Microrna-1271 Impedes the Development of Prostate Cancer By

Jiang et al. J Transl Med (2020) 18:209 https://doi.org/10.1186/s12967-020-02349-1 Journal of Translational Medicine

RESEARCH Open Access microRNA‑1271 impedes the development of prostate cancer by downregulating PES1 and upregulating ERβ Zhenming Jiang1, Yuxi Zhang1,2*, Xi Chen3, Yan Wang4, Pingeng Wu1, Chengzhang Wu2 and Dong Chen5

Abstract Background: As a nucleolar protein associated with ribosome biogenesis, pescadillo homolog 1 (PES1) has been reported to participate in the development of many cancers. However, its role in prostate cancer is not clearly defned. Therefore, the aim of this study is to explore the efects and the specifc mechanism of PES1 in prostate cancer. Methods: A microarray-based analysis was performed to analyze diferentially expressed genes (DEGs) between prostate cancer and normal samples. Next, the interaction between PES1 and microRNA-1271 (miR-1271) was inves- tigated using bioinformatics analysis in combination with dual-luciferase reporter gene assay. The expression of miR- 1271 in prostate cancer cells and tissues was determined using RT-qPCR. Its efects on downstream estrogen receptor β (ERβ) signaling pathway were further examined. Moreover, we analyzed whether miR-1271 afects proliferation, apoptosis, migration and invasion of prostate cancer cells by EdU assay, fow cytometry, and Transwell assay. Lastly, a prostate cancer mouse model was conducted to measure their roles in the tumor growth. Results: PES1 was identifed as a prostate cancer-related DEG and found to be upregulated in prostate cancer. miR- 1271, which was poorly expressed in both cells and tissues of prostate cancer, can specifcally bind to PES1. Addition- ally, overexpression of miR-1271 activated the ERβ signaling pathway. Overexpression of miR-1271 or depletion of PES1 inhibited prostate cancer cell proliferation, migration and invasion, promoted apoptosis in vitro and suppressed tumor growth in vivo. Conclusions: Taken together, overexpression of miR-1271 downregulates PES1 to activate the ERβ signaling pathway, leading to the delayed prostate cancer development. Our data highlights the potential of miR-1271 as a novel biomarker for the treatment of prostate cancer. Keywords: Prostate cancer, microRNA-1271, Pescadillo homolog 1, Estrogen receptor β

Background due to various factors such as economic development and Prostate cancer ranks second among the prevalent can- food consumption [2]. Prostate cancer can be induced cers in males and approximately 1.1 million people are by numerous risk factors, including smoking, drinking, diagnosed with prostate cancer annually in the world [1], obesity, as well as occupational exposure to pesticides with an increasing incidence rate in most Asian countries and cadmium [3]. Further, prostate cancer is defned as a heterogeneous disease characterized by variable perspec- tives and there are several approaches to treat this dis- *Correspondence: [email protected] ease, such as active surveillance, radiotherapy. However, 1 Department of Urology, The First Hospital of China Medical University, defning the best strategy for prostate cancer patients is No. 155 Nanjing North Street, Heping District, Shenyang 110001, Liaoning Province, People’s Republic of China still a challenge [4, 5]. Hence, it is important to provide Full list of author information is available at the end of the article more future directions for prostate cancer treatment.

© The Author(s) 2020. This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativeco mmons.org/licen ses/by/4.0/ . The Creative Commons Public Domain Dedication waiver (http://creativeco mmons .org/publi cdoma in/ zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Jiang et al. J Transl Med (2020) 18:209 Page 2 of 14

Our microarray-based analysis revealed that pes- Patient enrollment cadillo homolog 1 (PES1) gene was diferentially Prostate cancer tissues were collected through fne-nee- expressed in prostate cancer and was involved in the dle biopsy from 54 patients (aged from 43 to 82 years old prostate cancer development. As a nucleolar protein, with a mean age of 63.24 ± 6.52 years) who were patho- PES plays an essential role in the viability of yeast as logically diagnosed as prostate cancer at the Department well as higher eukaryotes and participates in multiple of Urology in Te First Hospital of China Medical Uni- cellular development, including cell proliferation, ribo- versity from June, 2017 to December, 2017. Te enrolled some biogenesis, and DNA replication [6]. PES1 has patients did not receive any treatment before blood test. been reported to be highly expressed in gastric cancer Te patients sufered from hypertension, acute infec- and downregulation of PES1 suppresses the progres- tion, tuberculosis, and diabetes mellitus were excluded. sion of gastric cancer, thus serving as a critical bio- According to the Gleason score of histopathological marker for the diagnosis of gastric cancer [7]. PES1 classifcation formulated by World Health Organization gene is upregulated in the microvesicles of prostate in 2003 [16], diferent patients had various pathologi- cancer cells and involved in the pathogenesis of pros- cal scores (19 patients with 6 scores, 18 patients with 7 tate cancer [8]. scores, 9 patients with 8 scores, and 8 patients with 9 As a kind of short non-coding RNA downregulating scores). As for tumor-nodes-metastasis (TNM) stages, the target mRNA expression, microRNAs (miRNAs) are 3 patients were at T1bN0M0 stage, 17 patients were at widely known to be involved in diverse cancer processes T1cN0M0, 15 patients were at T2aN0M0, 11 patients were and accepted as potential prognostic and diagnostic bio- at T2bN0M0, and 8 patients were at T2cN0M0. A total of markers for patients sufering from cancer [9]. miR-1271 15 patients pathologically diagnosed as benign prostatic is found decreased in pancreatic cancer tissues [10]. hyperplasia through transurethral resection of pros- miR-1271 is also poorly expressed in prostate cancer tis- tate or prostate biopsy were selected as controls. Tese sues and can function as a biomarker for management of patients did not experience other malignancies, coronary prostate cancer patients [11]. Based on the bioinformatic heart disease, and diabetes mellitus. prediction and dual-luciferase reporter gene assay in the current study, PES1 is a potent target gene of miR-1271 in prostate cancer. PES1 mediates the balance between Dual‑luciferase reporter gene assay estrogen receptor (ER)β and ERα in tumor growth of Te plasmid vectors pGL3-basic (Shanghai Realgene Co., estrogen-provoked breast cancer [12]. ERβ, encoded Ltd., Shanghai, China) harboring PES1-3′-untranslated by chromosome locus 14q22-24, belongs to the nuclear region (UTR)-wild type (Wt) and PES-3′UTR-Mutant receptor supergroup and expression of this gene can be (Mut) were constructed and transfected with miR-1271 found in luminal epithelial cells and the stromal cells of mimic or NC plasmids into cells. After 48 h of transfec- the prostate [13]. A number of studies have revealed the tion, the luciferase activity of samples was detected using suppressive efect of ERβ on the development of prostate the dual-luciferase reporter gene detection kits (E1960, cancer and that ERβ acts as a marker for the management Promega Corp., Madison, Wisconsin, USA). of prostate cancer [14, 15]. Based on these fndings and analyses, we hypothesized that the interaction among miR-1271, PES1 and ERβ may participate in the progres- Cell harvest and treatment sion of prostate cancer. Terefore, the present study was Four prostate cancer cell lines (LNCaP, 22Rv1, PC-3, designed to uncover the specifc mechanisms of these and DU145) and one normal prostatic epithelial cell line genes in prostate cancer via both in vitro and in vivo (RWPE-1) purchased from American Type Culture Col- assays. lection (Manassas, VA, USA) were cultured in Dulbecco’s modifed Eagle’s medium (DMEM; Gibco, Carlsbad, Cali- fornia, USA) containing 10% fetal bovine serum (FBS) Methods (Hangzhou Sijiqing Company, Zhejiang, China) and 1% Ethics statement penicillin (100 U/L)-streptomycin (100 mg/L) (Gibco, Tis study was approved by the Ethics Committee of Te Carlsbad, California, USA) at 37 °C with 5% CO2. In the First Hospital of China Medical University performed in following experiments, the cells were treated with miR- strict accordance with the Declaration of Helsinki. All 1271 mimic, miR-1271 inhibitor, short hairpin RNA participants or their relatives signed informed consent (sh)-PES1, pyrazolo [1,5-a] pyrimidine (PHTPP) (ERβ documentation. Animal experiments strictly adhered to antagonist), or their respective negative controls (NCs) the principle to minimize the pain, sufering and discom- (NC mimic, NC inhibitor, sh-NC, dimethyl sulfoxide fort to the experimental animals. [DMSO]) based on the manufacturer’s guide. Transient Jiang et al. J Transl Med (2020) 18:209 Page 3 of 14

