ala Asp Glu Ala Ala Glu Ala Ala Gly 195 2OO

<210s, SEQ ID NO 25 &211s LENGTH: 1103 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 25 Met Thr Ala Cys Ala Arg Arg Ala Gly Gly Lieu Pro Asp Pro Gly Lieu. 1. 5 1O 15 Cys Gly Pro Ala Trp Trp Ala Pro Ser Lieu Pro Arg Lieu Pro Arg Ala 2O 25 3O Lieu Pro Arg Lieu Pro Lieu. Lieu. Lieu. Lieu. Lieu. Lieu Lleu Lieu. Glin Pro Pro 35 4 O 45 Ala Leu Ser Ala Val Phe Thr Val Gly Val Lieu. Gly Pro Trp Ala Cys SO 55 6 O Asp Pro Ile Phe Ser Arg Ala Arg Pro Asp Lieu Ala Ala Arg Lieu Ala 65 70 7s 8O Ala Ala Arg Lieu. ASn Arg Asp Pro Gly Lieu Ala Gly Gly Pro Arg Phe 85 90 95 Glu Val Ala Lieu Lleu Pro Glu Pro Cys Arg Thr Pro Gly Ser Lieu. Gly 1OO 105 11 O Ala Val Ser Ser Ala Lieu Ala Arg Val Ser Gly Lieu Val Gly Pro Val 115 12 O 125 Asn Pro Ala Ala Cys Arg Pro Ala Glu Lieu. Lieu Ala Glu Glu Ala Gly 13 O 135 14 O Ile Ala Leu Val Pro Trp Gly Cys Pro Trp Thr Glin Ala Glu Gly Thr 145 150 155 160 Thir Ala Pro Ala Val Thr Pro Ala Ala Asp Ala Lieu. Tyr Ala Lieu. Lieu. 1.65 17O 17s Arg Ala Phe Gly Trp Ala Arg Val Ala Lieu Val Thr Ala Pro Glin Asp 18O 185 19 O Lieu. Trp Val Glu Ala Gly Arg Ser Lieu. Ser Thr Ala Lieu. Arg Ala Arg 195 2OO 2O5 Gly Leu Pro Val Ala Ser Val Thr Ser Met Glu Pro Leu Asp Leu Ser 21 O 215 22O Gly Ala Arg Glu Ala Lieu. Arg Llys Val Arg Asp Gly Pro Arg Val Thr 225 23 O 235 24 O

Ala Val Ile Met Val Met His Ser Val Lieu. Leu Gly Gly Glu Glu Gln 245 250 255

Arg Tyr Lieu. Lieu. Glu Ala Ala Glu Glu Lieu. Gly Lieu. Thir Asp Gly Ser 26 O 265 27 O

Lieu Val Phe Leu Pro Phe Asp Thir Ile His Tyr Ala Leu Ser Pro Gly 27s 28O 285

Pro Glu Ala Lieu Ala Ala Lieu Ala Asn. Ser Ser Glin Lieu. Arg Arg Ala 29 O 295 3 OO

His Asp Ala Val Lieu. Thir Lieu. Thr Arg His Cys Pro Ser Glu Gly Ser US 2015/0259395 A1 Sep. 17, 2015 57

- Continued

3. OS 310 315 32O Val Lieu. Asp Ser Lieu. Arg Arg Ala Glin Glu Arg Arg Glu Lieu Pro Ser 3.25 330 335 Asp Lieu. Asn Lieu. Glin Glin Val Ser Pro Lieu. Phe Gly. Thir Ile Tyr Asp 34 O 345 35. O Ala Val Phe Lieu. Lieu Ala Arg Gly Val Ala Glu Ala Arg Ala Ala Ala 355 360 365 Gly Gly Arg Trp Val Ser Gly Ala Ala Val Ala Arg His Ile Arg Asp 37 O 375 38O Ala Glin Val Pro Gly Phe Cys Gly Asp Lieu. Gly Gly Asp Glu Glu Pro 385 390 395 4 OO Pro Phe Val Lieu. Lieu. Asp Thr Asp Ala Ala Gly Asp Arg Lieu. Phe Ala 4 OS 41O 415 Thr Tyr Met Lieu. Asp Pro Ala Arg Gly Ser Phe Leu Ser Ala Gly Thr 42O 425 43 O Arg Met His Phe Pro Arg Gly Gly Ser Ala Pro Gly Pro Asp Pro Ser 435 44 O 445 Cys Trp Phe Asp Pro Asn. Asn. Ile Cys Gly Gly Gly Lieu. Glu Pro Gly 450 45.5 460 Lieu Val Phe Lieu. Gly Phe Lieu. Lieu Val Val Gly Met Gly Lieu Ala Gly 465 470 47s 48O Ala Phe Lieu Ala His Tyr Val Arg His Arg Lieu. Lieu. His Met Gln Met 485 490 495 Val Ser Gly Pro Asn Lys Ile Ile Lieu. Thr Val Asp Asp Ile Thr Phe SOO 505 51O Lieu. His Pro His Gly Gly. Thir Ser Arg Llys Val Ala Glin Gly Ser Arg 515 52O 525 Ser Ser Lieu. Gly Ala Arg Ser Met Ser Asp Ile Arg Ser Gly Pro Ser 53 O 535 54 O Glin His Lieu. Asp Ser Pro Asn. Ile Gly Val Tyr Glu Gly Asp Arg Val 5.45 550 555 560 Trp Lieu Lys Llys Phe Pro Gly Asp Gln His Ile Ala Ile Arg Pro Ala 565 st O sts Thir Lys Thr Ala Phe Ser Llys Lieu. Glin Glu Lieu. Arg His Glu Asn. Wall 58O 585 59 O Ala Lieu. Tyr Lieu. Gly Lieu. Phe Lieu Ala Arg Gly Ala Glu Gly Pro Ala 595 6OO 605 Ala Lieu. Trp Glu Gly Asn Lieu Ala Val Val Ser Glu. His Cys Thr Arg 610 615 62O Gly Ser Lieu. Glin Asp Lieu. Lieu Ala Glin Arg Glu Ile Llys Lieu. Asp Trp 625 630 635 64 O

Met Phe Llys Ser Ser Lieu Lleu Lieu. Asp Lieu. Ile Lys Gly Ile Arg Tyr 645 650 655 Lieu. His His Arg Gly Val Ala His Gly Arg Lieu Lys Ser Arg Asn. Cys 660 665 67 O Ile Val Asp Gly Arg Phe Val Lieu Lys Ile Thr Asp His Gly His Gly 675 68O 685

Arg Lieu. Lieu. Glu Ala Glin Llys Val Lieu Pro Glu Pro Pro Arg Ala Glu 69 O. 695 7 OO

Asp Gln Lieu. Trp Thr Ala Pro Glu Lieu. Lieu. Arg Asp Pro Ala Lieu. Glu 7 Os 71O 71s 72O US 2015/0259395 A1 Sep. 17, 2015 58

- Continued

Arg Arg Gly. Thir Lieu Ala Gly Asp Val Phe Ser Lieu Ala Ile Ile Met 72 73 O 73 Gln Glu Val Val Cys Arg Ser Ala Pro Tyr Ala Met Lieu. Glu Lieu. Thr 740 74. 7 O Pro Glu Glu Val Val Glin Arg Val Arg Ser Pro Pro Pro Leu. Cys Arg 7ss 760 765 Pro Leu Val Ser Met Asp Glin Ala Pro Val Glu. Cys Ile Leu Lleu Met 770 775 78O Lys Glin Cys Trp Ala Glu Gln Pro Glu Lieu. Arg Pro Ser Met Asp His 78s 79 O 79. 8OO Thir Phe Asp Lieu. Phe Lys Asn. Ile Asn Lys Gly Arg Llys Thir Asn. Ile 805 810 815 Ile Asp Ser Met Lieu. Arg Met Lieu. Glu Glin Tyr Ser Ser Asn Lieu. Glu 82O 825 83 O Asp Lieu. Ile Arg Glu Arg Thr Glu Glu Lieu. Glu Lieu. Glu Lys Gln Lys 835 84 O 845 Thir Asp Arg Lieu. Lieu. Thr Gln Met Lieu Pro Pro Ser Val Ala Glu Ala 850 855 860 Lieu Lys Thr Gly Thr Pro Val Glu Pro Glu Tyr Phe Glu Glin Val Thr 865 87O 87s 88O Lieu. Tyr Phe Ser Asp Ile Val Gly Phe Thr Thr Ile Ser Ala Met Ser 885 890 895 Glu Pro Ile Glu Val Val Asp Lieu. Lieu. Asn Asp Lieu. Tyr Thr Lieu. Phe 9 OO 905 91 O Asp Ala Ile Ile Gly Ser His Asp Val Tyr Llys Val Glu Thir Ile Gly 915 92 O 925 Asp Ala Tyr Met Val Ala Ser Gly Lieu Pro Glin Arg Asn Gly Glin Arg 93 O 935 94 O His Ala Ala Glu Ile Ala Asn Met Ser Lieu. Asp Ile Lieu. Ser Ala Val 945 950 955 96.O Gly Thr Phe Arg Met Arg His Met Pro Glu Val Pro Val Arg Ile Arg 965 97O 97. Ile Gly Lieu. His Ser Gly Pro Cys Val Ala Gly Val Val Gly Lieu. Thr 98O 985 99 O Met Pro Arg Tyr Cys Lieu Phe Gly Asp Thr Val Asn Thr Ala Ser Arg 995 1OOO 1005 Met Glu Ser Thr Gly Leu Pro Tyr Arg Ile His Val Asn Lieu Ser O1O O15 O2O Thr Val Gly Ile Lieu. Arg Ala Lieu. Asp Ser Gly Tyr Glin Val Glu O25 O3 O O35 Lieu. Arg Gly Arg Thr Glu Lieu Lys Gly Lys Gly Ala Glu Asp Thr O4 O O45 OSO

Phe Trp Lieu Val Gly Arg Arg Gly Phe Asn Llys Pro Ile Pro Llys O55 O6 O O65 Pro Pro Asp Leu Glin Pro Gly Ser Ser Asn His Gly Ile Ser Lieu. Of O O7 O8O

Glin Glu Ile Pro Pro Glu Arg Arg Arg Llys Lieu. Glu Lys Ala Arg O85 O9 O O95

Pro Gly Glin Phe Ser 1 OO US 2015/0259395 A1 Sep. 17, 2015 59

- Continued

<210s, SEQ ID NO 26 &211s LENGTH: 676 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 26 Met Ala Lys Ile Asn Thr Glin Tyr Ser His Pro Ser Arg Thr His Leu 1. 5 1O 15 Llys Val Llys Thir Ser Asp Arg Asp Lieu. Asn Arg Ala Glu Asn Gly Lieu. 2O 25 3O Ser Arg Ala His Ser Ser Ser Glu Glu Thir Ser Ser Val Leu Gln Pro 35 4 O 45 Gly Ile Ala Met Glu Thir Arg Gly Lieu Ala Asp Ser Gly Glin Gly Ser SO 55 6 O Phe Thr Gly Glin Gly Ile Ala Arg Lieu. Ser Arg Lieu. Ile Phe Lieu. Lieu. 65 70 7s 8O Arg Arg Trp Ala Ala Arg His Val His His Glin Asp Glin Gly Pro Asp 85 90 95 Ser Phe Pro Asp Arg Phe Arg Gly Ala Glu Lieu Lys Glu Val Ser Ser 1OO 105 11 O Glin Glu Ser Asn Ala Glin Ala Asn Val Gly Ser Glin Glu Pro Ala Asp 115 12 O 125 Arg Gly Arg Arg Llys Llys Thr Lys Llys Lys Asp Ala Ile Val Val Asp 13 O 135 14 O Pro Ser Ser Asn Lieu. Tyr Tyr Arg Trp Lieu. Thir Ala Ile Ala Leu Pro 145 150 155 160 Val Phe Tyr Asn Trp Tyr Lieu. Lieu. Ile Cys Arg Ala Cys Phe Asp Glu 1.65 17O 17s Lieu. Glin Ser Glu Tyr Lieu Met Lieu. Trp Lieu Val Lieu. Asp Tyr Ser Ala 18O 185 19 O Asp Val Lieu. Tyr Val Lieu. Asp Val Lieu Val Arg Ala Arg Thr Gly Phe 195 2OO 2O5 Lieu. Glu Glin Gly Lieu Met Val Ser Asp Thir Asn Arg Lieu. Trp Gln His 21 O 215 22O Tyr Lys Thr Thr Thr Glin Phe Llys Lieu. Asp Val Lieu Ser Leu Val Pro 225 23 O 235 24 O Thir Asp Lieu Ala Tyr Lieu Lys Val Gly. Thir Asn Tyr Pro Glu Val Arg 245 250 255 Phe Asn Arg Lieu Lleu Lys Phe Ser Arg Lieu. Phe Glu Phe Phe Asp Arg 26 O 265 27 O Thr Glu Thr Arg Thr Asn Tyr Pro Asn Met Phe Arg Ile Gly Asn Lieu. 27s 28O 285 Val Lieu. Tyr Ile Lieu. Ile Ile Ile His Trp Asn Ala Cys Ile Tyr Phe 29 O 295 3 OO

Ala Ile Ser Llys Phe Ile Gly Phe Gly Thr Asp Ser Trp Val Tyr Pro 3. OS 310 315 32O Asn. Ile Ser Ile Pro Glu. His Gly Arg Lieu. Ser Arg Llys Tyr Ile Tyr 3.25 330 335

Ser Leu Tyr Trp Ser Thr Lieu. Thir Lieu. Thir Thr Ile Gly Glu. Thr Pro 34 O 345 35. O

Pro Pro Val Lys Asp Glu Glu Tyr Lieu Phe Val Val Val Asp Phe Leu 355 360 365 US 2015/0259395 A1 Sep. 17, 2015 60

- Continued

Val Gly Val Lieu. Ile Phe Ala Thr Ile Val Gly Asn Val Gly Ser Met 37 O 375 38O Ile Ser Asn Met Asn Ala Ser Arg Ala Glu Phe Glin Ala Lys Ile Asp 385 390 395 4 OO Ser Ile Lys Glin Tyr Met Glin Phe Arg Llys Val Thir Lys Asp Lieu. Glu 4 OS 41O 415 Thir Arg Val Ile Arg Trp Phe Asp Tyr Lieu. Trp Ala Asn Llys Llys Thr 42O 425 43 O Val Asp Glu Lys Glu Val Lieu Lys Ser Lieu Pro Asp Llys Lieu Lys Ala 435 44 O 445 Glu Ile Ala Ile Asn. Wal His Lieu. Asp Thir Lieu Lys Llys Val Arg Ile 450 45.5 460 Phe Glin Asp Cys Glu Ala Gly Lieu. Lieu Val Glu Lieu Val Lieu Lys Lieu. 465 470 47s 48O Arg Pro Thr Val Phe Ser Pro Gly Asp Tyr Ile Cys Llys Lys Gly Asp 485 490 495 Ile Gly Lys Glu Met Tyr Ile Ile Asin Glu Gly Llys Lieu Ala Val Val SOO 505 51O Ala Asp Asp Gly Val Thr Glin Phe Val Val Lieu. Ser Asp Gly Ser Tyr 515 52O 525 Phe Gly Glu Ile Ser Ile Lieu. Asn. Ile Lys Gly Ser Llys Ser Gly Asn 53 O 535 54 O Arg Arg Thir Ala Asn. Ile Arg Ser Ile Gly Tyr Ser Asp Lieu. Phe Cys 5.45 550 555 560 Lieu. Ser Lys Asp Asp Lieu Met Glu Ala Lieu. Thr Glu Tyr Pro Glu Ala 565 st O sts Llys Lys Ala Lieu. Glu Glu Lys Gly Arg Glin Ile Lieu Met Lys Asp Asn 58O 585 59 O Lieu. Ile Asp Glu Glu Lieu Ala Arg Ala Gly Ala Asp Pro Lys Asp Lieu. 595 6OO 605 Glu Glu Lys Val Glu Gln Lieu. Gly Ser Ser Lieu. Asp Thr Lieu. Glin Thr 610 615 62O Arg Phe Ala Arg Lieu. Lieu Ala Glu Tyr Asn Ala Thr Gln Met Lys Met 625 630 635 64 O Lys Glin Arg Lieu. Ser Glin Lieu. Glu Ser Glin Val Lys Gly Gly Gly Asp 645 650 655 Llys Pro Lieu Ala Asp Gly Glu Val Pro Gly Asp Ala Thr Lys Thr Glu 660 665 67 O Asp Llys Glin Glin 675

<210s, SEQ ID NO 27 &211s LENGTH: 694 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 27 Met Ala Lys Ile Asn Thr Glin Tyr Ser His Pro Ser Arg Thr His Leu 1. 5 1O 15

Llys Val Llys Thir Ser Asp Arg Asp Lieu. Asn Arg Ala Glu Asn Gly Lieu. 2O 25 3O

Ser Arg Ala His Ser Ser Ser Glu Glu Thir Ser Ser Val Leu Gln Pro US 2015/0259395 A1 Sep. 17, 2015 61

- Continued

35 4 O 45 Gly Ile Ala Met Glu Thir Arg Gly Lieu Ala Asp Ser Gly Glin Gly Ser SO 55 6 O Phe Thr Gly Glin Gly Ile Ala Arg Lieu. Ser Arg Lieu. Ile Phe Lieu. Lieu. 65 70 7s 8O Arg Arg Trp Ala Ala Arg His Val His His Glin Asp Glin Gly Pro Asp 85 90 95 Ser Phe Pro Asp Arg Phe Arg Gly Ala Glu Lieu Lys Glu Val Ser Ser 1OO 105 11 O Glin Glu Ser Asn Ala Glin Ala Asn Val Gly Ser Glin Glu Pro Ala Asp 115 12 O 125 Arg Gly Arg Ser Ala Trp Pro Lieu Ala Lys Cys Asn. Thir Asn. Thir Ser 13 O 135 14 O Asn Asn Thr Glu Glu Glu Lys Llys Thir Lys Llys Lys Asp Ala Ile Val 145 150 155 160 Val Asp Pro Ser Ser Asn Lieu. Tyr Tyr Arg Trp Lieu. Thir Ala Ile Ala 1.65 17O 17s Lieu Pro Val Phe Tyr Asn Trp Tyr Lieu. Lieu. Ile Cys Arg Ala Cys Phe 18O 185 19 O Asp Glu Lieu. Glin Ser Glu Tyr Lieu Met Lieu. Trp Lieu Val Lieu. Asp Tyr 195 2OO 2O5 Ser Ala Asp Val Lieu. Tyr Val Lieu. Asp Val Lieu Val Arg Ala Arg Thr 210 215 220 Gly Phe Lieu. Glu Glin Gly Lieu Met Val Ser Asp Thr Asn Arg Lieu. Trp 225 23 O 235 24 O Gln His Tyr Lys Thr Thr Thr Glin Phe Llys Lieu. Asp Val Lieu. Ser Lieu. 245 250 255 Val Pro Thr Asp Leu Ala Tyr Lieu Lys Val Gly Thr Asn Tyr Pro Glu 26 O 265 27 O Val Arg Phe Asn Arg Lieu Lleu Lys Phe Ser Arg Lieu. Phe Glu Phe Phe 27s 28O 285 Asp Arg Thr Glu Thr Arg Thr Asn Tyr Pro Asn Met Phe Arg Ile Gly 29 O 295 3 OO Asn Lieu Val Lieu. Tyr Ile Lieu. Ile Ile Ile His Trp Asn Ala Cys Ile 3. OS 310 315 32O Tyr Phe Ala Ile Ser Lys Phe Ile Gly Phe Gly Thr Asp Ser Trp Val 3.25 330 335 Tyr Pro Asn Ile Ser Ile Pro Glu. His Gly Arg Lieu Ser Arg Llys Tyr 34 O 345 35. O Ile Tyr Ser Leu Tyr Trp Ser Thr Lieu. Thir Lieu. Thir Thr Ile Gly Glu 355 360 365