transfection was performed using Lipofectamine 2000 (ab32150, 1 : 1000), c-caspase-9 (ab2324, 1 : 1000), ERα reagents (Invitrogen, USA). Each transfection sequence is (ab241587, 1 : 5000), ERβ (ab268053, 1 : 5000), proliferat- listed in Additional fle 1: Table S1. ing cell nuclear antigen (PCNA; ab18197, 1 : 1000), PES1 (ab72539, 1 : 5000), Ki67 (209897, 1 : 5000), matrix met- Reverse transcription quantitative polymerase chain allopeptidase (MMP)-2 (ab37150, 1 : 1000), and MMP-9 reaction (RT‑qPCR) (ab38898, 1 : 1000). Total RNA was extracted from the prostate cancer cell lines using the RNA extraction kits (Invitrogen, Inc., 5‑ethynyl‑2′‑deoxyuridine (EdU) assay Carlsbad, CA, USA). Te designed primers (Table 1) were Cells were incubated with the addition of EdU solution synthesized by Takara (Tokyo, Japan). Te extracted RNA (a mixture of culture medium and EdU solution at 1000 : was reversely transcribed into complementary DNA 1) at room temperature for 2 h, fxed with 40 g/L polyfor- based on the protocol of PrimeScript RT kits. RT-qPCR maldehyde for 30 min, incubated with glycine solution for ® was conducted using the ABI PRISM 7300 system. U6 8 min, and rinsed with phosphate-bufered saline (PBS) was used as the internal control for miR-1271 and glyc- containing 0.5% Triton X-100. After stained with Apollo® eraldehyde-3-phosphate dehydrogenase (GAPDH) for reaction liquid and Hoechst 3334 for 30 min and 20 min PES1. Te transcription level of the target genes was respectively at room temperature in the dark, the cells ΔΔCt fnally calculated using the 2− method. were observed under a fuorescence microscope. Images were then captured under red light at an excitation wave- Western blot analysis length of 550 nm and under purple light at an excitation Total protein was extracted from cell lysates. After sepa- wavelength of 350 nm. Te cells with red fuorescence ration using 10% sodium dodecyl sulfate polyacrylamide were proliferative cells and cells with blue fuorescence gel electrophoresis, the protein was transferred onto the were total cells. Next, the number of EdU-stained cells polyvinylidene fuoride membrane using a wet transfer (proliferative cells) and Hoechst 3334-stained cells (total method. Subsequently, the membrane was blocked with cells) was counted in 3 randomly selected felds under the 5% skim milk and probed with the primary antibod- magnitude of 400. Te cell proliferation rate = the num- ies, followed by further incubation with secondary anti- ber of proliferative cells/the number of total cells × 100%. body labeled by horseradish peroxidase. Te membrane was developed and then visualized using the enhanced Annexin V‑FITC/PI staining and fow cytometry chemiluminescence detection kits (BB-3501, Amer- After 48 h of transfection, cells were washed with PBS sham, Little Chalfont, UK). Images were captured using and detached by trypsinization. Cells were harvested at the Bio-Rad image analysis system (Bio-Rad, Inc., Her- 6 a density of 1 × 10 cells/mL by centrifugation at 1000 r/ cules, CA, USA) and the results were analyzed using the min at 4 °C for 5 min. Next, the cells were resuspended Quantity One v4.6.2 software. Te relative protein level in 400 μL 1 × binding bufer with the cell concentration was expressed as the ratio of gray value of target bands 6 adjusted to 0.5–1 × 10 cells/mL. With the addition of 5 to that of β-actin band. All primary antibodies were sup- μL Annexin V-fuorescein isothiocyanate in cell suspen- plied by Abcam Inc., Cambridge, UK: GAPDH (ab8245; sion, cells were incubated at 4 °C for 15 min avoiding 1: 1000), total caspase-3 (ab13847, 1: 1000), c-caspase-3 exposure to light. Moreover, the cells were incubated at 4 °C for 15 min under dark conditions with 5 μL propid- ium iodide. Cell apoptosis rate was measured using a fow Table 1 Primer sequences for RT-qPCR cytometer. Log FL1-Log FL2 (X axis-Y axis) dual-param- eter dot plots were drawn and the data were analyzed. Gene Primer sequence (5′-3′) miR-1271 F: 5′-CTAGACGTCCAGATTGAATAGAC-3′ Transwell migration and invasion assays R: 5′-GTCCGAGCTTGGTCAGAATG-3′ Transwell chamber with 0.8 μm aperture diameter PES1 F: 5′-GAGGCTCACAGTCAATGAATCGTC-3′ (Corning, New York, USA) was employed for cell migra- R: 5′-AAACGTTCGGGCTGCTGTAGA-3′ tion assays and matrigel-coated Transwell chamber with U6 F: 5′-AGCCCGCACTCAGAACATC-3′ 0.8 μm aperture diameter (BD, Franklin Lakes, NJ, USA) R: 5′-GCCACCAAGACAATCATCC-3′ was applied for cell invasion detection. In short, cells GAPDH F: 5′-GCACCGTCAAGGCTGAGAAC-3′ were starved with serum-free DMEM for 24 h. Te baso- R: 5′-TGGTGAAGACGCCAGTGGA-3′ lateral Transwell chamber (Corning, New York, USA) was cultured with serum-free DMEM at 37 °C for 1 h. After RT-qPCR, reverse transcription quantitative polymerase chain reaction; PES1, pescadillo homolog 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, the detachment, cells were resuspended in serum-free forward; R, reverse 5 DMEM and diluted to 3 × 10 cells/mL. Afterwards, 100 Jiang et al. J Transl Med (2020) 18:209 Page 4 of 14

μL cells were added to the upper Transwell chamber and Results 600 μL DMEM supplemented with 10% FBS (chemokine) Analysis of microarray data from on‑line databases was added to the basolateral Transwell chamber, fol- Microarray-based analysis was performed to screen the lowed by incubation for 24 h. Subsequently, the cells that diferentially expressed genes (DEGs) associated with transferred into the basolateral chamber were subjected prostate cancer. Two datasets related to prostate cancer to 0.1% crystal violet staining for 10 min. Te cells were (GSE3868 and GSE30994) were retrieved from the Gene fnally observed in six randomly selected felds under an Expression Omnibus (GEO) database. Trough difer- inverted microscope (Olympus Optical Co., Ltd, Tokyo, ential analysis of the gene expression in prostate cancer Japan) and images were obtained. samples and normal samples, 224 and 3000 DEGs were obtained from GSE3868 and GSE30994 databases respec- Xenograft tumor in nude mice tively. Te heatmap generated from 50 DEGs from these A total of 84 specifc pathogen-free male nude mice (aged two expression datasets were constructed, respectively 6 weeks and weighing 23–27 g) were purchased from (Fig. 1a, b). In order to further screen prostate cancer- Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai related DEGs, the top 50% DEGs from the above two Laboratory Animal Center, Chinese Academy of Sci- datasets were subjected to Venn analysis, which revealed ence, Shanghai, China). Te nude mice were raised at 7 DEGs in the intersection of the results (Fig. 1c). Te constant temperature (25–27 °C) and constant humidity DisGeNET database was used to retrieve the known (45–50%). Te cells transfected with sh-PES1, miR-1271 prostate cancer-related genes, 10 of which with the high- −2 est score and 7 intersected DEGs were selected to con- agomir, miR-1271 antagomir, PHTPP (10 μL of 1 × 10 M PHTPP per mouse [17], or their respective NCs (sh- struct the gene interaction network (Fig. 1d). Te results NC, NC agomir, NC antagomir, DMSO) were resus- revealed that among 7 DEGs, only PES1, PARP3, and pended in 50% Matrigel (BD Biosciences, Bedford, MA, DDX43 were in the gene interaction network and PES 6 gene was correlated to such core genes as TP53 and USA) at a density of 2 × 10 cells/mL. Te transfected cells were used to construct stable cell line to prepare cell PTEN. Among PES1, PARP3, and DDX43 genes, PES1 5 was at the hub position in the gene interaction network. suspension, 0.2 mL of which (containing 4 × 10 cells) was then subcutaneously injected into each nude mouse Further analysis of the prostate cancer datasets in Te at left axilla. miR-1271 antagomir, miR-1271 agomir and Cancer Genome Atlas (TCGA) indicated that PES1 gene their separate controls were Shanghai GenePharma Co. expression was greatly upregulated in prostate cancer Ltd. (Shanghai, China). Te tumor volume was measured samples (Fig. 1e), which was in consistent with the gene every 7 days and the tumor growth curve was plotted. expression in the prostate cancer-related expression Te nude mice were euthanized and the tumor tissues datasets. Collectively, PES1 might play an important role were extracted and weighed. in the development of prostate cancer.