Thr Pro Pro Pro Val Lys Asp Glu Glu Tyr Lieu Phe Val Val Val Asp 37 O 375 38O

Phe Leu Val Gly Val Lieu. Ile Phe Ala Thr Ile Val Gly Asn Val Gly 385 390 395 4 OO

Ser Met Ile Ser Asn Met Asn Ala Ser Arg Ala Glu Phe Glin Ala Lys 4 OS 41O 415

Ile Asp Ser Ile Lys Glin Tyr Met Glin Phe Arg Llys Val Thir Lys Asp 42O 425 43 O

Lieu. Glu Thir Arg Val Ile Arg Trp Phe Asp Tyr Lieu. Trp Ala Asn Lys 435 44 O 445 US 2015/0259395 A1 Sep. 17, 2015 62

- Continued

Llys Thr Val Asp Glu Lys Glu Val Lieu Lys Ser Lieu Pro Asp Llys Lieu. 450 45.5 460 Lys Ala Glu Ile Ala Ile Asn. Wal His Lieu. Asp Thir Lieu Lys Llys Val 465 470 47s 48O Arg Ile Phe Glin Asp Cys Glu Ala Gly Lieu. Lieu Val Glu Lieu Val Lieu 485 490 495 Llys Lieu. Arg Pro Thr Val Phe Ser Pro Gly Asp Tyr Ile Cys Llys Llys SOO 505 51O Gly Asp Ile Gly Lys Glu Met Tyr Ile Ile Asn. Glu Gly Lys Lieu Ala 515 52O 525 Val Val Ala Asp Asp Gly Val Thr Glin Phe Val Val Lieu. Ser Asp Gly 53 O 535 54 O Ser Tyr Phe Gly Glu Ile Ser Ile Lieu. Asn Ile Lys Gly Ser Lys Ser 5.45 550 555 560 Gly Asn Arg Arg Thr Ala Asn. Ile Arg Ser Ile Gly Tyr Ser Asp Lieu. 565 st O sts Phe Cys Lieu. Ser Lys Asp Asp Lieu Met Glu Ala Lieu. Thr Glu Tyr Pro 58O 585 59 O Glu Ala Lys Lys Ala Lieu. Glu Glu Lys Gly Arg Glin Ile Lieu Met Lys 595 6OO 605 Asp Asn Lieu. Ile Asp Glu Glu Lieu Ala Arg Ala Gly Ala Asp Pro Llys 610 615 62O Asp Lieu. Glu Glu Lys Val Glu Gln Lieu. Gly Ser Ser Lieu. Asp Thir Lieu 625 630 635 64 O Glin Thr Arg Phe Ala Arg Lieu. Lieu Ala Glu Tyr Asn Ala Thr Gln Met 645 650 655 Llys Met Lys Glin Arg Lieu. Ser Glin Lieu. Glu Ser Glin Val Lys Gly Gly 660 665 67 O Gly Asp Llys Pro Lieu Ala Asp Gly Glu Val Pro Gly Asp Ala Thir Lys 675 68O 685 Thr Glu Asp Llys Glin Glin 69 O.

<210s, SEQ ID NO 28 &211s LENGTH: 354 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 28 Met Gly Ser Gly Ala Ser Ala Glu Asp Llys Glu Lieu Ala Lys Arg Ser 1. 5 1O 15 Lys Glu Lieu. Glu Lys Llys Lieu. Glin Glu Asp Ala Asp Llys Glu Ala Lys 2O 25 3O

Thr Val Llys Lieu Lleu Lleu Lieu. Gly Ala Gly Glu Ser Gly Lys Ser Thr 35 4 O 45 Ile Val Lys Gln Met Lys Ile Ile His Glin Asp Gly Tyr Ser Pro Glu SO 55 6 O

Glu Cys Lieu. Glu Phe Lys Ala Ile Ile Tyr Gly Asn Val Lieu. Glin Ser 65 70 7s 8O

Ile Lieu Ala Ile Ile Arg Ala Met Thir Thr Lieu. Gly Ile Asp Tyr Ala 85 90 95

Glu Pro Ser Cys Ala Asp Asp Gly Arg Glin Lieu. Asn. Asn Lieu Ala Asp US 2015/0259395 A1 Sep. 17, 2015 63

- Continued

1OO 105 11 O Ser Ile Glu Glu Gly Thr Met Pro Pro Glu Lieu Val Glu Val Ile Arg 115 12 O 125 Arg Lieu. Trp Lys Asp Gly Gly Val Glin Ala Cys Phe Glu Arg Ala Ala 13 O 135 14 O Glu Tyr Glin Lieu. Asn Asp Ser Ala Ser Tyr Tyr Lieu. Asn Glin Lieu. Glu 145 150 155 160 Arg Ile Thir Asp Pro Glu Tyr Lieu Pro Ser Glu Glin Asp Val Lieu. Arg 1.65 17O 17s Ser Arg Val Lys Thr Thr Gly Ile Ile Glu Thir Lys Phe Ser Val Lys 18O 185 19 O Asp Lieu. Asn. Phe Arg Met Phe Asp Val Gly Gly Glin Arg Ser Glu Arg 195 2OO 2O5 Lys Llys Trp Ile His Cys Phe Glu Gly Val Thr Cys Ile Ile Phe Cys 21 O 215 22O Ala Ala Lieu. Ser Ala Tyr Asp Met Val Lieu Val Glu Asp Asp Glu Val 225 23 O 235 24 O Asn Arg Met His Glu Ser Lieu. His Lieu. Phe Asn. Ser Ile Cys Asn His 245 250 255 Llys Phe Phe Ala Ala Thir Ser Ile Val Lieu. Phe Lieu. Asn Llys Lys Asp 26 O 265 27 O Lieu. Phe Glu Glu Lys Ile Llys Llys Val His Lieu. Ser Ile Cys Phe Pro 275 28O 285 Glu Tyr Asp Gly Asn. Asn. Ser Tyr Asp Asp Ala Gly Asn Tyr Ile Llys 29 O 295 3 OO Ser Glin Phe Lieu. Asp Lieu. Asn Met Arg Lys Asp Wall Lys Glu Ile Tyr 3. OS 310 315 32O Ser His Met Thr Cys Ala Thr Asp Thr Glin Asn Val Llys Phe Val Phe 3.25 330 335 Asp Ala Val Thr Asp Ile Ile Ile Lys Glu Asn Lieu Lys Asp Cys Gly 34 O 345 35. O

Leul Phe

<210s, SEQ ID NO 29 &211s LENGTH: 858 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 29 Met Gly Glu Ile Asn Glin Val Ala Val Glu Lys Tyr Lieu. Glu Glu Asn 1. 5 1O 15 Pro Glin Phe Ala Lys Glu Tyr Phe Asp Arg Llys Lieu. Arg Val Glu Val 2O 25 3O

Lieu. Gly Glu Ile Phe Lys Asn Ser Glin Val Pro Val Glin Ser Ser Met 35 4 O 45

Ser Phe Ser Glu Lieu. Thr Glin Val Glu Glu Ser Ala Lieu. Cys Lieu. Glu SO 55 6 O

Lieu. Leu Trp Thr Val Glin Glu Glu Gly Gly Thr Pro Glu Glin Gly Val 65 70 7s 8O His Arg Ala Lieu. Glin Arg Lieu Ala His Lieu. Lieu. Glin Ala Asp Arg Cys 85 90 95

Ser Met Phe Lieu. Cys Arg Ser Arg Asn Gly Ile Pro Glu Val Ala Ser US 2015/0259395 A1 Sep. 17, 2015 64

- Continued

1OO 105 11 O Arg Lieu. Lieu. Asp Val Thr Pro Thir Ser Llys Phe Glu Asp Asn Lieu Val 115 12 O 125 Gly Pro Asp Llys Glu Val Val Phe Pro Lieu. Asp Ile Gly Ile Val Gly 13 O 135 14 O Trp Ala Ala His Thr Llys Llys Thr His Asn Val Pro Asp Wall Lys Llys 145 150 155 160 Asn Ser His Phe Ser Asp Phe Met Asp Llys Glin Thr Gly Tyr Val Thr 1.65 17O 17s Lys Asn Lieu. Lieu Ala Thr Pro Ile Val Val Gly Lys Glu Val Lieu Ala 18O 185 19 O Val Ile Met Ala Val Asn Llys Val Asn Ala Ser Glu Phe Ser Lys Glin 195 2OO 2O5 Asp Glu Glu Val Phe Ser Llys Tyr Lieu. Asn. Phe Val Ser Ile Ile Lieu 21 O 215 22O Arg Lieu. His His Thr Ser Tyr Met Tyr Asn Ile Glu Ser Arg Arg Ser 225 23 O 235 24 O Glin Ile Lieu Met Trp Ser Ala Asn Llys Val Phe Glu Glu Lieu. Thir Asp 245 250 255 Val Glu Arg Glin Phe His Lys Ala Lieu. Tyr Thr Val Arg Ser Tyr Lieu 26 O 265 27 O Asn. Cys Glu Arg Tyr Ser Ile Gly Lieu. Lieu. Asp Met Thr Lys Glu Lys 275 28O 285 Glu Phe Tyr Asp Glu Trp Pro Ile Llys Lieu. Gly Glu Val Glu Pro Tyr 29 O 295 3 OO Lys Gly Pro Llys Thr Pro Asp Gly Arg Glu Val Asn. Phe Tyr Lys Ile 3. OS 310 315 32O Ile Asp Tyr Ile Lieu. His Gly Lys Glu Glu Ile Llys Val Ile Pro Thr 3.25 330 335 Pro Pro Ala Asp His Trp Thr Lieu. Ile Ser Gly Lieu Pro Thr Tyr Val 34 O 345 35. O Ala Glu Asn Gly Phe Ile Cys Asn Met Met Asn Ala Pro Ala Asp Glu 355 360 365 Tyr Phe Thr Phe Gln Lys Gly Pro Val Asp Glu Thr Gly Trp Val Ile 37 O 375 38O Lys Asn Val Lieu. Ser Lieu Pro Ile Val Asn Llys Lys Glu Asp Ile Val 385 390 395 4 OO Gly Val Ala Thr Phe Tyr Asn Arg Lys Asp Gly Llys Pro Phe Asp Glu 4 OS 41O 415 His Asp Glu Tyr Ile Thr Glu Thir Lieu. Thr Glin Phe Leu Gly Trp Ser 42O 425 43 O

Lieu. Lieu. Asn. Thir Asp Thr Tyr Asp Llys Met Asn Llys Lieu. Glu Asn Arg 435 44 O 445

Lys Asp Ile Ala Glin Glu Met Lieu Met Asn Glin Thr Lys Ala Thr Pro 450 45.5 460

Glu Glu Ile Llys Ser Ile Lieu Lys Phe Glin Glu Lys Lieu. Asn. Wall Asp 465 470 47s 48O

Val Ile Asp Asp Cys Glu Glu Lys Glin Lieu Val Ala Ile Lieu Lys Glu 485 490 495

Asp Lieu Pro Asp Pro Arg Ser Ala Glu Lieu. Tyr Glu Phe Arg Phe Ser SOO 505 51O US 2015/0259395 A1 Sep. 17, 2015 65

- Continued

Asp Phe Pro Lieu. Thr Glu. His Gly Lieu. Ile Lys Cys Gly Ile Arg Lieu 515 52O 525 Phe Phe Glu Ile Asn Val Val Glu Lys Phe Llys Val Pro Val Glu Val 53 O 535 54 O Lieu. Thir Arg Trp Met Tyr Thr Val Arg Lys Gly Tyr Arg Ala Val Thr 5.45 550 555 560 Tyr His Asn Trp Arg His Gly Phe Asin Val Gly Glin Thr Met Phe Thr 565 st O sts Lieu. Lieu Met Thr Gly Arg Lieu Lys Llys Tyr Tyr Thr Asp Lieu. Glu Ala 58O 585 59 O Phe Ala Met Lieu Ala Ala Ala Phe Cys His Asp Ile Asp His Arg Gly 595 6OO 605 Thir Asn. Asn Lieu. Tyr Glin Met Lys Ser Thir Ser Pro Lieu Ala Arg Lieu. 610 615 62O His Gly Ser Ser Ile Lieu. Glu Arg His His Leu Glu Tyr Ser Lys Thr 625 630 635 64 O Lieu. Lieu. Glin Asp Glu Ser Lieu. Asn. Ile Phe Glin Asn Lieu. Asn Lys Arg 645 650 655

Glin Phe Glu. Thir Wall Ile His Lieu. Phe Glu Wall Ala Ile Ile Ala Thr 660 665 67 O Asp Lieu Ala Lieu. Tyr Phe Llys Lys Arg Thr Met Phe Gln Lys Ile Val 675 68O 685 Asp Ala Cys Glu Gln Met Glin Thr Glu Glu Glu Ala Ile Llys Tyr Val 69 O. 695 7 OO Thr Val Asp Pro Thr Lys Lys Glu Ile Ile Met Ala Met Met Met Thr 7 Os 71O 71s 72O Ala Cys Asp Lieu. Ser Ala Ile Thr Llys Pro Trp Glu Val Glin Ser Glin 72 73 O 73 Val Ala Lieu Met Val Ala Asn. Glu Phe Trp Glu Glin Gly Asp Lieu. Glu 740 74. 7 O Arg Thr Val Lieu. Glin Glin Glin Pro Ile Pro Met Met Asp Arg Asn Lys 7ss 760 765 Arg Asp Glu Lieu Pro Llys Lieu. Glin Val Gly Phe Ile Asp Phe Val Cys 770 775 78O Thr Phe Val Tyr Lys Glu Phe Ser Arg Phe His Lys Glu Ile Thr Pro 78s 79 O 79. 8OO Met Lieu. Ser Gly Lieu. Glin Asn. Asn Arg Val Glu Trp Llys Ser Lieu Ala 805 810 815 Asp Glu Tyr Asp Ala Lys Met Llys Val Ile Glu Glu Glu Ala Lys Llys 82O 825 83 O Glin Glu Gly Gly Ala Glu Lys Ala Ala Glu Asp Ser Gly Gly Gly Asp 835 84 O 845

Asp Llys Llys Ser Llys Thr Cys Lieu Met Lieu 850 855

<210s, SEQ ID NO 3 O &211s LENGTH: 83 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 30 Met Ser Asp Asn Thr Thr Lieu Pro Ala Pro Ala Ser Asn Glin Gly Pro US 2015/0259395 A1 Sep. 17, 2015 66

- Continued

1. 5 1O 15 Thir Thr Pro Arg Lys Gly Pro Pro Llys Phe Lys Glin Arg Glin Thr Arg 2O 25 3O Glin Phe Llys Ser Llys Pro Pro Llys Lys Gly Val Lys Gly Phe Gly Asp 35 4 O 45 Asp Ile Pro Gly Met Glu Gly Lieu. Gly Thr Asp Ile Thr Val Ile Cys SO 55 6 O Pro Trp Glu Ala Phe Ser His Lieu. Glu Lieu. His Glu Lieu Ala Glin Phe 65 70 7s 8O Gly Ile Ile

<210s, SEQ ID NO 31 &211s LENGTH: 299 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 31 Met Met Ala Tyr Met Asn Pro Gly Pro His Tyr Ser Val Asn Ala Leu 1. 5 1O 15 Ala Leu Ser Gly Pro Ser Val Asp Leu Met His Glin Ala Val Pro Tyr 2O 25 3O Pro Ser Ala Pro Arg Lys Glin Arg Arg Glu Arg Thir Thr Phe Thr Arg 35 4 O 45 Ser Gln Lieu. Glu Glu Lieu. Glu Ala Lieu Phe Ala Lys Thr Glin Tyr Pro SO 55 6 O Asp Val Tyr Ala Arg Glu Glu Val Ala Lieu Lys Ile Asn Lieu Pro Glu 65 70 7s 8O Ser Arg Val Glin Val Trp Phe Lys Asn Arg Arg Ala Lys Cys Arg Glin 85 90 95 Glin Arg Glin Glin Glin Lys Glin Glin Glin Glin Pro Pro Gly Gly Glin Ala 1OO 105 11 O Lys Ala Arg Pro Ala Lys Arg Lys Ala Gly. Thir Ser Pro Arg Pro Ser 115 12 O 125 Thr Asp Val Cys Pro Asp Pro Leu Gly Ile Ser Asp Ser Tyr Ser Pro 13 O 135 14 O Pro Leu Pro Gly Pro Ser Gly Ser Pro Thr Thr Ala Val Ala Thr Val 145 150 155 160 Ser Ile Trp Ser Pro Ala Ser Glu Ser Pro Leu Pro Glu Ala Glin Arg 1.65 17O 17s Ala Gly Lieu Val Ala Ser Gly Pro Ser Lieu. Thir Ser Ala Pro Tyr Ala 18O 185 19 O Met Thr Tyr Ala Pro Ala Ser Ala Phe Cys Ser Ser Pro Ser Ala Tyr 195 2OO 2O5

Gly Ser Pro Ser Ser Tyr Phe Ser Gly Lieu. Asp Pro Tyr Lieu. Ser Pro 21 O 215 22O

Met Val Pro Gln Leu Gly Gly Pro Ala Leu Ser Pro Leu Ser Gly Pro 225 23 O 235 24 O

Ser Val Gly Pro Ser Leu Ala Glin Ser Pro Thr Ser Leu Ser Gly Glin 245 250 255

Ser Tyr Gly Ala Tyr Ser Pro Val Asp Ser Lieu. Glu Phe Lys Asp Pro 26 O 265 27 O

Thr Gly. Thir Trp Llys Phe Thr Tyr Asn Pro Met Asp Pro Leu. Asp Tyr US 2015/0259395 A1 Sep. 17, 2015 67

- Continued

27s 28O 285 Lys Asp Glin Ser Ala Trp Llys Phe Glin Ile Lieu. 29 O 295

<210s, SEQ ID NO 32 &211s LENGTH: 809 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 32 Met Phe Llys Ser Lieu. Thir Lys Val Asn Llys Val Llys Pro Ile Gly Glu 1. 5 1O 15 Asn Asn. Glu Asn. Glu Glin Ser Ser Arg Arg Asn. Glu Glu Gly Ser His 2O 25 3O Pro Ser Asn Glin Ser Glin Gln Thr Thr Ala Glin Glu Glu Asn Lys Gly 35 4 O 45 Glu Glu Lys Ser Lieu Lys Thr Lys Ser Thr Pro Val Thr Ser Glu Glu SO 55 6 O Pro His Thr Asn. Ile Glin Asp Llys Lieu. Ser Lys Lys Asn. Ser Ser Gly 65 70 7s 8O Asp Lieu. Thir Thr Asn Pro Asp Pro Glin Asn Ala Ala Glu Pro Thr Gly 85 90 95 Thr Val Pro Glu Gln Lys Glu Met Asp Pro Gly Lys Glu Gly Pro Asn 1OO 105 11 O Ser Pro Glin Asn Llys Pro Pro Ala Ala Pro Val Ile Asn Glu Tyr Ala 115 12 O 125 Asp Ala Glin Lieu. His Asn Lieu Val Lys Arg Met Arg Glin Arg Thr Ala 13 O 135 14 O Lieu. Tyr Lys Llys Llys Lieu Val Glu Gly Asp Lieu. Ser Ser Pro Glu Ala 145 150 155 160 Ser Pro Gln Thr Ala Lys Pro Thr Ala Val Pro Pro Val Lys Glu Ser 1.65 17O 17s Asp Asp Llys Pro Thr Glu. His Tyr Tyr Arg Lieu Lleu Trp Phe Llys Val 18O 185 19 O Llys Llys Met Pro Lieu. Thr Glu Tyr Lieu Lys Arg Ile Llys Lieu Pro Asn 195 2OO 2O5 Ser Ile Asp Ser Tyr Thr Asp Arg Lieu. Tyr Lieu Lleu Trp Lieu. Lieu. Lieu. 21 O 215 22O Val Thir Lieu Ala Tyr Asn Trp Asn. Cys Trp Phe Ile Pro Lieu. Arg Lieu 225 23 O 235 24 O Val Phe Pro Tyr Glin Thr Ala Asp Asn Ile His Tyr Trp Lieu. Ile Ala 245 250 255 Asp Ile Ile Cys Asp Ile Ile Tyr Lieu. Tyr Asp Met Lieu. Phe Ile Glin 26 O 265 27 O