Statistical analysis Silencing of PES1 inhibits the development of prostate Te SPSS 21.0 statistical software (IBM Corp., Armonk, cancer both in vivo and in vitro NY, USA) was used to analyze data in our study. Meas- Given the correlation of PES1 expression to the develop- urement data were presented as mean ± standard deviation. Data between two groups were analyzed using ment of prostate cancer by microarray-based analysis, independent sample t test. Te normal distribution was we aimed to explore the specifc efects of PES1 on the evaluated using the Kolmogorov–Smirnov test, with development of prostate cancer. Te results of RT-qPCR homogeneity of variance tested. Comparisons of data showed that mRNA expression of PES1 was decreased obeying normal distribution and homogeneity of vari- in PC-3 cells with PES1 silencing (Fig. 2a), confrming ance among multiple groups were conducted using one- the knockdown efciency of PES1 in PC-3 cells. In addi- way analysis of variance (ANOVA), followed by Tukey’s tion, EdU assay (Fig. 2b), fow cytometry (Fig. 2c), and post hoc tests with corrections for multiple compari- Transwell assay (Fig. 2d) were respectively conducted sons. Variables at diferent time points were analyzed by to measure cell proliferation, apoptosis, migration and repeated measures ANOVA with Bonferroni’s post hoc invasion. Te results showed that compared with the si- tests. Mann–Whitney U (non-parametric) test was used NC-treated cells, si-PES1-treated cells exhibited reduced for data with skewed distribution or defect variances. EdU-positive rate, elevated apoptosis rate, and attenuated Pearson’s correlation coefcient was used for analyzing cell migration and invasion abilities (all p < 0.05). West- the correlation between miR-1271 expression and Glea- ern blot analysis was performed to measure the protein son scoring. Te level of signifcance (p value) was set to expression of factors related to cell proliferation (Ki67 0.05. and PCNA) (Fig. 2b), apoptosis (c-caspase-3/caspase-3 Jiang et al. J Transl Med (2020) 18:209 Page 5 of 14

type type type type ENTPD2 8 Normal LOC100190938 12 Normal PCDHA2 PROX1 GRTP1 Tumor FER1L5 Tumor SPRR3 CHL1 10 RP3−406C18.2 6 ZNF711 BARX1 GNAL WNT1 LRP1B 8 MCM3AP−AS1 FRMPD4 CPM DACH2 6 LRRC14 4 LOC100131289 CELF3 CACNB4 SLC26A4 EDN3 4 CHST11 STAC AMELX 2 SLITRK3 POLH CAMKK2 2 C5orf45 LOC391334 LINS PDE8B DDX43 LIMS2 CDHR2 FOXC1 VLDLR ROR2 COL5A3 N4BP2L1 PES1 B3GNT8 FKBP2 EYA1 MRTO4 GALNT14 TBC1D2 HOXA7 SNX15 GPRASP1 ANAPC2 PYCARD AVPR1B C16orf45 GPC4 KRT14 POGLUT1 SRD5A2 CENPN ARMCX1 MON1B C9orf125 CRYBB2P1 SERP2 PARP3 TRO MAPRE3 SNAI2 FUZ FRMD6 POGZ DLK2 BARD1 CHRNA7 GPR157 ANP32E TOP3B ATP10D BCCIP ZNF439 ZNF394 CD8B GLE1 C7orf58 ARHGAP22 CHRFAM7A CCDC22 MCC ELAC2 ODZ3 TFF3 ZNF516 PHEX PES1 WRNIP1 PRR16 SAMD5

SNAI1 GSM767943 GSM767944 GSM767945 GSM767946 GSM767947 GSM767948 GSM88407 GSM88408 GSM88347 GSM88351 GSM88353 GSM88360 GSM88389 GSM88390 GSM88391 GSM88392 GSM88393 GSM88394 GSM88395 GSM88396 GSM88397 GSM88398 GSM88399 GSM88400 GSM88401 GSM88402 GSM88403 GSM88404 GSM88405 GSM88406

cde

Expression of PES1 in PRAD based on major cancer stages TMPRSS2 GSE3868 100 ERG ***

KLK3 80 AR NPEPPS PARP3 105 7 1493 60 PTEN TP53

PSAT1 40 PLAG1 Transcript per million PROS1 20 PES1 Normal Primary tumor GSE30994 DDX43 (n=52) (n=497) TCGA samples Fig. 1 Analysis of microarray data from on-line databases. A-B, Expression heatmaps of the DEGs from the datasets GSE3868 (a) and GSE30994 (b), in which the X axis refers to sample number, and the Y axis refers to gene names; the left dendrogram represents gene expression cluster; each square represents the expression of a gene in each sample; the upper right squares refer to color scale. c Venn diagram showing the DEGs from the datasets GSE3868 (the left circle) and GSE30994 (the right circle); the intersection showing the overlapped DEGs in the two datasets. d Gene interaction network of 7 DEGs retrieved from the expression datasets and 10 known prostate cancer-related genes obtained from the DisGeNET database; each circle represents a gene and the lines between the circles denote the interaction between genes. e Expression of PES1 in the TCGA database, in which the X axis refers to sample type, and the Y axis represents gene expression; the left box plot denotes the expression of PES1 in normal samples and the right box plot shows the expression of PES1 in prostate cancer samples. ***p < 0.001, vs. normal samples

and c-caspase-9/caspase-9) (Fig. 2c), migration and inva- sh-PES1 treatment caused reduced PES1 mRNA expression (MMP-2 and MMP-9) (Fig. 2d). Te results revealed sion as well as decreased tumor growth and tumor vol- that in comparison with the si-NC treatment, si-PES1 ume (p < 0.05) (Fig. 2e, f). Tese results demonstrated treatment resulted in downregulated expression of Ki67, that downregulation of PES1 dampened prostate cancer PCNA, MMP-2, and MMP-9 and upregulated expression progression. of c-caspase-3/caspase-3 and c-caspase-9/caspase-9 (all p < 0.05). Also, cells transfected with sh-NC or sh-PES1 miR‑1271 specifcally binds to PES1 and downregulates its plasmids were injected into the nude mice to investi- expression gate the role of PES1 in prostate cancer in vivo. Te After exploring the efects of PES1 on prostate can- results indicated that compared with sh-NC treatment, cer development, we then focused on the upstream Jiang et al. J Transl Med (2020) 18:209 Page 6 of 14

1.5 PES1 of 1.0

expression 0.5 *

Relative 0.0 si-NCsi-PES1

) si-NC 50 0.8 b KI67 si-PES1 40 PCNA 0.6 30 * β-actin 0.4 20 * NC 50 μm 50 μm si- 0.2 10 -PES1 * si si-NC si-PES1 Relative protein expression Positive expression rate (% 0 0.0 si-NC si-PES1 KI67 PCNA c si-NC 20 c-caspase-3 1.5 si-PES1

4 si-NC 4 si-PES1 * 10 10 ) * * caspase-3

3 3 15 10 10 1.0 2 2 c-caspase-9 10 10 10 PI PI

1 1 caspase-9 0.5 10 10 5 Apoptosis rate (% 0 0 10 0 1 2 3 4 10 0 1 2 3 4 β-actin

10 10 10 10 10 10 10 10 10 10 Relative protein expression Annexin V FITC Annexin V FITC 0 0.0 si-NC si-PES1 -3 -9 -NC e si pas i-PES1 s e-3/caspase e-9/cas d spas spas c-ca c-ca

n si-NC si-NC 150 1.0 si-PES1 si-PES1 MMP-2 0.8

migratio 50 μm 50 μm 100 MMP-9 0.6

0.4 * 50 * Cell number * β-actin 0.2 * -NC invasion si Relative protein expression 0 -PES1 0.0 50 μm 50 μm migrationinvasion si MMP-2 MMP-9 si-NCsi-PES1 e 1.5 f 1000 sh-NC ) PES1 3 sh-PES1 * of 800 * 1.0 600 *

400 expression 0.5 * 200 Tumor volume (mm sh-NC sh-PES1 Relative 0.0 0 si-NCsi-PES1 7 d14 d21 d35 d Fig. 2 Silencing of PES1 inhibits the development of prostate cancer in vivo and in vitro. a PES1 mRNA expression in PC-3 cells detected by RT-qPCR. b Images of EdU assay (200 ), positive rate of prostate cancer PC-3 cells and the expression of Ki67 and PCNA in response to si-NC or × si-PES1 detected by EdU assay and Western blot analysis. c PC-3 cell apoptosis and protein expression of c-caspase-3/caspase-3 and c-caspase-9/ caspase-9 in response to si-NC or si-PES1, as measured using fow cytometry and Western blot analysis. d PC-3 cell migration and invasion (200 ) × and protein expression of MMP-2 and MMP-9 in response to si-NC or si-PES1, as measured using Transwell assay and Western blot analysis. e PES1 mRNA expression in mouse tumors detected by RT-qPCR; f representative tumors and tumor growth rate of mice bearing human prostate cancer cell xenografts in response to sh-NC or sh-PES1 treatment (n 6 for each group). *p < 0.05, vs. treatment with si-NC or sh-NC. Data obtained from = three independent experiments were presented as mean standard deviation and analyzed using independent sample t-test between two groups ± and using one-way ANOVA among multiple groups. Tumor size across indicated time points was compared using two-way ANOVA Jiang et al. J Transl Med (2020) 18:209 Page 7 of 14