Pro Arg Lieu. Glin Phe Val Arg Gly Gly Asp Ile Ile Val Asp Ser Asn 27s 28O 285 Glu Lieu. Arg Llys His Tyr Arg Thir Ser Thr Llys Phe Glin Lieu. Asp Wall 29 O 295 3 OO

Ala Ser Ile Ile Pro Phe Asp Ile Cys Tyr Lieu Phe Phe Gly Phe Asn 3. OS 310 315 32O

Pro Met Phe Arg Ala Asn Arg Met Leu Lys Tyr Thr Ser Phe Phe Glu 3.25 330 335 US 2015/0259395 A1 Sep. 17, 2015 68

- Continued Phe Asn His His Lieu. Glu Ser Ile Met Asp Lys Ala Tyr Ile Tyr Arg 34 O 345 35. O Val Ile Arg Thr Thr Gly Tyr Lieu. Leu Phe Ile Lieu. His Ile Asn Ala 355 360 365 Cys Val Tyr Tyr Trp Ala Ser Asn Tyr Glu Gly Ile Gly Thr Thr Arg 37 O 375 38O Trp Val Tyr Asp Gly Glu Gly Asn. Glu Tyr Lieu. Arg Cys Tyr Tyr Trp 385 390 395 4 OO Ala Val Arg Thr Lieu. Ile Thir Ile Gly Gly Leu Pro Glu Pro Glin Thr 4 OS 41O 415 Lieu. Phe Glu Ile Val Phe Gln Leu Lieu. Asn Phe Phe Ser Gly Val Phe 42O 425 43 O Val Phe Ser Ser Lieu. Ile Gly Glin Met Arg Asp Val Ile Gly Ala Ala 435 44 O 445 Thir Ala Asn Glin Asn Tyr Phe Arg Ala Cys Met Asp Asp Thir Ile Ala 450 45.5 460 Tyr Met Asn. Asn Tyr Ser Ile Pro Llys Lieu Val Glin Lys Arg Val Arg 465 470 47s 48O Thir Trp Tyr Glu Tyr Thir Trp Asp Ser Glin Arg Met Lieu. Asp Glu Ser 485 490 495 Asp Lieu. Lieu Lys Thr Lieu Pro Thir Thr Val Glin Lieu Ala Lieu Ala Ile SOO 505 51O Asp Val ASn Phe Ser Ile Ile Ser Llys Val Asp Lieu Phe Lys Gly Cys 515 52O 525 Asp Thr Gln Met Ile Tyr Asp Met Lieu. Lieu. Arg Lieu Lys Ser Val Lieu 53 O 535 54 O Tyr Lieu Pro Gly Asp Phe Val Cys Llys Lys Gly Glu Ile Gly Lys Glu 5.45 550 555 560 Met Tyr Ile Ile Llys His Gly Glu Val Glin Val Lieu. Gly Gly Pro Asp 565 st O sts Gly. Thir Lys Val Lieu Val Thir Lieu Lys Ala Gly Ser Val Phe Gly Glu 58O 585 59 O Ile Ser Lieu. Lieu Ala Ala Gly Gly Gly Asn Arg Arg Thr Ala Asn Val 595 6OO 605 Val Ala His Gly Phe Ala Asn Lieu. Lieu. Thir Lieu. Asp Llys Llys Thir Lieu 610 615 62O Glin Glu Ile Lieu Val His Tyr Pro Asp Ser Glu Arg Ile Lieu Met Lys 625 630 635 64 O Lys Ala Arg Val Lieu Lleu Lys Glin Lys Ala Lys Thr Ala Glu Ala Thr 645 650 655 Pro Pro Arg Lys Asp Lieu Ala Lieu. Lieu. Phe Pro Pro Llys Glu Glu Thir 660 665 67 O

Pro Llys Lieu. Phe Llys Thr Lieu. Lieu. Gly Gly Thr Gly Lys Ala Ser Lieu. 675 68O 685

Ala Arg Lieu. Lieu Lys Lieu Lys Arg Glu Glin Ala Ala Glin Llys Lys Glu 69 O. 695 7 OO

Asn Ser Glu Gly Gly Glu Glu Glu Gly Lys Glu Asn. Glu Asp Llys Glin 7 Os 71O 71s 72O

Lys Glu Asn. Glu Asp Llys Gln Lys Glu Asn. Glu Asp Llys Gly Lys Glu 72 73 O 73

Asn Glu Asp Lys Asp Llys Gly Arg Glu Pro Glu Glu Lys Pro Lieu. Asp US 2015/0259395 A1 Sep. 17, 2015 69

- Continued

740 74. 7 O Arg Pro Glu. Cys Thr Ala Ser Pro Ile Ala Val Glu Glu Glu Pro His 7ss 760 765 Ser Val Arg Arg Thr Val Lieu Pro Arg Gly. Thir Ser Arg Glin Ser Lieu. 770 775 78O Ile Ile Ser Met Ala Pro Ser Ala Glu Gly Gly Glu Glu Val Lieu. Thr 78s 79 O 79. 8OO Ile Glu Val Lys Glu Lys Ala Lys Glin 805

<210s, SEQ ID NO 33 &211s LENGTH: 610 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 33 Met Pro Lieu. Thr Glu Tyr Lieu Lys Arg Ile Llys Lieu Pro Asn. Ser Ile 1. 5 1O 15 Asp Ser Tyr Thr Asp Arg Lieu. Tyr Lieu. Lieu. Trp Lieu Lleu Lieu Val Thr 2O 25 3O Lieu Ala Tyr Asn Trp Asn. Cys Cys Phe Ile Pro Lieu. Arg Lieu Val Phe 35 4 O 45 Pro Tyr Glin Thir Ala Asp Asn. Ile His Tyr Trp Lieu. Ile Ala Asp Ile SO 55 6 O Ile Cys Asp Ile Ile Tyr Lieu. Tyr Asp Met Leu Phe Ile Glin Pro Arg 65 70 7s 8O Lieu. Glin Phe Val Arg Gly Gly Asp Ile Ile Val Asp Ser Asn. Glu Lieu. 85 90 95 Arg Llys His Tyr Arg Thr Ser Thr Llys Phe Glin Lieu. Asp Val Ala Ser 1OO 105 11 O Ile Ile Pro Phe Asp Ile Cys Tyr Lieu. Phe Phe Gly Phe Asin Pro Met 115 12 O 125 Phe Arg Ala Asn Arg Met Leu Lys Tyr Thr Ser Phe Phe Glu Phe Asn 13 O 135 14 O His His Lieu. Glu Ser Ile Met Asp Lys Ala Tyr Ile Tyr Arg Val Ile 145 150 155 160 Arg Thr Thr Gly Tyr Lieu. Leu Phe Ile Lieu. His Ile Asn Ala Cys Val 1.65 17O 17s Tyr Tyr Trp Ala Ser Asn Tyr Glu Gly Ile Gly Thr Thr Arg Trp Val 18O 185 19 O Tyr Asp Gly Glu Gly Asn. Glu Tyr Lieu. Arg Cys Tyr Tyr Trp Ala Val 195 2OO 2O5 Arg Thr Lieu. Ile Thr Ile Gly Gly Lieu Pro Glu Pro Gln Thr Lieu. Phe 21 O 215 22O

Glu Ile Val Phe Gln Leu Lleu. Asn Phe Phe Ser Gly Val Phe Val Phe 225 23 O 235 24 O

Ser Ser Lieu. Ile Gly Glin Met Arg Asp Val Ile Gly Ala Ala Thr Ala 245 250 255

Asn Glin Asn Tyr Phe Arg Ala Cys Met Asp Asp Thir Ile Ala Tyr Met 26 O 265 27 O

Asn Asn Tyr Ser Ile Pro Llys Lieu Val Glin Lys Arg Val Arg Thir Trip 27s 28O 285 US 2015/0259395 A1 Sep. 17, 2015 70

- Continued Tyr Glu Tyr Thir Trp Asp Ser Glin Arg Met Lieu. Asp Glu Ser Asp Lieu. 29 O 295 3 OO Lieu Lys Thr Lieu Pro Thir Thr Val Glin Lieu Ala Lieu Ala Ile Asp Wall 3. OS 310 315 32O Asn Phe Ser Ile Ile Ser Llys Val Asp Lieu. Phe Lys Gly Cys Asp Thr 3.25 330 335 Glin Met Ile Tyr Asp Met Lieu. Lieu. Arg Lieu Lys Ser Val Lieu. Tyr Lieu. 34 O 345 35. O Pro Gly Asp Phe Val Cys Llys Lys Gly Glu Ile Gly Lys Glu Met Tyr 355 360 365 Ile Ile Llys His Gly Glu Val Glin Val Lieu. Gly Gly Pro Asp Gly Thr 37 O 375 38O Llys Val Lieu Val Thir Lieu Lys Ala Gly Ser Val Lieu. Lieu Ala Ala Gly 385 390 395 4 OO Gly Gly Asn Arg Arg Thr Ala Asn Val Val Ala His Gly Phe Ala Asn 4 OS 41O 415 Lieu. Lieu. Thir Lieu. Asp Llys Llys Thr Lieu. Glin Glu Ile Lieu Val His Tyr 42O 425 43 O Pro Asp Ser Glu Arg Ile Lieu Met Lys Lys Ala Arg Val Lieu. Lieu Lys 435 44 O 445 Glin Lys Ala Lys Thr Ala Glu Ala Thr Pro Pro Arg Lys Asp Lieu Ala 450 45.5 460 Lieu Lieu Phe Pro Pro Llys Glu Glu Thr Pro Llys Lieu Phe Llys Thir Lieu 465 470 47s 48O Lieu. Gly Gly. Thr Gly Lys Ala Ser Lieu Ala Arg Lieu Lleu Lys Lieu Lys 485 490 495 Arg Glu Glin Ala Ala Glin Llys Lys Glu Asn. Ser Glu Gly Gly Glu Glu SOO 505 51O Glu Gly Lys Glu Asn. Glu Asp Llys Gln Lys Glu Asn. Glu Asp Llys Glin 515 52O 525 Lys Glu Asn. Glu Asp Llys Gly Lys Glu Asn. Glu Asp Lys Asp Llys Gly 53 O 535 54 O Arg Glu Pro Glu Glu Lys Pro Lieu. Asp Arg Pro Glu. Cys Thr Ala Ser 5.45 550 555 560 Pro Ile Ala Val Glu Glu Glu Pro His Ser Val Arg Arg Thr Val Lieu. 565 st O sts Pro Arg Gly Thr Ser Arg Glin Ser Lieu. Ile Ile Ser Met Ala Pro Ser 58O 585 59 O Ala Glu Gly Gly Glu Glu Val Lieu. Thir Ile Glu Wall Lys Glu Lys Ala 595 6OO 605 Lys Glin 610