regulatory mechanism of PES1. Te mirDIP, miRDB, expression (both p < 0.05) (Fig. 3d, e). Collectively, PES1 miRSearch, and TargetScan databases were used to pre- was a target gene of miR-1271. dict the regulatory miRNAs of PES1 and the results indicated that miR-96 and miR-1271 were in the intersection (Fig. 3a). miR‑1271 is poorly expressed in prostate cancer tissues A specifc binding site between PES1 gene sequence and cells and miR-1271 sequence was predicted using the Tar- In order to understand the correlation between miR- getScan (Fig. 3b). Next, dual-luciferase reporter gene 1271 expression and prostate cancer, the expression of assay was conducted to confrm the predicted relation- miR-1271 in prostate cancer tissues and cells was deter- ship, the results of which displayed that compared with mined using RT-qPCR. As shown in Fig. 4a, the expres- the co-transfection of NC mimic and PES1-3′UTR-Wt, sion of miR-1271 was lower in prostate cancer tissues co-transfection of miR-1271 mimic and PES1-3′UTR-Wt than that in adjacent normal tissues (p < 0.05). Pearson’s led to reduced luciferase activity (p < 0.05). However, correlation coefcient revealed an adverse relationship there was no signifcant diference in the luciferase activ- between miR-1271 expression and Gleason scoring in ity between the co-transfection of miR-1271 mimic and prostate cancer tissues (Fig. 4b). Moreover, the expres- PES1-3′UTR-Mut and co-transfection of NC mimic and sion of miR-1271 was also evaluated in prostate cancer PES1-3′UTR-Mut (p > 0.05) (Fig. 3c), suggesting that cell lines (LNCaP, PC-3, 22Rv1, and DU145) and nor- miR-1271 can specifcally bind to PES1. mal prostatic epithelial cell line (RWPE-1). Te results Furthermore, the results of RT-qPCR and Western displayed that the expression of miR-1271 was signif- blot analysis illustrated that miR-1271 expression was cantly lower in prostate cancer cell lines compared with increased while PES1 expression was decreased fol- the normal prostatic epithelial cell lin2e. Particularly, lowing miR-1271 mimic treatment compared with the expression of miR-1271 was the lowest in PC-3 cell NC mimic treatment (both p < 0.05). In contrast to lines (p < 0.05) (Fig. 4c), and therefore, PC-3 cell lines NC inhibitor treatment, miR-1271 inhibitor treatment were selected for subsequent use. decreased miR-1271 expression but increased PES1

abmirDIP miRSearch 10 0 Ta rgetScan 0 0 17 miRDB 0 0 Position 410-416 of PES1 3’ UTR5 AAUGACUGGACUUUUGUGCCAAU 1 176

2 17 0 hsa-miR-1271-5p 3 ACUCACGAACGAUCCACGGUUC 4 3

4 c d NC mimic e NC mimic miR-1271 mimic miR-1271 mimic NC inhibitor NC inhibitor NC mimic miR-1271 inhibitor miR-1271 inhibitor 1.5 3 miR-1271 mimic * PES1

1.0 # 1.0 2 # β-actin 0.8

c r r ic o 0.6 mi ito it i im b 0.5 1 m m * inhib inhi 0.4 NC 71 # 2 71

Relative expression NC * -1 0.2 R -12 *

Relative luciferase activity mi 0.0 0 miR 0.0

PES1-3'UTR WT PES1-3'UTR MUT miR-1271PES1 Relative protein expression Fig. 3 miR-1271 interacts with PES1 and negatively regulates PES1 expression. a Regulatory miRNAs of PES1 predicted using the mirDIP, miRDB, miRSearch, and TargetScan databases; four ellipses refer to the prediction results in four databases respectively and the intersection among these ellipses indicating overlapped results. b Binding site between miR-1271 and PES1 predicted using the TargetScan. c Luciferase activity in response to co-transfection of miR-1271 mimic and NC mimic or PES1-3′UTR-Wt and PES1-3′UTR-Mut, as detected by dual-luciferase reporter gene assay. d Expression of miR-1271 and PES1 following treatment with miR-1271 mimic, miR-1271 inhibitor or their respective NCs, as determined using RT-qPCR. e Protein expression of PES1 in response to miR-1271 mimic, miR-1271 inhibitor or their respective NCs tested by Western blot analysis. *p < 005 vs. treatment with NC mimic; #p < 0.05 vs. treatment with NC inhibitor. Data obtained from three independent experiments were presented as mean standard deviation and analyzed using independent sample t-test between two groups and using one-way ANOVA among multiple ± groups Jiang et al. J Transl Med (2020) 18:209 Page 8 of 14

a b c

0.6 1.5 1.5

miR-1271 0.5 of 1.0 1.0 * 0.4 * * # 0.5 xpression 0.5 0.3 r = -0.5682 *# ee P < 0.0001 0.0 0.2 0.0 Relativ Relative expression of miR-1271 Relative expression of miR-1271 Adjacent normal tissue Prostate tissue 5678910 1 1 3 5 14 PC- 22Rv Gleason Scores NCaP DU RWPE- L Fig. 4 miR-1271 is poorly expressed in prostate cancer tissues and cells. a Expression of miR-1271 in prostate cancer and adjacent normal tissues detected by RT-qPCR; #p < 0.05 vs. adjacent normal tissues; b Correlation between miR-1271 expression and Gleason scoring in prostate cancer tissues analyzed by Pearson’s correlation coefcient. c Expression of miR-1271 in prostate cancer cell lines (LNCaP, PC-3, 22Rv1, and DU145) and normal prostatic epithelial cell line (RWPE-1); *p < 0.05 vs. normal prostatic epithelial cell line (RWPE-1); #p < 0.05 vs. LNCaP, 22Rv1, and DU145 cell lines. Data obtained from three independent experiments were presented as mean standard deviation and analyzed using independent ± sample t-test between two groups and using one-way ANOVA among multiple groups. Pearson’s correlation coefcient was used for analyzing the correlation between miR-1271 expression and Gleason scoring

Elevated miR‑1271 suppresses the progression of prostate c-caspase-9/caspase-9 (all p < 0.05). Further, the nude cancer both in vivo and in vitro mice were inoculated with miR-1271 agomir- or miR- On the basis that downregulation of miR-1271 was 1271 antagomir-treated cells to assess the efects of miR- observed in prostate cancer, the PC-3 cells were trans- 1271 on tumor growth in vivo. Te results indicated that fected with plasmids of miR-1271 mimic, miR-1271 compared with NC agomir treatment, tumor growth inhibitor or their respective NCs to reveal the efects of rate and tumor volume were decreased while miR-1271 miR-1271 on the development of prostate cancer. Ini- expression was upregulated in response to miR-1271 tially, RT-qPCR was conducted to detect the expression agomir treatment (p < 0.05). In contrast to NC antagomir of miR-1271 and PES1, the results of which showed an delivery, miR-1271 antagomir delivery caused reduced enhancement in miR-1271 expression and a decline in miR-1271 expression along with increased tumor growth PES1 mRNA expression in the presence of miR-1271 rate and tumor volume (p < 0.05) (Fig. 5e, f). Based on mimic. However, miR-1271 downregulation decreased the above fndings, it was suggested that miR-1271 could miR-1271 expression while elevating PES1 mRNA attenuate cell proliferation, migration, and invasion, as expression (Fig. 5a). EdU assay (Fig. 5b), fow cytometry well as tumor growth, but potentiated cell apoptosis in (Fig. 5c), and Transwell assay (Fig. 5d) were performed prostate cancer. to evaluate the efects of miR-1271 on cell proliferation, apoptosis, migration, and invasion in vitro. We found Elevated miR‑1271 suppresses prostate cancer that relative to PC-3 cells transfected with NC mimic development by reducing the expression of PES1 plasmids, PC-3 cells transfected with miR-1271 mimic plasmids had decreased positive rate, increased apop- According to our data described above, both miR- tosis rate, reduced migration and invasion abilities (all 1271 and PES1 played an essential role in the develop- p < 0.05), which was opposite to the results found in ment of prostate cancer. We then further elucidated PC-3 cells transfected with miR-1271 inhibitor plasmids whether miR-1271 participates in prostate cancer comparing to its control counterpart (NC inhibitor) progression by regulating PES1. RT-qPCR was con- (all p < 0.05). Additionally, expression of factors related ducted to detect the expression of miR-1271 and PES1, to proliferation (Ki67 and PCNA) (Fig. 5b), apopto- and the results of which showed a decline in PES1 sis (c-caspase-3/caspase-3 and c-caspase-9/caspase-9) mRNA expression in response to PES1 silencing yet (Fig. 5c), and migration and invasion (MMP-2 and MMP- an increase in response to miR-1271 knockdown. In 9) (Fig. 5d) was tested by Western blot analysis. Our data addition, PES1 mRNA expression was upregulated in showed that in comparison with NC mimic plasmid, PC-3 cells transfected with both sh-PES1 and miR- miR-1271 mimic plasmid transfection downregulated 1271 inhibitor plasmids (Fig. 6a). As detected by EdU expression of Ki67, PCNA, MMP-2, and MMP-9, but assay (Fig. 6b), fow cytometry (Fig. 6c), and Transwell upregulated expression of c-caspase-3/caspase-3 and assay (Fig. 6d), respectively, PC-3 cells transfected with both sh-PES1 and NC inhibitor plasmids presented Jiang et al. J Transl Med (2020) 18:209 Page 9 of 14

NC mimic a miR-1271 mimic 4 NC inhibitor miR-1271 inhibitor

3 *

expression 2 #

1 Relative # * 0 miR-1271 PES1 NC mimic NC mimic miR-1271 mimic miR-1271 mimic

b ) 80 NC inhibitor 4 NC inhibitor miR-1271 inhibitor Ki67 miR-1271 inhibitor # # 60 3 PCNA #

40 β-actin 2 r r ic c o ito im b 50 μm 50 μm 50 μm 50 μm 20 * m mimi hi hibit 1 in in NC 71 1 * * 2 7 -1 NC NC mimic miR-1271 mimic NC inhibitor miR-1271 inhibitor R Relative protein expression

Positive expression rate (% -12 0 mi R 0 mi Ki67 PCNA NC mimic c NC mimic miR-1271 mimic NC mimicmiR-1271 mimic NC inhibitor miR-1271 inhibitor miR-1271 mimic 4

4 4 4 40 NC inhibitor NC inhibitor 10 10 10 10 2.5 miR-1271 inhibitor c-caspase-3 miR-1271 inhibitor ) 3 3 3 3 * * 10 2.0 10 10 10 30 caspase-3 * 2 2 2 2 1.5 10 10 10 10 c-caspase-9 PI PI PI PI 20 1 1 1 1 1.0

10 caspase-9 10 10 10 10 0 Apoptosis rate (% 0 0 0 # β-actin 0.5 10 10 10 0 1 2 3 4 10 # 10 10 10 10 10 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 # 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 Relative protein expression r Annexin V FITC Annexin V FITC Annexin V FITC Annexin V FITC 0 ic o 0.0 -3 -9 mim ibit se se mimic h a a C in sp sp a a N /c /c 1271 NC -3 -9 d - e e iR as as m sp sp c-ca c-ca NC mimic miR-1271 mimic NC mimic NC inhibitor miR-1271 mimic miR-1271 inhibitor 150 2.0 NC inhibitor migration # MMP-2 miR-1271 inhibitor 50 μm 50 μm 50 μm 50 μm # 1.5 100 MMP-9 # # β-actin 1.0

50 c ic r r

Cell number o mi ito * i im ib 0.5 m m C inh inhibit * N 1 ** invasion 1271 NC 7

- Relative protein expression 0 iR 0.0 m R-12 50 μm 50 μm 50 μm 50 μm migrationinvasion mi MMP-2 MMP-9

NC mimic miR-1271 mimic NC inhibitormiR-1271 inhibitor NC agomir NC agomir e f miR-1271 agomir miR-1271 agomir NC antagomic NC antagomic miR-1271 antagomic 3 miR-1271 antagomic 1500 )

* 3 n # m # 2 # 1000 r r c c

expressio mi mi o go g gomi gomi a a ta a # C n nt 1 N 71 a a 500 12 1 - NC 7 iR Relative * 12 * * # m Tumor volume (m iR- m * 0 0 miR-1271 PES1 7 d14 d21 d35 d Fig. 5 Elevated expression of miR-1271 suppresses the progression of prostate cancer both in vivo and in vitro. a miR-1271 expression and PES1 mRNA expression in PC-3 cells detected by RT-qPCR. b Images of EdU assay (200 ), positive rate of PC-3 cells as well as the expression of Ki67 × and PCNA, following treatment of NC mimic, miR-1271 mimic or their respective NC detected by EdU assay and Western blot analysis. c PC-3 cell apoptosis and protein expression of c-caspase-3/caspase-3 and c-caspase-9/caspase-9 in PC-3 cells following treatment of NC mimic, miR-1271 mimic or their respective NC tested by fow cytometry and Western blot analysis. d Images (200 ) and quantitative analysis of PC-3 cell migration × and invasion and protein expression of MMP-2 and MMP-9 in PC-3 cells following treatment of NC mimic, miR-1271 mimic or their respective NC evaluated by Transwell assay and Western blot analysis. e miR-1271 expression and PES1 mRNA expression in mouse tumors detected by RT-qPCR. f Representative tumors and tumor growth rate of mice bearing human prostate cancer cell xenografts in response to NC agomir, miR-1271 antagomir or their respective NC (n 6 for each group). *p < 0.05, vs. treatment with NC mimic or NC agomir. #p < 0.05, vs. treatment with NC = inhibitor or NC antagomir. Data obtained from three independent experiments were presented as mean standard deviation and analyzed using ± independent sample t-test between two groups and using one-way ANOVA among multiple groups. Tumor size over indicated time points were compared using two-way ANOVA

reduced positive rate (p < 0.05), enhanced apoptosis plasmids exhibited a negative correlation while com- rate (p < 0.05), diminished migration and invasion abili- paring with the PC-3 cells co-treated with sh-PES1 and ties (p < 0.05) compared with those cells manipulated NC inhibitor plasmids (p < 0.05). In addition, the results with both sh-NC and NC inhibitor plasmids, which of Western blot analysis implied that the expression of was abrogated by dual transfection with sh-NC and proliferation-related factors (Ki67 and PCNA) (Fig. 6b) miR-1271 inhibitor plasmids. On the contrary, PC-3 and migration- and invasion-related factors (MMP-2 cells co-treated with sh-PES1 and miR-1271 inhibitor and MMP-9) (Fig. 6d) was downregulated while that of Jiang et al. J Transl Med (2020) 18:209 Page 10 of 14

a b

si-NC + NC inhibitor si-NC + NC inhibitor si-NC + NC inhibitor Ki67 si-NC + miR-1271 inhibitor si-NC + miR-1271 inhibitor si-NC + miR-1271 inhibitor si-PES1 + NC inhibitor PCNA si-PES1 + NC inhibitor si-PES1 + NC inhibitor si-PES1 + miR-1271 inhibitor

2.5 si-PES1 + miR-1271 inhibitor ) si-PES1 + miR-1271 inhibitor 2.0

80 n 50 μm 50 μm β-actin * * (% * te on 2.0 si-NC + NC inhibitor si-NC + miR-1271 inhibitor r

ra 60 * 1.5 xpressio 1.5

xpressi # # # # 40 1.0 ee 1.0 iv si-NC + NC inhibitor protei ne expression at * # 20 * si-PES1 + NC inhibitor 0.5 tive Rel 0.5 * si-NC + miR-1271 inhibito *

* la 50 μm 50 μm si-PES1 + miR-1271 inhibitor Re 0.0 si-PES1 + NC inhibitor si-PES1 + miR-1271 inhibitor Positive 0 0.0 miR-1271 PES1 Ki67 PCNA c-caspase-3 si-NC + NC inhibitor si-NC + NC inhibitor si-NC + miR-1271 inhibitor c si-NC + miR-1271 inhibitor caspase-3 si-PES1 + NC inhibitor si-PES1 + NC inhibitor si-PES1 + miR-1271 inhibitor 40 1.0 si-NC + NC inhibitor si-NC + miR-1271 inhibitor si-PES1 + NC inhibitor si-PES1 + miR-1271 inhibitor c-caspase-9 * 4 4 4 4 si-PES1 + miR-1271 inhibitor ) 10

10 * 10 10 * 0.8 (% 3

3 30 3 3 xpression 10 te 10 10 10 caspase-9 0.6 ra ne 2 2 2 2 10 10 10 10 20 # PI PI PI PI osis β-actin 0.4 protei 1 1 1 1 # 10 10 10 10 # *

10 tive 0.2 0 0 0 0 * la Aapopt * 10 10 10 0 1 2 3 4 100 101 102 103 104 0 1 2 3 4 10 0 1 2 3 4 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 Re Annexin V FITC Annexin V FITC Annexin V FITC Annexin V FITC 0 0.0 c-caspase-3/caspase-3 c-caspase-9/caspase-9

si-NC + NC inhibitor d si-PES1 + NC inhibitor si-NC + miR-1271 inhibitor si-PES1 + miR-1271 inhibitor si-NC + NC inhibitor si-NC + NC inhibitor si-PES1 + NC inhibitor si-PES1 + NC inhibitor MMP-2 si-PES1 + miR-1271 inhibitor si-PES1 + miR-1271 inhibitor 200 si-PES1 + miR-1271 inhibitor 2.0 n

migration si-PES1 + miR-1271 inhibitor MMP-9 * 50 μm 50 μm 50 μm 50 μm 150 * 1.5 * er β-actin xpressio ne 100 # 1.0 nu mb n * r r # r r # protei Cell #

invasio 50 0.5 tive * * la * 50 μm 50 μm 50 μm 50 μm * Re 0 si-NC + NC inhibito 0.0 si-NC + NC inhibitor si-NC + miR-1271 inhibitor si-PES1 + NC inhibitor si-PES1 + miR-1271 inhibitor migrationinvasion si-PES1 + NC inhibito MMP-2MMP-9 si-NC + miR-1271 inhibito sh-NC + NC antagomic si-PES1 + miR-1271 inhibito efsh-NC + miR-1271 antagomic sh-NC + NC antagomic sh-PES1 + NC antagomic sh-NC + miR-1271 antagomic sh-PES1 + miR-1271 antagomic sh-PES1 + NC antagomic