<210s, SEQ ID NO 34 &211s LENGTH: 71OO &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 34 gacatactga gaataaatcc aaaga catta gtttctittgc acgaaatgag gttacatatic 6 O cagtgacatt tatttgagct atttaaacaa cittaalacatc tttittcttitt cittaataagg 12 O gacgtttcaa gttgtggit ct cagccaaaat gag tdatacc cct tc tact g gtttitt.ccat 18O

US 2015/0259395 A1 Sep. 17, 2015 72

- Continued aggacttitta accaaaagaa aatctagat.c actaaataaa ataagct tag gag caccitaa 252O aaaaagagaa atcggtcaaa gagataaagt gtttcct cac aatgaatcta aatattgcaa. 2580 aagtacttitt gaaaacaaaa gtttattt ca totatttaac atccttgagc aaaaaccolaa 264 O agatttitt at gcaccgcaat Ctcaa.gcaga agtggcatct ggg tatttga gaggaatggc 27 OO aaagaagagt ttagtttcaa aagttactga t t cacacata actittaaaaa goc agaaaaa 276 O acgtaaaggg gataaagtga aagcaagtgc tattittalagt aaacaac atg Ctacaiaccag 282O ggcaaattct ttagcttctt togaaaaaacc tdattitt colt gaggctattg ct cat catt c 288O aattcaaaat tatatacaga gttggttgca gaa cataaat ccatat ccaa ctittaaag.cc 294 O tataaaatca gct coagtat gtagaaatga aacgagtgtg gtaaattgta gcaataatag 3 OOO tttitt caggg aatgat cocc atacaaattic tdgaaaaata agtaattittg titatggaaag 3 O 6 O taataagcac atalactaaaa ttgc.cggittt gaCaggagat aatctatgta aagagggaga 312 O taagttcttitt attgccaatg acactggtga agaagat citc catgagacac aggttggat C 318O tctgaatgat gct tatttgg titc.ccctgca tdaac actgt actttgtcac agt cagotat 324 O taatgat cat aatactaaaa gttcatatago togctgaaaaa totaggaccag agaaaaaact 33 OO tgtttaccag gaaataalacc tagctagaaa aaggcaaagt gtagaggct g c cattcaagt 3360 agat cotata gaagaggaaa citccaaaaga cct cittacca gtc.ctgatgc titcaccalatt 342O gcaa.gctt Ca gttcCtggta t t cacalagac to agaatgga gttgttcaaa ticCaggitt C 3480 acttgcaggt gttc.cc tittc attctgcaat atgtaattica tocactaatc. tcc ttctago 354 O ttggct Cttg gtgctaalacc taaagggaag tatgaatagc titctgtcaag ttgatgctica 36OO caaggctacc aacaaatctt cagaalacact togcattgttg gagattictaa agcacatagc 366 O tat cacagag gaagctgatg acttgaaagc tigctgttgcc aatttagtgg agt caactac 372 O aagccactitt ggacticagtg agaaagaa.ca agacatggitt ccaatagat c tittctgcaaa 378 O ttgttccacg gtcaac attic agagtgttcc taagtgcagt gaaaatgaaa galacaca agg 384 O aatcto ct ct ttggatggag gttgctctgc cagtgaggca ttgc.ccctgaagtctgttgt 3900 tittggaagtg acttgctic to catgtgagat gtgcactgta aataaggctt attct coaaa 396 O agagacatgt aac Cocagtg acacttittitt t cc tagtgat ggittatggtg tdgat Cagac 4 O2O ttctatgaat aaggcttgtt toctaggaga gqtctgttca citt actgata citgtgttitt c 4 O8O tgataaggct ttgct caaa aggagaacca tacct atgag ggagcttgcc caattgatga 414 O gacctacgitt cotgtcaatgtctgcaatac cattgactitt ttaaact coa aagaaaacac 42OO at at actgat a acttggatt Caactgaaga gttagaaaga ggtgatgaca tt Cagaaaga 426 O tctaaatatt ttgacagacc ctdaatataa aaatggattit aatacattgg tdt cacatca 432O aaatgtcagt aatttalagct cctgtggcct ttgcc talagt gaaaaagaag Cagaacttga 438 O taagaaac at agttctictag atgattittga aaattgttca citaaggaagt ttcaggatga 4 44 O aaatgcatat act tcc tittg atatggaaga accacgg act tctgaagaac caggct caat 4500 aaccaa.ca.gc atgacatcaa gtgaaagaaa cattt cagaa ttggaat citt ttgaagaatt 456 O agaaaaccat gacactgata t ctittaatac agtggtaaat ggaggagagc aagcc actga 462O agaattaatc Caagaagagg tagaggctag taaaactitta gaattgatag acatctotag 468O taagaatatt atggaagaaa aaagaatgaa cigtataatt tatgaaataa t cagtaagag 474. O US 2015/0259395 A1 Sep. 17, 2015 73

- Continued gctggcaa.ca ccaccatctt tagatttittg c tatgattct aagcaaaata gtgaaaagga 48OO gaccalatgaa ggagaalacta agatggtaala aatgatggtg aaaactatgg aaactggaag 486 O ttatt cagag toctict cotg atttaaaaaa atgcatcaaa agt ccagtga cittctgattg 492 O gtcagact at C9gcctgaca gtgacagtga gcagc catat aaaac at CC a gtgatgatcC 498O Caatgacagt ggcgaactta cccaa.gagaa agaatataac at aggatttgttaaaagggc 5040 aatagaaaaa citgitacggta aag cagatat tat caaacca totttittitt c ctdggtctac 51OO cc.gcaaatct caggtttgtc. cittataattic tdtggaattt cagtgttcca ggaaagcaa.g 516 O tott tatgat tctgaagggc agt catttgg ct cittctgaa caggitat ct a gtagttcatc 522 O tatgttgcag gaattic Cagg aggaaagaca agataagtgt gatgttagtg Ctgtgaggga 528 O

Caattattgt aggggtgaca ttgtagalacc tigtacaaaa caaaatgatg at agcagaat 534 O

Ccticacagac atagaggaag gag tactgat tacaaaggc aaatggctt C taaagaaaa 54 OO t catttgcta aggatgtcat citcaaaatcc tdgcatgtgt gigcaatgcag acaccacatc 546 O agtggacacic ct acttgata ataacagoag tdagg tacca tattolacatt ttggtaattit 552O ggcc cc aggc ccaacgatgg atgaactic to Ctctt Cagaa citcgaggaac tact calacc 558 O c ctitgaacta aaatgcaatt actittaa.cat gcct catggit agtgact cag aaccttitt.ca 564 O tgaggactitg Ctggatgttc gcaatgaaac Ctgtgccaag gaaagaatag caaat catca st OO tacagaggag aagggtag to at Cagt Caga aagag tatgc acatctgtca ct cattcCtt 576 O. tatttctgct ggtaacaaag totaccctgt citctgatgat gct attaaaa accaaccatt 582O gcctggcagt aatatgattic atggtacact t caggaagct gactictttgg ataaactgta 588 O tgct citttgt gigt caa.catt gcc caatact aactgttatt atcca accca togaatgagga 594 O agaccgagga tittgcatato goaaagaatc tdatattgaaaatttcttgg gtttittattt 6 OOO atggatgaaa atacacccat atttacttica gacagacaaa aatgtgttca gggaagagaa 6 O6 O caataaag.ca agtatgagac aaaatctitat tdataatgcc attggtgata tatttgatca 612 O gttittatttic agtaacacat ttgacttgat gigg taaaaga agaaaacaaa aaagaattaa 618O

Cttcttgggg ttagaggaag aaggtaattit aaagaaattt Calaccagatt talaggaaag 624 O gttttgtatgaatttcttgc acacat catt gttagttgttg gigtaatgtgg attcaaatac 63 OO acaagacct c agcggit caga caaatgaaat ctittaaag.ca gtcgatgaga ataacaactt 636 O attaaataac agattic cagg gct caagaac aaatctoaac caagtag taa gagaaaatat 642O caactgtcat tacttctittgaaatgcttgg toaa.gcttgc ct cittagata tittgccaagt 648 O tgag acct cottaaat atta gcaacagaaa tattittagaa citttgtatgt ttgagggtga 654 O aaatctttitc atttgggaag aggaagacat attaaattta actgat cittgaaag.cagtag 66OO agaacaagaa gatttata at ttcaatat ca gcacact cat t citttgtcaa tt cattttitt 666 O cc catgagat gaag cacatg togacgaatac gigacitagata acctictaaga attitt coact 672 O tottcaaaat gaact tactic tagaaagctt acccttggat aaccagtttg actitt cataa 678 O. tgtc.tctgtt ttttgtttitt coaacaatta cagacticagg ttct cittatt ttggaagttt 6840 citatctggitt ttgttctgaa cittacatttt tttitttittitt ggitat citat g atttitttittg 69 OO cticagggcat caaaatgtgc taaggacaag aattatat co tttittaaaaa atgttgttag 696 O cittggtgtaa aatgtatatt gactg tattg gtgaataaat tdaatagaca taacct caaa 7 O2O US 2015/0259395 A1 Sep. 17, 2015 74

- Continued gtactt cact tatt citttitt aac tactgat ttgataaaaa gitatgattat aagatat coa 708 O cgacaatcto at agtttctt 71OO