2.5 ) 3 1500 sh-PES1 + miR-1271 antagomic * mm

on 2.0 * e( 1000 * 1.5 um

ol #

xpressi r # e # rv *

ve 1.0 mo # ti 500 Tu # * *

Re la 0.5 * * si-NC + NC inhibitor si-PES1 + NC inhibitor * 0.0 0 si-NC + miR-1271 inhibitor miR-1271 PES1 si-PES1 + miR-1271 inhibito 7 d14 d21 d35 d Fig. 6 miR-1271 negatively regulates PES1 to impede the development of prostate cancer. PC-3 cells were transfected with sh-PES1 coupled with NC inhibitor or both sh-PESE1 coupled with miR-1271 inhibitor. a miR-1271 expression and PES1 mRNA expression in PC-3 cells detected by RT-qPCR. b Images of EdU assay (200 ), positive rate of PC-3 cells as well as the expression of Ki67 and PCNA in PC-3 cells detected by EdU assay × and Western blot analysis. c Cell apoptosis and protein expression of c-caspase-3/caspase-3 and c-caspase-9/caspase-9 in PC-3 cells tested by fow cytometry and Western blot analysis. d Images (200 ) and quantitative analysis of cell migration and invasion and protein expression of MMP-2 × and MMP-9 in PC-3 cells evaluated by Transwell assay and Western blot analysis. e miR-1271 expression and PES1 mRNA expression in mouse tumors detected by RT-qPCR. f Representative tumors and tumor growth rate of mice bearing human prostate cancer cell xenografts in response to co-treatment of sh-PES1 and NC antagomir or co-treatment of sh-PES1 and miR-1271 antagomir (n 6 for each group). *p < 0.05, vs. co-treatment = of sh-NC and NC inhibitor or co-treatment of sh-NC and NC antagomir; #p < 0.05, vs. co-treatment of sh-PES1 and NC inhibitor or co-treatment of sh-PES1 and NC antagomir. Data obtained from three independent experiments were presented as mean standard deviation and tested using ± one-way ANOVA among multiple groups. Tumor size over indicated time points was compared using two-way ANOVA apoptosis-related factors (c-caspase-3/caspase-3 and with sh-PES1 and NC antagomir had decreased PES1 c-caspase-9/caspase-9) (Fig. 6c) was upregulated in mRNA expression and reduced tumor growth rate and PC-3 cells co-transfected with sh-PES1 and NC inhibi- tumor volume, which was negated by co-treatment tor plasmids relative to the co-treatment of sh-NC with sh-NC and miR-1271 antagomir (both p < 0.05). and NC inhibitor plasmids. An opposite trend was Relative to co-treatment of sh-PES1 and NC antagomir, observed in PC-3 cells co-transfected with sh-NC and dual treatment with sh-PES1 and miR-1271 antagomir miR-1271 inhibitor or sh-PES1 and NC inhibitor plas- resulted in augmented PES1 mRNA expression along mids (all p < 0.05). Moreover, in comparison with the with elevated tumor growth rate and tumor volume mice inoculated with cells co-treated with sh-NC and (both p < 0.05) (Fig. 6e, f). Taken together, these results NC antagomir, mice inoculated with cells co-treated indicated that miR-1271 could downregulate PES1 to Jiang et al. J Transl Med (2020) 18:209 Page 11 of 14

inhibit prostate cancer cell proliferation, migration, and analysis was conducted to measure the protein expression invasion along with tumor growth and simultaneously, of factors related to cell proliferation (Ki67 and PCNA), potentiate cell apoptosis. apoptosis (c-caspase-3/caspase-3 and c-caspase-9/caspase-9), migration and invasion (MMP-2 and MMP-9). miR‑1271 activates the ERβ signaling pathway in prostate Our results revealed that compared with the cells treated cancer cells with sh-NC, cells treated with sh-PES1 displayed reduced Next, we aimed to explore the efects of miR-1271 on its positive rate, attenuated migration and invasion abilities, downstream signaling pathway. Western blot analysis and increased apoptosis rate, accompanied by downreg- was conducted to detect the protein expression of the ulated Ki67, PCNA, MMP-2, and MMP-9 and upregu- ERβ signaling pathway-related factors in PC-3 cells. Te lated c-caspase-3/caspase-3 and c-caspase-9/caspase-9, results revealed that compared with NC mimic treat- which was undermined following co-treatment of sh-NC ment, miR-1271 mimic treatment contributed to elevated and PHTPP (all p < 0.05). However, co-treatment of sh- expression of ERβ (p < 0.05), but reduced expression of PES1 and PHTPP resulted in an opposite trend relative EEF2K and MNK1/2 (p < 0.05). Tese data were opposite to the co-treatment of si-PES1 and DMSO (all p < 0.05). to the trend found in PC-3 cells treated with miR-1271 Moreover, the results from in vivo study revealed that in inhibitor versus the PC-3 cells treated with NC inhibitor contrast to the co-treatment of sh-NC, treatment of sh- (p < 0.05) (Fig. 7a, b). In summary, miR-1271 elevation PES1 resulted in elevated PES1 expression and decreased activated the ERβ signaling pathway. tumor growth rate and tumor volume, while co-treatment of sh-NC and PHTPP downregulated ERβ expres- Silencing of PES1 inhibits the progression of prostate sion and increased tumor growth rate and tumor volume cancer in vivo and in vitro by activating the ERβ signaling (p < 0.05). Compared with the co-treatment of sh-PES1 pathway and DMSO, co-treatment of sh-PES1 and PHTPP led to We then examined the role of PES1 in prostate cancer diminished ERβ expression and increased tumor growth progression via the ERβ signaling pathway. RT-qPCR rate and tumor volume (p < 0.05) (Fig. 8e, f), indicating and Western blot analysis were conducted to detect the PES1 deactivated ERβ in prostate cancer (Additional mRNA and protein expression of PES1, ERα and ERβ. fle 2). Te results revealed that PES1 could control ERα expression but not ERβ expression (Fig. 8a). EdU assay (Fig. 8b), Discussion fow cytometry (Fig. 8c), and Transwell assay (Fig. 8d) Prostate cancer is a serious disease featured with high were conducted to detect cell proliferation, apoptosis, fatality and morbidity rates [18]. However, efective treat- migration and invasion, respectively and Western blot ment to this disease still faces a big challenge due to the

abNC mimic miR-1271 mimic ERβ NC inhibitor 4 miR-1271 inhibitor EEF2K 3 #

β-actin * 2 r c c or ibit mimi mimi hibito inh in 1 NC 1271 NC 71 R- # * mi Relative protein expression miR-12 0 ERβ EEF2K Fig. 7 The ERβ signaling pathway is activated by the elevation of miR-1271 in prostate cancer cells. a, b, Protein bands (a) and quantitative analysis (b) of the expression of ERβ, EEF2K, and MNK1/2 in response to overexpression or depletion of miR-1271, detected by Western blot analysis. *p < 0.05 vs. NC mimic treatment; *p < 0.05 vs. NC inhibitor treatment. Data obtained from three independent experiments were presented as mean standard deviation and tested using one-way ANOVA among multiple groups ± Jiang et al. J Transl Med (2020) 18:209 Page 12 of 14

si-NC + DMSO a si-NC + DMSO PES1 si-PES1 + DMSO si-PES1 + DMSO si-NC + PHTPP ERα 1.5 si-NC + PHTPP 2.0 si-PES1+ PHTPP n si-PES1+ PHTPP

PES1 ERβ f 1.5 no 1.0 xpressio * β-actin 1.0 # O P P PP protei ne expressio 0.5 SO * MS * e D DM PHT 0.5 tive iv + + + PHT

C + la * -N -NC ES1 si Re Relat 0.0 -PES1 si -P 0.0 si si PES1ERα ERβ si-NC + DMSO si-PES1 + DMSO si-NC + DMSO si-NC + PHTPP b Ki67 si-PES1 + DMSO

) 100 si-PES1+ PHTPP 2.0 si-NC + PHTPP n (% * si-PES1+ PHTPP 80 PCNA

rate 1.5 *

# xpressio 60 β-actin * ne 1.0 O O P # 40 PP # MS protei expression HT D DMS PHTP + 0.5 50 μm 50 μm 50 μm 50 μm + + P tive * 20 * C + 1 1 S la * -N ES -NC E si si si-NC + DMSO ssi-PES1 + DMSO i-NC + PHTPP si-PES1 + PHTPP -P -P Re Positive 0 si si 0.0 Ki67 PCNA si-NC + DMSO si-NC + DMSO c c-caspase-3 si-PES1 + DMSO si-PES1 + DMSO si-NC + DMSOsi-PES1 + DMSOsi-NC + PHTPP si-PES1 + PHTPP si-NC + PHTPP 4 4 4 4 40 si-NC + PHTPP caspase-3 1.0 10 10 10 10 si-PES1+ PHTPP

) si-PES1+ PHTPP 3 3 3 3 0.8 * 10 10 10 10 (% 30 * c-caspase-9 xpressi on 2 2 2 2

rate 0.6 10 10 10 10 ne PI PI PI PI * 20 caspase-9 1 1 1 1

10 0.4 10 10 10 #

protei # β-actin 0 0 0 0 10 tive

Apoptos is # 10 10 10 10 0.2 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4 * 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 * la * P Annexin V FITC Annexin V FITC Annexin V FITC Annexin V FITC P PP SO Re d 0 0.0 DM DMSO PHT + + + c-caspase-3/caspase-3 c-caspase-9/caspase-9 C 1 S 1 -N S si i-NC + PHTE -PE s -P si-NC + DMSO si si n si-PES1 + DMSO si-NC + DMSO si-NC + PHTPP si-PES1 + DMSO

migratio si-PES1+ PHTPP MMP-2 si-NC + PHTPP 50 μm 50 μm 50 μm 200 1.5 * si-PES1+ PHTPP MMP-9 * 150

r *

xpressio n 1.0 be β-actin

# ne n * um 100 O P # # PP protei

Cel ln 0.5 invasio DMSO #

+ DMS ve 50 + PHTP + PHT 50 μm 50 μm 50 μm C ti * -N S1 * * si -NC * -PES1 +si -PE si-NC + DMSO ssi-PES1 + DMSO i-NC + PHTPP si-PES1 + PHTPP 0 si si Re la 0.0 migrationinvasion MMP-2MMP-9 si-NC + DMSO sh-NC + DMSO e PES1 f si-PES1 + DMSO sh-PES1 + DMSO sh-NC + DMSO 1.5 2.0 si-NC + PHTPP 2000 sh-PES1 + DMSO ERα sh-NC + PHTPP si-PES1+ PHTPP ) sh-NC + PHTPP PES1 sh-PES1 + PHTPP * 3

of 1.5 1500 sh-PES1 + PHTPP * pressi on 1.0 ERβ mm ex e( * #

1.0 um β-actin # 1000 #

P P ol * rotein xpression * SO SO p

rv * e 0.5 DM # SO PP PP PHTP SO 0.5 + DM mo ve * 500 M M tive + + PHTP * la D PHT PHT NC + Tu * - ES1 -NC ES1 + D + + si si C + Re i-P -P * Relati s 0.0 -N ES1 0.0 si 0 si i-NC ES1 -P s -P PES1 ERα ERβ 7 d14 d 21 d 35 d si si Fig. 8 Silencing of PES1 inhibits the progression of prostate cancer in vivo and in vitro by activating the ERβ signaling pathway. The cells were transfected with both si-PES1 and DMSO or both si-PES1 and PHTPP. a mRNA and protein expression of PES1, ERα and ERβ in PC-3 cells detected by RT-qPCR and Western blot analysis. b Images of EdU assay (200 ), positive rate of cells and the expression of Ki67 and PCNA in PC-3 cells × determined using EdU assay and Western blot analysis. c PC-3 cell apoptosis and protein expression of c-caspase-3/caspase-3 and c-caspase-9/ caspase-9 in PC-3 cells tested by fow cytometry and Western blot analysis. d Images (200 ) and quantitative analysis of cell migration and invasion × and protein expression of MMP-2 and MMP-9 in PC-3 cells evaluated by Transwell assay and Western blot analysis. e mRNA and protein expression of PES1, ERα and ERβ in mouse tumors detected by RT-qPCR and Western blot analysis. f Representative tumors and tumor growth rate of mice bearing human prostate cancer cell xenografts in response to co-treatment of sh-PES1 and DMSO or co-treatment of sh-PES1 and PHTPP (n 6 for = each group). *p < 0.05, vs. co-treatment of sh-NC and DMSO or co-treatment of sh-NC and DMSO; #p < 0.05, vs. co-treatment of sh-PES1 and DMSO or co-treatment of sh-PES1 and DMSO. Data obtained from three independent experiments were presented as mean standard deviation and ± tested using one-way ANOVA among multiple groups. Tumor size over indicated time points was compared using two-way ANOVA

various clinical behaviors [19]. As indicated by microar- cancer. Our fndings provide evidence that miR-1271 ray-based analysis, PES1 was screened as a DEG associ- downregulated PES1 to activate the ERβ signaling path- ated with the progression of prostate cancer and was a way, which further inhibited the biological processes of downstream mRNA of miR-1271. Terefore, this study prostate cancer. aimed to investigate the underlying mechanism of PES1 Initially, we found that PES1 was highly expressed and miR-1271 in modulating the development of prostate while miR-1271 was marginally expressed in prostate Jiang et al. J Transl Med (2020) 18:209 Page 13 of 14

cancer. Consistently, Li et al. [20] found that PES was gene mechanistic target of rapamycin (mTOR) [28]. As abundantly expressed in many cancer cells, including for PES, Li et al. [29] demonstrated that depletion of colon cancer, breast cancer, and ovarian cancer. Among PES1 suppressed cell proliferation and attenuated tumo- these studies, PES was indicated to be involved in the rigenicity in breast cancer, suggesting that PES1 could progression of cancer and acted as a diagnostic and work as a marker for the breast cancer therapy. Moreover, therapeutic biomarker for cancers. Likewise, colon can- downregulation of PES1 has the potency to facilitate cell cer tissues displayed elevated expression of PES1, and in apoptosis and attenuate tumor growth in neuroblastoma, the absence of PES1, attenuated proliferation and tumor thus also acting as a marker to predict the treatment out- growth of colon cancer cell was observed, suggesting come of neuroblastoma [30]. However, these studies did that downregulated PES1 functions as a tumor suppres- not fnd upstream regulatory miRNA to mediate the cel- sor [21]. Moreover, miRNAs were found to exert promo- lular process. tive or inhibitory efects on prostate cancer and many miRNAs, including miR-221 and miR-205 were reported Conclusions to be poorly expressed in prostate cancer tissues [22]. Taken together, our results demonstrated that overex- Additionally, miR-1271 expression was downregulated pression of miR-1271 could potentially repress the pro- in prostate cancer tissues and its elevation remarkably gression of prostate cancer via activation of the ERβ hindered the progression of prostate cancer by negatively signaling pathway by downregulating PES1. Tis obser- regulating the expression of its target gene DIX domain vation highlighted upregulated miR-1271 and down- containing 1 (DIXDC1) [23]. regulated PES1 can be therapeutic predictive markers Our data revealed that PES1 was a novel target gene for prostate cancer. However, more eforts are necessary of miR-1271 and the inhibition of PES1 caused by miR- to elucidate the clinical efects of miR-1271 and PES1 1271 activated the ERβ signaling pathway. miR-1271 in prostate cancer and relevant diseases in the future was shown to specifcally target ETS-related gene (ERG) studies. to further downregulate the expression of ERG and inhibit cellular processes in prostate cancer [11], which Supplementary information was in line with our results. Similarly, elevated miR- Supplementary information accompanies this paper at https://doi. 1271 worked as an inhibitor in ovarian cancer due to its org/10.1186/s12967-020-02349-1. inhibitory role in cell proliferation and tumor growth by directly targeting cyclin G1 [24]. Furthermore, PES1 Additional fle 1: Table S1. Transfection sequence. expression is found to be negatively associated with ERβ Additional fle 2. Original images of Western blot. while positively correlated with ERα in breast cancer [12, 25]. Terefore, downregulated PES1 resulted in a delay in Abbreviations the development of ovarian cancer via activated ERβ but PES1: Pescadillo homolog 1; DEGs: Diferentially expressed genes; miRNAs: attenuated ERα, which further proposed PES1 as a thera- microRNAs; miR-1271: microRNA-1271; ER: Estrogen receptor; TNM: Tumor- nodes-metastasis; Wt: Wild type; Mut: Mutant; FBS: Fetal bovine serum; NC: peutic target for treatment of ovarian cancer [26], which Negative control; DMSO: Dimethyl sulfoxide; RT-qPCR: Reverse transcription was consistent with our fndings. quantitative polymerase chain reaction; GAPDH: Glyceraldehyde-3-phosphate More importantly, overexpression of miR-1271 or dehydrogenase; PHTPP: Pyrazolo [1,5-a] pyrimidine; PCNA: Proliferating cell nuclear antigen; TCGA: The Cancer Genome Atlas; ERG: ETS-related gene. silencing of PES1 suppressed prostate cancer cell prolif- 3′-UTR: 3′-untranslated region; 3′-UTR: 3′-untranslated region; BSA: Bovine eration, migration, and invasion as well as tumor growth, serum albumin; PBS: Phosphate-bufered saline; sh: Short hairpin RNA; DMEM: but promoted cell apoptosis. Previously, Liu et al. [10], Dulbecco’s modifed Eagle’s medium; EdU: 5-ethynyl-2′-deoxyuridine; ANOVA: Analysis of variance; GEO: Gene Expression Omnibus; DIXDC1: DIX domain have shown that overexpression of miR-1271 inhibits cell containing 1; ERG: ETS-related gene; ZEB1: Zinc-fnger Ebox binding home- proliferation, invasion, migration, and tumor metasta- obox 1; TWIST1: Twist family bHLH transcription factor 1; mTOR: Mechanistic sis by binding to zinc-fnger Ebox binding homeobox 1 target of rapamycin. (ZEB1) and twist family bHLH transcription factor 1 Acknowledgements (TWIST1) in pancreatic cancer, highlighting that miR- We give our sincere gratitude to the reviewers for their valuable suggestions. 1271 can function as a marker for treatment and prog- Authors’ contributions nosis of metastatic pancreatic cancer. Also, miR-1271 ZJ and YZ designed the study. XC, YW and PW collated the data, carried out targeted and downregulated forkhead box protein Q1 to data analyses and produced the initial draft of the manuscript. CW and DC further repress gastric cancer cell invasion, proliferation, contributed to drafting the manuscript. All authors read and approved the fnal manuscript. and epithelial-mesenchymal transition [27]. In non-small cell lung cancer, upregulation of miR-1271 contributes to Funding the inhibition of cancer development both in vitro and This study was supported by Prostate Cancer Foundation China (PCF China) Young Investigator Award; National Natural Science Foundation of China in vivo by downregulation the expression of its target Youth Fund (No. 81001143); Shenyang Science and Technology Program Key Jiang et al. J Transl Med (2020) 18:209 Page 14 of 14