<210s, SEQ ID NO 35 &211s LENGTH: 21.56 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 35 Met Ser Asp Thr Pro Ser Thr Gly Phe Ser Ile Ile His Pro Thr Ser 1. 5 1O 15 Ser Glu Gly Glin Val Pro Pro Pro Arg His Leu Ser Lieu. Thr His Pro 2O 25 3O Val Val Ala Lys Arg Ile Ser Phe Tyr Lys Ser Gly Asp Pro Glin Phe 35 4 O 45 Gly Gly Val Arg Val Val Val Asn Pro Arg Ser Phe Llys Ser Phe Asp SO 55 6 O Ala Lieu. Lieu. Asp Asn Lieu. Ser Arg Llys Val Pro Lieu Pro Phe Gly Val 65 70 7s 8O Arg Asn. Ile Ser Thr Pro Arg Gly Arg His Ser Ile Thr Arg Lieu. Glu 85 90 95 Glu Lieu. Glu Asp Gly Glu Ser Tyr Lieu. Cys Ser His Gly Arg Llys Val 1OO 105 11 O Glin Pro Val Asp Lieu. Asp Lys Ala Arg Arg Arg Pro Arg Pro Trp Lieu. 115 12 O 125 Ser Ser Arg Ala Ile Ser Ala His Ser Pro Pro His Pro Val Ala Val 13 O 135 14 O Ala Ala Pro Gly Met Pro Arg Pro Pro Arg Ser Lieu Val Val Phe Arg 145 150 155 160 Asn Gly Asp Pro Llys Thr Arg Arg Ala Val Lieu Lleu Ser Arg Arg Val 1.65 17O 17s

Thr Glin Ser Phe Glu Ala Phe Lieu. Glin His Lieu. Thr Glu Wal Met Glin 18O 185 19 O Arg Pro Val Val Llys Lieu. Tyr Ala Thr Asp Gly Arg Arg Val Pro Ser 195 2OO 2O5 Lieu. Glin Ala Val Ile Lieu. Ser Ser Gly Ala Val Val Ala Ala Gly Arg 21 O 215 22O Glu Pro Phe Llys Pro Gly Asn Tyr Asp Ile Gln Lys Tyr Lieu. Leu Pro 225 23 O 235 24 O Ala Arg Lieu Pro Gly Ile Ser Glin Arg Val Tyr Pro Llys Gly Asn Ala 245 250 255 Lys Ser Glu Ser Arg Lys Ile Ser Thr His Met Ser Ser Ser Ser Arg 26 O 265 27 O Ser Glin Ile Tyr Ser Val Ser Ser Glu Lys Thr His Asn Asn Asp Cys 27s 28O 285

Tyr Lieu. Asp Tyr Ser Phe Val Pro Glu Lys Tyr Lieu Ala Lieu. Glu Lys 29 O 295 3 OO

Asn Asp Ser Glin Asn Lieu Pro Ile Tyr Pro Ser Glu Asp Asp Ile Glu 3. OS 310 315 32O

Lys Ser Ile Ile Phe Asn Glin Asp Gly Thr Met Thr Val Glu Met Lys 3.25 330 335 US 2015/0259395 A1 Sep. 17, 2015 75

- Continued Val Arg Phe Arg Ile Lys Glu Glu Glu Thir Ile Llys Trp Thir Thr Thr 34 O 345 35. O Val Ser Lys Thr Gly Pro Ser Asn Asn Asp Glu Lys Ser Glu Met Ser 355 360 365 Phe Pro Gly Arg Thr Glu Ser Arg Ser Ser Gly Lieu Lys Lieu Ala Ala 37 O 375 38O Cys Ser Phe Ser Ala Asp Val Ser Pro Met Glu Arg Ser Ser Asn Glin 385 390 395 4 OO Glu Gly Ser Lieu Ala Glu Glu Ile Asn. Ile Glin Met Thr Asp Glin Val 4 OS 41O 415 Ala Glu Thir Cys Ser Ser Ala Ser Trp Glu Asn Ala Thr Val Asp Thr 42O 425 43 O Asp Ile Ile Glin Gly. Thr Glin Asp Glin Ala Lys His Arg Phe Tyr Arg 435 44 O 445 Pro Pro Thr Pro Gly Lieu. Arg Arg Val Arg Glin Llys Llys Ser Val Ile 450 45.5 460 Gly Ser Val Thr Lieu Val Ser Glu Thr Glu Val Glin Glu Lys Met Ile 465 470 47s 48O Gly Glin Phe Ser Tyr Ser Glu Glu Arg Glu Ser Gly Glu Asn Llys Ser 485 490 495 Glu Tyr His Met Phe Thr His Ser Cys Ser Lys Met Ser Ser Val Ser SOO 505 51O ASn Llys Pro Val Lieu Val Glin Ile ASn ASn ASn Asp Gln Met Glu Glu 515 52O 525 Ser Ser Lieu. Glu Arg Llys Lys Glu Asn. Ser Lieu Lleu Lys Ser Ser Ala 53 O 535 54 O Ile Ser Ala Gly Val Ile Glu Ile Thr Ser Gln Lys Met Lieu. Glu Met 5.45 550 555 560 Ser His Asn Asn Gly Lieu Pro Ser Thr Ile Ser Asn Asn Ser Ile Val 565 st O sts Glu Glu Asp Val Val Asp Cys Val Val Lieu. Asp Asn Llys Thr Gly Ile 58O 585 59 O Lys Asn Phe Llys Thr Tyr Gly Asn Thr Asn Asp Arg Phe Ser Pro Ile 595 6OO 605 Ser Ala Asp Ala Thr His Phe Ser Ser Asn. Asn. Ser Gly. Thir Asp Llys 610 615 62O

Asn. Ile Ser Glu Ala Pro Ala Ser Glu Ala Ser Ser Thir Wall. Thir Ala 625 630 635 64 O Arg Ile Asp Arg Lieu. Ile Asn. Glu Phe Ala Glin Cys Gly Lieu. Thir Lys 645 650 655 Lieu Pro Lys Asn. Glu Lys Lys Ile Lieu. Ser Ser Val Ala Ser Lys Llys 660 665 67 O

Llys Llys Llys Ser Arg Glin Glin Ala Ile Asn. Ser Arg Tyr Glin Asp Gly 675 68O 685

Glin Lieu Ala Thir Lys Gly Ile Lieu. Asn Lys Asn. Glu Arg Ile Asn. Thir 69 O. 695 7 OO

Lys Gly Arg Ile Thr Lys Glu Met Ile Val Glin Asp Ser Asp Ser Pro 7 Os 71O 71s 72O

Lieu Lys Gly Gly Ile Lieu. Cys Glu Glu Asp Lieu. Glin Llys Ser Asp Thr 72 73 O 73

Val Ile Glu Ser Asn Thr Phe Cys Ser Lys Ser Asn Lieu. Asn Ser Thr US 2015/0259395 A1 Sep. 17, 2015 76

- Continued

740 74. O

Ile Ser Lys Asn. Phe His Arg Asn Lys Luell ASn. Thir Thir Gl Asn Ser 760 765

Wall Glin Gly Lieu. Lieu. Thir Ser Arg Ser Le u Asn Lys 770 775

Ile Ser Luell Gly Ala Pro Llys Lys Arg Glu Ile Gly Glin Air g Asp 78s 79 O 79.

Wall Phe Pro His Asn Glu Ser Cys Lys Ser Thr Ph. e Glu Asn 805 810 815

Ser Luell Phe His Wall Phe ASn Ile Luell Glu Glin Llys o Lys Asp 82O 825 83 O

Phe Ala Pro Glin Ser Glin Ala Glu Wall Ala Ser Gly r Lieu. Arg 835 84 O 845

Gly Met Ala Ser Luell Wall Ser Val Thr Asp Se r His Ile 850 855 860

Thir Luell Ser Glin Llys Llys Arg Llys Gly Asp Llys Val S Ala Ser 865 87O 88O

Ala Ile Luell Ser Lys Gln His Ala Thr Thir Arg Ala Asn Se r Lieu Ala 885 890 895

Ser Luell Llys Pro Asp Phe Pro Glu Ala Ile Ala His Hi s Ser Ile 9 OO 905 91 O

Glin Asn Tyr Ile Glin Ser Trp Lieu. Glin Asn Ile Asn. Pro Pro Thir 915 920 925

Lell Lys Pro Ile Llys Ser Ala Pro Wall Arg Asn. Glu Th r Ser Wall 93 O 935 94 O

Wall Asn Ser Asn Asn. Ser Phe Ser Gly Asn Asp Pro Hi S Thir Asn 945 950 955 96.O

Ser Gly Ile Ser Asn. Phe Wal Met Glu Ser Asn Llys Hi s Ile Thir 965 97.

Ile Ala Gly Lieu. Thr Gly Asp Asn Luell Cys Lys Glu Gl y Asp Lys 98O 985 99 O

Ser Phe Ile Ala Asn Asp Thr Gly Glu Glu Asp Lieu. His Glu Thir Glin 995

Wall Ser Lieu. Asn Asp Ala Tyr Luell Wall Pro Leu His Glu His O15 O2O

Lell Ser Glin Ser Ala Ile Asn Asp His Asn Thir Ser O25 O3 O O35

His Ala Ala Glu Lys Ser Gly Pro Glu Llys Llys Luell Wall OSO

Glin Glu Ile Asn Lieu Ala Arg Llys Arg Glin Ser Wall Glu Ala Ala O55 O65

Ile Glin Wall Asp Pro Ile Glu Glu Glu Thir Pro Llys Asp Lell Lell Of O O8O

Pro Lell Met Lieu. His Glin Lieu. Glin Ala Pro Gly Ile

His Thir Glin Asn Gly Val Wall Glin Met Ser Lell Ala

Gly Pro Phe His Ser Ala Ile ASn Thir Asn Lell

Lell Luell Ala Trp Lieu. Lieu Val Luell Asn Luell Ser Met Asn 13 O US 2015/0259395 A1 Sep. 17, 2015 77

- Continued

Ser Phe Cys Glin Val Asp Ala His Lys Ala Thr Asn Llys Ser Ser 145 SO 155 Glu Thir Lieu Ala Lieu. Lieu. Glu Ile Lieu Lys His Ile Ala Ile Thr 16 O 65 17 O Glu Glu Ala Asp Asp Lieu Lys Ala Ala Val Ala Asn Lieu Val Glu 17s 8O 185 Ser Thir Thr Ser His Phe Gly Lieu Ser Glu Lys Glu Glin Asp Met 190 95 2OO Val Pro Ile Asp Lieu. Ser Ala Asn. Cys Ser Thr Val Asn. Ile Glin 2O5 21 O 215 Ser Val Pro Lys Cys Ser Glu Asn Glu Arg Thr Glin Gly Ile Ser 22O 225 23 O Ser Lieu. Asp Gly Gly Cys Ser Ala Ser Glu Ala Cys Ala Pro Glu 235 24 O 245 Val Cys Val Lieu. Glu Val Thr Cys Ser Pro Cys Glu Met Cys Thr 250 255 26 O Val Asn Lys Ala Tyr Ser Pro Lys Glu Thir Cys Asn Pro Ser Asp 265 27 O 27s Thr Phe Phe Pro Ser Asp Gly Tyr Gly Val Asp Gln Thr Ser Met 28O 285 29 O Asn Lys Ala Cys Phe Lieu. Gly Glu Val Cys Ser Lieu. Thir Asp Thr 295 3OO 305 Val Phe Ser Asp Lys Ala Cys Ala Glin Lys Glu Asn His Thr Tyr 310 315 32O Glu Gly Ala Cys Pro Ile Asp Glu Thr Tyr Val Pro Val Asn Val 3.25 33 O 335 Cys Asn. Thir Ile Asp Phe Lieu. Asn Ser Lys Glu Asn Thr Tyr Thr 34 O 345 350 Asp Asn Lieu. Asp Ser Thr Glu Glu Lieu. Glu Arg Gly Asp Asp Ile 355 360 365 Glin Lys Asp Lieu. Asn. Ile Lieu. Thir Asp Pro Glu Tyr Lys Asn Gly 37O 375 38O

Phe Asn. Thir Lieu. Wal Ser His Glin Asn. Wal Ser Asn Lieu. Ser Ser 385 390 395 Cys Gly Lieu. Cys Lieu. Ser Glu Lys Glu Ala Glu Lieu. Asp Llys Llys 4 OO 405 41 O His Ser Ser Lieu. Asp Asp Phe Glu Asn. Cys Ser Lieu. Arg Llys Phe 415 42O 425 Glin Asp Glu Asn Ala Tyr Thir Ser Phe Asp Met Glu Glu Pro Arg 43 O 435 44 O Thir Ser Glu Glu Pro Gly Ser Ile Thr Asn Ser Met Thr Ser Ser 445 450 45.5

Glu Arg Asn. Ile Ser Glu Lieu. Glu Ser Phe Glu Glu Lieu. Glu Asn 460 465 47 O His Asp Thr Asp Ile Phe Asn Thr Val Val Asn Gly Gly Glu Gln 47s 48O 485

Ala Thr Glu Glu Lieu. Ile Glin Glu Glu Val Glu Ala Ser Llys Thr 490 495 SOO

Lieu. Glu Lieu. Ile Asp Ile Ser Ser Lys Asn. Ile Met Glu Glu Lys 5 OS 510 515 US 2015/0259395 A1 Sep. 17, 2015 78

- Continued Arg Met Asn Gly Ile Ile Tyr Glu Ile Ile Ser Lys Arg Lieu Ala 52O 525 53 O Thr Pro Pro Ser Lieu. Asp Phe Cys Tyr Asp Ser Lys Glin Asn Ser

Glu Lys Glu Thr Asn Glu Gly Glu Thir Lys Met Val Lys Met Met

Val Lys Thr Met Glu Thr Gly Ser Tyr Ser Glu Ser Ser Pro Asp

Lieu Lys Lys Cys Ile Llys Ser Pro Val Thir Ser Asp Trp Ser Asp

Tyr Arg Pro Asp Ser Asp Ser Glu Glin Pro Tyr Lys Thr Ser Ser

Asp Asp Pro Asn Asp Ser Gly Glu Lieu. Thr Glin Glu Lys Glu Tyr 610 615 62O Asn. Ile Gly Phe Wall Lys Arg Ala Ile Glu Lys Lieu. Tyr Gly Lys 625 63 O 635 Ala Asp Ile Ile Llys Pro Ser Phe Phe Pro Gly Ser Thr Arg Lys 64 O 645 650 Ser Glin Val Cys Pro Tyr Asn Ser Val Glu Phe Glin Cys Ser Arg 655 660 665 Lys Ala Ser Lieu. Tyr Asp Ser Glu Gly Glin Ser Phe Gly Ser Ser 670 675 68O

Glu Glin Wal Ser Ser Ser Ser Ser Met Lieu. Glin Glu Phe Glin Glu 685 69 O. 695 Glu Arg Glin Asp Llys Cys Asp Val Ser Ala Val Arg Asp Asn Tyr 7 OO 7Os 71O Cys Arg Gly Asp Ile Val Glu Pro Gly. Thir Lys Glin Asn Asp Asp 71s 72 O 72 Ser Arg Ile Lieu. Thir Asp Ile Glu Glu Gly Val Lieu. Ile Asp Llys 73 O 73 74 O Gly Lys Trp Lieu. Lieu Lys Glu Asn His Lieu. Lieu. Arg Met Ser Ser 74. 7 O 7ss Glu Asn Pro Gly Met Cys Gly Asn Ala Asp Thr Thr Ser Val Asp 760 765 770 Thr Lieu Lleu. Asp Asn Asn Ser Ser Glu Val Pro Tyr Ser His Phe 775 78O 78s Gly Asn Lieu Ala Pro Gly Pro Thr Met Asp Glu Lieu Ser Ser Ser 79 O 79. 8OO Glu Lieu. Glu Glu Lieu. Thr Glin Pro Lieu. Glu Lieu Lys Cys Asn Tyr 805 810 815 Phe Asn Met Pro His Gly Ser Asp Ser Glu Pro Phe His Glu Asp 82O 825 83 O

Lieu. Lieu. Asp Val Arg Asn. Glu Thir Cys Ala Lys Glu Arg Ile Ala 835 84 O 845

Asn His His Thr Glu Glu Lys Gly Ser His Glin Ser Glu Arg Val 850 855 86 O

Cys Thir Ser Val Thr His Ser Phe Ile Ser Ala Gly Asn Llys Val 865 87 O 87s

Tyr Pro Val Ser Asp Asp Ala Ile Lys Asn Gln Pro Lieu Pro Gly 88O 885 890

Ser Asn Met Ile His Gly. Thir Lieu. Glin Glu Ala Asp Ser Lieu. Asp

US 2015/0259395 A1 Sep. 17, 2015 81

- Continued gtgcaactgg attggaagtt tocct acata ccc cctdaga gct tcctgaa accagaa.gct 282O Cagactaagg ggaaggatac Caaggacagt t caaagatct Catctgaaga ggaaaaggct 288O t cattt cott cocaggat.ca gatggcatct c ct gaggttc ccattgaagic tdgc.cagtat 294 O cgatctaaga gaaaacct co to atggggga gaaagaaagg agaaggagca C caggttgtg 3 OOO agct acticaa gaagaaaa.ca toaaaaga at aggtgttcaaggaaagaa tagaatggag 3 O 6 O tat cittagcc ttaa.catctt aaatggaaat acaccagagc aggtgaatta cactgagtgg 312 O aagttcticag agactalacag Ctt cataggit gatggctitta aaaat cagca Caggaagag 318O gaaatgacat tat cocattc agcactgaaa cagaaggaac citctacatcc totaaatgac 324 O aaagaatcct Ctgaacaagg ttctgaagtic agtgaag cac aaact accga cagtgatgat 33 OO gtcatagtgc cacccatgtc. tcagaaat at Cctaaggcag attcagaga a gatgtgcatt 3360 gaaattgtct C cctggcctt Ctacccagag gCagaagtga tigtctgatga gaa cataaaa 342O Caggtgtatgttgagtacaa attctacgac ct accCttgt Cigagacaga gactic cagtg 3480 t ccctaagga agcctagggc aggagaagaa atc. cactitt.c actittagcaa ggtaatagac 354 O Ctggacccac aggagcagca aggcc.galagg cqgtttctgt t cacatgct gaatggacaa 36OO gatcCtgatc aaggacattt aaagtttaca gtggtaagtg atcCtctgga tigaagaaaag 366 O aaagaatgtg aagaagtggg atatgcat at Cttcaactgt ggcagat.cct ggagt cagga 372 O agagat attc tagagcaaga gct agaCatt gttagcCCtg aagatctggC tacCC Calata 378 O. ggaaggctga aggttt CCct tcaag cagct gctgtcCtcc atgct attta Caaggagatg 384 O actgaagatt tdttitt catg aaggaacaag togctatt coa atctaaaagt citctgaggga 3900 accatagitaa aaagttct citt ataaagttag cittgctataa catgaaaaaa 395 O

<210s, SEQ ID NO 37 &211s LENGTH: 1286 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OO > SEQUENCE: 37 Met Ser His Lieu Val Asp Pro Thir Ser Gly Asp Lieu Pro Val Arg Asp 1. 5 1O 15 Ile Asp Ala Ile Pro Lieu Val Lieu Pro Ala Ser Lys Gly Lys Asn Met 2O 25 3O Llys Thr Glin Pro Pro Lieu. Ser Arg Met Asn Arg Glu Glu Lieu. Glu Asp 35 4 O 45 Ser Phe Phe Arg Lieu. Arg Glu Asp His Met Lieu Val Lys Glu Lieu. Ser SO 55 6 O Trp Llys Glin Glin Asp Glu Ile Lys Arg Lieu. Arg Thir Thr Lieu. Lieu. Arg 65 70 7s 8O

Lieu. Thir Ala Ala Gly Arg Asp Lieu. Arg Val Ala Glu Glu Ala Ala Pro 85 90 95

Lieu. Ser Glu Thir Ala Arg Arg Gly Glin Lys Ala Gly Trp Arg Glin Arg 1OO 105 11 O Lieu. Ser Met His Glin Arg Pro Gln Met His Arg Lieu Gln Gly His Phe 115 12 O 125 His Cys Val Gly Pro Ala Ser Pro Arg Arg Ala Glin Pro Arg Val Glin 13 O 135 14 O