Science and Technology Research and Development Program (No. 17-230-9- 10. Liu H, Wang H, Liu X, Yu T. miR-1271 inhibits migration, invasion and 18); the First Batch of Talents of Introduction of Top Health Talented Team of epithelial-mesenchymal transition by targeting ZEB1 and TWIST1 in Qinghai Province; the First Batch of Talents of Xining “Absorbing 555 Talents pancreatic cancer cells. Biochem Biophys Res Commun. 2016;472:346–52. Project” and the National Key Research and Development Program of China 11. Wang M, Gao W, Lu D, Teng L. MiR-1271 inhibits cell growth in prostate (Grant No.2017YFC0908003). cancer by targeting ERG. Pathol Oncol Res. 2018;24:385–91. 12. Cheng L, Li J, Han Y, Lin J, Niu C, Zhou Z, et al. PES1 promotes breast Availability of data and materials cancer by diferentially regulating ERalpha and ERbeta. J Clin Invest. All data generated or analyzed during this study are available. 2012;122:2857–70. 13. Christoforou P, Christopoulos PF, Koutsilieris M. The role of estrogen Ethics approval and consent to participate receptor beta in prostate cancer. Mol Med. 2014;20:427–34. This study was approved by the Ethics Committee of The First Hospital of 14. Hartman J, Strom A, Gustafsson JA. Current concepts and signifcance of China Medical University performed in strict accordance with the Declaration estrogen receptor beta in prostate cancer. Steroids. 2012;77:1262–6. of Helsinki. All participants or their relatives signed informed consent docu- 15. Omoto Y, Iwase H. Clinical signifcance of estrogen receptor beta in breast mentation. Animal experiments strictly adhered to the principle to minimize and prostate cancer from biological aspects. Cancer Sci. 2015;106:337–43. the pain, sufering and discomfort to the experimental animals. 16. Koo KC, Park SU, Rha KH, Hong SJ, Yang SC, Hong CH, et al. Transurethral resection of the prostate for patients with Gleason score 6 prostate Consent for publication cancer and symptomatic prostatic enlargement: a risk-adaptive strategy Not applicable. for the era of active surveillance. Jpn J Clin Oncol. 2015;45:785–90. 17. Hsu I, Chuang KL, Slavin S, Da J, Lim WX, Pang ST, et al. Suppression of Competing interests ERbeta signaling via ERbeta knockout or antagonist protects against The authors declare that they have no competing interests. bladder cancer development. Carcinogenesis. 2014;35:651–61. 18. Tao ZQ, Shi AM, Wang KX, Zhang WD. Epidemiology of prostate cancer: Author details current status. Eur Rev Med Pharmacol Sci. 2015;19:805–12. 1 Department of Urology, The First Hospital of China Medical University, No. 19. Colicchia M, Morlacco A, Cheville JC, Karnes RJ. Genomic tests to guide 155 Nanjing North Street, Heping District, Shenyang 110001, Liaoning Prov- prostate cancer management following diagnosis. Expert Rev Mol Diagn. ince, People’s Republic of China. 2 Department of Urology, People’s Hospital 2017;17:367–77. of Datong Hui and Tu Autonomous County, Xining 810100, People’s Republic 20. Zhang H, Li J, Wang X, Sun Y, Yuan B, Yang Z, et al. The antibody of China. 3 Department of Pharmacy, The First Hospital of China Medical preparation and expression of human Pescadillo. Sci China C Life Sci. University, Shenyang 110001, People’s Republic of China. 4 Department 2007;50:298–304. of Pathology, The First Hospital and College of Basic Medical Sciences, China 21. Xie W, Feng Q, Su Y, Dong B, Wu J, Meng L, et al. Transcriptional regulation Medical University, Shenyang 110001, People’s Republic of China. 5 Central of PES1 expression by c-Jun in colon cancer. PLoS ONE. 2012;7:e42253. Lab, The First Hospital of China Medical University, Shenyang 110001, People’s 22. Luu HN, Lin HY, Sorensen KD, Ogunwobi OO, Kumar N, Chornokur G, et al. Republic of China. miRNAs associated with prostate cancer risk and progression. BMC Urol. 2017;17:18. Received: 13 October 2019 Accepted: 24 April 2020 23. Zhong J, Liu Y, Xu Q, Yu J, Zhang M. Inhibition of DIXDC1 by micro- RNA-1271 suppresses the proliferation and invasion of prostate cancer cells. Biochem Biophys Res Commun. 2017;484:794–800. 24. Liu X, Ma L, Rao Q, Mao Y, Xin Y, Xu H, et al. MiR-1271 inhibits ovarian cancer growth by targeting cyclin G1. Med Sci Monit. 2015;21:3152–8. References 25. Thomas C, Gustafsson JA. Targeting PES1 for restoring the ERalpha/ 1. Maia MC, Hansen AR. A comprehensive review of immunotherapies in ERbeta ratio in breast cancer. J Clin Invest. 2012;122:2771–3. prostate cancer. Crit Rev Oncol Hematol. 2017;113:292–303. 26. Li J, Zhuang Q, Lan X, Zeng G, Jiang X, Huang Z. PES1 diferentially regu- 2. Kimura T, Egawa S. Epidemiology of prostate cancer in Asian countries. Int lates the expression of ERalpha and ERbeta in ovarian cancer. IUBMB Life. J Urol. 2018;25:524–31. 2013;65:1017–25. 3. Shephard RJ. Physical activity and prostate cancer: an updated review. 27. Xiang XJ, Deng J, Liu YW, Wan LY, Feng M, Chen J, et al. MiR-1271 inhibits Sports Med. 2017;47:1055–73. cell proliferation, invasion and EMT in gastric cancer by targeting FOXQ1. 4. Sebesta EM, Anderson CB. The surgical management of prostate cancer. Cell Physiol Biochem. 2015;36:1382–94. Semin Oncol. 2017;44:347–57. 28. Zhou Z, Niu X, Li C, Sheng S, Lu S. Inhibition of the growth of non-small 5. Dong DX, Ji ZG. Current progress and controversies in prostate cancer cell lung cancer by miRNA-1271. Am J Transl Res. 2015;7:1917–24. management. Chin Med J (Engl). 2017;130:2991–5. 29. Li J, Yu L, Zhang H, Wu J, Yuan J, Li X, et al. Down-regulation of pescadillo 6. Cho HK, Ahn CS, Lee HS, Kim JK, Pai HS. Pescadillo plays an essential role inhibits proliferation and tumorigenicity of breast cancer cells. Cancer Sci. in plant cell growth and survival by modulating ribosome biogenesis. 2009;100:2255–60. Plant J. 2013;76:393–405. 30. Nakaguro M, Kiyonari S, Kishida S, Cao D, Murakami-Tonami Y, Ichikawa 7. Chen Y, Li C, Tan C, Liu X. Circular RNAs: a new frontier in the study of H, et al. Nucleolar protein PES1 is a marker of neuroblastoma outcome human diseases. J Med Genet. 2016;53:359–65. and is associated with neuroblastoma diferentiation. Cancer Sci. 8. Lazaro-Ibanez E, Lunavat TR, Jang SC, Escobedo-Lucea C, Oliver-De La 2015;106:237–43. Cruz J, Siljander P, et al. Distinct prostate cancer-related mRNA cargo in extracellular vesicle subsets from prostate cell lines. BMC Cancer. 2017;17:92. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in pub- 9. Massillo C, Dalton GN, Farre PL, De Luca P, De Siervi A. Implications of lished maps and institutional afliations. microRNA dysregulation in the development of prostate cancer. Repro- duction. 2017;154:R81–97.